Effects of Polyunsaturated Fatty Acids and Bovine Somatotropin on Endocrine Function, Embryo Development, and Uterine-Conceptus Interactions in Dairy Cattle

Home , Bovine somatotropin

EFFECTS OF POLYUNSATURATED FATTY ACIDS AND BOVINE SOMATOTROPIN ON ENDOCRINE FUNCTION, EMBRYO DEVELOPMENT, AND UTERINE-CONCEPTUS INTERACTIONS IN DAIRY CATTLE

TODD RUSSELL BILBY

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2005

Todd R. Bilby

To my parents, Ross and Cheryl Bilby, for their endless support

ACKNOWLEDGMENTS

I am deeply indebted to Dr. William W. Thatcher, my supervisory committee chair.

Dr. Thatcher provided endless guidance, encouragement, inspiration, and financial support. Dr. Thatcher provided me with the skills to be successful and instilled in me a passion for knowledge. I am proud of the opportunity I had to work with him and will always consider Dr. Thatcher an excellent mentor and great friend. I extend my appreciation to my committee members: Dr. Peter J. Hansen, who allowed me to use his laboratory for my final project and provided endless insight into my projects, curriculum, and overall professional development; Dr. Lokenga Badinga for his teaching in the area of nutritional physiology, and for always being willing to answer any questions; and Dr.

Nasser Chegini for the use of his laboratory and invaluable contributions. All committee members provided continual support throughout my Ph.D. program.

I greatly appreciate Dr. Charles Staples for his patience and guidance in working with me on my projects, editing papers, and providing knowledge on dairy cattle nutrition. I would also like to thank Dr. Staples’s graduate students: Mr. Bruno Amaral for his help with my last research project and Mrs. Faith Cullens for her assistance at the

Dairy Research Unit with my projects.

I extend my appreciation to Mrs. Marie-Joelle Thatcher for all her help with different hormone assays, statistics, excel spreadsheets, and for the excellent French cuisine.

iv I would like to express my gratitude to Mr. Jeremy Block for being a great friend,

colleague, and roommate. Jeremy was always willing and able to help me at any time during my projects at the DRU without complaint.

I owe special thanks to all of the members of the Thatcher Lab (Dr. Flavio

Silvestre, Dr. Julian Bartolome, Dr. Metin Pancarci, Dr. Allessandro Sozzi, Dr. Aydin

Guzeloglu, Mr. Ocilom Sa Filho) for helping with all aspects of my projects, for their

insightful discussions, and for the great camaraderie. I thank the laboratory technicians

who worked in Dr. Thatcher’s laboratory (Mr. Oscar Hernandez, Mr. Frank Michel and

Ms. Idania Alverez) for teaching me various molecular biology techniques, and for their

continuous technical support.

I am very grateful to Dr. Shunichi Kamimura, Dr. Ana Meikle, Dr. Leslie

MacLaren, Dr. Maarten Drost, Dr. Tom Jenkins, and Dr. Alan Ealy for their assistance

and guidance with my research papers and projects.

I would like to acknowledge members of the Hansen Lab: Dr. Rocio Rivera, Mrs.

Amber Brad, Mr. Jeremy Block, Mr. Dean Jousan, Mr. Moises Franco, Ms. Maria Padua,

Dr. Luiz de Castro e Paula, Ms. Barbara Loureiro, Dr. Katherine Hendricks, and Dr. Zvi

Roth. I could always find someone in their laboratory to help me at any time, nights or

weekends. They included me in many of their social functions. Words cannot express all

the fun, friendship, and knowledge I gained through knowing each one of them.

I express appreciation to Dr. Herbert Head, Mrs. Joyce Hayen, Dr. Marcio Liboni,

and Dr. Tomas Belloso for their assistance with my radioimmunoassays.

I thank Mr. David Armstrong and Mrs. Mary Russell, and all the staff at the Dairy

Research Unit for their safe care and handling of the cows for all of my projects. I am

v also very grateful to the faculty, staff and students of the Animal Sciences department for creating a positive working environment, and for all their support, discussion, and friendship.

I would like to extend special thanks to Ms. Myriam Lopez for her endless patience and continuous support. Ms. Lopez always made herself available to help with my research projects, no matter the time or day. There are not enough words to express how thankful I am for her encouragement and meaningful friendship.

Last but not least, I extend my utmost sincere appreciation to my parents, Ross and

Cheryl Bilby. Their never-ending love and unconditional moral and financial support brought me where I am today. They have always encouraged my brother and me to look toward the future and experience life. Through them, I learned that hard work, a good personality, a sense of humor, and a strong education will lead to success and happiness.

For all of that and much more, I thank them. I would also like to thank my brother, Chad

Bilby. His encouragement and excellent advice has proven true, time and time again. To all my family and friends in both the United States and now in other countries, I give heartfelt thanks.

vi TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ...... iv

LIST OF TABLES...... xii

LIST OF FIGURES ...... xv

LIST OF ABBREVIATIONS...... xviii

ABSTRACT...... xxi

CHAPTER

1 INTRODUCTION ...... 1

2 REVIEW OF LITERATURE...... 7

Reproductive Challenges of the High-Producing Dairy Cow ...... 7 Transition Period and Energy Balance...... 7 Fertility ...... 9 Follicle and Estradiol...... 12 Corpus Luteum and Progesterone Production...... 14 Oocyte Competence and Early Embryo ...... 16 Conceptus and Maternal Unit...... 19 Fatty Acid Metabolism ...... 22 Enzymes ...... 22 Biohydrogenation ...... 24 Fatty-Acid Intermediates...... 25 Effects of Supplemental Lipids on the High-Producing Dairy Cow ...... 28 Transition Period and Energy Balance...... 28 Fertility ...... 32 Follicles and Estradiol ...... 34 Corpus Luteum and Progesterone ...... 36 Oocyte and Early Embryo ...... 38 Conceptus and Maternal Unit...... 41 Peroxisome Proliferator-Activated Receptors...... 44 Bovine Somatotropin and the Insulin-Like Growth Factor System ...... 46 Bovine Somatotropin...... 46 Structure, synthesis, and secretion ...... 46 Receptor and ligand binding ...... 50

vii Second messengers...... 51 Insulin-like Growth Factor System ...... 52 Structure, synthesis, and secretion ...... 52 Receptors and ligand binding...... 54 Second messengers...... 56 Binding proteins ...... 57 Effects on Lactation...... 58 Effects on Reproduction...... 62

3 PREGNANCY AND BOVINE SOMATOTROPIN IN NONLACTATING DAIRY COWS: RESPONSES OF THE OVARIAN, CONCEPTUS AND IGF SYSTEMS ...... 70

Introduction...... 70 Materials and Methods ...... 72 Materials...... 72 Animals and Experimental Design...... 73 Tissue Sample Collection...... 74 Interferon-tau Antiviral Assay...... 75 Ribonucleic Acid Isolation and Northern Blotting...... 76 Analysis of Hormones in Plasma and ULF ...... 76 Analysis of Uterine Luminal IGFBPs ...... 77 Statistical Analyses...... 78 Results...... 80 Pregnancy Rates, Conceptus Sizes, and Total Amount of IFN-τ in ULF ...... 80 Ovarian Responses on Days 7, 16, and 17 ...... 80 Plasma and ULF Hormone Concentrations...... 81 Endometrial mRNA Expression of the GH/IGF-I System...... 82 Analysis of ULF for IGFBPs...... 82 Simple and Partial Correlations for the GH-IGF System...... 82 Discussion...... 83 Conclusions...... 90

4 PREGNANCY, BOVINE SOMATOTROPIN, AND DIETARY OMEGA-3 FATTY ACIDS IN LACTATING DAIRY COWS: I. OVARIAN, CONCEPTUS, AND GROWTH HORMONE—IGF SYSTEM RESPONSES ...... 100

Introduction...... 100 Materials and Methods ...... 102 Materials...... 102 Animals and Experimental Diets...... 103 Estrus Synchronization, Ultrasonography of Ovaries, and bST Treatment ...... 105 Tissue Sample Collection...... 106 Interferon-tau Antiviral Assay...... 107 Quantitative Real-Time Reverse Transcription-PCR...... 107 Ribonucleic Acid Isolation and Northern Blotting...... 108 Analysis of Hormones in Plasma and Uterine Luminal Flushings...... 109

viii Analysis of Uterine Luminal IGFBP...... 110 Statistical Analyses...... 111 Results...... 113 Weight, BCS, and Milk Production before the Start of Synchronization ...... 113 Ovarian and Uterine Responses before the Start of Synchronization ...... 114 Concentrations of Plasma and ULF Hormones before the Start of Synchronization ...... 115 Milk Production after an Induced Ovulation...... 115 Ovarian Responses after an Induced Ovulation ...... 116 Plasma and ULF Hormone Concentrations after an Induced Ovulation...... 116 Ovarian and Uterine Responses at Day 17...... 118 Pregnancy Rates, Conceptus Sizes, IFN-τ mRNA and Protein, and ISG-17 Protein at Day 17 ...... 118 Endometrial mRNA Expression of the GH-IGF-I System at Day 17 ...... 119 Analysis of ULF for IGFBP at Day 17...... 120 Simple and Partial Correlations for the GH-IGF System at Day 17 ...... 120 Discussion...... 121 Conclusions...... 128

5 PREGNANCY, BOVINE SOMATOTROPIN, AND DIETARY OMEGA-3 FATTY ACIDS IN LACTATING DAIRY COWS: II. GENE EXPRESSION RELATED TO MAINTENANCE OF PREGNANCY...... 143

Introduction...... 143 Materials and Methods ...... 146 Materials...... 146 Animals and Experimental Diets...... 146 Estrus Synchronization and Tissue Collection...... 147 Ribonucleic Acid Isolation and Northern Blotting...... 149 Immunohistochemical Analyses...... 150 Microscopic Image Analysis ...... 151 Western Blotting for ERα and PGHS-2 Proteins ...... 152 Radioimmunoasssay...... 153 Statistical Analyses...... 153 Results...... 154 Endometrial PR Expression...... 154 Endometrial ERα Expression ...... 155 Endometrial OTR Expression...... 156 Endometrial PGHS-2 Expression...... 156 Endometrial PGFS and PGES mRNA Expression...... 157 Total Contents of PGF2α and PGE2 in ULF...... 157 Simple and Partial Correlations for the PG Cascade at Day 17 ...... 157 Discussion...... 158 Conclusions...... 166

ix 6 PREGNANCY, BOVINE SOMATOTROPIN, AND DIETARY OMEGA-3 FATTY ACIDS IN LACTATING DAIRY COWS: III. FATTY ACID DISTRIBUTION ...... 172

Introduction...... 172 Materials and Methods ...... 174 Animals and Experimental Diets...... 174 Estrus Synchronization, Ultrasonography of Ovaries, and bST Treatment ...... 175 Tissue Sample Collection...... 176 Milk Fat Isolation and Analyses of Fatty Acid Composition...... 177 Statistical Analyses...... 178 Results...... 179 Long Chain Fatty Acid Composition among Tissues...... 179 Fatty Acid Composition in Endometrium at Day 17...... 180 Fatty Acid Composition in Liver at Day 17 ...... 181 Fatty Acid Composition in Mammary Tissue at Day 17...... 181 Fatty Acid Composition in Milk at Day 17...... 182 Fatty Acid Composition in Muscle at Day 17...... 182 Fatty Acid Composition in Subcutaneous Adipose Tissue at Day 17...... 182 Fatty Acid Composition in Internal Adipose Tissue at Day 17...... 183 Discussion...... 183 Conclusions...... 192

7 EFFECTS OF DIETS ENRICHED IN DIFFERENT FATTY ACIDS ON OOCYTE QUALITY AND FOLLICULAR DEVELOPMENT IN LACTATING DAIRY COWS IN SUMMER...... 204

Introduction...... 204 Materials and Methods ...... 206 Materials...... 206 Animals and Experimental Diets...... 207 Synchronization for OPU and TAI...... 209 Blood and Temperature Sampling...... 210 Ultrasonography and OPU Procedure ...... 211 In Vitro Production of Embryos from Oocytes Collected by OPU...... 212 In Vitro Production of Embryos from Ovaries Collected from an Abattoir...... 214 Group II Caspase Activity...... 214 The TUNEL Assay, Assessment of Total Cell Number, and Progression to Metaphase II...... 215 Statistical Analyses...... 216 Results...... 217 Dry Matter Intake, Body Weight, and Milk Yield ...... 217 Follicle and Oocyte Responses to Different Diets ...... 218 Follicle and Oocyte Responses to Different Days of the Estrous Cycle ...... 219 Oocyte Quality for the 5th OPU session ...... 219 Internal IVF Control from Slaughterhouse Ovaries ...... 220 Progesterone, Ovarian, and Pregnancy Responses...... 220

x Discussion...... 221 Conclusions...... 229

8 GENERAL DISCUSSION AND CONCLUSIONS ...... 240

LIST OF REFERENCES...... 254

BIOGRAPHICAL SKETCH ...... 298

LIST OF TABLES

Table page

3-1 Least squares means and pooled SE for conceptus length, IFN-τ (µg/total uterine luminal flushing), number of corpora lutea (CL), CL tissue volume (mm3), and CL weight (g) on d 17 after a synchronized estrus (d 0) in nonlactating cyclic (C) and pregnant (P) cows injected with bST (+/-) on d 0 and 11...... 92

3-2 Least squares means and pooled SE for uterine endometrial mRNA, uterine luminal flushings (ULF) protein expression, and hormone concentration at d 17 after a synchronized estrus (d 0) in nonlactating cyclic (C) and pregnant (P) dairy cows injected with bST (+/-) on d 0 and 11...... 99

4-1 Ingredient and chemical composition of diets containing 0 or 1.9% calcium salts of fish oil enriched lipid product (FO)...... 129

4-2 Bovine IFN-τ primers and probe sequences used for quantitative real-time reverse transcription-PCR...... 131

4-3 Least squares means and pooled SE for conceptus size, interferon tau (IFN-τ) mRNA (mean fold effect), IFN-τ (µg/total uterine luminal flushing [ULF]), IFN stimulated gene-17 (ISG-17) protein, number of corpora lutea (CL), CL tissue volume (mm3), CL weight (g), uterine endometrial mRNA, ULF protein expression, and hormone concentration at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and d 11...... 141

5-1 Least squares means and pooled SE for uterine endometrial mRNA and protein, and uterine luminal flushings (ULF) protein expression at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11 (n = 28)...... 168

5-2 Least squares means and pooled standard error (SE) for uterine endometrial protein expression responses at d 17 after an induced ovulation (d 0) in lactating dairy cows injected with or without bST on d 0 and 11...... 169

5-3 Statistical analyses of uterine endometrial protein expression for Table 5-2...... 170

xii 6-1 Least squares means and pooled SE of the endometrium fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11...... 194

6-2 Least squares means and pooled SE for different fatty acid percentages in endometrium and liver tissue at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11...... 195

6-3 Least squares means and pooled SE of the liver fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11...... 196

6-4 Least squares means and pooled SE for the mammary tissue fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11...... 197

6-5 Least squares means and pooled SE for different fatty acid percentages in mammary tissue and milk fat at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11...... 198

6-6 Least squares means and pooled SE for the milk fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11...... 199

6-7 Least squares means and pooled SE for the muscle fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11. 200

6-8 Least squares means and pooled SE for different fatty acid percentages in muscle, subcutaneous adipose, and internal adipose tissue at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11...... 201

xiii 6-9 Least squares means and pooled SE for subcutaneous adipose tissue fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11...... 202

6-10 Least squares means and pooled SE for internal adipose tissue fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11...... 203

7-1 The percent of fatty acids from the total fatty acids in the supplemental fat sources...... 231

7-2 Body temperature, and follicular and oocyte responses of lactating multiparous and primiparous cows fed diets enriched in either C18:1 cis (n=14), C18:1 trans (n = 14), C18:2 (n=13) or C18:3 (n =13)...... 233

7-3 Follicular and embryonic responses of lactating multiparous and primiparous cows fed diets enriched in either C18:1 cis (n=14), C18:1 trans (n = 14), C18:2 (n=13) or C18:3 (n =13) and transvaginaly aspirated on d 3, 6, 9 and 12 of a synchronized estrous cycle...... 234

7-4 Oocyte quality responses from lactating multiparous and primiparous cows fed diets enriched in either C18:1 cis (n=14), C18:1 trans (n = 14), C18:2 (n=13) or C18:3 (n =13)...... 235

7-5 Follicle, corpus luteum (CL) and pregnancy responses from lactating multiparous and primiparous cows fed diets enriched in either C18:1 cis (n=14), C18:1 trans (n = 14), C18:2 (n=13) and C18:3 (n =13) and transvaginally aspirated...... 239

xiv

LIST OF FIGURES

Figure page

2-1 Pathway of desaturation and elongation of linoleic and linolenic acids sequentially acted upon by ∆-6 desaturase, elongase, and ∆-5 desaturase enzymes...... 69

3-1 Experimental protocol illustrating the sequence of injections, collection of samples, and day of ultrasonography...... 91

3-2 Profiles of plasma progesterone concentrations of cyclic (C) cows (▲) and pregnant (P) cows (□) from d 0 to 17 of a synchronized estrous cycle (*P < 0.05; aP < 0.10)...... 93

3-3 Profiles of plasma growth hormone (GH) concentrations of C (∆), P (□), bST-C (▲), and bST-P (■) cows from d 0 to 17 of a synchronized estrous cycle...... 94

3-4 Profiles of plasma IGF-I concentrations of C (∆), P (□), bST-C (▲), and bST-P (■) cows from d 0 to 17 of a synchronized estrous cycle...... 95

3-5 Profiles of plasma insulin concentrations of C (∆), P (□), bST-C (▲), and bST-P (■) cows from d 0 to 17 of a synchronized estrous cycle...... 96

3-6 Representative Northern blots of IGF-I, IGF-II, IGFBP-2 and IGFBP-3 mRNA. ..97

3-7 Representative Ligand Blot detected IGFBP-3, IGFBP-4 and IGFBP-5 in the uterine luminal flushings (ULF) of cows on d 17 after a synchronized estrus (d0)...... 98

4-1 Experimental protocol illustrating the sequence of injections, collection of samples, and day of ultrasonography...... 130

4-2 Regression analysis (third order curves) of daily milk production starting 10 DIM until the start of bST treatment and timed AI for cows fed either 0 (Least squares means: ■ ) or 1.9% (Least squares means: □ ) calcium salt of fish oil enriched lipid diets...... 132

4-3 Linear regression of plasma insulin concentrations for cows fed fish oil enriched lipid (FO) at 0 (Least squares means:■) or 1.9% (Least squares means: □) of dietary DM from 14 to 53 DIM...... 133

xv 4-4 Overall pooled linear regression equations of GH (Least squares means:■) and IGF-I (Least squares means: □ ) plasma concentrations from 14 to 53 DIM for all cows fed either 0 or 1.9% calcium salt of fish oil enriched lipid diets...... 134

4-5 Regression analysis (second order curves) of daily milk production from d 0 to 17 of a synchronized estrous cycle (d 0) for cyclic and pregnant cows fed the control diet and injected with bST (Least squares means: □ ) or not (Least squares means: ■ ) on d 0 and 11...... 135

4-6 Concentrations of plasma progesterone of cyclic cows injected or not injected bST (n = 11) (∆) and pregnant cows injected or not injected with bST (n = 10) (□), measured from d 0 to 17 of a synchronized estrous cycle differed (P < 0.05) between d 0 and 11...... 136

4-7 Concentrations of plasma progesterone of cyclic and pregnant cows not given bST (n = 10) (□) and those given bST (n = 11) (▲) collected from d 0 to 17 of a synchronized estrous cycle differed (P < 0.05)...... 137

4-8 Profiles of plasma GH concentrations of cyclic cows fed control diet (no bST) ( ∆ ), cyclic cows fed control diet with bST injections ( ▲ ), cyclic cows fed FO (- -x- -), cyclic cows fed FO with bST injections (- -o- -), pregnant cows fed control diet (no bST) ( □ ), and pregnant cows fed control diet with bST injections ( ■ ) from d 0 to 17 of a synchronized estrous cycle...... 138

4-9 Profiles of plasma IGF-I concentrations of cyclic cows fed control diet (no bST) ( ∆ ), cyclic cows fed control diet with bST injections ( ▲ ), cyclic cows fed FO (- -x- -), cyclic cows fed FO with bST injections (- -o- -), pregnant cows fed control diet (no bST) ( □ ), and pregnant cows fed control diet with bST injections ( ■ ) from d 0 to 17 of a synchronized estrous cycle...... 139

4-10 Plasma insulin concentrations of cyclic cows fed a control diet (C), cyclic cows fed the fish oil enriched diet (FO), and pregnant cows fed the control diet (P) from d 0 to 17 of a synchronized estrous cycle...... 140

4-11 Representative autoradiograph from ligand blot analysis of uterine luminal IGFBP at d 17 following an induced ovulation...... 142

5-1 Expression of PR (A, B, C), ERα (D, E, F), and PGHS-2 (G, H, I) in bovine endometrium at d 17 following an induced ovulation...... 171

7-1 Experimental protocol illustrating the days in milk (DIM) for synchronization injections, ultrasonography, ovum pick-up, and timed artificial insemination (TAI; d 0)...... 232

7-2 Percent of cleaved embryos at either the 2 to 3, 4 to 7 or > 8 cell stage on d 3 following insemination of either Holstein (n = 115) or Non-Holstein (n = 112) oocytes collected from slaughterhouse ovaries with semen from Angus bulls...... 236

xvi 7-3 Percent of embryos on d 8 following insemination based on stage of development as affected by oocyte genotype...... 237

7-4 Plasma progesterone concentration (ng/mL) and corpus luteum (CL) volume (mm3) collected on d 3, 6, 9, 12, and 16 of a synchronized estrous cycle from lactating multiparous and primiparous cows fed diets enriched in either C18:1 cis (n=14), C18:1 trans (n = 14), C18:2 (n=13) and C18:3 (n =13)...... 238

8-1 Plasma GH (ng/mL) of pregnant cows that were nonlactating or lactating. Cows received injections of bST (+/-; 500 mg) on days 0 (i.e., day of GnRH) and 11 after a synchronized insemination (Days 0 to 17)...... 248

8-2 Plasma IGF-I (ng/mL) of pregnant cows that were nonlactating or lactating. Cows received injections of bST (+/-; 500 mg) on days 0 (i.e., day of GnRH) and 11 after a synchronized insemination (Days 0 to 17)...... 249

8-3 Plasma insulin (ng/mL) of pregnant cows that were nonlactating or lactating. Cows received injections of bST (+/-; 500 mg) on days 0 (i.e., day of GnRH) and 11 after a synchronized insemination (Days 0 to 17)...... 250

8-4 Model diagram representing the effects of bST on genes and proteins of the prostaglandin cascade in the endometrial cell of pregnant lactating dairy cows. ..251

8-5 Model diagram representing the effects of pregnancy on genes and proteins of the prostaglandin cascade in the endometrial cell of lactating dairy cows...... 252

8-6 Model diagram representing the effects of an enriched fish oil diet on genes and proteins of the prostaglandin cascade in the endometrial cell of lactating cyclic dairy cows...... 253

xvii

LIST OF ABBREVIATIONS

AA Arachidonic acid

AI Artificial insemination

BCS Body condition score bST Recombinant bovine somatotropin

C Cyclic cows

CT Comparative threshold cycle

CL Corpus luteum

CLA Conjugated linoleic acid

COC Cumulus oocyte complexes

DGE Deep glandular epithelium

DHA Docosahexaenoic acid

DIM Days in milk

DIX Desaturase index

DMI Dry matter intake

DS Deep stroma

EPA Eicosapentaenoic acid

ERα Estradiol receptor α

FO Fish oil enriched lipid

FSH Follicle simulating hormone

GH Growth hormone

xviii GHR Growth hormone receptor

GHRH Growth hormone-releasing hormone

GnRH Gonadotropin releasing hormone

IFN-τ Interferon-τ

IGF Insulin-like growth factor

IGFBP Insulin-like growth factor binding protein

IRS-1 Insulin receptor substrate-1

JAK2 Janus kinase 2

KSOM Potassium simplex optimized medium

LCFA Long chain fatty acid

LE Luminal epithelium

LH Luteinizing hormone

MUFA Monounsaturated fatty acid

OCM Oocyte collection medium

OMM Oocyte maturation medium

OPU Ovum pick-up

OTR Oxytocin receptor

P Pregnant cows

PG Prostaglandin

PGES Prostaglandin E synthase

PGFM 13, 14-dihydro-15-keto-PGF2α metabolite

PGF2α Prostaglandin F2 alpha

PGFS Prostaglandin F synthase

xix PGHS-2 Prostaglandin H synthase-2

PPAR Peroxisome proliferator-activated receptors

PR Progesterone receptor

PUFA Polyunsaturated fatty acid

PVP Polyvinylpyrrolidone

SFA Saturated fatty acid

SGE Superficial glandular epithelium

SS Superficial stroma

STAT Signal transducer and activator of transcription

TALP Tyrodes albumin lactate pyruvate

TAI Timed artificial insemination

TUNEL Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling

ULF Uterine luminal flushings

UFA Unsaturated fatty acid

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

EFFECTS OF POLYUNSATURATED FATTY ACIDS AND BOVINE SOMATOTROPIN ON ENDOCRINE FUNCTION, EMBRYO DEVELOPMENT, AND UTERINE-CONCEPTUS INTERACTIONS IN DAIRY CATTLE

Todd R. Bilby

December 2005

Chair: William W. Thatcher Major Department: Animal Sciences

A series of experiments were conducted to investigate mechanisms through which polyunsaturated fatty acids (PUFA) and bovine somatotropin (bST) increase fertility.

The first study used nonlactating dairy cows to examine the effects of bST on components of the insulin-like growth factor (IGF) system. Exogenous bST decreased pregnancy rates. However, conceptus length and interferon-tau (IFN-τ) in uterine flushings were increased. The bST may have hyper-stimulated IGF-I and insulin concentrations, causing detrimental effects on conceptus viability.

The second experiment used the same estrous synchronization protocol and bST treatment as the first study; however, lactating dairy cows were used and effects of a diet supplemented with a fish oil enriched lipid (FO) were evaluated. Exogenous bST increased pregnancy rates, conceptus size, and IFN-τ in uterine flushings. The FO altered uterine gene expression, proteins, and plasma hormones in a manner that mimicked pregnancy. Furthermore, FO reduced the n-6:n-3 ratio and increased conjugated linoleic

xxi acid (CLA) concentrations in milk. Pregnancy altered endometrial expression of certain

antiluteolytic associated genes and fatty acid composition, which may attenuate the luteolytic pulsatile secretion of prostaglandin F2 alpha (PGF2α) contributing to embryo

survival.

In the last experiment, diets enriched in different omega fatty acids altered oocyte quality and follicular dynamics in lactating dairy cows. The C18:2 enriched diet reduced

oocyte quality, as indicated by reduced in vitro embryo development, versus a C18:1 cis

enriched diet. Previously documented benefits of PUFA on reproductive responses

reflect actions at alternative biological windows other than oocytes from follicles < 12

mm. Possible beneficial effects of PUFA on the periovulatory follicle and corpus luteum

(CL) were evident by the increase in dominant follicle size and CL volume due to feeding

PUFA.

In summary, bST had differential responses on fertility which were dependent on

lactational status. The bST appears to increase pregnancy thru increased conceptus

length and subsequent IFN-τ production in lactating dairy cows and by altering IGF gene

expression in uterine endometrium. The FO altered endometrial responses and fatty acid

distribution which may benefit pregnancy. Diets enriched in particular fatty acids may

have different effects on oocyte quality and follicular dynamics in lactating dairy cows.

xxii CHAPTER 1 INTRODUCTION

Over the past decade commercial dairy farms have changed dramatically. The

amount of milk produced per cow, larger herd sizes, genetic selection, and improved

management and nutrition are just some of these changes. A shift toward more

productive, large-scale farms has been associated with a decline in reproductive

efficiency. Beam and Butler (1999) reported that conception rates have declined from

66% in 1951 to approximately 40% in 1999. During this same period, yearly milk

production per cow increased 218% (National Agricultural Statistics Service, USDA).

However, Butler and Smith, (1989) indicated no negative genetic trend on fertility because conception rates after artificial insemination (AI) in nonlactating heifers remained constant (between 70 and 80%) during this same time period. In addition,

Lopez-Gatius et al. (2005) indicated that high individual milk production can be positively related to high fertility. In contrast, other studies indicate that there is clearly an antagonistic relationship between milk production and reproduction in dairy cattle

(Dematawewa and Berger, 1998; Hansen, 2000).

The important determinant of dairy farm profitability is the amount of milk produced and sold. Earlier studies reported that to increase farm profitability, calving intervals need to be between 12 to 13.5 months to increase the amount of time cows spend in peak milk production (Louca and Legates, 1968; Holmann et al., 1984).

However, in recent years, reports recommend extending calving intervals to 14 to 15 months (Arbel et al., 2001; Roenfeldt, 1996). The logic underlying this recommendation

1 2 is that there is less need to initiate another lactation in a cow if she is producing at relatively high levels in the latter days of lactation. The increased calving interval may depend on variables such as increased milk production, milk prices, parity, and replacement heifer prices. Cows with greater milk production have a better chance of staying in the herd longer compared with cows in lower milk production which would ultimately increase the calving interval. In order for a dairy farm to achieve a calving interval of 14 months, cows need to become pregnant within the first 140 days of lactation. Presently pregnancy and parturition are still the only means of inducing copious secretion and production of milk. Therefore strategies to increase reproduction would prove beneficial for farm profitability.

Most reproductive inefficiency on dairy farms is due to a high rate of embryonic mortality, particularly early embryonic losses. Early embryonic loss, as defined by

Santos et al. (2004a), is the loss of a pregnancy before d 24 after fertilization.

Fertilization rate is approximately 76% but pregnancy rate falls to approximately 40% at

30 d after AI. Thurmond et al. (1990) estimated that dairy farms, on average, lose $640 for each pregnancy lost. Decreasing the high amount of early embryonic loss would increase both reproductive performance and total milk production, and thus improve the economic success or profitability of dairy farms.

A critical point within the time period constituting early embryonic loss is when the elongating conceptus interacts with the maternal unit to sustain the CL, thereby maintaining pregnancy. Between d 15 to 17 after estrus, the conceptus produces maximal amounts of IFN-τ which leads to the inhibition of episodic pulses of PGF2α (Thatcher et al., 2001). The PGF2α causes CL regression, which induces a return to estrus in

nonpregnant cows or terminates the pregnancy with a loss of the embryo. Therefore,

some of the embryonic losses in cattle are thought to be mediated by the inability of the

conceptus to suppress the luteolytic cascade during the period of CL maintenance

(Thatcher et al., 1986). One potential reason for the inability of the conceptus to suppress

PGF2α is due to reduced development and growth of the embryo/conceptus thereby

reducing the amount of IFN-τ available to prevent luteolysis. Elongation of the embryo

is associated with increased secretion of IFN-τ (Hansen et al., 1988). Therefore

stimulation in conceptus length, (thereby increasing IFN-τ) may reduce the amount of

embryonic loss. An alternative way to reduce embryonic loss would be through regulation of endometrial tissue to attenuate mechanisms involved in the biosynthesis of

PGF2α. This later strategy, coupled with IFN-τ produced from an underdeveloped

conceptus, may provide a strong enough signal to overcome luteolysis and enhance

embryo survival.

Two strategic approaches may be used to decrease early embryonic loss (without

compromising milk production) and to increase milk production. The first strategy is to

use bST. The recombinant bST is produced through fermentation technology and is

coupled with a slow release formulation, allowing bST to be injected biweekly to

increase milk production. The administration of bST to dairy cows is now an accepted and widely used management practice (Bauman, 1999). However, in earlier studies, bST administration was shown to have negative effects on reproductive performance (Cole et al., 1991; Downer et al., 1993). One of the main negative effects of bST is a reduction in estrus behavior that contributes to poor reproductive efficiency due to decreased rates of heat detection. With the advent of timed artificial insemination (TAI) programs such as

Ovsynch, the need for estrus detection was eliminated. Several studies indicated that bST given at or around TAI increased pregnancy rates (Moreira et al., 2000b and 2001; Santos et al., 2004b; Morales-Roura et al., 2001). In addition, Moreira et al. (2002a and 2002b) reported that bST increased embryonic development when measured at d 7 after fertilization utilizing an in vitro as well as in vivo model with the use of lactating dairy cows. Furthermore, bST reduced endometrial PGF2α secretion in vitro (Badinga et al.,

2002). However the mechanisms by which bST increases pregnancy rates during the critical window of CL maintenance are unknown.

The second strategy to increase fertility and possibly milk production is by using supplemental fats in the diet. Supplemental fats are used as an energy source in the diet to support the high demands of lactation. One such fat source is fish meal or fish oil which is relatively high in two fatty acids: eicosapentaenoic acid (EPA) and docosahexanoic acid (DHA). Fish meal increased pregnancy rates in lactating dairy cows

(Carroll et al., 1994; Bruckental et al., 1989; Armstrong et al., 1990). In addition, feeding fish meal (Mattos et al., 2002) or fish oil (Mattos et al., 2004) to lactating dairy cows reduced circulating concentrations of PGF2α. Production of PGF2α was also reduced by bovine endometrial cells when incubated with EPA and DHA (Mattos et al., 2003).

Several mechanisms by which EPA and DHA can decrease PGF2α have been hypothesized; however, the precise mechanism(s) are unknown.

Another beneficial effect of supplementing diets with long chain fatty acids

(LCFA; such as those found in fish oil) is the health-promoting factors that are increased in the milk for human consumption. Unsaturated fatty acids (UFA) have anticarcinogenic effects and other human health-promoting properties (Bauman et al.,

2001). Understanding the mechanisms by which fish oil increases fertility may be

beneficial for the cow; understanding how fish oil regulates fatty acid distribution in meat

and milk for human consumption may be beneficial for humans.

Although supplemental fat feeding has shown to increase fertility, studies have not

been conducted to document which fatty acids are beneficial, which ones have no effect and which ones have negative effects on reproductive processes. Understanding which

fatty acids are beneficial, and formulating diets enriched in those particular fatty acids,

may enhance reproductive performance.

This dissertation will review the many reproductive challenges facing the modern

day dairy cow and the effects of both supplemental fat feeding and bST administration on

reproduction (Chapter 2). In addition, experiments are described that were conducted to elucidate the mechanisms by which bST increases pregnancy rates, in particular, at the

time when there is a dialogue between conceptus and endometrium to maintain the CL.

The nonlactating dairy cow was used first (Chapter 3) as an experimental model to

evaluate bST effects given at TAI on conceptus and endometrial function at d 17 of the

estrous cycle or pregnancy. Ovarian function, conceptus development, and regulation of

the GH-IGF system in the uterus were examined. This study was repeated in a second

experiment using lactating dairy cows as the experimental model and also examining the effects of a supplement containing calcium salts of fish oil enriched lipid. Responses

evaluated were:

• Ovarian, conceptus and the GH—IGF system (Chapter 4)

• Endometrial gene expression related to the maintenance of pregnancy (Chapter 5)

• Distribution of fatty acids in tissues and milk (Chapter 6)

The last experiment (Chapter 7) evaluated the effects of diets enriched in different UFA on oocyte quality and follicular development in lactating dairy cows.

CHAPTER 2 REVIEW OF LITERATURE

Reproductive Challenges of the High-Producing Dairy Cow

Transition Period and Energy Balance

A critical time period in the life cycle of dairy cattle is the period 3 weeks before and after calving (the transition period). Many dramatic physiological changes occur to both endocrine and nutritional statuses to support milk production. Just before parturition, nutrient demand increases markedly to satisfy late fetal development at a time when dry matter intake (DMI) is decreasing. Consequently, body reserves must be mobilized to meet demand. After parturition, nutritional requirements increase suddenly with initiation of milk production, and cows enter a negative energy balance. The degree

and duration of tissue mobilization are primarily related to DMI rather than milk yield.

The DMI can be influenced by several factors, such as body condition prior to

calving (Grummer, 1993), environment (Drew, 1999; Fuquay, 1981), diet (Allen, 2000),

management (Drew, 1999), and immune stressors like uterine, hoof, and (or) metabolic

disorders (Formigoni and Trevisi, 2003). Negative energy balance usually reaches its

lowest point or nadir between the second and third weeks of lactation (Butler and Smith,

1989). The DMI needs to increase four to six fold to meet the high nutrient demands of

milk production. However, the dairy cow in early lactation cannot increase DMI fast

enough to meet nutrient demands required for lactation and, as a result, fat and protein

are mobilized from body reserves. Tamminga et al. (1997) found that energy partitioning

in early lactation resulted in mobilization of 42 kg of empty body weight, 31 kg fat, and

7 8

5 kg protein. On a per-day basis, cows mobilized an average of 0.7 kg for empty body

weight, 0.56 kg for fat and 0.04 kg for protein; however, the largest part of the

mobilization occurs in the first week of parturition: 37% of empty body weight, 12% of

total fat, and 58% of total protein are mobilized. This further decrease in energy balance

profoundly affects fertility by decreasing luteinizing hormone (LH) pulse frequency,

reducing the diameter of the dominant follicle with low estradiol production, the period

of low concentrations of plasma progesterone, and increasing the interval to first estrus

(Roche et al., 2000).

Metabolic hormones also are altered with an increased concentration of growth

hormone (GH) possibly associated with an uncoupling of the GH receptor (GHR) and

IGF-I production (Kobayashi et al., 1999). The result is decreased systemic

concentrations of IGF-I and possibly intra-follicular IGF-I, decreased body condition

score (BCS), lower glucose and insulin concentrations of plasma, and higher concentrations of nonesterified fatty acids, β-hydroxy butyrate and triacyl glycerol in plasma (Beam and Butler, 1999; Roche et al., 2000). Thus high DMI early postpartum in high-producing dairy cows is critical to normal resumption of ovulation and development of a normal size CL with sufficient production of progesterone to sustain high fertility

(Vandehaar et al., 1995). Consequently, nutritional management of the high-producing

dairy cow during the transition period has significant carry-over effects on reproductive

efficiency. Staples et al. (1990) reported lower milk production and feed intake resulting

in a more-negative energy balance in anestrous dairy cows compared with cows that

returned to cyclic ovarian activity before d 60 postpartum. Lucy et al. (1992) fed cows a

high-energy diet to achieve a positive energy balance, or fed cows a low-energy diet to

maintain negative energy balance during the early postpartum period. The nonesterified fatty acid levels were elevated and the IGF-I was reduced in cows fed the low energy

diet. In addition, the growth of the preovulatory follicles in cows fed the low energy diet

was reduced by 50% versus that of cows fed the high energy diet.

Fertility

Milk production per cow increased steadily during the last 20 years, because of a combination of improved management, better nutrition, and intense genetic selection.

Also, dairy farms have moved toward larger-scale operations: nearly 30% of the dairy

farms in the United States have 500 or more cows (Lucy, 2001). This shift toward more

productive cows and larger herds is associated with a decrease in reproductive efficiency.

Butler (1998) documented a decline in first-service conception rate from approximately

65% in 1951 to 40% in 1996. Cows inseminated artificially at observed estrus typically had conception rates of approximately 55% (Casida, 1961). However, more recent studies report conception rates of approximately 45% for inseminations at spontaneous estrus (Dransfield et al., 1998) and approximately 35% when TAI is used (Burke et al.,

1996; Pursley et al., 1997a, 1997b, and 1998).

During the last 10 years, milk production has increased approximately 20% and reproductive efficiency has declined (Lucy, 2001). However, an epidemiology analysis of reproductive performance in dairy cows indicated that the hazard ratio for initial cumulative 60-d milk yield in US Holstein cattle was near 1.0 (i.e., neutral effect) on conception rate (Grohn and Rajala-Schultz, 2000). Only at the highest level of milk production was there a nonsignificant increase in hazard ratio. Other factors such as

postpartum disorders affected conception rate, suggesting that factors such as energy

balance, postpartum disease, embryonic loss, inbreeding, and heat stress are affecting reproductive performance (Lucy, 2001).

Cows undergo a normal process of nutrient partitioning and adipose tissue mobilization during early lactation (Bauman and Currie, 1980) associated with negative energy balance, weight loss, and decreased BCS. This is the time when nutrient requirements for maintenance and lactation exceed the ability of the cow to consume energy in the feed. Garnsworthy and Webb (1999) found the lowest conception rates in cows that lost more than 1.5 BCS units between calving and insemination. In addition,

Butler (2000) reported that conception rates range between 17% and 38% when BCS

decreases 1 unit or more, between 25% and 53% if the loss is between 0.5 and 1 unit, and

is >60% if cows do not lose more than 0.5 units or gain weight.

An inadequate immune status can negatively affect fertility in lactating dairy cattle.

Several epidemiological studies reveal a reduction in fertility for cows affected by

disorders of the reproductive tract (Labernia et al., 1999), mammary gland (Schrick et al.,

2001), feet (Dobson et al., 2001), and metabolic diseases such as ketosis, milk fever and

left-displaced abomasums (Markusfeld et al., 1997; Beaudeau et al., 2000). Retained

placenta, metritis, and ovarian cysts are risk factors for conception. Cows had lower

conception rates of 14% with retained placenta, 15% with metritis and 21% for those

with ovarian cysts (Grohn and Rajala-Schultz, 2000). Mastitis also significantly reduces

fertility in lactating dairy cattle (Hansen et al., 2004).

Embryonic loss is a large problem reducing fertility and farm profitability in

lactating dairy cows. In a recent review (Santos et al., 2004a), lactating dairy cows seem

to be most susceptible to reproductive failure in part due to low fertilization rate (~ 76%)

and embryo viability in the first few days of gestation, but also because of extensive

embryonic and fetal death (~ 60%). In heifers and moderate yielding dairy cows

(Sreenan et al., 2001) fertilization rates upwards of 90% and calving rates of

approximately 55% indicate an overall embryonic and fetal mortality rate of

approximately 40%. It was concluded that few embryos are lost after fertilization and up

to d 8 of pregnancy, and about 70 to 80% of total embryo loss occurs between d 8 and 18

after breeding. Subsequent losses were estimated to be around 10% between d 16 and 42

and 5 to 8% between d 42 and calving (Sreenan et al., 2001). Beef heifers were used to

determine embryo survival during distinct stages of pregnancy with 93% survival rates to d 8, 66% to d 16 and 58% to d 42 (Diskin and Sreenan, 1980). Vasconcelos et al. (1997) reported losses of 20% between 28 and 98 d after insemination in high-producing dairy cows. Inadequate progesterone concentrations can cause changes in concentrations of hormones such as LH and estradiol which can negatively affect the oocyte, embryo, and uterine environment subsequently owing to high rates of embryonic loss (Inskeep, 2004).

Genetic selection for milk production has been optimized at the expense of fertility.

Inbreeding has increased in US Holsteins since 1980 (Lucy, 2001). Present levels of inbreeding are approximately 5% and some have predicted that levels of inbreeding will be 10% by 2020 (Hansen, 2000). Each 1% increase in inbreeding led to a 0.17 increase in services per conception, a 2 d increase in days open, and a 3.3 percentage unit decrease in conception rate. If these estimates are correct then inbreeding alone could account for the decline in fertility since the 1980s.

Heat stress is a major contributing factor to the low fertility of dairy cows inseminated in the summer months (Ray et al., 1992; Thompson et al., 1996). Bradley

(2000) reported the decade of the 1990s was the warmest since the beginning of instrumental temperature recording capabilities. The decrease in conception rate during the hot season can range between 20 and 30% compared to the winter season (Cavestany et al., 1985; Badinga et al., 1985) Reproduction in high-producing dairy cows is extremely sensitive to heat stress because of the high metabolic rate associated with increased milk yields (Wolfenson et al., 2000). Al-Katanani et al. (1999) examined 90-d return rates throughout the calendar year and reported that summer infertility was greatest in the highest milk producing dairy cattle. Therefore, there are negative additive effects of heat stress and increased milk production on first-service conception rate in dairy cattle. There are also clear seasonal patterns in efficiency of estrus detection, day to first service and conception rate in dairy cows with lower conception rates consistently observed in summer months (Cavestany et al., 1985; Ryan et al., 1993; Almier et al.,

2002). There appear to be negative carry-over effects of heat stress on fertility into the autumn months (Badinga et al., 1985; Wolfenson et al., 1997). It is suggested that this could be an effect of heat stress damage on early antral follicles during the summer that develop into large less fertile dominant follicles 40 to 50 d later (Roth et al., 2001).

Follicle and Estradiol

A transient increase in follicle stimulating hormone (FSH) at 2 or 3 d after parturition induces emergence of a cohort of three to six follicles (4 to 6 mm) in diameter and by d 10 one of these follicles will have achieved dominance (Roche and Diskin,

2001). The LH pulse frequency increases during the first 2 weeks after parturition and is higher in cows that ovulate their first dominant follicle in comparison with cows that do not (Beam and Butler, 1999). Cows have ovarian follicular waves with each wave being

7 to 10 d in duration and comprised of distinct phases defined as emergence, deviation,

dominance and atresia or ovulation. The cow’s estrous cycle normally has one or two

non-ovulatory waves and a terminal ovulatory wave. Hormonal interactions within a

wave involve pituitary gonadotropins (LH and FSH), proteins and peptides of follicular

origin (inhibin and follistatin), ovarian steroids of follicular (estradiol) or luteal

(progesterone) origin (Mihm et al., 2002), and PGF2α having a critical role within the

ovulatory wave. Follicles generally reach ovulatory size at a diameter of 13 to 20 mm

with the interval between the preovulatory surge of LH and ovulation of 28 h. The LH

surge causes differentiation of the granulose cells from producing estradiol to

progesterone (Juengel and Niswender, 1999). The LH surge also activates an

inflammatory reaction involving both hyperemia and collagen degradation mediated by

increased production of PGE2 and PGF2α, leading to a thinning and eventual rupture of

the follicular wall (Espey, 1980).

Lactating Holstein cows tend to have two-wave cycles (Townson et al., 2002),

whereas beef and dairy heifers tend to have either two- or three-wave cycles (Ginther et

al., 1989). The peak and average plasma concentrations of FSH and inhibin are lower in the two non-ovulatory waves of a three-wave cycle than in the ovulatory wave, but are similar in two-wave cycles (Parker et al., 2003). Number of follicular waves in the cycle preceding estrus did not influence the probability of conception in beef cattle; however, there were only eight three-wave cycles to characterize conception rate (Ahmad et al.,

1997). Holstein cows with a three-wave cycle preceding insemination had higher conception rates to first insemination than those with two waves (Townson et al., 2002).

Beef cows with three waves in the cycle following insemination had a higher conception rate (Ahmad et al., 1997). Thus number of follicular waves in a cycle may increase the

probability of conception in animals with three-wave cycles. This could be because the

ovulatory follicle developed over a shorter period (Mihm et al., 1994; Townson et al.,

2002), or because there was a slightly longer luteal phase after insemination (Ginther et

al., 1989) that may benefit growth of the conceptus.

Metabolism may also affect blood concentrations of estradiol. Sartori et al. (2002a)

reported lactating cows had larger preovulatory follicles than did heifers but lower

preovulatory concentrations of estradiol in blood. In a study comparing lactating and

nonlactating dairy cows, plasma estradiol concentrations during the preovulatory period

were several-fold higher in nonlactating compared with lactating cows (de la Sota et al.,

1993). Beam and Butler (1994) compared cows that were either not milked (Dry),

milked twice per day or three times per day following parturition. This resulted in

different energy balance and body weight loss among groups during the first 4 weeks

postpartum. Although peak plasma estradiol was similar among groups, maximum

diameter of the dominant preovulatory follicle from the first follicular wave postpartum was larger in both the 3x and 2x cows compared with the dry cows. Therefore, lactational status or large differences in energy balance do not prevent the formation of

follicular waves but apparently alter the growth and ultimate diameter of dominant

follicles.

Corpus Luteum and Progesterone Production

The CL is formed from an ovulated dominant follicle and secretes progesterone

which is critical for establishment and maintenance of pregnancy. Pregnant dairy cows

have greater concentrations of blood progesterone compared with non-pregnant dairy

cows within the first week to 10 d after insemination (Mann et al., 1999). Low plasma

progesterone has been associated with a decrease in fertility possibly due to increased

15 milk yield in high-producing lactating dairy cows (Lucy, 2001). Sartori et al. (2002a) found that concentrations of progesterone and estradiol in lactating dairy cows were lower than in heifers in summer and similar to dry cows in winter, despite the fact that they had larger ovulatory follicles and larger CL.

Although CL mass of high-producing dairy cows may be larger, progesterone secretion and clearance may be more important to fertility. Starbuck et al. (2001) showed that cows with adequate milk progesterone (>3 ng/mL) had pregnancy rates of approximately 50 to 55%, whereas cows with concentrations of < 1 ng/mL had pregnancy rates < 10%. Lucy et al. (1998a) found lower plasma concentrations of progesterone in higher producing cows than controls. Poor nutrition and weight loss in beef cattle causes a decrease in blood progesterone concentrations (Beal et al., 1978).

Progesterone concentrations in blood are determined by rates of secretion, metabolism, and clearance. The liver is the primary site of progesterone metabolism, and progesterone and its metabolites are excreted in the feces, urine, and milk (Parr, 1992). A study comparing dairy cows implanted with progesterone releasing devices, either grazing pasture ad libitum or grazing pasture for a restricted period of time, showed that cows grazing pasture ad libitum had lower plasma concentrations of progesterone

(Rabiee et al., 2000). In addition, Sangsritavong et al. (2000) demonstrated that liver blood flow (liter/h) and progesterone metabolism (ng/mL) increased by greater than 50% when feed intake was either acutely or chronically increased. Sheep also demonstrated an increase in progesterone metabolism with increased level of feeding (Parr, 1992). The previous studies concluded that the modern day high-producing dairy cow has lower blood concentrations of progesterone due to an increased metabolic rate associated with

increased consumption of feed to meet energy demands for lactation. During lactation,

luteal phase progesterone concentrations were lower in higher yielding dairy cows, and

there was a delay in the increase of progesterone in the early luteal phase in cows with peak milk production > 42 kg/day. However, in lower yielding cows no such relationships are apparent (Lucy and Crooker, 2001). Also, it has been suggested that

lower progesterone concentrations may be related to a greater liver mass and associated

higher catabolic activity when cattle and sheep receive a greater dietary input

(O’Callaghan et al., 2001).

Oocyte Competence and Early Embryo

The ability of an oocyte to mature, be fertilized and finally develop into a viable

embryo is acquired gradually by the oocyte during folliculogenesis. During the period

just prior to ovulation, cytoplasmic and nuclear maturation occurs allowing for

developmental competence of the early embryo. During this long period of follicular

growth up to ovulation, developmental competence of the oocyte is determined. Thus

many diseases and disorders may negatively affect oocytes within follicles that begin

their development during the early postpartum period. For instance, during the early

postpartum period the high-producing dairy cow goes through a negative energy balance

and body weight loss as mentioned previously. Snijders et al. (2000) found that the

ability of an oocyte to be fertilized and develop to the blastocyst stage in vitro was

affected by body condition of the donor dairy cow. Oocytes fertilized in vitro from dairy

cows in low body condition had a lower cleavage rate and lower developmental rate

compared with oocytes from dairy cows in better body condition. They also noted

reduced developmental competence of oocytes collected from high genetic merit and first

lactation cows, suggesting that reproductive efficiency is compromised by genetic

17 selection as well as first lactation. The exact period of nutritional imprinting of the oocyte is not known but many have speculated that it occurs during the 2 months that it takes upon activation for a follicle to progress from the primordial to preovulatory stage.

The possibility that the modern day dairy cow has poor oocyte quality and low fertilization capacity in vivo has been examined by comparing cleavage stage of embryos from lactating and nonlactating dairy cattle (Sartori et al., 2002b). The percentage of normal embryos 4 to 5 d after estrus was low (58%) for lactating cattle and lower than historical values reported by Ayalon (1978). The percentage of normal embryos for nonlactating dairy cattle was comparable to historical values for normal lactating cattle

(82%). The percentage of early stage embryos in lactating cows approached that expected for repeat-breeder cattle (cows with four or more inseminations and failing to achieve pregnancy) described in the 1970s (Ayalon, 1978). Sartori et al. (2002b) concluded that high milk production exerts negative effects on oocyte quality and embryo development that can be detected by 5 d after ovulation. Also the detrimental effect is augmented by increased environmental temperature due to pronounced heat stress in lactating cows reducing fertilization rate. Gwazdauskas et al. (2000) collected oocytes throughout lactation (30 to 100 days in milk [DIM]) by twice weekly follicular aspiration and concluded that cows on high energy diets produced more high quality oocytes, but stage of lactation negatively influenced oocyte quality.

During the summer months, heat stress reduces pregnancy and conception rates which can carry-over into the fall months (Wolfenson et al., 2000). Oocytes obtained from dairy cows collected during the summer heat stress period had reduced developmental competence in vitro (Rocha et al., 1998). In this experiment oocytes were

collected from Holstein cows with ultrasound guided aspiration. The proportion of oocytes classified as morphologically normal and the rate of blastocyst development following in vitro fertilization was lower in summer versus winter. Rutledge et al. (1999) also reported a decrease in the number of Holstein oocytes that developed to the blastocyst stage during July and August compared to cooler months. In both of these studies, fertilization rate was not affected by season but the lower development following fertilization during the summer was indicative of oocyte damage. When superovulated donor heifers were exposed to heat stress for 16 h beginning at the onset of estrus, there was no effect on fertilization rate. However, there was a reduced number of normal embryos recovered on d 7 after estrus (Putney et al., 1988a). This illustrates that a brief heat stress can still affect oocyte competence within the periovulatory follicle. In addition, exposure of cultured oocytes to elevated temperature during maturation decreased cleavage rate and the proportion of oocytes that became blastocysts (Edwards

et al., 1997).

Heat stress can also affect the early developing embryo. When a heat stress was

applied from d 1 to 7 after estrus there was a reduction in embryo quality and stage from

embryos flushed from the reproductive tract at d 7 after estrus (Putney et al., 1989). In

addition, embryos collected from superovulated donor cows in the summer months were

less able to develop in culture than embryos collected from superovulated cows during

the fall, winter, and spring months (Monty and Racowsky, 1987). Drost et al. (1999)

demonstrated that transfer of in vivo produced embryos from cows exposed to

thermoneutral temperatures increased pregnancy rate in heat stressed recipient cows

compared to that in heat stressed cows subjected to AI. Embryos appear to have

19 developmental stages in which they are more susceptible to the deleterious effects of heat stress as shown in vitro. Heat shock in vitro at the 2 to 4 cell stage caused a larger reduction in embryo cell number than heat shock at the morula stage (Paula-Lopes and

Hansen, 2002). Earlier studies also showed that heat shock caused a greater reduction in embryo development when applied at the 2 cell stage than the morula stage (Arechiga et al., 1995; Edwards and Hansen, 1997) or at d 3 following fertilization than at d 4 (Ju et al., 1999).

Conceptus and Maternal Unit

High rates of embryonic loss have been observed between the period of conception and around the time of maternal recognition of pregnancy, which occurs between d 17 to

19 after estrus (Mann et al., 1999). During this time, the conceptus must secrete sufficient amounts of IFN-τ to inhibit CL regression in order to maintain both progesterone production and pregnancy. Discord between the conceptus secretions and maternal unit can cause early embryonic loss. Studies utilizing embryo transfer and early pregnancy diagnosis indicate that less than 50% of the viable embryos establish pregnancy by 27 to 30 d after ovulation in lactating dairy cows (Drost et al., 1999; Santos et al., 2004a), whereas in beef cattle 69 and 83% of frozen and fresh embryos, respectively, establish pregnancy on d 37 of gestation.

In normal cows, a large percentage of embryos are lost between d 8 and 16 of pregnancy (Diskin and Sreenan, 1980; Dunne et al., 2000) which is the period of conceptus elongation and IFN-τ production to inhibit PGF2α pulsatile release.

Conceptuses (d 17 to 19) from repeat-breeder cows were smaller than normal cows

(Ayalon, 1978) and may be incapable of blocking the luteolytic cascade resulting in embryonic loss. When reciprocal embryo transfer was performed between repeat-breeder

and normal cattle, the repeat-breeder cattle failed to achieve normal pregnancy rates even

though an embryo from a normal cow was transferred (Gustafsson and Larsson, 1985).

On the contrary, normal cattle had normal pregnancy rates when an embryo from a repeat-breeder cow was transferred. This suggests that the failure to establish pregnancy may be due to a suboptimal uterine environment.

One reason for the discord between the conceptus and maternal unit may be the presence of a retarded embryo that cannot sufficiently produce IFN-τ. Hansen et al.

(1988) stated that elongation of the embryo is associated with increased secretion of IFN-

τ, and that most of the increased output of IFN-τ is due to the increased size of the embryo and not increased synthesis per unit weight. By increasing embryo/conceptus growth, the antiluteolytic signal (IFN-τ) may be strong enough to suppress pulsatile release of PGF2α such that more animals establish and maintain pregnancy.

Progesterone secretion by the CL is essential for coordinating the histotrophic environment to nourish the developing conceptus. Progesterone plays a vital role in stimulating the production of several endometrial proteins and growth factors important for embryo/conceptus growth (Geisert et al., 1992). Concentrations of plasma progesterone have a marked influence on the development of the embryo (Mann et al.,

1996) and its ability to secrete IFN-τ (Mann et al., 1998; Mann and Lamming, 2001).

Dairy cows with early post ovulatory increases and greater concentrations of

progesterone during the luteal phase had larger conceptuses on d 16 that secreted more

IFN-τ than cows with late increases in progesterone and lower progesterone

concentrations (Mann et al., 1998). Supplemental progesterone during the first 4 d after

AI increased morphological development and biosynthetic activity of d 14 conceptuses

(Garret et al., 1998). Lamming and Darwash, (1995) observed that a delay in the

postovulatory rise and low progesterone was associated with reduced pregnancy rates.

However, when an accessory CL is induced 5 d following estrus to increase progesterone

concentrations in lactating dairy cows, conception rates were greater at d 28 (46 vs.

39%), 45 (40 vs. 36%), and 90 days (38 vs. 32%) after AI (Santos et al., 2001).

Furthermore, if the high-producing dairy cow has a lower rise in progesterone concentrations during early diestrus, it could compromise the ability of the conceptus to be large enough to secrete ample amounts of IFN-τ to inhibit luteolysis. This could contribute to the large rate of embryo death (Mann and Lamming, 1999; Darwash and

Lamming, 1998).

Not only can heat stress affect the oocyte and the early embryo, but it can also reduce growth of the conceptus. Biggers et al. (1987) showed that heat stress reduced the weights of conceptuses recovered on d 17 from beef cows. This reduction in conceptus size would reduce the amount of IFN-τ available to inhibit PGF2α pulsatile secretion. In

addition, Putney et al. (1988b) incubated conceptuses and endometrial explants obtained

on d 17 of pregnancy at a thermoneutral (39°C, 24 h) or heat stress (39°C, 6 h; 43°C, 18

h) temperatures. The heat stress decreased protein synthesis and secretion of IFN-τ by

71% in the conceptuses. However, endometrial secretion of PGF2α and conceptus secretion of PGE2 increased in response to heat stress by 72%. Wolfenson et al. (1993)

observed that secretion of PGF2α was increased in vivo when heifers were exposed to

high ambient temperatures. Collectively these studies demonstrate that both the

conceptus and the uterine environment can be disrupted due to heat stress inhibiting the

conceptuses ability to secrete IFN-τ and maintain pregnancy.

A reduction in the amount of growth factors, due to a high level of milk production

and (or) nutritional status, may reduce the amount of embryotrophic growth factors that

are needed for embryo/conceptus growth. Secretion of embryotrophic growth factors into

the uterine lumen may be controlled by nutritional status of the cow since embryo

transfer pregnancy rates were reduced in recipients with low BCS (Mapletoft et al.,

1986). Also GH, IGFs, and their binding proteins may be regulated by nutritional status and level of milk production which are important for embryo/conceptus growth.

Fatty Acid Metabolism

Enzymes

Enzymes found in the rumen of dairy cows modify dietary fatty acids before they are absorbed in the small intestine. Lipolytic anaerobic bacteria found in the rumen secrete enzymes (lipases) which rapidly hydrolyze fats to release the fatty acids and galactose from their glycerol backbone. Both glycerol and galactose are released and

fermented by the bacteria to volatile fatty acids. The length of the acyl chain, the number

of double bonds in the chain, and the types of isomers formed by each double bond

determines fatty acid structure and function (Mattos et al., 2000). For instance, saturated

fatty acids (SFA) do not have double bonds in the acyl chain. Unsaturated fatty acids

have double bonds in their acyl chain and are classified according to the position of the

first double bond in relation to the methyl end of the molecule (Cook, 1996). For

example, linoleic acid has 18 carbon atoms and two double bonds (C18:2), with its first

double bond located at the sixth position from the methyl end, and is therefore a member

of the n-6 family. In contrast, linolenic acid has three double bonds (C18:3) and belongs

to the n-3 family because the first double bond is at the third carbon position. Rumen

23 enzymes acting upon fatty acids of one family (i.e., n-3) can only generate fatty acids of that same family (Jenkins, 1993).

Three different enzymes, designated as isomerases, desaturases and elongases, play a large role in modifying the configuration around a double bond, number of double bonds, and length of the acyl chain, respectively. By changing the structure of the fatty acid, these enzymes also are changing their function and type of fatty acid. Isomerases change the orientation of the fatty acid molecule around a double bond, converting the native cis-isomers into trans-isomers. Isomerization also can change the location of the double bonds in the carbon chain (Khanal and Dhiman, 2004). For example, linoleic acid

(cis-9, cis-12 C18:2) can be isomerized into conjugated linoleic acid (cis-9, trans-11 C18-2) which has human health promoting properties (i.e., anticarcinogenic, antidiabetic, antiatherosclerosis etc.; Bauman et al., 2001).

Elongation involves the addition of two carbon units to the acyl chain of the fatty acid by an elongase enzyme. For example, stearidonic acid (C18:4) is elongated to eicosatetraenoic acid (C20:4). Fatty acid desaturases are nonheme iron-containing enzymes that introduce a double bond between defined carbons of fatty acyl chains.

Delta desaturases create a double bond at a fixed position counted from the carboxyl end of fatty acids. Stearoyl CoA desaturases (also called ∆-9 desaturase) catalyze synthesis of monounsaturated fatty acids (MUFAs) from SFA (Bauman and Griinari, 2003). For example, stearic acid (C18:0) is acted upon by ∆-9 desaturase to form the UFA, oleic acid

(C18:1). The desaturases are classified according to the position of insertion of the double bond. For instance, the ∆-9 desaturase enzymes introduce the first cis-double bond at the 9, 10 position from the carboxyl end of fatty acids. The ∆-6 desaturases and

∆-5 desaturases are required for the synthesis of highly UFA. The ∆-6 desaturases are

membrane bound desaturases that catalyze the synthesis of PUFAs. The ∆-6 desaturases

and ∆-5 desaturases are classified as front-end desaturases because they introduce a double bond between the pre-existing double bond (i.e., omega-3 and -6) and the carboxyl (front) end of the fatty acid (Nakamura and Nara, 2004). The ∆-6 desaturase inserts the double bond between the sixth and seventh carbon from the carboxyl end and

∆-5 desaturase inserts the double bond between the fifth and sixth position from the carboxyl end. Examples of ∆-6 and ∆-5 desaturase are the conversion of C24:5 into

C24:6 and C20:3 into C20:4, respectively.

In animals, desaturation of fatty acids does not occur at positions in the acyl chain greater than ∆-9 (Cook, 1996). This does not allow the animal to produce fatty acids of the n-3 or n-6 family. However, animals have absolute requirements for some fatty acids from the n-3 and n-6 families. These fatty acids are considered to be essential fatty acids since they must be provided by the diet (Lambert et al., 1954). The two essential fatty acids are linoleic (C18:2, n-6) and linolenic acid (C18:3, n-3). For example, linoleic acid is essential for the synthesis of AA (C20:4, n-6). Linoleic acid is converted to AA by both a ∆-5 and ∆-6 desaturase and an elongase (Figure 2.1). Linolenic acid is converted to EPA (C20:5) by both a ∆-5 and ∆-6 desaturase and an elongase (Figure 2.1).

Biohydrogenation

The two major components in a dairy cow’s diet are forages and concentrates. The forages consist largely of glycolipids and phospholipids. The major fatty acids in these two lipid classes are linolenic (C18:3) and linoleic acid (C18:2) which are the essential fatty acids. In contrast, the main lipids in seed oils used in concentrate feedstuffs are predominantly triglycerides containing linoleic and oleic acid (cis-9 C18:1). When these

dietary lipids are consumed by ruminants, they undergo two important transformations in the rumen (Dawson and Kemp, 1970; Keeney, 1970; Dawson et al., 1977). The first step

in the fatty acid transformation is hydrolysis of the ester linkages catalyzed by microbial

lipases. The anaerobic bacteria found in the rumen secrete lipases which rapidly

hydrolyze fats to release the fatty acids and galactose from their glycerol backbone. The

glycerol and galactose released are fermented by the bacteria to volatile fatty acids. The

second step for fatty acid transformation is a process called biohydrogenation.

Biohydrogenation is attained through the addition of a hydrogen ion at the point of the

double bond. Hydrogenation results in the conversion of UFA into SFA. An example of

this would be the conversions of C18:3, C18:2, and C18:1 into C18:0. As a result, the

proportion of SFA reaching the small intestine is greater than that entering the rumen.

This increased amount of SFA occurs at the expense of UFA such as the essential fatty

acids, linoleic and linolenic acid.

Fatty-Acid Intermediates

Biohydrogenation in the rumen is not completely efficient in that some proportion

of a fatty acid molecular class can be completely biohydrogenated, some of the molecules

are partially biohydrogenated, and some remain in the original native state. During the

biohydrogenation of linoleic acid to stearic acid C18:0, eight isomers known as CLA are

formed. Also CLAs can be synthesized in animal tissues from the conversion of

transvaccenic acid (trans-11 C18:1), another intermediate of rumen biohydrogenation of

linoleic or linolenic acid, by the ∆-9 desaturase enzyme to form cis-9, trans-11 CLA (Corl

et al., 2001; Griinari and Bauman, 1999). Thus, rumen production of trans-11 C18:1 and

mammary tissue ∆-9 desaturase are important in determining the CLA content in milk.

However, a range of trans C18:1 isomers are produced in the rumen and subsequently

26 absorbed from the small intestine and incorporated into milk fat (Corl et al., 2001).

These different isomers, specifically trans-10 C18:1 reduced milk fat synthesis, rather than C18:1 isomers in general (Griinari et al., 1996). In addition Baumgard et al. (2000) demonstrated that trans-10, cis-12 CLA inhibited milk fat synthesis, whereas the cis-9, trans-11 CLA isomer had no effect.

The mechanism by which trans-10 C18:1 and trans-10, cis-12 CLA reduce fat synthesis may be multifaceted. Baumgard et al. (2002) utilized mammary tissue biopsies obtained on d 5 of treatment with trans-10, cis-12 CLA and observed that the reduction in milk fat yield corresponded to reductions in mRNA abundance for genes that encoded for enzymes involved in the uptake and transport of fatty acids (i.e., lipoprotein lipase and fatty acid binding protein), de novo fatty acid synthesis (i.e., acetyl CoA carboxylase and fatty acid synthetase), desaturation of fatty acids (i.e., ∆-9 desaturase), and triglyceride synthesis (i.e., glycerol phosphate acyltransferase and acylglycerol phosphate acyltransferase). Two candidates for control of these genes in reducing milk fat synthesis are peroxisome proliferator-activated receptors (PPAR) and sterol regulatory element binding proteins which both are regulated by PUFAs (Clarke, 2001; Jump and Clarke,

1999).

An increasing interest in CLA consumption from animal products is attributed to their potential health benefits such as anticarcinogenic, antiatherogenic, antidiabetic and antiadipogenic effects (Banni et al., 2003; Belury, 2003; Kritchevsky, 2003; Pariza,

1999). Of the two physiologically important isomers (cis-9, trans-11 and trans-10, cis-12

CLA), cis-9 trans-11 CLA is the most predominate comprising 80 to 90% of total CLA in milk and meat from ruminants, whereas trans-10 cis-12 is present in small amounts at 3

27 to 5% of total CLA (Parodi, 2003). Previous studies have demonstrated that the cis-9 trans-11 CLA reduces mammary tumor incidence in rats when added to the diet or consumed as a natural component of butter (Ip et al., 1999). The estimated average consumption of CLA is 1 g/d for adults, below the estimated 3.5 g/d intake suggested as a protective amount. An epidemiological study involving >2300 middle-aged men reported a decreased incidence of heart disease for men consuming milk and butter

(Elwood, 1991).

A large interest in discovering ways to increase CLAs in milk and meat from cows has emerged. The CLAs increase due to dietary changes such as supplementation with unsaturated fats. In a study by Griinari et al. (1998), CLA of the milk fat in dairy cows increased from 0.35 to 1.98% when the diet was changed from a saturated to an unsaturated fat diet. Plant oils such as sunflower, soybean, corn, canola, linseed, and peanut profoundly increase CLA. In particular, plant oils high in linoleic acid give the greatest response (Kelly et al., 1998), and there is a clear dose dependent increase in milk fat content of CLA (Bauman et al., 1999a). Addition of dietary fish oils or fish meal also increases milk fat CLA. In addition, fish oils seem to produce a larger increase in milk fat CLA than an equal amount of plant oils (Chouinard et al., 1998). Although the rumen biohydrogenation of the PUFAs found in fish oil is not well understood (Harfoot and

Hazelwood, 1988), neither CLA nor trans-11 octadecenoic acid seem to be intermediates.

Chilliard et al. (1999) demonstrated that feeding of fish oil results in increased ruminal production of trans-11 octadecenoic acid. The increase in trans-11 octadecenoic acid could involve inhibition of bacteria that reduce octadecenoic acid (C18:1) since trans-11

C18:1 is not an intermediate. More trans-11 octadecenoic acid increases the amount of precursor for ∆-9 desaturases that can be converted endogenously into CLA.

Polyunsaturated fatty acids of the n-3 family such as EPA (C20:5, n-3) and DHA

(C22:6, n-3), have been shown to undergo little biohydrogenation (Ashes et al., 1992).

The EPA and DHA are found typically in diets derived from fish meal or oil which also increases amounts of CLAs in ruminant products. However, PUFAs themselves can also be essential for growth and development, prevention and treatment of heart disease,

arthritis, inflammation, autoimmune diseases, and cancer (Simopoulos, 1999).

Accordingly, there are now dietary recommendations and guidelines for omega-3 fatty

acid intakes. For example, in a recent scientific statement, the AHA Dietary Guidelines

suggest Americans consume at least two servings of fish per week, and include in the diet vegetable oils rich in the omega-3 fatty acids such as C18:3, EPA and DHA (Kris-

Etherton et al., 2003). It also recommends that 1.3 to 2.7 g/d total omega-3 fats be consumed. Despite these recommendations, it is estimated that actual dietary intakes of omega-3 fatty acids, and EPA and DHA specifically, are as low as one-tenth of these levels. It is estimated that to achieve the recommended levels of EPA and DHA, a

fourfold increase in fish consumption in the United States is necessary (Kris-Etherton et

al., 2000). The possible feeding of fish oils to dairy cows will increase human

consumption of PUFAs, specifically EPA and DHA, by increasing their concentration in

meat and milk.

Effects of Supplemental Lipids on the High-Producing Dairy Cow

Transition Period and Energy Balance

The transition period (3 weeks before until 3 weeks after parturition) is a time

marked by physiological changes to accommodate fetal growth, parturition, lactogenesis,

29 galactopoeisis, and uterine involution. These changes, which are more dramatic than at any other time during the gestation-lactation cycle, influence tissue metabolism and nutrient utilization. A reduction in feed intake is initiated during the prepartum transition period, yet nutrient demands for support of initiation of milk synthesis and reproduction are increasing. This instills a negative energy status on the high-producing cow, that until alleviated antagonizes proper immune and reproductive function.

Fat supplementation is commonly used to increase the energy density of the diet of lactating dairy cows. Previous studies supplementing fat to improve the energy status of the cow during the transition period have been shown to have differing effects depending on whether DMI suppression occurred. The type of fat fed as well as the type and amount of forage will have an effect on the extent to which DMI is affected (Allen,

2000). The mechanisms by which fat can depress DMI are not clear. Intake could be depressed when supplemental fats are fed due to decreased palatability, ruminal fill due to decreased fiber digestion, regulation of the gut hormone cholecystokinin on the brain satiety centers, and increased amount of fatty acid oxidation in the liver that alters signals generated by hepatic vagal afferent nerves to brain centers signaling satiety (Allen, 2000).

However, other studies have reported that feeding fat can have no effect on DMI (Staples et al., 1998). In addition, some studies reported DMI was depressed early in the experiment but had no effect later in the experiment after cows had consumed the diets for a longer period of time (Beam and Butler, 1998; Chouinard et al., 1997; Garcia-

Bojalil et al., 1998). This indicates there is a period in which cows must become adjusted to the supplemental fat source. In studies were fat did not depress DMI and did not change the energy status of the cow, more energy was probably utilized for milk

production. Production of fat-corrected milk was increased by 2.2 kg/d (Andrew et al.,

1991) and by 1.4 kg/d (Harrison et al., 1995) when cows were fed supplemental fats and

neither energy status nor DMI was changed compared to controls.

Supplementation of fat has also resulted in higher DMI in several studies (Allen,

2000). Substitution of fat for grain can reduce the hypophagic effects of propionate by reducing its flux to the liver. Also, dietary fat has a lower heat increment per unit of energy than other energy sources and its inclusion in the diet has been advocated as a possible means of reducing heat stress and increasing DMI of dairy cows (Beede and

Collier, 1986; Morrison, 1983). In a study by Skaar et al. (1989), DMI was increased 7% in the warm season and was 5% lower in the cool season for cows consuming diets with added fat compared to diets without supplemental fat. However, in other studies utilizing

lactating dairy cows in heat stress versus thermoneutral environments and fed diets with or without supplemental fat, there was no interaction of diet and environment on feed

intake.

The fatty acid composition of different fat sources varies widely. For example,

unprocessed plant oils contain a large amount of PUFAs such as linoleic and linolenic acid. Rendered fats like tallow and yellow grease contain a large portion of MUFAs such as oleic acid. Granular fats such as calcium salts of palm oil and prilled fats, contain high amounts of saturated fats palmitic and stearic acids. The hypophagic effects of added fat has shown to increase with increasing amounts of UFA (Jenkins and Jenny, 1989; Pantoja et al., 1996; Pantoja et al., 1994) and the mechanisms behind this are unknown. Greater hypophagic effects of LCFA with increased degree of unsaturation were observed when

LCFA were infused into the abomasum, with no effects of fat source on total tract

digestibility of fatty acids (Bremmer et al., 1998). Drackely et al. (1992) suggested that unsaturated LCFA reaching the small intestine of dairy cows affects gastrointestinal motility and DMI. The differences in DMI due to differing types of fatty acids are not clearly determined and await affordable sources of pure fatty acid products (C18:1, C18:2 etc.) to understand this phenomenon (Bremmer et al., 1998).

Supplemental fats can also affect metabolic hormones such as insulin that would regulate not only feed intake but also reproductive responses such as interval to first ovulation. In a review by Staples et al. (1998), out of 17 fat studies that measured insulin, eight showed a decrease in plasma insulin. Insulin concentrations usually reflect energy intake. For example plasma concentrations of insulin increased with increasing

DIM and DMI (Lucy et al., 1991b). In addition, when energy status was used as a covariate in the statistical model, the significant differences of diet and day on insulin were eliminated, suggesting insulin differences among diets were due to differences in energy status. Insulin suppression by supplemental feeding of fat may benefit the development of follicles. Spicer et al. (1993) reported that bovine granulosa cells tended to produce less IGF-I when cultured with insulin and GH. Because IGF-I is a potent stimulator of bovine granulosa cells in vitro (Spicer et al., 1993), suppression of insulin through the feeding of fat may allow IGF-I to affect positively follicle development.

However, several other studies have shown that increased insulin concentration positively

affects interval to first ovulation and resumption of normal estrous cycles (Armstrong et

al., 2003).

As mentioned earlier, an inadequate immune status during the transition period can

negatively affect fertility. Diets differing in type of fatty acids such as n-3 or n-6 PUFAs

have been shown to be important modulators of immune function (Calder et al., 2002).

In mice fed an enriched n-3 PUFA diet, inflammatory reactions were reduced, and different types of antibody response to antigenic stimulation were developed compared with mice fed an n-6 enriched diet (Albers et al., 2002). Lessard et al. (2003) fed diets of calcium salts of palm oil, flaxseed, or soybeans to cows from 6 wks prepartum to 6 wks postpartum. The lymphocyte response of blood mononuclear cells to mitogenic stimulation was lower in cows fed soybeans than in those receiving flaxseed or calcium salts of palm oil. Thus a diet high in linoleic acid (soybeans) may improve immune function.

A possible explanation of the mechanism behind modulation of immune function due to different fats may be related to eicosanoid synthesis such as prostaglandins (PG) and leukotrienes. Omega-6 fatty acids such as linoleic acid (C18:2) and omega-3 fatty acids such as α-linolenic (C18:3) leads to the formation of arachidonic acid (AA) and

EPA, respectively. Both AA and EPA are precursors of eicosanoids, but those that are synthesized from EPA, such as PGE3 and leukotriene B5, do not have a strong biological

activity as do those produced from AA, such as PGF2α, PGE2 and leukotriene B5 (Yaqoob

and Calder, 1995). As a result, feeding plant or fish oil rich in omega-3 PUFAs generally reduces inflammatory reactions and as well as production of interleukin-1, -6, and tumor necrosis factor-α in different animal species, including human (Yaqoob and Calder,

1995)..

Fertility

Many studies report an improvement in reproductive performance of cows fed supplemental fat. Staples et al. (1998) reported an improvement in fertility in 11 of 20 reviewed articles and it appeared that it was due to supplementation of a fat source and

not solely due to an improvement in energy status. The average increase in rate of

conception or pregnancy of the studies reporting a positive response was 17 percentage

units. In addition, Scott et al. (1995) conducted a large study in five herds and reported a greater proportion of cows fed calcium salts of LCFA expressed stronger signs of estrus, more active ovaries, and required less exogenous PGF2α to induce estrus. First service

conception rate was improved when 253 cows over four herds were fed 2% ruminally

inert fat from 0 to 150 DIM (43 vs. 59%; Ferguson et al., 1990). When lactating dairy

cows were fed either tallow or no tallow as a fat supplement, cows fed tallow tended to

have a better conception rate (62 vs. 44%) by 98 days in milk (DIM; Son et al., 1996).

Petit et al. (2001) fed formaldehyde-treated flaxseed from 9 to 19 weeks of lactation to dairy cows which experienced a greater first service conception rate than those fed calcium salts of palm oil (87 vs. 50%). Feeding a calcium salt of palm and soybean oil

(i.e., 26% linoleic acid and 4% linolenic acid) increased first service pregnancy rate of lactating dairy cows compared to an unsupplemented control (27 vs. 58%; Cullens et al.,

2004). In a study using a calcium salt blend of primarily C18:2 and C18:1 trans versus a

calcium salt blend of primarily palm oil (C16:0 and C18:1), the lactating dairy cows

receiving the calcium salt blend of C18:2 and C18:1 had an improved first service

conception rate (25.6 vs. 33.5%; Juchem et al., 2004). The latter study indicates that the

type of fatty acid can have differential effects on fertility. In Staples et al. (1998) review

of the literature there was an improvement in pregnancy rate for four studies that fed fish

meal to dairy cows. However, in some of these studies the inclusion of fish meal

partially replaced soybean meal such that one can not determine whether a beneficial

effect of fish meal is due to reduced degradable protein or increased fatty acids such as

EPA and DHA characteristic of fish. Burke et al. (1996) fed fish meal to lactating dairy

cows while maintaining ruminally undegradable protein constant. Conception rate was improved due to the fish meal suggesting a fish oil beneficial effect on fertility.

Several studies reported a decrease in conception rate of cows fed supplemental fat

(Sklan et al., 1994; Sklan et al., 1991; Erickson et al., 1992). However, in each of these studies the lowered conception rate was accompanied by an increase in milk production.

High milk production has been linked to a decrease in fertility as described previously.

Number of days open was unaffected by fat supplementation with one positive exception

(Sklan et al., 1991), and number of AI per conception was decreased in three studies

(Armstrong et al., 1990; Ferguson et al., 1990; Sklan et al., 1991) in which fat was supplemented.

Follicles and Estradiol

Many studies reported that number and growth dynamics of ovarian follicles are altered due to lipid supplementation. Many of the lipid effects on the follicle are due to the supplemental lipid source and not just energy. Lucy et al. (1991a) replaced corn with

Ca-LCFA in a diet containing whole cottonseeds that was fed to lactating dairy cows beginning at parturition. The number of small (2 to 5 mm) follicles decreased and number of medium (6 to 9 mm) follicles increased within 25 DIM in cows fed the Ca-

LCFA. Just after the 25 DIM and during a synchronized estrous cycle, number of small

(2 to 5 mm) follicles and large (> 15 mm) follicles increased in cows fed Ca-LCFA. In addition, the diameters of the largest (18.2 vs. 12.4 mm) and second largest (10.9 vs. 7.4 mm) follicles were greater in cows fed Ca-LCFA. However, in this study, the two diets were not of equal energy density and the responses may have been due to either the supplemental fat source or the increased energy. When this study was repeated, lactating

Holstein cows fed the Ca-LCFA diet had a larger second wave dominant follicle versus

cows fed a diet of similar energy density without Ca-LCFA (16.1 vs. 18.7 mm; Lucy et

al., 1993b).

Dominant follicle size was increased in cows fed diets enriched in PUFAs

compared with cows fed a diet enriched in MUFAs, indicating that it was PUFAs that

were most effective (Staples et al., 2000). In addition, Beam and Butler, (1997) reported

that supplemental fat increased the diameter of the largest follicle of the first wave

follicle from d 8 to 14 of the estrous cycle. Oldick et al. (1997) infused water, glucose,

tallow or yellow grease into the abomasums of lactating dairy cows. The first wave

dominant follicle grew faster to a larger size in cows infused with yellow grease versus

tallow. It appears that diets enriched in different fatty acids can have differential effects on follicle development.

The increased follicle size may be due to fats affecting plasma LH secretion to stimulate follicular growth. However, plasma LH during the luteal phase of the estrous cycle was unaffected by a diet containing Ca-LCFA but was increased during the follicular phase in primiparous cows (Sklan et al., 1994). Lucy et al. (1991a) reported that the LH profile was unaffected in dairy cows fed Ca-LCFA in the early postpartum period. However, as LH pulse amplitude increased, the diameter of the largest follicle increased, and energy status was less negative. Lipid supplementation is used to increase the amount of energy consumed to improve the energy status of the cow. Cows in negative energy status have a prolonged postpartum anestrous (Roche and Diskin, 2000) and the frequency of LH pulses are reduced which may limit both follicle growth to the

preovulatory stage and ovulation (Schillo, 1992). Lipid supplementation may aid in

increasing energy status and improve LH pulse frequency.

Estradiol has stimulatory effects on uterine secretion of the luteolytic hormone,

PGF2α (Knickerbocker et al., 1986). In addition, estradiol can increase the sensitivity of

the CL to PGF2α,(Howard et al., 1990) which can cause a more complete regression of the

CL. Thus lowered plasma estradiol may prevent premature CL regression and prevent

early embryonic mortality. Oldick et al. (1997) infused into the abomasum of lactating

dairy cows either water, glucose, tallow or yellow grease and reported that tallow and

yellow grease had lower concentrations of plasma estradiol (2.42 vs. 3.81 pg/mL) on d 15

to 20 of a synchronized estrous cycle compared to cows infused with glucose. When

supplemental lipids were fed to beef cows during the early postpartum period, serum

concentrations of estradiol were lower compared to unsupplemented cows (1.41 vs. 1.61

ng/mL; Hightshoe et al., 1991). Also, concentration of estradiol was lower in the

follicular fluid from beef cows fed soybean oil (Ryan et al., 1992). Other studies have

reported no effect of supplemental fats on estradiol concentrations during either the

follicular or luteal phase of lactating dairy cows (Lucy et al., 1991a; Lucy et al., 1993b;

Sklan et al., 1994).

Corpus Luteum and Progesterone

Since follicle size is increased due to lipid supplementation, the subsequent CL

from the larger follicle may also be larger. Larger ovulating dominant follicles in heifers,

nonlactating, and lactating dairy cows resulted in larger corpora lutea (Sartori et al.,

2002a; Moreira et al., 2000a) which was associated with greater circulating

concentrations of plasma progesterone. When lactating dairy cows were fed either 0 or

2.2% Ca-LCFA starting at parturition and examined weekly by rectal palpation for the

37 first 60 DIM, the number of CL (0.85 vs. 1.05) and the size of the largest CL (12.2 vs.

17.2 mm) tended to be greater in cows fed Ca-LCFA (Garcia-Bojalil et al., 1998). Larger

CL were detected in lactating dairy cows fed high levels of omega-3 fatty acids through the diet as formaldehyde-treated linseed or as a mixture of formaldehyde–treated linseed and fish oil (Petit et al., 2002).

A larger CL may not only be due to ovulation of a larger follicle but also through direct developmental and steroidogenic effects on the CL. Electron microscopic examination of CL tissue revealed that lipid content was greater in luteal cells from beef heifers fed Ca-LCFA compared with unsupplemented controls (Hawkins et al., 1995).

Increased concentrations of progesterone were associated with improved conception rates of lactating dairy cows (Butler et al., 1996). Previous studies have reported an increase (Staples et al., 1998), no effect (Mattos et al., 2002), or a decrease

(Robinson et al., 2002) in plasma progesterone in dairy cows supplemented with LCFA.

Moallem et al. (1999) fed Ca salts of palm oil from 0 to 150 DIM to lactating dairy cows and reported an increase not only in progesterone concentration in follicular fluid (55.4 vs. 33.0 ng/mL) but also in progesterone content of fluid from estradiol-active follicles

(173.9 vs. 68.3 ng). Concentration of progesterone in follicular fluid also was greater for beef cows fed soybean oil compared to control cows (Ryan et al., 1992).

With a larger CL due to supplemental fat, progesterone concentration in the blood may be increased; however, this may not be the only reason. Cholesterol is a precursor for the synthesis of progesterone, and feeding supplemental fat increases plasma concentrations of cholesterol probably because cholesterol is needed for supplemental fat absorption (Grummer and Carroll, 1991).

Also, progesterone concentrations may be increased if the clearance rate of progesterone from the blood is reduced in cows fed supplemental lipids. Hawkins et al.

(1995) fed beef heifers either 0 or 0.57 kg/d of Ca salts of palm oil from 100 d prepartum through the third estrous cycle postpartum. Average concentrations of plasma progesterone and cholesterol were elevated in heifers fed fat. Heifers were ovariectomized on d 12 to 13 of the third estrous cycle, and blood samples were taken repeatedly thereafter. Increased plasma concentrations of progesterone from repeated samples taken just before and after ovariectomy in the fat-fed group indicated a greater half-life of progesterone. This supported the concept that feeding supplemental lipids caused a slower clearance rate of progesterone from plasma. When liver slices in media were incubated with progesterone, estradiol, and fatty acids such as C18:2, the half-life of progesterone and estradiol increased in the C18:2 treatment compared with media containing no fatty acids (Sangritavong et al., 2002).

Oocyte and Early Embryo

Acquisition of oocyte developmental competence occurs as a continuum throughout folliculogenesis. This acquisition can be divided into three separate stages defined by particular physiological events. The first stage is oocyte growth, which takes place mainly during the beginning of follicle growth. Second stage is oocyte capacitation

(preparation of the oocyte for supporting early embryo development by acquiring important factors such as mRNAs, proteins, mitochondria, etc.), starting at the end of oocyte growth in antral follicles. Lastly is oocyte maturation which starts after the LH surge in preovulatory follicles or after removal of the oocyte from the follicular environment which inhibits meiotic resumption (Mermillod et al., 1999). The preovulatory LH surge or removal of the oocyte from its follicular inhibitory environment

triggers resumption of meiosis for maturation to metaphase II and is termed nuclear

maturation. During the entire life of the oocyte and for a distinct period after the LH surge, the oocyte is going through cytoplasmic maturation. Cytoplasmic maturation is the accumulation of mRNA, proteins, mitochondria, and many other important cellular nutrients which are critical for subsequent fertilization and embryo development. Homa and Brown, (1992) cultured bovine oocytes, from slaughterhouse ovaries, with linoleic

acid and noticed a significant reduction in spontaneous germinal vesicle breakdown

compared with oocytes cultured without fatty acids. This illustrates that fatty acids can

affect nuclear maturation and could possibly affect cytoplasmic maturation with profound

effects on subsequent embryo development.

When bovine follicles are dissected and classified according to size, the oocytes

harvested from larger follicles undergo better development than those from smaller

follicles (Pavlok et al., 1992; Lonergan et al., 1994). Follicle size is stimulated due to

supplemental fat feeding which may increase oocyte competence leading to an increase in

fertility as previously discussed. Nutritional induced changes in endocrine and metabolic

signals that regulate follicular growth also can influence oocyte maturation (Armstrong et

al., 2001; Boland et al., 2001).

Competence of the oocyte and embryo is also related to fatty acid composition;

specifically, phospholipid content of the cellular membrane plays a vital role in development during and after fertilization. The amount of lipid in the ruminant oocyte is approximately 20-fold greater than that of the mouse (76 vs. 4 ng) and consists (w/w) of approximately 50% triglyceride, 20% phospholipid, 20% cholesterol and 10% free fatty acids (McEvoy et al., 2000). Previous studies showed that C16:0 and C18:1 acids were

40 the most abundant fatty acids in the phospholipid fraction of oocytes from cattle and may function as an energy reserve (Kim et al., 2001; Zeron et al., 2001). Polyunsaturated fatty acids comprise <20% of total fatty acids with linoleic (C18:2n-6) being the most abundant.

Temperature modulates the physical properties of the lipids in cell membranes and changes lipid composition of the membrane (Quinn, 1985). Zeron et al. (2001) reported that oocyte membrane fluidity is affected by temperature alterations between seasons, as well as by changes in fatty acid composition. Furthermore, a relationship was documented between decreased PUFA content, a change in biophysical behavior of oocytes, and low fertility of dairy cows during summer. Zeron et al. (2001) documented that MUFA and PUFA contents are lower in oocytes and granulosa cells in the summer compared to the winter season in dairy cattle. The number of high quality oocytes was higher in ewes fed PUFAs than in control ewes (74.3 and 57.0%, respectively), and

PUFA supplementation increased the proportion of LCFA in the plasma and cumulus cells (Zeron et al., 2002). However, these changes in fatty acid composition were relatively small in oocytes indicating that uptake of PUFAs to the oocyte is either selective or highly regulated.

Few studies have investigated the effects of fat supplementation on oocyte and embryo quality in lactating dairy cattle. In a study by Fouladi-Nashta et al. (2004), lactating dairy cows were fed either 200 or 800 g/d of Ca salts of palm and soybean oil, and follicles were transvaginally aspirated 3 to 4 d apart. A total of 1157 oocytes were collected from 20 cows, and oocytes were matured, fertilized and cultured in vitro. A greater percentage of oocytes developed into blastocysts from cows fed the higher fat

diet. In another study, conception rate to first service was increased when lactating dairy cows were fed a mixture of calcium salts of linoleic and trans fatty acids compared to palm oil (33.5 vs. 25.6%; Juchem et al., 2004). In a sub-sample of the cows, fertilization rate (87 vs. 73%), number of total cells, percentage of live cells, and percentage of embryos graded 1 and 2 (73 vs. 51%) were greater for calcium salt blend of primarily

C18:2 and C18:1 trans versus a calcium salt blend of primarily palm oil (C16:0 and

C18:1; Cerri et al., 2004). Also, the number of accessory sperm cells attached to the zona pellucida was greater. However, whether the beneficial effects are due to an enrichment of linoleic and (or) 18:1 trans fatty acids cannot be determined.

Conceptus and Maternal Unit

Although, to date, no studies have investigated the effects of supplemental fats on conceptus development in lactating dairy cows, several studies have investigated the effects of supplemental fats on the “cross-talk” between the conceptus and maternal unit.

The maternal unit constitutes all tissues in the female reproductive tract that directly or indirectly interacts with gametes or conceptus. Appropriate exchange (cross-talk) of hormonal signals between both units is required for successful establishment and completion of pregnancy. Discord between the conceptus and maternal unit can cause early embryonic loss and the start of a new estrous cycle.

cyclic to a pregnant state not only depends on the production of antiluteolytic signals

from the developing conceptus but also the capacity of the endometrium to respond to

these signals, thus blocking pulsatile PGF2α production (Binelli et al., 2001b). Such communications between the conceptus and maternal units are not always successful, thus leading to early embryonic loss.

(PR) in the uterus (Spencer and Bazer, 1995; Wathes and Lamming, 1995; Robinson et al. 2001). Loss of PR in the uterus activates oxytocin receptor (OTR) expression and subsequent luteolysis (Wathes and Lamming, 1995). Conversely, estradiol receptor α

(ERα) concentrations are upregulated during luteolysis in sheep. Although the role of PR and ERα in regulating the OTR regulation is not clearly elucidated, the OTR certainly is suppressed by IFN-τ secreted from the conceptus (Flint et al., 1992; Wathes and

Lamming, 1995; Mann et al., 1999).

In the uterine luminal epithelium, AA is released from phospholipids by hydrolysis and acted upon by prostaglandin H synthase (PGHS-2) to form PGH2, which is converted

to either PGF2α and (or) PGE2 through the two reductases, prostaglandin F synthase

(PGFS) and prostaglandin E synthase (PGES), respectively. It is unknown whether

relative endometrial expression of the 2 synthetic enzymes, PGFS and PGES, changes

during the period of CL maintenance in pregnant lactating dairy cattle.

Previous studies reported that feeding fats, in particular PUFAs, can attenuate

endometrial PGF2α production. In a study by Burke et al. (1996), a higher proportion of

lactating dairy cows fed fish meal had higher plasma progesterone concentrations 2 d

after PGF2α injection indicating attenuation in efficiency of CL regression due to fish oils.

In this study pregnancy rates were increased from 32 to 41%. In a study by Mattos et al.

(2002), cyclic lactating dairy cows fed fish meal, containing EPA and DHA, had reduced plasma 13, 14-dihydro-15-keto-PGF2α metabolite (PGFM) concentrations compared to

unsupplemented controls when challenged with estradiol and oxytocin injections. Dairy cows fed diets containing fish oil during the transition period had greater EPA and DHA concentrations in caruncular tissues collected within 12 h after parturition as compared to control cows fed olive oil (Mattos et al., 2004). Furthermore, the lactating dairy cows fed fish oil had reduced plasma concentrations of PGFM just after parturition.

A series of in vitro studies were performed to evaluate the effects of particular

MUFAs and PUFAs on PGF2α secretion (Mattos et al., 2003). An immortalized bovine endometrial (BEND) cell line was used to test the effects of no fatty acid (control) or

C18:1, C18:2, C18:3, C20:4, C20:5, and C22:6 fatty acids (i.e., 100 µM) on PGF2α secretion. Only C20:4, precursor for PGF2α, stimulated PGF2α production compared to control cells. The C18:3, C20:5, and C20:6 fatty acids were the only fatty acids to suppress synthesis of PGF2α with C20:5 (EPA) and C20:6 (DHA) being the most

suppressive. Also C18:2, which is also a precursor for PGF2α, did not increase PGF2α and

it was hypothesized that perhaps the bend cells were not capable of efficiently converting

linoleic acid (C18:2) to AA (C20:4). Robinson et al. (2002) fed soybeans (high in C18:2)

that were partially protected from biohydrogenation, to lactating dairy cows. The PGFM

plasma concentration was increased, after oxytocin challenge, compared to cows fed

other fat sources. Another study fed whole sunflower seeds, also high in C18:2, to

lactating dairy cows and reported an increase in plasma concentrations of PGFM after an

oxytocin challenge compared to cows fed other fat sources (Petit et al., 2004). Thus

supplemental lipids can either inhibit or stimulate PG secretion depending upon the

specific fatty acids.

The mechanism by which PUFAs inhibit PGF2α secretion may involve decreasing

the availability of AA precursor, increasing the concentration of fatty acids that compete

with AA for processing by PGHS-2, or inhibition of PGHS-2. Reduced availability of

AA in the uterine phospholipid pool for conversion to PGs of the 2 series can occur through a reduction in the synthesis of AA or through displacement of existent AA from the phospholipids pool by other fatty acids (Mattos et al., 2000).

Collectively these studies show that different fatty acids can either increase or decrease PGF2α secretion. Decreasing PGF2α pulsatile secretion through fatty acid

feeding coupled with a conceptus producing IFN-τ may allow a more effective

antiluteolytic signal so that more cows to establish and maintain pregnancy.

Peroxisome Proliferator-Activated Receptors

The PPARs are a family of nuclear receptors activated by selected LCFA,

eicosanoids and peroxisome proliferators. Three PPAR isoforms, encoded by separate

genes, have been identified thus far: PPARγ, PPARα, and PPARδ which upon ligand

binding, heterodimerize with the retinoid receptor and interact with specific PPAR

response elements in the promoter region of target genes to affect transcription.

Regulation of promoter function is complex, since there is tissue specific expression of the PPAR and retinoid receptor subtypes, competition for the retinoid receptor binding

partner, and differences in binding affinity among the PPAR subtypes and among the

retinoid receptor subtypes (Desvergne and Wahli, 1999). PPAR activation may be ligand

dependent or independent, and there is also cross-talk with other nuclear receptors and

45 their response elements, as well as several transcription factors (Desvergne and Wahli,

1999; Nunez et al., 1997). The PPARs are best known for their roles in lipid metabolism, but they are also involved in development, epidermal maturation, reproduction in several animal models, and functions of nerve, lung, kidney and cardiac tissues (Desvergne and

Wahli, 1999; Berger and Moller, 2002).

The PPARγ is expressed in a broad range of tissues including heart, skeletal muscle, colon, small and large intestines, kidney, pancreas, adipose, and spleen. The

PPARγ is required in adipocyte differentiation, and regulate genes that control cellular energy homeostasis and insulin action (Berger and Moller, 2002).

In rodents and humans, PPARα is expressed in numerous metabolically active tissues including liver, kidney, heart, skeletal muscle, ovary and brown fat (Nunez et al.,

1997; Braissant et al., 1996; Auboeuf et al., 1997). It is also present in monocytic

(Chinetti et al., 1998), vascular endothelial (Inoue et al., 1998), uterine epithelial (Nunez et al., 1997) and vascular smooth muscle cells (Staels et al., 1998). The PPARα has been shown to play a critical role in the regulation of cellular uptake, activation, and β- oxidation of fatty acids (Berger and Moller, 2002). Long-chain UFA such as linoleic, arachidonic, EPA, and linolenic acids, as well as the branched chain fatty acid phytanic acid bind to PPARα with reasonable affinity (Willson et al., 2000). In contrast to

PPARα, PPARγ has a preference for PUFAs over MUFA or UFA (Khan and Heuvel,

2003).

The PPARδ is expressed in a wide range of tissues and cells, with relatively higher levels of expression noted in brain, adipose, and skin (Braissant et al., 1996; Amri et al.,

1995). Importantly, in the endometrium PPARδ is vital for normal fertility serving as a

regulator of PG production and is required for implantation in rodent models (Lim et al.,

1997; Lim et al., 1999). MacLaren et al. (2005) reported similar expression of PPARα and PPARδ mRNA levels in BEND cells and endometrium from cyclic and pregnant

Holstein cows (MacLaren et al., 2003, 2005). The PPARδ/α agonist cPGI had a dramatic stimulatory effect on PGHS-2 mRNA levels and synthesis of PGF2α and PGE2, which appeared to be mediated at least in part through PPARδ (MacLaren et al., 2005). They

hypothesized that PPARδ is involved in the pregnancy recognition process of cattle and

that it mediates at least some of the beneficial effects of long chain omega-3 PUFA

supplementation on fertility. Also Balaguer et al. (2005) reported an inverse relationship

between endometrial PPARδ mRNA concentration and that of ERα and PGHS-2 within the first week of the estrous cycle in lactating Holstein dairy cattle.

The inverse relationship between these genes spawned further speculation that

PPARs, PPARδ in particular, are mediators of uterine PGF2α biosynthesis in dairy cattle.

In addition, PPARs appear to be one possible route in which PUFAs can have beneficial

effects in humans through regulation of atherosclerotic plaque formation and stability,

vascular tone, angiogenesis, anti-inflammation, cellular differentitiation, and anti-

carcinogenic (Berger and Moller, 2002). Feeding fatty acids that influence PPARs may

regulate PGF2α synthesis and possibly implantation owing to the beneficial effects of

certain fat supplements on dairy cattle fertility.

Bovine Somatotropin and the Insulin-Like Growth Factor System

Bovine Somatotropin

Structure, synthesis, and secretion

In the bovine literature, GH and bST are used interchangeably. For clarity purposes in this dissertation, GH will be used to illustrate naturally produced GH, and

47 exogenous recombinant GH will be referred to as bST. In cattle, GH is a 191 amino acid single chain polypeptide with a molecular weight of 22 kDa (Secchi and Borromeo,

1997). Four cysteines form two disulfide bridges within the GH molecule (Secchi and

Borromeo, 1997). The molecular structure of GH contains four alpha helixes arranged in an up-up-down-down configuration (Secchi and Borromeo, 1997). Prolactin and placental lactogen are structurally related to GH because each hormone contains a similar helix bundle (van der Walt, 1994). The GH, prolactin, and placental lactogen are members of a larger family of hormones called the hematopoietic cytokines. Other members of this family include erythropoietin, the interleukins and other growth factor receptors (Horseman and Yu-lee, 1994).

In humans, two forms of the GH gene are produced by alternative splicing such that there are two forms of GH found in the peripheral system (Baumann, 1991). The most common form has a molecular weight of 22 kDa (Lewis, 1992). This form of GH makes up 70 to 75% of the total GH in circulation. The other less common form makes up 5 to

10% of the circulating GH and has a lower molecular weight of 20 kDa (Tuggle and

Trenkle, 1996) because it lacks 15 amino acids (Baumann, 1991). This less abundant form was not found in other mammals such as cattle (van der Walt, 1994). The remaining circulating forms of GH are derivatives of the 22-kDa isoform (Tuggle and

Trenkle, 1996).

The GH gene is located on the long arm of chromosome 17 (Baumann, 1991). The

GH gene is approximately 2.6 to 3.0 kb in length with five exons and four introns

(Tuggle and Trenkle, 1996). Compared to other species, the amino acid sequence of bovine GH is 66.5 to 99% homologous (Secchi and Borromeo, 1997).

Growth hormone is produced and secreted from cells in the anterior pituitary called

somatotrophs (van der Walt, 1994). Somatotrophs comprise 40 to 50% of the total

number of cells in the anterior pituitary. Two hypothalamic peptides control GH secretion: growth hormone-releasing hormone (GHRH) and somatostatin (Cuttler, 1996).

The GHRH can stimulate secretion and synthesis of GH by the somatotrophs.

Adenylate cyclase is activated by a stimulatory G-protein when GHRH binds to GHRH receptors on somatotrophs. Adenylate cyclase causes an increase in cyclic adenosine monophosphate (cAMP) which ultimately increases intracellular calcium concentrations.

Increases in calcium concentrations stimulate GH secretion (Mayo et al., 1995; Cuttler,

1996). The increase in cAMP also activates kinases that phosphorylate proteins that activate GH synthesis.

The somatostatin inhibits GH secretion, but does not affect GH synthesis. Both the short and long forms of somatostatin have the same affect on GH secretion. However, the shorter form is the most abundant in the circulation. After somatostatin is secreted from the hypothalamus, it binds to somatostatin receptors on somatotrophs. Activation of the somatostatin receptor complex stimulates an inhibitory G-protein that suppresses cAMP production which blocks calcium release and prevents GH secretion (Cuttler, 1996).

However, somatostatin and GHRH collate their effects to replenish GH pools within somatotrophs before GH release (Gillies, 1997).

Regulation of GH secretion can also occur due to hormones from the gastric lining.

Small synthetic molecules called growth hormone secretagogues stimulate the release of growth hormone from the pituitary. They act through the GH secretagogue receptor, a G protein-coupled receptor whose ligand has only been discovered recently (Kojima and

Kangawa, 2005). Using a reverse pharmacology paradigm with a stable cell line

expressing GH secretagogue receptor, the endogenous ligand for GH secretagogue

receptor was purified from rat stomach and named "ghrelin" (Kojima et al., 1999).

Ghrelin is a peptide hormone in which the third amino acid, usually a serine but in some

species a threonine, is modified by a fatty acid; this modification is essential for ghrelin's activity. The discovery of ghrelin indicates that the release of GH from the pituitary might be regulated not only by hypothalamic GHRH, but also by ghrelin derived from the stomach. In addition, ghrelin stimulates appetite by acting on the hypothalamic arcuate nucleus, a region known to control food intake (Korbonits et al., 2004). Ghrelin is orexigenic; it is secreted from the stomach and circulates in the bloodstream under fasting conditions, indicating that it transmits a hunger signal from the periphery to the central nervous system (Kamegai et al., 2001). Taking into account all these activities, ghrelin plays important roles for maintaining GH release and energy homeostasis in animals.

Age, body composition, steroids, sleep, nutrition, stress, exercise, and gender are involved in the regulation of GH secretion. Calves also have greater GH concentrations compared to 3 to 6 month old cattle (Reynaert et al., 1976). Adiposity is negatively correlated with GH concentrations. Concentrations of GH in cattle were greater during negative energy balance compared to the period of positive energy balance (Gluckman et al., 1987; Vandehaar et al., 1995). Elevated GH is required for normal accelerated growth when cattle are maturing. Growth hormone secretion is greater during deep sleep

in humans (Cuttler, 1996), but not in cattle (Gluckman et al., 1987). Protein rich diets

can stimulate GH secretion, whereas free fatty acids reduce GH secretion (Cuttler, 1996).

In cattle, infusing glucose resulted in elevated GH concentrations (McAtee and Trenkle,

1971). Stress in cattle decreased GH possibly by increasing circulating free fatty acids

(Reynaert et al., 1976). Lastly, bulls have more pulses of GH secretion whereas cows have fewer pulses with higher magnitude (Reynaert et al., 1976).

Receptor and ligand binding

The greatest numbers of GHR are found in the liver (Hauser et al., 1990).

However, many reproductive tissues have GHR mRNA. For example, hypothalamus, pituitary, CL, ovarian follicle, oviduct, endometrium, myometrium, and placenta have

GHR mRNA (Heap et al., 1996; Kirby et al., 1996; Lucy et al., 1998b). In addition

Izadyar et al. (1997 and 2000) was able to detect GHR mRNA in bovine granulosa cells, cumulus cells, oocyte and embryos at all stages of development up to d 9 post fertilization.

The bovine GHR has 242 amino acids in the extracellular binding domain, 24 amino acids in the single transmembrane domain and 350 amino acids in the intracellular domain. The extracellular domain of the GHR has seven N-linked glycosylation sites and seven cysteine residues. All seven extracellular cysteines and four of the seven glycosylation sites are conserved between species. An additional seven cysteines are found in the intracellular region (Hauser et al., 1990). In all mammalian species examined, except for humans, there is a conserved amino acid sequence proximal to the membrane in the extracellular portion of cytokine/hematopoietin receptors. The six amino acid sequence consists of tryptophan, serine, no specific amino acid, tryptophan and serine (WSXWS motif). Both motifs seem to be important for GH binding. Another important feature of the GHR is the intracellular Box 1 and Box 2 regions. Box 1 is more proximal to the cell membrane compared to Box 2. These amino acid sequences are

important for signal transduction (Postel-Vinay and Finidori, 1995; Carter-Su et al.,

1996).

The GH molecule contains two binding sites for the GHR. Site 1 has greater

receptor affinity than site 2 and binds to the receptor first. After binding of site 1, a

second GHR binds to site 2 and forms a complex (one ligand and dimerized receptor).

Receptor dimerization is important for GH signal transduction. High circulating GH

concentrations diminish receptor dimerization because site 1 binds both undimerized

GHR not allowing site 2 binding and inhibiting dimerization (Waters et al., 1994).

Alanine mutations in the GH molecule can decrease GH binding by 400% without

affecting the tertiary structure of the molecule (Cunningham and Wells, 1989).

Second messengers

Several proposed second messenger systems have been reported for GH. One common protein to all GH second messenger pathways is Janus Kinase 2 (JAK2). The

JAK2 protein is one of four members in the Janus tyrosine kinase family (Carter-Su et al.,

1996). After GH binding and receptor dimerization, JAK2 is activated and binds intracellular portions of each GHR. The JAK2 binding initiates GH signal transduction.

The JAKs transphosphorylate each other at tyrosine residues and then phosphorylate

tyrosine residues located on the GHR. Phosphorylation of GHR creates docking sites for

the Src homology 2 domain of downstream signal transducers and activators of

transcription (STAT) molecules. Tyrosine phosphorylation of STAT molecules occurs

after STAT binding to the GHR. The STAT molecules then either hetero- or

homodimerize and translocate to the nucleus to effect gene transcription. Although there are seven STAT molecules (Darnell Jr, 1997), only STATs 1, 3 and 5 are involved in GH signal transduction (Carter-Su et al., 1996 and 1997).

The second proposed GHR second messenger system involves a more complex

group of intracellular events. Similar to the system above, JAK2 binds and

phosphorylates the GHR. Then a SH2 domain protein called SHC binds to the GHR and

is activated by JAK2 phosphorylation. Once SHC is stimulated, a cascade of

downstream events occurs that activates proteins such as Grb2, SOS, Ras, Raf, MEK and

MAPK. The phosphorylated MAPK enters the nucleus targeting genes that may control growth and metabolism (Carter-Su et al., 1996 and 1997).

A third GHR second messenger pathway was proposed by Carter-Su et al. (1996 and 1997). This mechanism involved the activation of insulin receptor substrate-1 (IRS-

1). The IRS-1 is a component of insulin and IGF-I second messenger systems. Activated

IRS-1 stimulates phosphatidylinositol 3’ (PI-3) kinase. The downstream events that occur following PI-3 kinase activation are still unclear (Carter-Su et al., 1997).

Activation of IRS-1 or SHC by GH occurs in vitro and not in vivo. Only the JAK-STAT pathway has been shown to be stimulated in both in vitro and in vivo GH experiments

(Chow et al., 1996).

Growth and metabolism are regulated by GH. Binding of GH to the GHR affects

the transcription of various genes associated with normal growth (Norstedt et al., 1990).

Some of the known genes induced by GH are IGF-I, c-fos, c-jun, JunB, serine protease

inhibitor 2.1 and 2.2 (Rotwein et al., 1994).

Insulin-like Growth Factor System

Structure, synthesis, and secretion

The IGF-I and IGF-II are growth promoting peptides and members of a

superfamily of related insulin-like hormones in mammals (Rinderknecht and Humbel,

1978; Humbel, 1990). The IGF-I and II are related closely to insulin in terms of primary

53 sequence and biological activity. The IGFs are major growth factors whereas insulin predominately regulates glucose uptake and cellular metabolism. The IGF-I is a 7.6 kDa protein made up of 70 amino acids; however, IGF-II is slightly smaller consisting of 67 amino acids and a molecular mass of 7.5 kDa (Rinderknecht and Humbel, 1978; Rutanen and Pekonen, 1990; Humbel, 1990). The IGFs consist of A, B, C, and D domains. Large portions of the sequences within the A and B domains are homologous to α and β chains of proinsulin. The sequence homology is 43% for IGF-I and 41% for IGF-II. In addition, IGF-I is 65% homologous to IGF-II (Rutanen and Pekonen, 1990). All three hormones (i.e., insulin, IGF-I, and IGF-II) contain α and β chains, and a connecting peptide region (C). However, amino acid sequences are different among the proteins with no sequence homology between the C domains of IGFs and the C peptide region of proinsulin (Gluckman et al., 1987). The C domain of the IGFs is not removed during prohormone processing. Therefore, the mature IGF peptides are single chain polypeptides (Zapf and Froesch, 1986; Daughaday and Rotwein, 1989). Another region in the IGFs different than proinsulin is a carboxy-terminal extension called the D domain

(Gluckman et al., 1987; Humbel, 1990).

The gene encoding IGF-I is highly conserved such that 57 of 70 residues from the mature protein are identical across species (Zapf and Froesch, 1986). Expression of IGF-

I is affected at many levels including gene transcription, splicing, translation and secretion. Expression of the IGF-I gene is tissue specific and influenced by hormones, nutrition, and developmental factors (Bichell et al., 1992; Gronowski and Rotwein, 1995;

Thissen et al., 1994). Furthermore, the molecular weight of IGF-I is the same for human,

54 bovine, porcine, ovine, rat and mouse (Humbel, 1990). Three disulfide bridges within

IGF-I aid in proper folding and stabilization of the protein structure (Quin, 1992).

The IGF-I found in blood is produced primarily by the liver in response to GH

(Gluckman et al., 1987). However, many other tissues produce IGF-I that exert both paracrine and autocrine effects (D’Ercole et al., 1984). One IGF-I effect is through stimulation of cell growth and proliferation with IGF-I acting in an endocrine, paracrine or autocrine manner (Quin, 1992). The GH exerts a dominant endocrine influence on liver production of IGF-I to increase circulating concentrations of the IGFs (i.e., IGF-I which is 100% GH dependent). Once IGF-I is released from the liver, it is transported through the blood to act on distant tissues (Zulu et al., 2002).

Receptors and ligand binding

The biological functions of IGFs are mediated by a family of transmembrane receptors, which includes the insulin, IGF-I, and IGF-II receptors. Type I IGF receptors have the greatest affinity for IGF-I, hence the name IGF-I receptor. However, IGF-II can bind to type I IGF receptors but with lower affinity (Sun et al., 1991).

The IGF-I receptor is a glycoprotein on the cell surface which binds IGF and activates a highly integrated intracellular signaling system (Sepp-Lorenzino, 1998; Kim et al., 2004). Expression of the IGF-I receptor gene occurs in many tissues such as reproductive tissues, and is expressed constitutively in most cells (Spicer and

Echternkamp, 1995; Eckery et al., 1997). The IGF-I receptor is synthesized on the ribosome as a single polypeptide chain that is post-translationally modified by removal of a 30-amino acid signal peptide, and the proreceptor undergoes cleavage into a 706 amino acid extracellular α-subunit and a 626 amino acid transmembrane β-subunit. The two α and β subunits are linked together by disulfide bonds to form an αβ-half-receptor, which

in turn, is linked subsequently to another αβ-half-receptor (Humbel; 1990). Ligand binding occurs in the cysteine-rich extracellular domain of the α-subunit, while tyrosine

kinase activity resides in the cytoplasmic β-domain (Jones and Clemmons, 1995). In

addition, the intracellular domains of the β-subunits contain ATP binding sites. These

sites bind ATP for the tyrosine kinase reaction that occurs after receptor binding and

activation. Activation of the tyrosine kinase causes autophosphorylation of tyrosine

residues on the IGF-I receptor (Rutanen and Pekonen, 1990; Giudice, 1992).

Although the IGF-I receptor preferentially binds IGF-I, it can also bind IGF-II or

insulin (Quin, 1992). However, type II IGF receptors have the greatest affinity for IGF-II

(Rutanen and Pekonen, 1990; Giudice, 1992). Furthermore the IGF-II receptor has a much lower binding affinity for IGF-I and does not bind insulin (Jones and Clemmons,

1995). The IGF-II receptor is a 250 kDa polypeptide monomer with homology to the

mannose-6-phosphate receptor. The extracellular domain is 90% of the receptor and has

15 conserved repeat sequences (Giudice, 1992). A major difference between the IGF-II

and IGF-I receptors is that IGF-II receptors lack tyrosine kinase activity (Giudice, 1992).

The binding site for IGF-II is distinct from that for mannose-6-phospate, and IGF-II can

bind simultaneously with the mannose-6-phosphate ligands (Braulke et al., 1989).

However, the binding of certain lysosomal enzymes can interfere noncompetitively with

IGF-II binding and vice versa (Kiess et al., 1988). The IGF-II can be cleared from the

blood through binding to mannose-6-phospate receptors, internalization and subsequent degradation, which can be inhibited by lysosomal enzymes (Oka et al., 1985). In addition, it is well accepted that IGF-II receptors are scavenger receptors which mediate the uptake and degradation of IGF-II (Jones and Clemmons, 1995).

Second messengers

Binding of IGF-I to the type I IGF receptor activates autophosphorylation of

tyrosine residues. Therefore, the type I IGF receptor is a tyrosine kinase receptor

(Giudice, 1992). In addition to phosphorylating tyrosine residues, serine residues also are

phosphorylated. Activation of the IGF-I receptor causes phosphorylation of a 185 kDa protein called insulin receptor substrate 1 (IRS-1), which also can be phosphorylated by insulin receptors (Foncea et al., 1997). Phosphorylation of IRS-1 occurs by direct interaction with the IGF-I receptor (Dey et al., 1996). The IRS-1 protein contains 21

tyrosine phosphorylation sites, six of which occur in the YMXM sequence, which is a

recognition motif for binding of proteins containing src homology 2 domains (Myers and

White, 1993; White and Kahn, 1994).

Several second messengers can be activated simultaneously once IRS-1 is phosphorylated. Therefore, IRS-1 is viewed as a docking protein that after phosphorylation by IGF-I or insulin receptors forms a large protein complex that activates multiple signaling cascades (Jones and Clemmons, 1995). Some proteins that are activated by IRS-1 are the p85/p110 complex (PI-3 kinase), Grb2, Syp and Nck. All four activated proteins are part of separate intracellular pathways and each contains src homology 2 domains. Activation of the p85/p110 complex, also known as the PI-3 kinase pathway, is important for cell growth. Another pathway involves activation of

Grb2, which stimulates an exchange protein called Son of Sevenless causing the phosphorylation of a guanine nucleotide activating Ras. Activated Ras stimulates another protein called Raf causing phosphorylation of the MAP kinases which activates cell mitosis and metabolism. The downstream signaling events of the other two IRS-1 activated proteins, Syp and Nck, are unknown (Jones and Clemmons, 1995). Recent

57 studies demonstrated that IRS-1 is not the only second messenger activated by the IGF-I receptor. Another molecule activated by the beta subunits of the IGF-I receptor is the

Shc protein. Activation of Shc stimulates the Grb2/SOS complex and their respective downstream intracellular events (Jones and Clemmons, 1995).

The IGF-II receptor signal transduction is different from insulin or IGF-I signaling since it lacks both serine and tyrosine kinase activities (Okamoto et al., 1990). Binding of IGF-II to the IGF-II receptor can cause internalization and degradation of IGF-II

(Jones and Clemmons, 1995). Previous studies have associated an inhibitory G-protein with IGF-II receptor signaling (Okamoto et al., 1990); however, the complete signal transduction mechanism is unknown.

Binding proteins

A family of six high affinity IGF-binding proteins (IGFBP-1 through IGFBP-6) has been identified. The IGFBPs coordinate and regulate biological activity of IGFs in several ways: 1) transport of IGFs in plasma which controls diffusion and efflux from the vascular space; 2) increase the half-life and regulate clearance of the IGFs; 3) provide specific binding sites for the IGFs in the extracellular and pericellular space; 4) modulate, inhibit or facilitate interaction of IGFs with their receptors (Rajaram et al., 1997).

The IGFBPs are regulated by post-translational modifications such as glycosylation and phosphorylation, and (or) differential localization of the IGFBPs in the pericellular and extracellular space (Rajaram et al., 1997). In addition to stabilizing and regulating levels of diffusible IGFs, it has been proposed that IGFBPs may regulate IGF-I cellular responses by facilitating receptor targeting of IGF-I or modulating IGF-I bioavailability in the pericellular space (Firth and Baxter, 2002).

The effects of IGFBPs can be regulated further by specific IGFBP proteases, which

cleave the IGFBPs into fragments rendering the IGFBPs incapable of binding the IGFs

(Russo et al., 1999). Some IGFBPs such as IGFBP-2 and -3 can induce direct cellular

effects independent of the IGFs (Rajaram et al., 1997). The IGFBP-3, similar to IGFBP-

5, and more recently IGFBP-2 are reported to contain sequences with the potential for

nuclear localization and possibly can regulate gene function (Schedlich et al., 1998). The

complexity of the IGFBP system in biological fluids is shown by the presence of six

IGFBPs, multiple IGFBP proteases, and the intricate regulation of the two.

Understanding the mechanisms by which the IGFs are regulated by IGFBPs and IGFBPs by IGFBP proteases may improve our understanding of the physiological function of

IGFs.

Effects on Lactation

Advances in biotechnology beginning in the early 1980s, such as recombinant

DNA technology, allowed for massive production of recombinant GH (bST). The first study in 1982 demonstrated that bST injected into lactating dairy cows increased milk production (Bauman et al., 1982). In 1994, bST was commercialized for use in lactating dairy cows beginning at approximately 60 DIM. The recombinant bST was coupled with a slow release formulation that allowed for injections of bST (500 mg) to be given biweekly.

Injections of bST in lactating dairy cows increased milk production from 7 to 41% above untreated controls (Burton et al., 1990; Stanisiewski et al., 1992; Downer et al.,

1993). The typical milk yield responses are increases of 10 to 15%; however, the greatest increases occur when management and care of the animals are optimal (Bauman, 1992;

Chilliard, 1989). Variability in milk yield response to bST depends on other factors such

as age, parity (Huber et al., 1988; Downer et al., 1993), energy balance (Peel et al., 1983;

Bauman et al., 1985), nutrition (Elsasser et al., 1989), and milking frequency (Knight,

1992). Injections of bST stimulate the production of IGF-I in the same manner as endogenous GH. Concentrations of IGF-I increase within 48 h of bST treatment (Gong et al., 1993).

The major factor affecting the magnitude of milk response to bST is the quality of

management, in particular, nutrition (Etherton and Bauman, 1998). Lucy et al. (1993a)

reported that cows initially loose energy as milk production increases and reach an

energy balance nadir around the third week of treatment. During this time, nutrients are

repartitioned to support energy and nutrient demands for increased milk production.

Supplying adequate amounts of a properly formulated feed ration that provides enough

energy to support the cow and lactation are critical. An increase in milk production is

followed by an increase in feed intake. By the 10th week of treatment, cows generally

consume adequate energy for a positive energy balance (Bauman et al., 1985).

Injections of bST appear to have little effects on the mammary tissue to increase milk production since very little GHR mRNA has been found in mammary tissue. Binelli et al. (1995) did not show an effect of GH on mammary epithelial cells. Direct arterial

infusion of the mammary gland with bST had no effect on milk yield (McDowell et al.,

1987), whereas direct arterial infusion of IGF-I or IGF-II stimulated milk yield (Prosser

and Davis, 1992; Prosser et al., 1994, 1995).

The increase in blood IGF-I concentrations that occurs in response to bST

treatment is most likely the method for increased milk production by bST. Capuco et al.

(2001) administered bST to lactating dairy cows and reported an increase in the rate of

cell renewal in the mammary gland thereby reducing the rate of mammary regression

during lactation. One important effect mediated by IGF-I is increased cell proliferation

(Rechler and Nissley, 1990), which is seen in cultured mammary cells obtained from both pregnant and lactating cows (Baumrucker and Stemberger, 1989). Thus, increased

concentrations of IGF-I in bST-treated cows during the postpartum period might have

positive effects on cell numbers via either epithelial cell proliferation, differentiation, and

(or) maintenance, allowing for a greater milk yield. In addition, IGF-I has been shown to

be a potent inhibitor of apoptosis in a variety of tissues (Peruzzi et al., 1999), which may

contribute to more mammary cells being maintained for lactation.

Blood IGF-I concentrations increase from early to late lactation (Vega et al., 1991).

Lower blood IGF-I during early lactation is most likely due to energy balance and

uncoupling of the GH receptor in the liver. In dairy heifers and cows, serum IGF-I was

correlated positively with energy balance (Yung et al., 1996; Spicer et al., 1990). In

addition, dairy heifers in a positive energy balance had a greater IGF-I response to bST

treatment compared to heifers in a negative energy balance (Yung et al., 1996). The IGF-

I response to bST is also greater during late lactation when most cows are in a positive

energy balance (Vicini et al., 1991).

A main reason for an increase in milk yield due to bST is through the partitioning

of absorbed nutrients to the mammary gland for an increase in milk synthesis (Etherton

and Bauman, 1998). Many metabolic effects are a direct action of bST involving a

variety of tissues and the metabolism of all nutrient classes: carbohydrates, lipids,

proteins, and minerals.

Lipid metabolism changes drastically after injections of bST. Lactating dairy cows

in a negative energy balance and treated with bST have decreased lipogenesis and

increased lipolysis, whereas when dairy cows are in a positive energy balance and treated

with bST there is a decrease in lipogenesis without a change in lipolysis (Peel and

Bauman, 1987). The reduction in lipogenesis in bST-treated cows can be as high as 97% and increased lipolysis can occur within 2 h of bST treatment (Lanna et al., 1995;

Gluckman et al., 1987). Bell (1995) reported that the changes seen in lipogenesis and

activity of lipogenic enzymes occurs partially through bST increasing insulin. Although

insulin is increased due to bST injections, bST increases the sensitivity of tissues to

insulin (in particular adipose tissue) with no change in maximum response. This leads to

a marked decrease in insulin-regulated events such as glucose transport, lipogenic

enzyme activities, expression of lipogenic enzyme genes, and lipid synthesis (Etherton

and Bauman, 1998). Furthermore, changes in lipolysis and (or) lipogenesis can cause an

increase in nonesterified fatty acid concentrations in dairy cows treated with bST (Binelli et al., 1995).

Other responses to bST include increased hepatic gluconeogenesis, decreased amino acid uptake by the liver, and decreased urea excretion (Etherton and Bauman,

1998). Recombinant bST also increased transport and oxidation of glucose which stimulated lactose synthesis (Peel and Bauman, 1987). Even though nutrient partitioning

to the mammary gland is increased, the gross composition of milk (fat, protein, and

lactose) is not altered by bST treatment (Burton et al., 1994). Therefore the daily production of major milk constituents is increased by an amount comparable to the increase in milk yield.

Peak milk production usually occurs between 28 to 56 DIM in lactating dairy cows;

however, bST is not injected until approximately 60 DIM. The bST appears to increase

milk production after bST injections due to a decrease in the normal rate of decline in

milk production. Milk production response to bST is greater during late compared to

early lactation (McDowell, 1991).

Effects on Reproduction

Earlier studies examining the effects of bST on reproduction found negative effects such that lactating dairy cows treated with bST had decreased conception rates (Downer

et al., 1993), reduced pregnancy rates (Cole et al., 1991; Esteban et al., 1994), increased

incidence of cystic ovaries, increased number of days to first insemination (Esteban et al.,

1994), increased days in anestrus (Waterman et al., 1993; Esteban et al., 1994), and

increased services per conception (Cole et al., 1991). Other studies found no effect of

bST on the number of days not pregnant following parturition (Zhao et al., 1992), length

of the estrous cycle (Gong et al., 1991), or services per conception (Zhao et al., 1992;

Downer et al., 1993; Esteban et al., 1994).

One possible explanation for the decreased reproductive performance is through the

inhibition of behavioral estrus in cows treated with bST. A decrease in estrus detection

was observed in lactating dairy cows treated with bST (Morbeck et al., 1991; Waterman

et al., 1993). In addition, Cole et al. (1992) reported an increase in the interval from first

estrus to first insemination and attributed this effect to a reduced estrus expression.

Furthermore, the reduced estrus expression was associated with an increased negative

energy balance. However, in dairy heifers that were ovariectomized and steroid-primed,

bST treatment reduced estrus expression (Lefebvre and Block, 1992). It was concluded

that bST affected behavioral centers within the brain that control estrus expression.

Kirby et al. (1997b) detected a reduction in estrus expression and an increase in the

percentage of undetected ovulations. Furthermore, neither progesterone nor estradiol concentrations were affected by bST treatment.

With the advent of TAI, the deleterious effects of bST on reproduction can be by- passed. Since bST decreased estrus expression that contributed to an increase in days open, elimination of estrus detection through TAI alleviated this problem. When lactating dairy cows were injected with bST at the initiation of the Ovsynch protocol, pregnancy rates were greater than controls at d 27 and d 45 after AI (Moreira et al.,

2000b). In addition, when cyclic-lactating dairy cows were injected with bST at either the initiation of the Ovsynch program or at the time of AI pregnancy rates were increased

compared to controls (53.2, 44.9, and 38.8%, respectively; Moreira et al., 2001).

Additional studies have documented the beneficial effect of bST on pregnancy rates when injected during the period approaching AI (Santos et al., 2004b) and in sub-fertile cows detected in estrus and injected with bST at insemination (Morales-Roura et al., 2001).

In a review by Lucy et al. (2000), bST was shown to have numerous effects on ovarian function in dairy cattle. The majority of GH receptors within the bovine ovary are localized in the large luteal cells of the CL; however, there are low levels of GHR in the follicles. The increase in peripheral IGF-I released in response to bST injections may be the primary regulator of follicular development in cattle (Lucy et al., 1995; Gong et al., 1997). Heifers treated with increasing doses of bST failed to have greater growth of antral follicles when the bST dose was below the threshold for increased IGF-I (Gong et al., 1997). Also, miniature cattle (i.e., deficient in GH receptors) with high blood GH but low blood IGF-I concentrations had one-third the number of small antral follicles

64 compared with control cattle in the same herd (Chase et al., 1998). The IGF-I may either have synergistic effects with gonadotropin receptors to increase follicle number and size, and (or) decrease atresia of growing follicles leading to a greater number of healthy antral follicles (Lucy et al., 2000).

The number of recruited follicles increased in both cows and heifers that were either injected daily with bST or with the sustained release formulation bST (de La Sota et al., 1993; Gong et al., 1991, 1993, and 1997; Kirby et al., 1997a). In addition, lactating dairy cows injected with bST had a greater number of medium (6 to 9 mm; De La Sota et al., 1993) and large (> 10 mm; Lucy et al., 1995; Kirby et al., 1997b) follicles while small follicle numbers were similar to control. In dairy heifers, the increased number of small follicles in response to bST was correlated with plasma GH and IGF-I (Gong et al., 1991 and 1997). Dominant and second largest follicles are also responsive to bST injections.

The method or amount of bST administration may be important to follicular responses since Jimenez-Krassel et al. (1999) reported increased numbers of dominant follicles and increased ovulation rate in dairy cattle infused for 63 d with pulsatile doses of bST.

Kirby et al. (1997a) found that lactating dairy cows injected with bST had a larger second wave dominant follicle than controls. In the same study, the first wave dominant follicles in bST-treated cows regressed faster than controls which led to an earlier emergence of the second follicular wave (Kirby et al., 1997a, 1997b). Lucy et al. (1994) also reported earlier emergence of the second follicular wave in bST-treated heifers.

An effect of bST on follicular growth also was shown in earlier studies in which bST increased twinning rates (Butterwick et al., 1988; Wilkinson and Tarrant, 1991; Cole et al., 1992). Earlier studies speculated that greater blood IGF-I concentrations in bST-

65 treated cows may be the reason for increased twinning since IGF-I is increased in cows selected for twinning (Echternkamp et al., 1990). However, although follicular recruitment is stimulated by bST, only a single follicle is selected and only a single follicle is ovulated (Kirby et al., 1997a). Thus, the reported increase in twinning rates among bST-treated cows may not be related to an increase in ovulation rate, but to an increased likelihood of embryonic survival in cows with double ovulations (Kirby et al.,

1997a). Also, other studies reported no effect of bST on ovulation rate (Lucy et al.,

1993a), numbers of Class 1 or Class 3 follicles, size of subordinate follicle, size of dominant follicle (Kassa et al., 2002) or twinning rate (Downer et al., 1993). Lucy et al

(2000) stated that failure to observe consistent results of bST on twinning in dairy cattle may reflect an interaction of bST with either genetic or environmental factors.

The large luteal cells of the CL contain the majority of GH receptors. Heifers injected with bST developed larger CL during the early luteal phase (Lucy et al., 1994).

Increased progesterone concentrations were reported in cows treated with bST (Gallo and

Block, 1991; Lucy et al., 1994). A slower decline in progesterone following luteolysis was observed in bST-treated cows perhaps because of an increase in the proportion of large luteal cells (Lucy et al., 1994).

Other studies have shown a decrease in progesterone (Jimenez-Krassel et al., 1999;

Kirby et al., 1997a) or no differences in progesterone after bST treatment in dairy cows

(Gong et al., 1991; De La Sota et al., 1993). Lactating Holstein cows treated with bST had a decrease in the size of the CL and a decrease in progesterone concentrations compared with controls (Jimenez-Krassel et al., 1999). Injections of bST lowered progesterone concentrations (Kirby et al., 1997a) in dairy cows possibly due to decreased

CL function perhaps by reducing the number of LH receptors (Pinto Andrade et al.,

1996), by down-regulating somatotropin receptor mRNA in luteal cells (Kirby et al.,

1996), and (or) by increasing overall metabolism associated with increased DMI and milk production (Etherton and Bauman, 1998) thereby increasing progesterone clearance

(Sangsritavong et al., 2002).

Previous studies have reported beneficial effects of GH and IGF-I on oocyte and

embryonic development both in vitro and in vivo. Izadyar et al. (1997) detected GH

receptors in cumulus cells and demonstrated greater in vitro maturation of bovine oocytes

treated with GH. In addition, Izadyar et al. (2000) also reported an enhanced proportion

of > 8 cell stage embryos on d 3 postfertilization, increased percent of blastocysts

formation and percent of hatched blastocysts on d 9 postfertilization. Recent studies by

Moreira et al. (2002a, 2002b) confirmed these earlier observations with the addition of

GH and IGF-I increasing development to the blastocysts stage and cell number in vitro

and in vivo. In addition, IGF-I has been shown to increase total cell number and reduce

the number of blastomeres that become apoptotic in bovine embryos (Jousan and Hansen,

2004). Another way in which bST may increase blastocyst development may involve

inhibition of apoptosis. These results imply that manipulation of the IGF-I system may

enhance embryonic survival in cows exposed to heat stress or other stresses which induce

apoptosis.

Although bST has direct effects on the oviduct (Pershing et al., 2002), uterus, and

early embryo development (Lucy et al., 1995; Kirby et al., 1996; Moreira et al., 2002a,

2002b), little is known of bST’s effects after d 7 and before d 32 post AI, which appears

to be a critical period for bST to exert direct embryonic or indirect effects via the

maternal unit (i.e., uterus) and (or) circulating hormones such as IGF-I (Moreira et al.,

2001). Another important event within this critical window, on d 16 to 17 after estrus, is

maintenance of the CL.

Treatment with bST both in vivo and in vitro affected the genes regulating

production of PGF2α. Badinga et al. (2002) demonstrated in a bovine endometrial cell

line that both bovine GH and IFN-τ suppressed PGF2α production induced with phorbol

12,13- dibutyrate. When added in combination there was an additive effect in reducing

PGF2α secretion. In addition, when endometrium was collected on d 3 and 7 following a

synchronized ovulation in lactating cows injected with bST, endometrial concentrations

of PGHS-2 protein were decreased compared to untreated controls (Balaguer et al.,

2005). Also, evidence exists for “cross-talk” between hormone signal-transduction

systems such as ERα with IGF-I (Klotz et al., 2002). Effects of bST on fertility may

involve an interaction between bST and IFN-τ signaling pathways to regulate PG

secretion or other components of the PG cascade critical for maintenance of pregnancy.

Kolle et al. (1997) found GHR mRNA in d 13 embryos. Their data suggest that

GH may act along with other growth factors (IGF-I and IGF-II) to increase the development of preimplantation embryos (Kaye, 1997). Furthermore IGF-I receptor is found in all stages of bovine preimplantation embryos (Yaseen et al., 2001). Because supplemental bST increases the rate of embryo development to the blastocyst stage and cell numbers, both in vitro and in vivo, bST may subsequently enhance conceptus development that allows for a greater secretion of IFN-τ at d 17 of pregnancy. An increase of IFN-τ may contribute to an increase in the number of animals establishing pregnancy and a decrease in those experiencing early embryonic loss.

In summary, the previous observations provide definitive evidence that bST increases pregnancy rates when dairy cows are submitted to a TAI synchronization program. Previous studies report beneficial effects on the early embryo through d 7 following TAI, however little is known of bST effects after d 7 through d 17 which is the critical time for CL maintenance. In addition, supplemental FO feeding may modulate endocrine function, PG cascade, and uterine environment during and before this critical time. Among other objectives, this dissertation aims to elucidate the mechanism(s) by which both bST and supplemental FO can increase pregnancy rates with particular focus on d 17 following a synchronized ovulation (Chapters 3-5). In addition, Chapter 6 explores the effects of both bST and FO on fatty acid distributions among various tissues.

The objective of Chapter 7 is to explore effects of diets enriched in different fatty acids on oocyte quality and ovarian function in lactating dairy cows.

Figure 2-1. Pathway of desaturation and elongation of linoleic and linolenic acids sequentially acted upon by ∆-6 desaturase, elongase, and ∆-5 desaturase enzymes.

CHAPTER 3 PREGNANCY AND BOVINE SOMATOTROPIN IN NONLACTATING DAIRY COWS: RESPONSES OF THE OVARIAN, CONCEPTUS AND IGF SYSTEMS

Introduction

Since approval of bST for use in dairy cows to increase milk production, the effects of bST on reproductive function have gained considerable interest. An increase in pregnancy rate was detected when bST was administered in conjunction with a TAI program. When lactating dairy cows were treated with bST at the initiation of the

Ovsynch protocol, pregnancy rates were greater than controls at d 27 and 45 after insemination (Moreira et al., 2000b). In addition, when bST was injected at either the initiation of the Ovsynch program or at the time of insemination, lactating dairy cows had greater pregnancy rates than controls (53.2, 44.9, and 38.8%, respectively; Moreira et al.,

2001). Additional studies documented the beneficial effect of bST on pregnancy rates when given during the period approaching insemination and to cows considered to be sub-fertile (Santos et al., 2004b; Morales-Roura et al., 2001).

In an in vitro study (Moreira et al., 2002b), GH added to the maturation media increased cleavage rates of fertilized ova, but had no significant effect on blastocyst development. Culturing bovine embryos in the presence of GH or rhIGF-I, however, accelerated embryo development by d 8 post-fertilization and increased the number of cells per embryo. Moreira et al. (2002a) reported that bST treatment of superovulated donor cows reduced the number of unfertilized oocytes, increased the number of embryos that developed to the blastocyst stage, and increased the number of transferable embryos.

70 71

Although several studies examined bST effects on pregnancy rates and early embryonic

development, little is known regarding the physiological mechanisms altered by bST that

may increase embryo development up to d 7. Recently, Pershing et al. (2002) examined

the effects of bST, when given at the time of synchronized ovulation of the Ovsynch

protocol, on expression of oviductal and uterine genes encoding components of the IGF

system. Lactating dairy cows were slaughtered at either d 3 or 7 following a

synchronized estrus (d 0), and oviductal and uterine tissues were analyzed. Steady-state

concentrations of IGF-II mRNA were greater in oviducts collected from bST-treated

cows than from control cows. Uterine IGFBP-3 mRNA concentrations were greater in

bST-treated cows than controls, both on d 3 and 7 of the estrous cycle. The mRNA for

GHR was decreased in bST-treated cows by d 7. This study revealed the bST regulatory

complexity in tissue specific gene expression during early pregnancy in lactating dairy cows.

These findings, as well as others, give conclusive evidence that bST has direct effects on the oviduct, uterus, and early embryo development (Spicer et al., 1995; Lucy et al., 1995; Kirby et al., 1996; Izadyar et al., 1996; 1997). However, little is known of bST effects after d 7 and before d 32 post insemination, which may be a critical period for bST to exert a direct embryonic or indirect effect via the maternal unit (i.e., uterus) and/or

peripheral responses (Moreira et al., 2001). Another important event within this critical window, on d 16 to 17 after estrus, is maintenance of the CL. This process is established by the ability of the conceptus to secrete IFN-τ which regulates secretion of PGF2α in the

uterine endometrium (Thatcher et al., 2001). At least 40% of total embryonic losses have

been estimated to occur between d 8 and 17 of pregnancy (Thatcher et al., 1994). This

72 high proportion of embryonic losses seems to occur around the same time as the inhibition of PGF2α secretion by the conceptus.

Because bST increases rate of embryo development to the blastocyst stage and increases cell number in vitro, bST may subsequently enhance conceptus development, allowing for a greater secretion of IFN-τ at d 17 of pregnancy. This increase of IFN-τ may contribute to an increase in the number of animals establishing pregnancy and decrease the percentage of early embryonic loss.

The objective of this study was to characterize the effects of exogenous bST on ovarian function, conceptus development, and regulation of the IGF system in the uterus on d 17 of the estrous cycle in nonlactating Holstein cows as an experimental model.

Materials and Methods

Materials

Gonadotropin-releasing hormone ([GnRH] Fertagyl®; Intervet Inc., Millsboro,

DE), PGF2α (Lutalyse®; Pfizer Animal Health, Kalamazo, MI), and recombinant bST

(Posilac®; Monsanto Co., St. Louis, MO) were used for synchronization of ovulation and experimental treatment. Recombinant bIFN-τ (1.08 x 107 units of antiviral activity per mg used as a standard) for the antiviral assay was a generous gift from Dr. Michael

Roberts (University of Missouri, Columbia, MO). The cDNAs of GHR-1A, IGF-I, IGF-

II, IGFBP-2, and IGFBP-3 were a generous gift from Dr. Mathew Lucy (University of

Missouri, Columbia, MO). All other materials were purchased from various companies such as: Trizol, Random Primers DNA Labeling System (Invitrogen Corporation,

Carlsbad, CA), Taq polymerase (cat # M166A; Promega, Madison, WI), ultrasensitive hybridization buffer (ULTRAhyb, Cat # 8670; Ambion Inc., Austin, TX), dCTP α-32P

(cat # 33004x01), Biotrans Nylon membrane (ICN, Irvine, CA), Centriprep Centrifugal

Filter Devices (Millipore, Bedford, MA), nitrocellulose membranes (Hybond, Amersham

Biosciences Corp., Piscataway, NJ), recombinant human IGF-I and IGF-II (Upstate

Biotechnology, Lake Placid, NY), and Modified Eagles medium, Vesicular Stomatitis virus, and immortalized bovine kidney cells (MDBK) were purchased from American

Type Culture Collection (Manassas, VA). All other general materials used were from

Fisher Scientific (Pittsburgh, PA) and Sigma Chemical Co. (St. Louis, MO).

Animals and Experimental Design

The experiment was conducted at the University of Florida Dairy Research Unit

(Hague, FL) during the months of October 2001 through February 2002. Nonlactating

Holstein cows in good body condition (≥3.0) were housed together in a free-stall facility with grooved concrete floors and fed a total mixed ration twice daily throughout the experiment. The barn was equipped with fans and sprinklers that were operated when the temperature exceeded 25˚C. Estrus was presynchronized (Presynch) in 78 cows starting on d −27 (d 0 = TAI) with a GnRH (2 mL, 86 µg, i.m.) injection and with an injection of

PGF2α (5 mL, 25mg; i.m.) on d −20 (DeJarnette and Marshall, 2003; Figure 3-1). Estrus was detected between d −20 and −10 using the Heatwatch electronic estrus-detection system (DDx Inc., Denver, CO; Rorie et al., 2002). The Ovsynch protocol (Pursley et al.,

1997a) was administered beginning on d −10 GnRH (2 mL, 86 µg, i.m.) followed 7 d later (d −3) by an injection of PGF2α. At 48 h after injection of PGF2α, GnRH (d −1) was administered, and 55 cows were inseminated 16 h later. All inseminations were administered by the same technician with semen from one Holstein bull of known fertility (Select Sires; 7H05379). The cycling group (n = 23) was not inseminated. Cows

received either a recommended commercial dose of bST (500 mg) or no bST on d 0

(when cows were either inseminated or not) and again on d 11. The bST injections were given 11 d apart, instead of 14 d, to allow sustained continual exposure to GH until d 17 of slaughter. The bST injections were given subcutaneously in the space between the

ischium and tail head. Ovaries were evaluated by real-time ultrasonography (Aloka SSD-

500, Aloka Co., Ltd., Tokyo, Japan) with a 7.5-MHz linear-array transrectal transducer

on d 0, 7, and 16. Follicular responses examined were: numbers of class 2 (6 to 9 mm)

follicles, class 3 (> 10 mm) follicles, CL, diameters of the largest follicle (mm), and the

CL tissue volume (mm3). The tissue volume (V) was calculated using the length (L) and

width (W) of the CL to calculate the average diameter and volume (V), with the formula

V = 4/3 × π × R3 using a radius (R) calculated by the formula R = (L/2 + W/2)/2. For CL

with a fluid filled cavity, the volume of the cavity was calculated and subtracted from the

total volume of the CL. Blood samples were collected daily from d 0 to 17 to be

analyzed for various hormone concentrations. A follicular cyst was detected on d 7 in 5

cows and CL regression prior to d 16 was observed in 2 cows. These 7 cows were

excluded and not slaughtered. Cows (n = 71) were slaughtered on d 17 after TAI to

collect tissue samples and verify presence of a conceptus. Pregnancy rates were defined

as number of cows classified pregnant based upon visualization of a conceptus in the

flushing at slaughter divided by number of cows inseminated.

Tissue Sample Collection

All cows were sacrificed in the abattoir of the Meats Laboratory at the University of Florida. Reproductive tracts were collected within 10 min of slaughter, placed on ice, and taken to the laboratory. Conceptuses and uterine secretions were recovered as

described by Lucy et al. (1995). Briefly, 40 mL of PBS was injected into the uterine horn at the uterotuberal junction contralateral to the CL and massaged gently through the uterine horns, exiting through an incision in the horn ipsilateral to the CL. Uterine luminal flushings (ULF) and the conceptus were recovered into 250-mL beakers. The CL were removed from the ovaries, weighed, and their diameter (mm) was measured to calculate total tissue volume as described above. The uterine horn ipsilateral to the CL was cut along the mesometrial border, and the endometrium was dissected from the myometrium. Endometrial tissue from the anti-mesometrial border of the ipsilateral horn

was cut (1 cm × 1cm) and frozen in liquid nitrogen for Northern blot analyses.

Endometrial tissues were collected from 14 cycling (7 C and 7 bST-C) and 16 pregnant

(7 P and 9 bST-P) cows. The ULF was recovered from 19 cycling (12 C and 7 bST-C)

and 18 pregnant (9 P and 9 bST-P) cows.

Interferon-tau Antiviral Assay

Activity is expressed in terms of antiviral units per mL as assessed in a standard

cytopathic effect assay (Familletti et al., 1981). Three-fold dilutions of ULF from

pregnant cows were incubated with MDBK cells in 96 well plates for 24 h at 37˚C.

Following incubation, inhibition of viral replication was determined in a cytopathic effect

assay using vesicular stomatitis virus as challenge. Antiviral units/mL (defined as the

dilution causing a 50% reduction in destruction of the monolayer) was converted to

µg/mL IFN-τ by using a standard curve with known amounts of recombinant bovine IFN-

τ. Total amount of IFN-τ (µg/total volume) in the ULF was calculated by multiplying the

IFN-τ concentration by total amount of flushing fluid recovered for each pregnant cow.

Ribonucleic Acid Isolation and Northern Blotting

Total RNA was isolated from endometrial tissues (300 mg; n = 30) with Trizol

according to the manufacturer’s specifications. Total cellular RNAs (30 µg) were

resolved into 1.0% agarose-formaldehyde gels and blotted to nylon membranes.

Following blotting, RNA was crosslinked by UV irradiation and baked at 80oC for 1 h.

The blots were prehybridized with ULTRAhyb® buffer for 1 h at 42 oC. Filters were

then hybridized with random primer-P32-labelled bovine specific cDNAs (GHR-1A, IGF-

I, IGF-II, IGFBP-2, IGFBP-3 and GAPDH; Feinberg and Vogelstein, 1983) overnight at

42oC. The next day, the blots were washed once in 2X SSC/0.1% SDS for 20 min and

twice in 0.1X SCC/0.1% SDS for 20 min each at 42oC. The blots were gently patted dry

with kimwipes and exposed to X-ray film at -80oC. The autoradiographs were quantified

using densitometric analysis (AlphaImager, Alpha Innotech Corp., CA). Once all blots

had been labeled with their respective probes, blots were stripped, probed for GAPDH,

and quantified.

Analysis of Hormones in Plasma and ULF

Blood samples (7 mL) were collected daily from TAI (d 0) until slaughter (d 17)

using a 20-g Vacutainer blood collection needle (Benton Dickinson and Company,

Franklin Lakes, NJ) from the coccygeal vein in 3 different locations, which were rotated

at each bleeding to minimize irritation. Samples were collected in evacuated heparinized

tubes (Vacutainer; Becton Dickson, East Rutherford, NJ). Immediately following sample

collection, blood was stored on ice until it was returned to the laboratory for

centrifugation (3000 × g for 20 min at 4˚C) for collection of plasma within 6 h. Plasma was stored at –20˚C until assayed for GH, IGF-I, insulin, and progesterone.

Concentrations of progesterone were analyzed using a solid phase RIA kit (Coat-a-count,

DPC, Diagnostic Products Co, Los Angeles, CA). Plasma samples were analyzed for GH

(Badinga et al., 1991), insulin (Malven et al., 1987; Badinga et al., 1991), and IGF-I

(Badinga et al., 1991) by specific RIAs. The extraction procedure used for the IGF-I assay (Badinga et al., 1991) was modified slightly using a 6:3:1 ratio of ethanol:acetone:acetic acid. The ULF was concentrated from 15 ml to approximately 2 ml with a Centriprep Centrifugal Filter Device fitted with a 3000-MW filter (Millipore,

Bedford, MA) and then analyzed for IGF-I and GH using the same RIA procedures.

Values for immunoreactive IGF-I and GH were expressed as total ng in ULF. Protein concentrations in ULF were determined using the Bradford method (Bradford, 1976).

The minimum detectable concentrations for GH, IGF-I, insulin and progesterone were 0.1 ng/mL, 10 ng/mL, 0.02 ng/mL, and 0.1 ng/mL, respectively. The intra- and inter-assay coefficients of variation for plasma GH, IGF-I, and insulin were 9.7% and 5.4%, 5.3%

and 1.9%, 1.7% and 3.5%, respectively. Plasma concentrations of progesterone were

completed in one assay with intra-assay coefficients of variation calculated from

duplicated samples in 3 ranges of low (0.5-1 ng/mL; 12.0%), medium (1-3 ng/mL;

8.24%) and high (>3 ng/mL; 7.27%) progesterone concentrations. The intra-assay

coefficient of variation was 9.7% for the luteal phase plasma reference sample (5.8

ng/mL). A reference pool for ULF resulted in intra-assay coefficients of variation of

15.8% and 10.8% for GH and IGF-I, respectively. The intra-assay coefficients of variation for duplicate samples within the complete assay for the ULF GH and IGF-I were 10.0% and 11.5%, respectively.

Analysis of Uterine Luminal IGFBPs

Ligand blot analysis (De la Sota., 1996) determined the relative abundances of

IGFBPs in the ULF. Concentrated ULF proteins (100 µg) were subjected to a 12.5%

SDS-PAGE under non-reducing conditions. Proteins were then transferred to a

nitrocellulose membrane by electrotransfer. The filters were blocked for 1 h with Tris-

buffered saline (TBS, pH 7.4) which contained 1% non-fat dry milk. The membranes were washed and then incubated in 30 mL of TBS containing 1 × 106 cpm/mL of [125I]- labeled rhIGF-II for 24 h at 4˚C. Filters were washed with 5 changes 10 min each in

TBS, blotted dry, and exposed to X-ray film for 48 to 72 h. Signals for IGFBPs were quantified by densitometric analysis and the total content of IGFBPs in ULF calculated.

The IGFBPs (arbitrary units/100 µg) were calculated back to the total amount of protein in the ULF recovered, and units expressed as arbitrary units of IGFBPs/total ULF.

Statistical Analyses

Pregnancy rates were analyzed using the Chi-square and Logistic Regression procedure examining the main effect of bST. The main effect of bST was also tested for conceptus size (cm) and IFN-τ content of ULF utilizing the GLM procedure of SAS

(SAS Inst. Inc, Cary, NC). The ovarian responses on d 17 at slaughter were also analyzed using the GLM procedure of SAS testing the main effect of bST, pregnancy status, and the interaction of bST-pregnancy status. Number of CL was used as a covariate for analysis of CL volume on d 17.

Numbers of class 2 (6 to 9 mm) and class 3 (> 10 mm) follicles, and CL, as well as largest follicle size, and CL tissue volume were analyzed using the Mixed Model procedure of SAS (Littell et al., 1996). Cow within bST and pregnancy status was a random effect in the model. The model included fixed effects of bST, pregnancy status, day and the higher order interactions. The CL tissue volume was adjusted for CL number as a covariate.

Plasma hormone concentrations were analyzed using the homogeneity of regression

procedure and the repeated measures analysis in the Mixed Model of SAS. This

procedure applies methods based on the mixed model with special parametric structure

on the covariance matrices. The dataset was tested to determine the covariance structure

that provided the best fit for the data. Covariance structures tested included compound

symmetry, autoregressive order 1, and unstructured. The covariance structure used was autoregressive order 1. The model included effects of bST, pregnancy status, and day

with the higher order interactions using a statement specifying cow within bST and

pregnancy status as being random. Day 0 plasma hormone concentrations were used as a

covariate for all respective plasma hormone concentrations. The PDIFF statement was

used for bST-pregnancy status-day to obtain the probability values for differences between treatments on a particular day.

Abundances of IGF-I, IGF-II, IGFBP-2, IGFBP-3 mRNAs in Northern blots were analyzed using the GLM procedure of SAS. The main effects of treatment (C, P, bST-C and bST-P), gel and the interaction of treatment-gel were examined with the abundance values for GAPDH mRNA used as a covariate to adjust for loading gel differences. Pre- designed orthogonal contrasts were used to compare treatment means (bST, pregnancy status, and bST-pregnancy status).

Total contents of GH, IGF-I, IGFBP-3, IGFBP-4 and IGFBP-5 in ULF were

analyzed using the GLM procedure of SAS. The mathematical model included the main

effects of treatment (C, P, bST-C, and bST-P) and orthogonal contrasts were used to

compare treatment means (pregnancy status, bST and bST-pregnancy status interaction).

Results

Pregnancy Rates, Conceptus Sizes, and Total Amount of IFN-τ in ULF

Pregnancy rate at d 17 of nonlactating dairy cows was decreased (P < 0.01) by bST

(27.2%; 9 of 33) compared with control (63.6%; 14 of 22) cows. Although pregnancy rates were decreased in bST-treated cows, the conceptuses that survived to d 17 in the bST-P cows had a greater (P < 0.01) average conceptus length (n = 8; 39.2 ± 4.8 cm) than

P cows (n = 10; 20.0 ± 4.3 cm). Furthermore, the amount of IFN-τ in the ULF from bST-

P (n = 8) cows was almost three times greater (P < 0.05) at 7.15 µg/total ULF compared with 2.36 µg/total ULF in P (n = 10) cows (Table 3-1). However, differences in IFN-τ were not significant when adjusted for conceptus length as a covariate.

Ovarian Responses on Days 7, 16, and 17

Ovarian responses were measured by ultrasonography on d 7 and 16 in 7 C, 6 P, 7 bST-C and 4 bST-P cows. No significant differences among treatments were detected for the number of class 3 follicles (1.7 ± 0.2), size of the largest follicle (18.0 ± 1.1mm), number of CL (1.2 ± 0.2), and CL tissue volume (8667 ± 2069 mm3). An interaction (P ≤

0.05), however, was detected between bST and pregnancy status for number of class 2

follicles that decreased in bST-C cows compared with C, P, and bST-P cows on both d 7

and 16 (2.4 < 4.9, 4.2, and 5.5, respectively).

On d 17, at the time the reproductive tract was recovered, CL (15 C, 10 P, 5 bST-C,

and 9 bST-P) were counted, measured, and weighed. No significant differences were

detected between treatment groups for the number of CL and the volume of the CL.

However, CL tended (P ≤ 0.10) to be heavier in bST-treated animals than non-bST

treated animals (Table 3-1).

Plasma and ULF Hormone Concentrations

Daily blood samples were collected from d 0 (day of synchronized estrus) to d 17

after estrus from 22 cows (5 C, 6 P, 7 bST-C, and 4 bST-P). No main effect of bST on

progesterone concentrations in plasma was detected, but there was a tendency (P < 0.10)

for a treatment × day interaction with C cows having greater progesterone on d 12, 14,

and 16 (P <0 .05) and a tendency (P < 0.10) to have greater progesterone on d 11 and 15

(Figure 3-2) compared with P cows. The bST injections increased (P < 0.01) plasma GH

concentrations in both bST-C and bST-P cows compared with the non-bST injected C

and P cows (8.5 ± 0.6 and 7.9 ± 0.8 ng/mL vs. 3.1 ± 0.7 and 2.9 ± 0.8 ng/mL,

respectively; Figure 3-3). Associated with an increase in plasma GH was an increase (P

< 0.01) in IGF-I in both bST-C and bST-P groups in contrast with C and P groups (601 ±

42 and 635 ± 55 ng/mL vs. 413 ± 50 and 345 ± 45 ng/mL respectively; Figure 3-4).

Concentrations of plasma insulin increased (P < 0.01) in both bST-C and bST-P compared with C and P animals (3.68 ± 0.3 and 3.76 ± 0.4 vs. 1.85 ± 0.4 and 1.97 ± 0.3 respectively; Figure 3-5) with a tendency for a bST-status-day interaction (P ≤ 0.10;

Figure 3-5.) with the quadratic curves being different (P ≤ 0.05) for bST-C and bST-P

cows. Inspection of the curves indicated insulin concentrations of bST-C cows were

greater before d 9 compared with bST-P, and insulin concentrations were greater after d 9

in bST-P, compared with bST-C animals.

Uterine luminal flushings were collected at the time of slaughter on d 17 from 37

cows (12 C, 9 P, 7 bST-C and 9 bST-P) for analysis of GH and IGF-I concentrations.

Volumes and protein content of ULF did not differ due to pregnancy status or bST

treatment. Total amount of GH in the ULF did not differ. A tendency (P = 0.07) for an increase in ULF content of IGF-I in bST-C and bST-P cows was detected compared with

C and P cows (202 ± 32 and 161 ± 28 vs. 157 ± 25 and 101 ± 28 ng, respectively; Table

3-2). There was also a tendency (P < 0.10) for an increase in ULF content of IGF-I in C

cows compared with P cows (Table 3-2).

Endometrial mRNA Expression of the GH/IGF-I System

Northern blot analysis was used to probe the endometrial tissue from d 17 cows for

GHR-1A, IGF-I, IGF-II, IGFBP-2, and IGFBP-3 (Figure 3-6). The GHR-1A was

undetectable in the endometrium of all animals. The mRNA transcript sizes (Kb) for

IGF-I, IGF-II, IGFBP-2 and IGFBP-3 were 7.5, 4.6, 1.7, and 2.8 Kb, respectively. There

were significant interactions (P < 0.01) between status (P vs. C) and bST (+/-) for IGF-I,

IGF-II, and IGFBP-3 mRNAs and a comparable (P < 0.10) trend for IGFBP-2 (Table 3-

2). In general, a slight increase in expression was detected for P cows in the absence of

bST. In contrast, bST treatment stimulated the respective responses of C cows.

However, the bST induced increases were attenuated in P cows to a level of expression comparable to P cows not injected with bST.

Analysis of ULF for IGFBPs

Ligand blot analyses for IGFBPs were conducted on d 17 ULF from 37 cows

(Figure 3-7). Total ULF protein did not differ among treatment groups. Five distinct

IGFBP bands were detected from 44 to 24 kDa. There was no significant treatment affect

on IGFBP-4 (28 and 24 kDa) and IGFBP-5 (29 kDa). There was an interaction (P <

0.10) between status and bST with pregnancy decreasing IGFBP-3 (44 and 40 kDa), but bST blocked this decrease in bST-P cows (Table 3-2).

Simple and Partial Correlations for the GH-IGF System

There was no correlation between IGF-I in ULF and circulating concentrations of

IGF-I at d 17 (r = −0.17). A series of positive correlations were detected (P < 0.05).

Plasma concentrations of GH were correlated with IGF-I in plasma (r = 0.81), IGF-I in plasma was associated with insulin in plasma (r = 0.51), and IGF-I in plasma was associated with GH in ULF (partial correlation adjusted for treatment [pr = 0.55]).

Concentration of GH in ULF was associated negatively with IGF-I mRNA (−0.38), and low expression of IGF-I mRNA was related to enhanced expression of IGF-II mRNA (r =

−0.68; pr = −0.77). Growth hormone in the intrauterine environment (i.e., GH in ULF) was correlated with the relative abundance of IGFBP-3 (r = 0.59), IGFBP-4 (r = 0.63), and IGFBP-5 (r = 0.63) in the ULF. Although correlations are not proof of causative effects, significant associations were detected among hormonal components and uterine gene expression of the GH-IGF system at d 17 in cyclic and pregnant animals treated differentially with bST.

Discussion

In the present study, bST significantly decreased pregnancy rates when administered at the time of insemination in nonlactating dairy cows following an

Ovsynch protocol. Nonlactating cows were chosen as the model to eliminate the homeorhetic state of lactation in evaluating bST effects and to reduce the expense.

Previous studies have shown that pregnancy rates were increased in cyclic, lactating dairy cows when bST was injected at the initiation of the Ovsynch protocol or near the TAI

(Moreira et al., 2000b, 2001; Morales-Roura et al., 2001; Santos et al., 2004b).

This difference in response may reflect a complex relationship between the physiological and nutritional status (i.e., lactating vs. nonlactating) and reproduction in dairy cows. In dairy heifers receiving either a 500 mg dose of bST at 14 d following AI or on both the day of AI and d 14 after AI, pregnancy rates were reduced compared with

controls that did not receive bST (66.7, 66.1, and 94.4%, respectively; Rorie et al., 2004).

However, in that study when bST was only given at the time of AI, pregnancy rates did

not differ from untreated controls (84.2 vs. 94.4%). This may have been due to timing of

bST injections and (or) the amount of IGF-I stimulation after bST injection. Amount of

IGF-I stimulation seemed to have detrimental effects when bST was administered immediately before the initiation of CL maintenance for establishment of a pregnancy. In

other studies using lactating beef cows and heifers (Bilby et al., 1999), which may have

more closely mimicked the physiological status of a nonlactating dairy cow, no effect of a low dose (167 mg) of bST (Posilac®) on pregnancy rates was detected. In these latter studies, conception rates for bST-treated and control cows were 54.4 and 49.5% (n = 617) for lactating beef cows, and 46.0 and 46.3% for heifers (n = 1123), respectively.

Dose of bST may determine the ultimate outcome of reproductive responses because administration of a daily reduced dose of bST (5 mg/d) improved first-service conception rates and pregnancy rates in cows (Stanisiewski et al., 1992). In contrast, in that study, cows injected with more bST (14 mg/d) had a significant decrease in conception and pregnancy rates compared with those treated with less bST (5 mg/d).

Other dose titration studies reported a reduction in estrus detection rate (Morbeck et al.,

1991) and an increase in number of cows not-conceiving (Downer et al., 1993) when treated with high doses of bST.

Dose and (or) timing of bST in which a positive or negative reproductive response occurs may depend upon the stimulatory responses of IGF-I and IGFBPs after injection of bST. The primary determinants of plasma IGF-I concentrations are nutrition and body condition (Vicini et al., 1991; McGuire et al., 1992). Plasma concentrations of IGF-I are

positively associated with body condition and nutrient intake (Housekneckt et al., 1988;

Yelich et al., 1996), and low concentrations of IGF-I are associated with an extended postpartum interval to estrus in beef cows and with delayed puberty (Rutter et al., 1989;

Nugent et al., 1993; Roberts et al., 1997). Once IGF-I concentrations increase in plasma to reach a threshold concentration, follicular sensitivity to LH may increase due to an

IGF-I induction of LH receptors (Beam and Butler, 1999). With increases in estradiol output by the preovulatory follicle that induces a LH surge, cows resume estrous cycles and can potentially become pregnant. These changes illustrate a positive threshold response of IGF-I on reproduction.

The opposite, however, may be true when IGF-I concentrations are overstimulated.

Well-fed cows and heifers have greater blood IGF-I concentrations, whereas under- nourished cows have reduced plasma concentrations of IGF-I. The same association exists for nonlactating versus lactating cows in which nonlactating cows have greater

IGF-I concentrations than lactating cows (De la Sota et al., 1993; Bilby et al., 1999). In

the present study, IGF-I concentrations may have been hyperstimulated with a standard

dose of bST (Figure 3-4). It is important to recognize, that in addition to using

experimental cows that were nonlactating, cows also were injected twice with bST at an interval of 11 d. This was done to ensure a high concentration of bST for the entire 17-d period to slaughter. Although IGF-I concentrations were sustained throughout the experimental period, the concentrations for both bST-C (601 ng/mL) and bST-P (635 ng/mL) cows were substantially greater than normally seen in untreated nonlactating cows (214 ng/mL) or bST-treated lactating cows (306 ng/mL; De la Sota., 1993) and growing heifers (117 ng/mL; Lucy et al., 1994). Collectively these studies indicate that a

86 critical threshold of GH and (or) IGF-I concentrations may exist that stimulates reproductive performance, and exceeding that threshold may decrease reproductive responses.

In the present study, a hyperstimulation may have had deleterious effects on embryo development, uterine environment and (or) gene expression on or before d 17

(Guzeloglu et al., 2004a). The reason for the deleterious effects of bST in some inseminated cows, and not others, may reflect differences in among cow sensitivity to

GH regarding IGF-I secretion. Another possible deleterious effect of bST on pregnancy rates in non-lactating dairy cows may be due to the hyperstimulation of blood insulin secretion. High concentrations of insulin, GH, and IGF-I may be detrimental to early embryo growth. Over stimulation of IGF-I (Armstrong et al., 2001) and probably insulin

(Armstrong et al., 2003) is detrimental to follicle and oocyte development. Excess IGF-I either in vivo or in vitro had deleterious effects on the preimplantation embryo in rats

(Katagiri et al., 1996, 1997). In mice, high concentrations of IGF-I and insulin induced a down regulation of the IGF-I receptor on the blastocyst, with a subsequent decrease in signaling of IGF-I receptor associated pathways (Chi et al., 2000). This decrease in IGF-

I receptor reduced glucose uptake and triggered apoptosis. Women with polycystic ovary syndrome exhibit elevated concentrations of insulin and IGF-I and also experience more pregnancy losses (Sagle et al., 1988; Balen et al., 1993; Tulppala et al., 1993). A threshold may exist in which GH, IGF-I and (or) insulin goes from being beneficial to detrimental on oocyte and embryo development.

Plasma concentrations of progesterone were greater in C compared with P cows after d 11 following a synchronized induced ovulation (Figure 3-2). This is contradictory

to earlier reports where uninseminated and inseminated, but not pregnant nonlactating

dairy cows, had a slower rise of progesterone compared with pregnant nonlactating dairy

cows during the first 16 d following insemination (Mann and Lamming, 2001). In their

study, however, cows were administered two injections of PGF2α, 11 to 13 d apart, and

inseminations occurred 72 or 96 h after the second injection. Their reproductive

management system probably did not induce as precise a timing of ovulation as the

system used in the present study. A reduced synchrony in CL formation may have

contributed to differences in progesterone concentrations between pregnant cows and

non-pregnant cows.

Even though progesterone concentrations were less in pregnant cows of the present

study, no differences in CL tissue volume were detected on d 7, 16, and 17, or CL weight

on d 17. Reduced plasma concentrations of progesterone may reflect a greater clearance rate of progesterone by the uterus of pregnant cows. However, a tendency existed for bST-treated cows to have a heavier CL on d 17. Lucy et al. (1995) also showed that CL weight was increased when lactating dairy cows were treated with 25 mg/d for 16 d after estrus compared with saline treated controls. Greater CL weight may be due to either GH and (or) IGF-I increasing differentiation of luteal cells (Donaldson and Hansel, 1965) and

(or) increased DNA synthesis of luteal cells as shown in vitro (Chakravorty et al., 1993).

Although pregnancy rates were decreased in bST-treated cows, the bST-P cows that maintained a conceptus until d 17 had longer embryos (i.e., 2 fold) than non-bST treated cows. Furthermore, with an increased conceptus length, the amount of IFN-τ also was increased threefold. Longer conceptuses confirm observations of Hansen et al.,

(1988), who stated that elongation of the embryo is associated with increased secretion of

IFN-τ, and that most of the increased output of IFN-τ is due to the increased size of the

embryo and not increased synthesis per unit weight. In combination with high IFN-τ and

IGF-I concentrations of bST-treated cows, profound effects on the luteolytic mechanisms involved with maternal recognition of pregnancy were observed (Guzeloglu et al.,

2004a).

With the substantial differences between conceptus lengths of bST-treated and non- bST treated cows, it is possible that bST advanced uterine development such that an asynchronous uterine environment was created (Guzeloglu et al., 2004a). Change in intrauterine environment could have occurred by advancing gene expression or by advancing embryonic growth that in turn altered the uterine environment. An asynchronous environment is detrimental to embryo survival as shown in an embryo transfer model (Moore and Shelton, 1964). Transfer of embryos to recipients that are not in estrus at the same time as the donors resulted in altered embryo development (Lawson et al., 1983). In these studies, embryo development was retarded when embryos were transferred to a less advanced uterus, whereas development was accelerated when embryos were transferred to a more advanced uterus. Perhaps in the present study, bST stimulated a more advanced uterus.

Advancement of the uterus and (or) conceptus may not only be due to the amount of IGF-I in the blood, but may be related closer to the amount of IGF-I in the uterine lumen and its association with regulatory binding proteins. In our study, IGF-I concentrations in the ULF tended to be greater in bST-treated cows, and particularly stimulated in cyclic cows versus pregnant cows. However, IGFBP-3 was greater in bST pregnant cows versus non-treated pregnant cows. This increase of IGFBP-3 may be due

to maternal mechanisms compensating for high IGF-I concentrations and alleviating

some of the IGF-I actions on the developing conceptus.

Amount of IGF-I, IGF-II, IGFBP-2, and IGFBP-3 mRNAs in the endometrium had

consistent interactions between status and bST such that expression was increased in

pregnant endometrium versus cyclic endometrium, and bST stimulated a comparable

increase in cyclic cows, but not in pregnant cows treated with bST. This appears to be another example in which treatment with bST in pregnant cows caused a hyperstimulation in plasma IGF-I that appeared to induce a local endometrial down regulation in components encoding the IGF system (i.e., IGF-I, IGF-II, and IGFBP-3

mRNAs). This may be a coordinated response to possibly maintain homeostasis and (or) a suitable environment for embryo growth. This effect in pregnant cows is likely due to

products of the conceptus such as IFN-τ.

Bovine IFN-τ regulates gene transcription of endometrial cells via induction of

STATs and IFN regulatory factors (i.e., IRF-1; Binelli et al., 2001a). Bovine IFN-τ regulates expression of various endometrial proteins such as suppression in transcription of oxytocin and estrogen receptors (Spencer et al., 1995), enhanced expression of Mx

(Ott et al., 1998), and ubiquitin cross-reactive proteins (Johnson et al., 1999). Spencer et al. (1999) demonstrated that pretreatment of ewes with IFN-τ was necessary to induce endometrial responsiveness to placental lactogen and GH. Although GHR-1A mRNA was not detected in the present experiment, bST stimulated gene expression of the IGF family within the endometrium of cyclic cows. In endometrial tissues of pregnant cows, however, the bST stimulation was blocked. Local regulatory effects of the conceptus on

90 endometrial responsiveness to exogenous hormones such as bST warrant further investigation (i.e., in lactating dairy cows whereby bST stimulates pregnancy rates).

Conclusions

Treatment with bST significantly decreased pregnancy rates in nonlactating dairy cows. This appeared to be due to a hyperstimulation of IGF-I in nonlactating dairy cows.

As a consequence, the uterus and embryo seem to be advanced in development as reflected by stimulation in conceptus growth. The IGF system within the intrauterine environment (as characterized by gene expression in the uterine endometrium and proteins in the uterine lumen) is responsive to treatment with bST. Since previous reports have shown that pregnancy rates are increased due to bST in lactating dairy cows,

Chapter 4 explores the mechanisms by which bST increases pregnancy rates in lactating dairy cows during the critical period of CL maintenance necessary to sustain a pregnancy.

Presynch Ovsynch Ultrasound

-27 -20 -10 -3 -10 7 11 1617 Detect estrus 16 h Daily blood samples GnRH PG GnRH PG GnRH ±TAI

± bST Sacrifice

Figure 3-1. Experimental protocol illustrating the sequence of injections, collection of samples, and day of ultrasonography. Day 0 represents the time of ovulation from an induced LH surge. PG = PGF2α, TAI = timed AI

Table 3-1. Least squares means and pooled SE for conceptus length, IFN-τ (µg/total uterine luminal flushing), number of corpora lutea (CL), CL tissue volume (mm3), and CL weight (g) on d 17 after a synchronized estrus (d 0) in nonlactating cyclic (C) and pregnant (P) cows injected with bST (+/-) on d 0 and 11. Treatments1 Contrasts2 Pregnancy Response C P bST-C bST-P S.E. bST bST × P status (P) 64% 27% Pregnancy rate … … … … ** … (14/22) (9/33) Conceptus size2, cm … 20.0 … 39.2 4.6 … ** … IFN-τ2, µg/total ULF … 2.36 … 7.15 1.7 … * … 3 Number of CL 1.1 1.1 1.2 1.0 0.1 NS NS NS 3 3 CL volume , mm 6555 7474 7669 7773 761.5 NS NS NS 3 CL weight , g 5.7 5.5 7.2 5.9 0.5 NS † NS 1 bST-C = bST-cyclic, bST-P= bST-pregnant. 2 † P ≤ 0.10, * P ≤ 0.05, ** P ≤ 0.01, NS = non-significant. 3 n = 18. 4 n = 39.

) 7 * * a * 6 a 5 4 ± bST 3 ± bST 2

Plasma Progesterone (ng/mL Progesterone Plasma 1 0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Days after GnRH (i.e., estrus)

Figure 3-2. Profiles of plasma progesterone concentrations of cyclic (C) cows (▲) and pregnant (P) cows (□) from d 0 to 17 of a synchronized estrous cycle (*P < 0.05; aP < 0.10).

20 18

) 16 ± bST 14 12 ± bST 10 8 6 Plasma GH (ng/mL 4 2 0 01234567891011121314151617 Days after GnRH (i.e., estrus)

Figure 3-3. Profiles of plasma growth hormone (GH) concentrations of C (∆), P (□), bST-C (▲), and bST-P (■) cows from d 0 to 17 of a synchronized estrous cycle. Both bST-C and bST-P cows had greater GH concentrations when injected with bST on d 0 and 11 than C and P cows (P < 0.01). C = cyclic with bST injection; bST-P = pregnant with bST injection.

900 800

700 600 500 400 300

Plasma IGF-I (ng/mL)) 200 ± bST ± bST 100 0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Days after GnRH (i.e., estrus)

Figure 3-4. Profiles of plasma IGF-I concentrations of C (∆), P (□), bST-C (▲), and bST-P (■) cows from d 0 to 17 of a synchronized estrous cycle. Both bST-C and bST-P cows had greater IGF-I concentrations when injected with bST on d 0 and 11 than C and P cows (P < 0.01). C = cyclic (no bST); P = pregnant (no bST); bST-C = cyclic with bST injection; bST-P = pregnant with bST injection.

7 ± bST ± bST

4 3

Insulin (ng/mL) 2

0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Days after GnRH (i.e., estrus)

Figure 3-5. Profiles of plasma insulin concentrations of C (∆), P (□), bST-C (▲), and bST-P (■) cows from d 0 to 17 of a synchronized estrous cycle. Both bST-C and bST-P cows had greater insulin concentrations when injected with bST on d 0 and 11 than C and P cows (P < 0.01). A tendency for bST-pregnancy status-day interaction occurred, with bST-C animals having greater insulin concentrations before d 9 than bST-P animals, and bST-P animals having greater insulin concentrations after day 9 compared with bST-C cows (P ≤ 0.10). C = cyclic (no bST); P = pregnant (no bST); bST-C = cyclic with bST injection; bST-P = pregnant with bST injection.

C P bST-C bST-P

IGF-I mRNA → ← 7.5 Kb

C P bST-C bST-P

IGF-II mRNA → ← 4.6 Kb

C P bST-C bST-P

IGFBP-2 mRNA→ ← 1.7 Kb

C P bST-C bST-P IGFBP-3 mRNA→ ← 2.8 Kb

Figure 3-6. Representative Northern blots of IGF-I, IGF-II, IGFBP-2 and IGFBP-3 mRNA. Thirty µg of total RNA from 30 cows (7 C, 7 P, 7 bST-C, and 9 bST-P) were used. C = cyclic (no bST); P = pregnant (no bST); bST-C = cyclic with bST injection; bST-P = pregnant with bST injection.

bST-C C bST-P P KDa

44 IGFBP-3 40

IGFBP-5 29 28 IGFBP-4 24

Figure 3-7. Representative Ligand Blot detected IGFBP-3, IGFBP-4 and IGFBP-5 in the uterine luminal flushings (ULF) of cows on d 17 after a synchronized estrus (d0). Two hundred µg of ULF protein from 37 cows (12 C, 9 P, 7 bST-C and 9 bST-P) were used for Ligand blot analysis. The blots were probed with 125I-IGF-II. Five IGFBP bands were detected with a molecular mass (KDa) of 44, 40, 29, 28 and 24. C = cyclic (no bST); P = pregnant (no bST); bST-C = cyclic with bST injection; bST-P = pregnant with bST injection.

Table 3-2. Least squares means and pooled SE for uterine endometrial mRNA, uterine luminal flushings (ULF) protein expression, and hormone concentration at d 17 after a synchronized estrus (d 0) in nonlactating cyclic (C) and pregnant (P) dairy cows injected with bST (+/-) on d 0 and 11. Arbitrary units (AU) were generated by densitometry and mRNA results are adjusted for glyceraldehydes-3-phosphate dehydrogenase as a covariate. Treatments1 Contrasts2 Pregnancy Response3 C P bST-C bST-P SE bST bST x P status (P) Endometrium (n = 30) IGF-I mRNA, AU 58 61 66 58 1.1 * * ** IGF-II mRNA, AU 57 61 62 60 1.1 NS † ** IGFBP-2 mRNA, AU 57 63 67 65 2.2 NS ** † IGFBP-3 mRNA, AU 50 54 60 50 1.1 ** ** **

ULF (n = 37) GH, ng/ULF 10 10 11 12 1.3 NS NS NS IGF-I, ng/ULF 157 101 201 161 28 † † NS IGFBP-3, AU 21 14 20 24 2.7 NS NS * IGFBP-4, AU 18 14 20 19 2.3 NS NS NS IGFBP-5, AU 18 14 20 19 2.4 NS NS NS 1 bST-C = bST-cyclic, bST-P= bST-pregnant. 2 † P ≤ 0.10, * P ≤ 0.05, ** P ≤ 0.01, NS = non-significant. 3 IGFBP = Insulin-like growth factor binding protein; GH = growth hormone.

CHAPTER 4 PREGNANCY, BOVINE SOMATOTROPIN, AND DIETARY OMEGA-3 FATTY ACIDS IN LACTATING DAIRY COWS: I. OVARIAN, CONCEPTUS, AND GROWTH HORMONE—IGF SYSTEM RESPONSES

Introduction

Exogenous injections of bST improve lactational performance, increasing milk production by an average of 3 to 5 kg/d (Bauman et al., 1999b). When lactating dairy cows were injected with bST (500 mg) at the initiation of the Ovsynch protocol, pregnancy rates were greater than controls at d 27 and 45 after AI (Moreira et al., 2000b).

In addition, when bST was injected at either the initiation of the Ovsynch program or at the time of AI, lactating dairy cows, that were cycling, had greater pregnancy rates than controls (53.2, 44.9, and 38.8%, respectively; Moreira et al., 2001). Additional studies have documented the beneficial effect of bST on pregnancy rates when injected during the period approaching AI (Santos et al., 2004b) and to cows considered to be sub-fertile

(Morales-Roura et al., 2001).

The beneficial effects of bST on fertilization and embryonic development both in

vitro and in vivo of lactating dairy cows are associated with the rise in circulating

concentrations of GH and IGF-I (Moreira et al., 2002a, 2002b). Furthermore, bST and

IGF-I influence follicle development (Kirby et al., 1997a), uterine luminal fluid composition (Chapter 3), luteal function (Lucy et al., 1998b), and endometrial secretion

of PGF2α (Badinga et al., 2002). Pershing et al. (2002) examined the effects of bST,

given at the time of synchronized ovulation of the Ovsynch protocol, on expression of

oviductal and uterine genes encoding components of the IGF system on d 3 and 7

100 101

following a synchronized ovulation. This study revealed the regulatory complexity of bST on tissue specific gene expression of the IGF system during early pregnancy in lactating dairy cows.

Although bST has direct effects on the oviduct, uterus, and early embryo development (Lucy et al., 1995; Kirby et al., 1996; Moreira et al., 2002a, 2002b), little is known of bST’s effects after d 7 and before d 32 post AI, which appears to be a critical period for bST to exert direct embryonic or indirect effects via the maternal unit (i.e., uterus) and (or) circulating hormones such as IGF-I (Moreira et al., 2001). Another important event within this critical window, on d 16 to 17 after estrus, is maintenance of the CL. This process is established by the ability of the conceptus to secrete IFN-τ which

regulates secretion of PGF2α by the uterine endometrium (Thatcher et al., 2001). At least

40% of total embryonic losses have been estimated to occur between d 8 and 17 of

pregnancy (Thatcher et al., 1994). This high proportion of embryonic losses seems to

occur around the same time that the conceptus inhibits pulsatile PGF2α secretion.

Because supplemental bST increases the rate of embryo development to the blastocyst

stage and cell numbers in vitro and in vivo (Moreira et al., 2002a, 2002b), bST may subsequently enhance conceptus development by allowing for a greater secretion of IFN-

τ at d 17 of pregnancy. An increase of IFN-τ may contribute to an increase in the number of animals establishing pregnancy and a decrease in those experiencing early embryonic loss.

An additional strategy to potentially increase embryo survival is the addition of FO to the diet (Mattos et al., 2000). Menhaden fish meal can be used in dairy cow diets as a source of ruminally undegradable protein. Fish meal contains oil (8% of DM) with

102

relatively high concentrations of two PUFAs of the n-3 family, EPA (C20:5) and DHA

(C22:6). Feeding fish meal (Mattos et al., 2002) or fish oil (Mattos et al., 2004) to

Holstein cows resulted in reduced circulating concentrations of PGF2α when PGF2α release was induced. Also production of PGF2α was reduced by bovine endometrial cells

incubated with EPA and DHA (Mattos et al., 2003). Thus EPA and DHA may contribute

to the antiluteolytic effect of early pregnancy and increase embryo survival.

Supplemental feeding of LCFA increased pregnancy rates (Son et al., 1996; Sklan et al.,

1991), progesterone concentration in plasma (Sklan et al., 1991), CL longevity (Williams,

1989), embryo development and quality (Cerri et al., 2004), and regulated gene

expression (Sessler and Ntambi, 1998). However, few studies have investigated the

effects of LCFA, bST, and their interaction on the uterine environment.

The objective of this study was to characterize the effects of exogenous bST,

dietary fatty acids enriched in FO, and pregnancy on ovarian function, conceptus

development, and regulation of the GH-IGF system in the uterus on and before d 17 of

the estrous cycle in lactating Holstein cows.

Materials and Methods

Materials

GnRH (Fertagyl; Intervet Inc., Millsboro, DE), PGF2α (Lutalyse; Pfizer Animal

Health, Kalamazo, MI), and bST (Posilac®; Monsanto Co., St. Louis, MO) were used for

synchronization of ovulation and experimental treatment. Recombinant bIFN-τ (1.08 x

107 international units [IU] of antiviral activity per mg used as a standard) for the antiviral

assay was a generous gift from Dr. Michael Roberts (University of Missouri, Columbia,

MO). The cDNAs of GHR-1A, IGF-I, IGF-II, IGFBP-2, and IGFBP-3 were a generous

gift from Dr. Mathew Lucy (University of Missouri, Columbia, MO). All other materials

103

were purchased from various companies such as: Trizol, Random Primers DNA Labeling

System (Invitrogen Corporation, Carlsbad, CA), Taq polymerase (cat # M166A;

Promega, Madison, WI), ultrasensitive hybridization buffer (ULTRAhyb; Ambion Inc.,

Austin, TX), dCTP α-32P (MP Biomedicals, Irvine, CA), Biotrans Nylon membrane (MP

Biomedicals, Irvine, CA), RNAqueous-4 PCR kit and RNase-free DNase (Ambion Inc,

Austin, TX), real-time PCR probes (Biosearch Technologies; Novato California), TAQ

Gold polymerase, Moloney murine leukemia virus reverse transcriptase, and 18S RNA

control Reagent (Applied Biosystems; Foster City, CA), Centriprep Centrifugal Filter

Devices (Millipore, Bedford, MA), nitrocellulose membranes (Hybond, Amersham

Biosciences Corp., Piscataway, NJ), recombinant human IGF-I and IGF-II (Upstate

Biotechnology, Lake Placid, NY), Modified Eagles medium, and immortalized Madin-

Darby bovine kidney cells were purchased from American Type Culture Collection

(Manassas, VA). All other general materials used were from Fisher Scientific

(Pittsburgh, PA) and Sigma Chemical Co. (St. Louis, MO).

Animals and Experimental Diets

The experiment was conducted at the University of Florida Dairy Research Unit

(Hague, FL) during the months of October 2002 through February 2003. All

experimental animals were managed according to the guidelines approved by the

University of Florida Animal Care and Use Committee. Forty multiparious Holstein

cows in late gestation were housed in sod-based pens and fed diets formulated to contain

1.51 Mcal NEL/kg, 13.1% CP, and a cation anion difference of -90 meq/kg (DM basis) beginning approximately 3 wk prior to expected calving date. Upon calving, cows were moved to a free-stall facility with grooved concrete floors equipped with fans and sprinklers that operated when the temperature exceeded 25˚C. All experimental cows

104

were offered ad libitum amounts of a total mixed ration to allow 5 to 10% feed refusals

daily. Two dietary treatments were fed containing 0 or 1.9% calcium salt of a fish oil

enriched lipid (FO) product (EnerG-II Reproduction formula, Virtus Nutrition, Fairlawn,

OH). The fatty acid profile of the fat source as given by the manufacturer was 2.2%

C14:0, 41.0% C16:0, 4.2% C18:0, 30.9% C18:1, 0.2% C18:1 trans, 8.0% C18:2, 0.5%

C18:3, 0.4% C20:4, 2.0% C20:5, 2.3% C22:6, and 2.7% unknown. The control diet

contained a greater concentration of whole cottonseed and therefore was similar in

concentration of ether extract and NEL (Table 4-1) to that containing FO. The control

diet was fed to all cows during the first 9 DIM. Thirty cows were assigned to the control

diet for the duration of the study. From 10 to 16 DIM, ten cows were assigned to

consume a FO diet containing half the final concentration of the fat product (0.95% of

dietary DM) in order to adjust the cows to a new fat source. Starting at 17 DIM, these

cows were switched to the 1.9% FO diet and continued on that diet until the end of the study. Cows fed the ruminally protected FO consumed approximately 14.8 g/cow per day of EPA and DHA. Dry matter of corn silage was determined weekly (55°C for 48 h), and the diets were adjusted accordingly to maintain a constant forage:concentrate ratio on a

DM basis. Samples of forages and concentrate mixes were collected weekly, composited monthly and analyzed by wet chemistry methods for chemical composition (Dairy One,

Ithaca, NY; Table 4-1). Cows were milked three times per day and milk weights were recorded by calibrated electronic milk meters at each milking. Body weights were measured and BCS (Wildman et al., 1982) assigned weekly by the same two individuals.

105

Estrus Synchronization, Ultrasonography of Ovaries, and bST Treatment

Estrus was presynchronized starting at 44 ± 5 DIM (d −27 in relation to day of TAI using an injection of GnRH (2 mL, 86 µg, i.m.) followed 7 d later with an injection of

PGF2α (5 mL, 25 mg, i.m.) on d −20 (DeJarnette and Marshall, 2003; Figure 4-1). Estrus was detected during the next 10 d using the Heatwatch electronic estrus-detection system

(DDx Inc., Denver, CO; Rorie et al., 2002). At the end of 10 d, the Ovsynch protocol

(Pursley et al., 1997a) was initiated using a GnRH injection (2 mL, 86 µg, i.m.) followed

7 d later by an injection of PGF2α (5 mL, 25 mg, i. m.). At 48 h after injection of PGF2α,

GnRH (2 mL, 86 µg, i.m.) was administered, and 16 cows fed the control diet were inseminated 16 h later. All inseminations were administered by the same technician with semen from one Holstein bull of known fertility (Select Sires, Plain City, OH; 7H05379).

Tokyo, Japan) using a 7.5-MHz linear-array transrectal transducer on d 0, 7, 9, 11, 13, 15,

16, and 17. Follicular responses examined the following: numbers of class 1 (2 to 5 mm), class 2 (6 to 9 mm), and class 3 (≥ 10 mm) follicles, number of CL, diameter of the largest follicle (mm), and volume of CL tissue (mm3). The volume of CL tissue was calculated using the following equation: volume = 1.333 x π x radius3, where radius =

106

(length/2 + width/2)/2. For CL’s with a fluid-filled cavity, the volume of the cavity was

calculated and subtracted from the total volume of the CL. Three cows were excluded for

various health concerns, and CL regression prior to d 17 was observed in two cows.

These five cows were excluded from the study. Cows (n = 35) were slaughtered on d 17 after TAI to collect tissue samples and verify presence of a conceptus. Pregnancy rates were defined as number of cows classified pregnant based upon visualization of a

conceptus in the uterine flushing at slaughter divided by number of cows inseminated.

From the inseminated cows that were slaughtered, 6 cows not treated with bST and 1 cow

treated with bST were not pregnant. These 7 cows were not used for any analyses from d

0 to 17 following TAI. Number of cows used for analyses from d 0 to 17 in each group

was as follows: control diet had 5 bST-treated cyclic (bST-C), 5 non bST-treated cyclic

(C), 5 bST-treated pregnant (bST-P), and 4 non bST-treated pregnant (P) cows; FO diet

had 4 bST-treated (bST-FO) and 5 non bST-treated cyclic (FO) cows.

Tissue Sample Collection

All cows were sacrificed in the abattoir of the Department of Animal Sciences at

the University of Florida. Reproductive tracts were collected within 10 min of slaughter,

placed on ice and taken to the laboratory. Conceptuses and uterine secretions were

recovered as described by Lucy et al. (1995). Briefly, 40 mL of PBS were injected into

the uterine horn at the uterotuberal junction contralateral to the CL and massaged gently

through the uterine horns, exiting through an incision in the horn ipsilateral to the CL.

Uterine luminal flushing media and conceptus were recovered in 250-mL beakers. The

CL were removed from the ovaries, weighed, and diameter (mm) measured to calculate

total tissue volume. The uterine horn ipsilateral to the CL was cut along the mesometrial

border, and the endometrium was dissected from the myometrium. Endometrial tissue

107 from the anti-mesometrial border of the ipsilateral horn was sectioned (1 cm × 1 cm) and frozen in liquid nitrogen for Northern blot analyses. Endometrial tissues and ULF were collected from 11 cycling (5 C and 6 bST-C) cows fed the control diet, 8 cycling cows fed a FO diet (4 FO, and 4 bST-FO) and 9 pregnant (4 P and 5 bST-P) cows fed the control diet.

Interferon-tau Antiviral Assay

Activity is expressed in terms of antiviral units per mL as assessed in a standard cytopathic effect assay (Familletti et al., 1981). Three-fold dilutions of ULF from pregnant cows were incubated with Madin-Darby bovine kidney cells in 96 well plates for 24 h at 37˚C. Following incubation, inhibition of viral replication was determined in a cytopathic effect assay using the vesicular stomatitis virus. Antiviral units/mL (defined as the dilution causing a 50% reduction in destruction of the monolayer) were converted to µg/mL of IFN-τ by using a standard curve with known amounts of recombinant bovine

IFN-τ. Total amount of IFN-τ (µg/total volume) in the ULF was calculated by multiplying the IFN-τ concentration by total amount of flushing fluid recovered for each pregnant cow.

Quantitative Real-Time Reverse Transcription-PCR

Quantitative real-time reverse transcription-PCR was used to measure the relative abundance of IFN-τ mRNA in conceptuses. Total cellular RNA was extracted from conceptuses with the RNAqueous-4 PCR kit. All samples were incubated with RNase- free DNase at the end of RNA extraction and again immediately before reverse transcription. The total cellular RNA (20 ng) was reverse-transcribed using Moloney murine leukemia virus reverse transcriptase. Reactions that were not exposed to reverse

108

transcriptase were included on a subset of samples to verify that samples were free of

genomic DNA contamination. Specific primers and probe sets were used for amplifying

reverse transcription product from conceptus samples (Table 4-2). The IFN-τ primers

and probe were developed to recognize every known bovine and ovine IFN-τ isoform.

The IFN-τ probes were labeled with a fluorescent 5' reporter dye (FAM) and 3' quencher

(BHQ-1). Forty-five cycles of PCR were completed using TAQ Gold polymerase and the

ABI PRISM 7700 Sequence Detection System. Abundance of 18S RNA was used as a

loading control by adding 18S primers and an 18S probe containing a VIC-labeled 5'

fluorescent reporter and 3' TAMRA quencher within the Real-Time PCR reactions. Each

RNA sample was analyzed in triplicate reactions.

The comparative threshold cycle (CT) method was used to quantify the abundance

of bovine IFN-τ mRNA relative to that of 18S RNA (ABI Prism Sequence Detection

System User Bulletin No. 2; Applied Biosystems). The CT number for FAM (IFN-τ

mRNA) and VIC (18S RNA) fluorescence was calculated within the geometric region of

the plot generated during PCR. The ∆CT value was determined by subtracting the 18S CT value from the bovine IFN- τ CT value of the same sample. The ∆∆CT for each sample

was calculated by subtracting the highest sample ∆CT value (i.e., the sample with the

lowest target expression) from the remaining values. Since each unit of ∆∆CT difference

is equivalent to a doubling in the amplified PCR product, fold changes in relative bovine

IFN-τ mRNA abundance was determined by solving for 2-∆∆CT.

Ribonucleic Acid Isolation and Northern Blotting

Total RNA was isolated from endometrial tissues (300 mg of fresh weight; n = 28)

with Trizol according to the manufacturer’s specifications. Total cellular RNA (30 µg) was loaded into 1.0% agarose-formaldehyde gels and blotted to nylon membranes.

109

Following blotting, RNA was crosslinked by UV irradiation and baked at 80oC for 1 h.

The blots were prehybridized with ULTRAhyb® buffer for 1 h at 42oC. Filters were then

hybridized with random primed-P32-labelled bovine specific cDNAs (GHR-1A, IGF-I,

IGF-II, IGFBP-2, IGFBP-3 and GAPDH; Feinberg and Vogelstein, 1983) overnight at

42oC. The next day, the blots were washed once in 2X SSC/0.1% SDS for 20 min and

twice in 0.1X SSC/0.1% SDS for 20 min each at 42oC. The blots were patted dry gently

with kimwipes and exposed to X-ray film at -80oC. The autoradiographs were quantified

using densitometric analysis (AlphaImager, Alpha Innotech Corp., CA). Once all blots

had been labeled with their respective probes, blots were stripped, probed, and quantified

for GAPDH.

Analysis of Hormones in Plasma and Uterine Luminal Flushings

Blood samples (7 mL) were collected just after the afternoon feeding (1300 h)

twice weekly from 14 DIM until 44 ± 5 DIM and daily from TAI (d 0; 77 ± 12 DIM)

until slaughter (d 17; 94 ± 12 DIM) from the coccygeal vein or artery in three different

locations, which were rotated at each bleeding to minimize irritation. Vacutainer blood collection needles (20 g; Benton Dickinson and Company, Franklin Lakes, NJ) were used. Samples were collected in evacuated heparinized tubes (Vacutainer; Becton

Dickson, East Rutherford, NJ). Immediately following sample collection, blood was stored on ice until it was returned to the laboratory for centrifugation (3000 × g for 20 min at 4˚C) for collection of plasma within 6 h. Plasma was stored at –20˚C until assayed for GH, IGF-I, insulin, and progesterone. Concentrations of progesterone were analyzed using a solid phase RIA kit (Coat-A-Count Progesterone, DPC, Diagnostic Products Co.,

Los Angeles, CA) validated in our laboratory (Garbarino et al., 2004). Plasma samples were analyzed for GH (Badinga et al., 1991), insulin (Malven et al., 1987; Badinga et al.,

110

1991), and IGF-I (Badinga et al., 1991) by specific RIA. The extraction procedure used

for the IGF-I assay (Badinga et al., 1991) was modified slightly using a 6:3:1 ratio of

ethanol:acetone:acetic acid. The ULF was concentrated with a Centriprep Centrifugal

Filter Device fitted with a 3000-MW filter and then analyzed for IGF-I and GH using the

same RIA procedures. Values for immunoreactive IGF-I and GH were expressed as total

ng in ULF. Protein concentrations in ULF were determined using the Bradford method

(Bradford, 1976). The minimum detectable concentrations for GH, IGF-I, insulin, and

progesterone were 0.1, 10, 0.02, and 0.1 ng/mL, respectively. The intra- and interassay

coefficients of variation for plasma progesterone, GH, IGF-I, and insulin were 7.7 and

6.0%, 9.1 and 4.9%, 7.0 and 4.9%, and 4.8 and 7.8%, respectively. Plasma

concentrations of progesterone had intraassay coefficients of variation calculated from duplicated samples in three ranges of low (0.5-1 ng/mL; 6.8%), medium (1-3 ng/mL;

7.4%) and high (>3 ng/mL; 4.3%) progesterone concentrations. A reference pool for

ULF resulted in intraassay coefficients of variation of 5.3 and 8.3% for GH and IGF-I,

respectively. The intraassay coefficients of variation for duplicate concentrated samples

within the complete assay for the total amount of GH and IGF-I in the ULF were 11.5

and 17.4%, respectively.

Analysis of Uterine Luminal IGFBP

Ligand blot analysis (De la Sota., 1996) determined the relative abundances of

IGFBP in the ULF. One hundred µg of concentrated ULF proteins were subjected to a

12.5% SDS-PAGE under non-reducing conditions. Proteins were transferred to a

nitrocellulose membrane by electrotransfer. The filters were blocked for 1 h with Tris-

buffered saline (TBS, pH 7.4) which contained 1% [w/v] non-fat dry milk. The

membranes were washed and then incubated in 30 mL of TBS containing 1 × 106

111 cpm/mL of [125I]-labeled recombinant human IGF-II for 24 h at 4˚C. Filters were washed with five changes, 10 min each in TBS, blotted dry, and exposed to X-ray film for 48 to

72 h. Signals for IGFBP were quantified by densitometric analysis and the total content of IGFBP in ULF calculated. The IGFBP (arbitrary units/100 µg) were calculated back to the total amount of protein in the ULF recovered, and units expressed as arbitrary units of IGFBP/total ULF.

Statistical Analyses

All variables analyzed prior to the start of presynchronization as well as BCS, body weight, and milk production for the entire study were analyzed using homogeneity of regression analyses for polynomial response curves utilizing the GLM procedure of SAS

(SAS Inst. Inc, Cary, NC). Regression analyses were performed to determine the best-fit curves among treatments in relation to DIM, and the regressions that did not differ among treatments were pooled to characterize the response as related to DIM. Linear, quadratic, cubic, quartic and quintic curves were tested. All variables were analyzed with the main effects of treatment, DIM and the interaction of treatment-by-DIM. Milk production response was adjusted for parity. Cow within treatment or treatment-parity were considered as a random variable.

Pregnancy rates were analyzed using the Chi-square and Logistic Regression procedures to examine the main effect of bST. The main effect of bST injection on conceptus size (cm), IFN-τ protein content of ULF and IFN-τ mRNA concentration in the conceptuses were evaluated utilizing the GLM procedure of SAS. The ovarian responses were analyzed using the GLM procedure of SAS testing the main effects of bST, pregnancy status, and the interaction of bST-pregnancy status. A separate series of

112

analyses examined effects of bST, FO, and the interaction of bST by FO. Number of CL

was used as a covariate for analysis of CL volume on d 17 post AI.

During the post-ovulation period, numbers of follicles and CL, as well as diameters

of the largest follicle, and volume of CL tissue were analyzed using the Mixed Model

procedure of SAS (Littell et al., 1996). This procedure applies methods based on the

mixed model with special parametric structure on the covariance matrices. The data set

was tested to identify the covariance structure that provided the best fit for the data.

Covariance structures tested included compound symmetry, autoregressive order 1, and

unstructured. The covariance structure used was autoregressive order 1. Cow within

bST and pregnancy status or bST and FO were random effects in the model. Two

mathematical models used to evaluate treatment effects were the following: 1) bST,

pregnancy status, day and higher order interactions and 2) bST, FO, day and higher order

interactions. The volume of CL tissue was adjusted for CL number as a covariate.

Plasma hormone concentrations were analyzed using the homogeneity of regression

procedure (Proc GLM, SAS, Wilcox et al., 1990) and the repeated measures analysis in

the Mixed Model of SAS as described previously. The model included effects of bST, pregnancy status, and day or bST, FO and day with the higher order interactions using a statement specifying cow nested within bST and pregnancy status or cow nested within bST and FO as being random. Concentration of plasma hormone at TAI was used as a covariate for all respective plasma hormone concentrations during the post-ovulatory period. The PDIFF statement of SAS was used to obtain the probability values for differences between treatments on a particular day when tests were significant for bST- pregnancy status-day and for bST-FO-day interaction.

113

Abundances of IGF-I, IGF-II, IGFBP-2, IGFBP-3 mRNA in Northern blots were

analyzed using the GLM procedure of SAS. The main effects of treatment (C, FO, P,

bST-C, bST-FO, and bST-P), gel and the interaction of treatment-gel were examined with

the abundance values for GAPDH mRNA used as a covariate to adjust for loading gel

differences. Pre-designed orthogonal contrasts were used to compare treatment means

(bST, pregnancy status, and bST-pregnancy status interaction or bST, FO, and bST by

FO interaction).

Total contents of GH, IGF-I, IGFBP-3, and IGFBP-4 in ULF were analyzed using the GLM procedure of SAS. The mathematical models included the main effects of

treatment (C, FO, P, bST-FO, bST-C, and bST-P) and orthogonal contrasts were used to

compare treatment means (bST, pregnancy status, and bST-pregnancy status interaction

or bST, FO, and bST by FO interaction).

Results

Weight, BCS, and Milk Production before the Start of Synchronization

Weekly measurements of BCS and body weight and daily measurements of milk

production were recorded starting at 10 DIM until cows were sacrificed. Regression

analysis did not detect a difference between treatments for body weight or BCS. Body

weight followed a cubic pattern as described by the following equation: ŷ = 630.87 -

2 3 2 1.999x + 0.0443x - 0.00025x , where ŷ = body weight and x = DIM; P < 0.01, R reg =

0.18. The BCS followed a quartic pattern as described by the following equation: ŷ =

3.35 - 0.036x + 0.0012x2 - 0.000015x3 + 0.000000065x4, where ŷ = BCS and x = DIM; P

2 < 0.01, R reg = 0.28. Third order milk production curves between cows fed the FO and control diets differed with cycling cows fed FO producing as much as 3 kg more milk

than cyclic control-fed cows (FO: ŷ = 13.12 + 0.923x - 0.0117x2 + 0.000045x3; Cyclic

114

control-fed cows: ŷ = 16.51 + 0.808x - 0.0137x2 + 0.000085x3, where ŷ = milk

2 production and x = DIM; P < 0.01, R reg = 0.46; Figure 4-2).

Ovarian and Uterine Responses before the Start of Synchronization

The number of class 1 follicles was greater (P < 0.05) in cows fed FO compared to

cyclic control-fed cows (34.5 ± 2.4 vs. 28.0 ± 1.2, respectively). The number of class 2

follicles (3.9 ± 0.3), class 3 follicles (2.3 ± 0.2), number of CL (0.5 ± 0.1), CL size (199 ±

19 mm3), size of the largest follicle (15.1 ± 0.8 mm), size of the nonpregnant uterine horn

(2.9 ± 0.1 cm) and size of the previous pregnant uterine horn (3.1 ± 0.1 cm) were not

affected by FO. As expected, the number of follicles, number of CL, CL size, size of

largest follicle, size of nonpregnant uterine horn, and size of previous pregnant uterine

horn differed according to DIM (P < 0.01). However, regression curves did not differ

between treatments in relation to DIM (i.e., x) so the overall pooled regression equations

and R2 values are presented for the respective variables (i.e., ŷ). The number of class 1

2 follicles (ŷ = 25.02 + 0.263x, P < 0.01, R reg = 0.08) and class 2 follicles (y = 2.51 +

2 0.0496x, P < 0.01, R reg = 0.05) increased linearly with DIM. Regression analysis

revealed second order curvilinear relationship for number of class 3 follicles (ŷ = -0.03 +

2 2 2 0.135x - 0.0019x , P < 0.01, R reg = 0.05), number of CL (ŷ = -1.11 + 0.096x - 0.0014x ,

2 2 2 P < 0.01, R reg = 0.13), CL size (ŷ = -496.60 + 40.356x - 0.5372x , P < 0.01, R reg =

2 2 0.17), and size of largest follicle (ŷ = 9.12 + 0.297x - 0.00242x , P < 0.01, R reg = 0.08) in relation to DIM. The size (cm) of the previous pregnant (ŷ = 4.25 - 0.044x, P < 0.01,

2 2 R reg = 0.19) and nonpregnant uterine horns (ŷ = 3.46 - 0.023x, P < 0.01, R reg = 0.08)

decreased linearly with DIM.

115

Concentrations of Plasma and ULF Hormones before the Start of Synchronization

Beginning on d 14 ± 3 until d 44 ± 3 postpartum, blood samples were collected

twice weekly from 36 cows (9 FO and 27 control-fed). Insulin concentrations increased

linearly with increasing DIM, with the cyclic control-fed cows increasing at a faster rate

2 (ŷ = 0.56 + 0.011x, P < 0.01, R reg = 0.14) compared with cows fed FO (ŷ = 0.75 +

2 0.0012x, P < 0.01, R reg = 0.14; Figure 4-3). Regression analysis of plasma GH, IGF-I,

and progesterone concentrations over DIM did not detect differences between dietary

treatments. The overall pooled regression equations with DIM (i.e., x) are presented.

Both GH and IGF-I concentrations had a linear relationship to DIM with GH

2 concentrations decreasing (ŷ = 7.46 - 0.042x, P < 0.01, R reg = 0.04; Figure 4-4) and IGF-

2 I concentrations increasing over time (ŷ = 85.27 + 0.922x, P < 0.01, R reg = 0.05; Figure

4-4). A second order curve was detected for progesterone concentrations in relation to

2 2 DIM (progesterone: ŷ = -3.54 + 0.281x - 0.0036x , P < 0.01, R reg = 0.19). Pattern for

accumulated progesterone concentrations (ŷ = 4.90 - 0.714x + 0.0287x2 - 0.00017x3, P <

2 0.01, R reg = 56.04), days to first ovulation (23.5 ± 2.4 d) and percent of cows cycling

before the start of presynchronization (51.9 ± 13.3%) were not different between cows

fed diets of 0 or 1.9% FO.

Milk Production after an Induced Ovulation

Treatment with bST increased milk production (P < 0.01) described by second

order curves (i.e., bST vs. C) during days of the synchronized estrous cycle (ŷ = 33.30 -

2 2 0.125x - 0.0029x , ŷ= bST and x = days of the estrous cycle; R reg = 0.06; Figure 4-5).

The bST given on d 0 and 11 relative to AI, increased milk production as much as 7 kg/d

compared with cows not injected with bST.

116

Ovarian Responses after an Induced Ovulation

Ovarian structures were measured by ultrasonography on d 0 (day of synchronized ovulation), 7, 9, 11, 13, 15, 16, and 17 in 5 C, 4 FO, 4 P, 6 bST-C, 4 bST-FO, and 5 bST-

P cows, respectively. No differences among treatments were detected for the mean number of class 3 follicles (2.6 ± 0.4), size of the largest follicle (19.1 ± 1.0 mm), size of the second wave follicle (10.8 ± 1.3 mm), and number of CL (1.1 ± 0.1). Pregnant cows tended (P < 0.10) to have greater volume of CL tissue compared with cyclic cows fed the control diet (10742 ± 722 vs. 8803 ± 681 mm3). From d 9 to 16 post AI, the number of class 1 follicles was influenced by bST injection and pregnancy status. Of those cows fed the control diet, giving bST to cows that were pregnant resulted in an increase in the number of class 1 follicles whereas those that were pregnant without a bST injection had a decrease in the number of class 1 follicles; cyclic cows had no change in this number

(bST by pregnancy by day interaction, P < 0.05). Pregnant cows tended to have more class 2 follicles on d 13 and 16 compared with cyclic cows fed the control diet (6.3 ± 0.8,

5.3 ± 0.8 vs. 3.2 ± 0.7, 3.4 ± 0.7, respectively) but numbers were not different at the other days (pregnancy status by day interaction; P < 0.10).

Plasma and ULF Hormone Concentrations after an Induced Ovulation

Daily blood samples were collected from d 0 (day of synchronized ovulation) to d

17 after estrus from 28 cows (n = 5 for C, 4 for FO, 4 for P, 6 for bST-C, 4 for bST-FO and 5 for bST-P). Feeding FO did not alter progesterone concentrations in plasma.

Pregnant cows tended (P < 0.10) to have lower progesterone concentration between d 0 and 11 compared to cyclic control-fed cows (pregnancy by day interaction; Figure 4-6).

Also bST (P < 0.05) lowered progesterone concentrations in plasma for cyclic and

117 pregnant cows fed the control diet relative to comparable cows not injected with bST

(Figure 4-7).

The bST injections increased (P < 0.01) mean concentration of plasma GH in bST-

C, bST-FO, and bST-P cows compared with the non-bST injected C, FO, and P cows

(14.2 ± 1.1, 20.0 ± 1.2 and 20.5 ± 1.2 ng/mL vs. 6.0 ± 1.1, 6.7 ± 1.2 and 5.9 ± 1.3 ng/mL, respectively; Figure 4-8). There were significant (P < 0.05) interactions between cyclic cows fed the control or FO diet and also between cyclic cows fed the control diet and pregnant cows. Administration of bST increased mean GH concentrations in bST-C but not to the extent of bST-FO and bST-P cows (14.2 ± 1.1 vs. 20.0 ± 1.2, 20.5 ± 1.2, respectively; Figure 4-8). Associated with increases in plasma GH were increases (P <

0.01) in IGF-I for both bST-C and bST-P groups in contrast with C and P groups (211 ±

17 and 261 ± 18 ng/mL vs. 152 ± 17 and 150 ± 19 ng/mL respectively; Figure 4-9). The curves of the concentration of plasma IGF-I for the bST-P and bST-C groups followed different fourth-order patterns with the pregnant cows maintaining their peak concentration the last wk of measurement (pregnancy by day interactions; P < 0.05;

Figure 4-9). In addition, injecting bST into cows fed the control diet resulted in a gradual rise in concentration of plasma IGF-I from d 0 to d 8 followed by a gradual decrease compared to a fairly constant and lower concentration of circulating IGF-I in cows injected with bST and fed FO (bST-C vs. bST-FO by day interaction, P < 0.05; Figure 4-

10). Mean concentrations of plasma insulin decreased (P < 0.01) in both FO and bST-FO treatments compared with both C and bST-C cows (0.9 ± 0.1 and 1.0 ± 0.1 vs. 1.5 ± 0.1 and 1.2 ± 0.1 respectively) with a tendency for a bST-by-fish oil interaction (P ≤ 0.10;

Figure 4-10).

118

Ovarian and Uterine Responses at Day 17

On d 17, at the time the reproductive tract was recovered, CL (n = 5 for C, 4 for

FO, 4 for P, 6 for bST-C, 4 for bST-FO, and 5 for bST-P) were counted, measured, and

weighed. No differences were detected among treatment groups for the weight of the CL.

Injecting bST tended to reduce the number of CL in the cyclic control-fed cows while

increasing the number of CL in the fish oil-fed cows and in the pregnant control-fed cows

(Table 4-3). Volume of the CL was increased (P < 0.01) in pregnant compared with

cyclic cows fed the control diet (11,171 vs. 7686 mm3; Table 4-3).

Uterine luminal flushings were collected at the time of slaughter on d 17 from 28

cows (n = 5 for C, 4 for FO, 4 for P, 6 for bST-C, 4 for bST-FO and 5 for bST-P) for

analysis of GH and IGF-I concentrations. Volumes and protein content of ULF did not differ due to pregnancy status, diet or bST treatment. Total amounts of GH or IGF-I in the ULF did not differ (Table 4-3).

Pregnancy Rates, Conceptus Sizes, IFN-τ mRNA and Protein, and ISG-17 Protein at Day 17

Pregnancy rate at d 17 tended to increase (P < 0.09) due to bST (83.3%; 5 of 6) compared with non-bST-treatment (40.0%; 4 of 10). Not only were pregnancy rates increased in bST-treated cows, the conceptuses that survived to d 17 in the bST-P cows

tended to have a greater (P < 0.09) mean length (45.4 ± 4.5 cm) than P cows (34.3 ± 5.1

cm). Furthermore, the amount of IFN-τ in the ULF from bST-P cows was almost two times greater (P < 0.05) at 9.4 µg/total ULF compared with 5.3 µg/total ULF in P cows

(Table 4-3). However, differences in IFN-τ amount were not different when adjusted for

conceptus length as a covariate. The relative abundance of IFN-τ mRNA in conceptus

119 tissue and the amount of interferon stimulated gene-17 protein in the endometrial tissue on d 17 was not affected by bST injections (Table 4-3).

Endometrial mRNA Expression of the GH-IGF-I System at Day 17

Northern blot analyses were used to probe the endometrial tissue from d 17 sacrificed cows for GHR-1A, IGF-I, IGF-II, IGFBP-2, and IGFBP-3. The GHR-1A was undetectable in the endometrium of all animals. The mRNA transcript sizes for IGF-I,

IGF-II, IGFBP-2 and IGFBP-3 were 7.5, 4.6, 1.7, and 2.8 Kb, respectively. The IGF-I mRNA was lower (P < 0.01) in pregnant cows and tended to be lower (P < 0.06) in cycling cows fed FO compared with cows fed the control diet (Table 4-3). Within control-fed animals, pregnancy and bST increased (P < 0.01) IGF-II mRNA. Injecting bST caused an increase in endometrial IGF-II mRNA for cycling cows fed the control diet but not for those fed the FO (diet by bST interaction, P < 0.01).

When only cycling cows were considered, those injected with bST had less IGFBP-

2 mRNA in their endometrial tissue than those not injected with bST (54 vs. 99 AU, respectively). Treatment of bST in cows that became pregnant resulted in greater

IGFBP-2 mRNA in endometrium (121 vs. 79 AU) which bST treatment in cycling cows caused lower IGFBP-2 mRNA (51 vs. 80 AU; bST by pregnancy interaction, P < 0.05).

There was a significant decrease (P < 0.05) in IGFBP-2 mRNA among bST-treated cyclic cows fed a control or fish oil diet; however, there was an interaction (P < 0.05) between pregnant cows and cyclic cows fed a control diet with bST increasing IGFBP-2 mRNA in pregnant cows but decreasing IGFBP-2-mRNA in cyclic control-fed cows. No differences among treatments were detected for IGFBP-3 mRNA.

120

Analysis of ULF for IGFBP at Day 17

Ligand blot analyses for IGFBP were conducted on ULF from 28 cows at d 17 post

AI. Total ULF protein did not differ among treatment groups. Four distinct IGFBP bands were detected from 44 to 24 kDa (Figure 4-11). Treatment did not affect IGFBP-3

(44 and 40 kDa) or IGFBP-4 (28 and 24 kDa; Table 4-3); this may have been due to great variability among cows as shown in Figure 4-11.

Simple and Partial Correlations for the GH-IGF System at Day 17

Correlations were not detected between IGF-I in ULF and circulating

concentrations of IGF-I or between GH in the ULF and circulating concentrations of

plasma GH at d 17. However, a series of simple (r) and partial (pr) correlations were

detected (P ≤ 0.05). Concentrations of plasma GH were correlated positively with IGF-I in plasma (r = 0.37; partial correlation adjusted for treatment [pr = 0.51]). The IGF-I in

plasma was associated positively with insulin (r = 0.38; pr = 0.46) and plasma progesterone (r = 0.36; pr = 0.72). Progesterone concentrations in plasma were correlated positively with plasma insulin concentrations (r = 0.42; pr = 0.56) and negatively correlated with IGFBP-4 in the ULF (pr = -0.44). The GH in the ULF was associated positively with IGF-I in the ULF (r = 0.94; pr = 0.94). The IGFBP-2 mRNA was positively correlated with IGF-I (pr = 0.49), IGF-II (r = 0.53; pr = 0.50), IGFBP-3 mRNA (r = 0.53; pr = 0.57) and concentrations of plasma insulin (r = 0.51; pr = 0.62).

Amount of IGFBP-3 protein was associated positively with IGFBP-4 protein in the ULF

(r = 0.60; pr = 0.57). The IGF-I mRNA expression was associated positively with IGF-II mRNA expression (r = 0.59; pr = 0.88). Although correlations are not proof of causative effects, significant associations were detected among hormonal components and uterine

121

gene expression of the GH-IGF system at d 17 in fish oil fed, control-fed, and cyclic and

pregnant animals treated differentially with bST.

Discussion

Dietary supplementation with FO increased milk production compared with cows fed lipid in the form of whole cottonseeds during the postpartum period before TAI or

bST treatment (Figure 4-2). Previous studies reported an increase (Keady et al., 2000;

Donovan et al., 2000) or no effect on milk production (Jones et al., 2000; Petit et al.,

2004) when FO-enriched diets were fed. Although milk yield increased, BCS and BW were not influenced by diet.

Pregnancy rate, length of conceptus and amount of IFN-τ in ULF were increased by bST administration at TAI and again 11 d later following an Ovsynch protocol (Table 4-

3). Previous field experiments reported that pregnancy rates were increased in cyclic, lactating dairy cows when bST was injected at the initiation of the Ovsynch protocol or at the time of insemination (Moreira et al., 2000b, 2001; Morales-Roura et al., 2001; Santos et al., 2004b). Both GH and IGF-I had beneficial effects on embryo development in vitro

(Moreira et al., 2002b) and injection of bST at insemination in superovulated donor cows advanced embryo development (Moreira et al., 2002a). The beneficial effects of bST on early embryo development appear to be extended to latter stages of development approaching the critical period when the conceptus secretes IFN-τ for maintenance of the

CL. Due to the bST-induced increase in conceptus length, amount of IFN-τ in ULF increased which may have contributed to the bST-induced increase in pregnancy rate.

Injections of bST increased IGF-I concentrations in plasma (Figure 4-9) and this increase may have compensated for an inadequate concentration of IGF-I in high- producing dairy cows resulting in improved fertility. In chapter 3, pregnancy rate was

122

decreased in nonlactating dairy cows when bST was injected at TAI and 11 d later. This

negative effect appeared to be due to a hyperstimulation of IGF-I concentrations.

Pregnancy rate was high in the non bST-treated control group whose basal concentrations

of plasma IGF-I approximated those observed in the present study in lactating cows

injected with bST. In contrast, the lactating control cows with lower fertility had low

concentrations of IGF-I. In other target populations of cattle, such as nonlactating dairy

heifers (Rorie et al., 2004) and lactating beef cattle (Bilby et al., 1999), in which plasma

IGF-I would be at greater concentrations than in lactating dairy cattle (Bilby et al., 1999),

exogenous bST appears to have no beneficial effect or even negative effects on

pregnancy rate.

There appears to be a threshold concentration of IGF-I associated with increased

fertility, and elevation of IGF-I beyond this threshold concentration may have a negative

impact on pregnancy rate. The reason for the beneficial effects of bST injections in some

inseminated cows and not others, may reflect differences in among-cow sensitivity to bST regarding IGF-I secretion. This sensitivity is likely influenced by physiological (i.e., lactation) and nutritional statuses. The combination of increased IGF-I concentrations and localized production of IFN-τ in bST-treated cows have profound effects on the antiluteolytic mechanisms involved with maintenance of the CL (Chapter 5).

Injections of bST twice at an interval of 11 d sustained concentration of plasma GH for the entire 17-d period until slaughter as anticipated. Concentrations of GH were greater in P cows and those fed FO compared to cycling cows not fed FO (Figure 4-8).

Growth hormone has been shown to “crosstalk” via signal transduction systems with

PPARα, which is a nuclear transcription factor found in hepatocytes that can be activated

123

by PUFAs to activate or repress expression of various genes (Khan and Vanden Heuvel,

2003). Through PPARα, dietary FO may decrease GH receptor expression such that

basal concentrations of plasma GH remain greater in bST-injected cows. Such an effect

may be reflected in a differential response of IGF-I concentrations. Indeed

concentrations of plasma IGF-I in FO-fed cows was lower than either pregnant or cyclic

cows when injected with bST (Figure 4-9). This may reflect a decreased sensitivity of

the liver to GH in cows fed FO and injected with bST. Milk yield increased due to bST

injections as a main effect during the 17 d period before sacrifice (Figure 4-5).

Not only did feeding FO have interacting effects on the GH-IGF-I system but it

also chronically reduced insulin concentrations in plasma throughout the experiment

beginning approximately 2 wk after initiating full feeding of the FO diet (Figure 4-3).

Feeding increasing amounts of calcium salts of LCFA (Choi et al., 1996) caused a linear decrease in plasma insulin concentrations. In a review by Staples et al. (1998), 7 of 9 studies that fed fat reported decreased plasma insulin concentrations. In rodents, feeding n-3 long chain PUFA, as compared to a high fat diet, lowered concentrations of plasma insulin by sustaining glucose transporter protein GLUT4 receptors in the muscle, by preventing decreased expression of GLUT4 in adipose tissue, and by inhibiting both activity and expression of liver glucose-6-phosphatase that increased glucose uptake and metabolism (Delarue et al., 2004).

Increased insulin levels stimulate a subsequent increase in the amount of GHR in both the liver and adipose tissue of lactating dairy cows (Rhoads et al., 2004).

Continuous intraperitoneal infusions of insulin into diabetic human patients increased plasma GH binding protein and restored the responsiveness of GH to normal levels

124

(Hanaire-Broutin et al., 1996). In rats, diabetes leads to reduced liver GH binding, and insulin therapy restores GH binding to normal levels (Baxter et al., 1980). Since plasma insulin was reduced due to FO in the present study, GHR, GH binding protein and GH binding sensitivity may be reduced compared with control-fed cows accounting for the increase in plasma GH without a subsequent rise in plasma IGF-I in FO versus control- fed cows. The reduction in insulin may also account for the increase in the number of class 1 follicles in FO-fed cows prior to synchronization. Insulin-like growth factor-I is a potent stimulator of bovine granulosa cells in vitro (Spicer et al., 1993) and bovine granulosa cells tended to produce less IGF-I when cultured with insulin and GH.

Therefore, suppression of insulin through the feeding of FO may allow IGF-I to positively affect follicle development and possibly other reproductive responses.

Progesterone concentrations in plasma were unaffected by feeding FO both before and after synchronization. However, bST treatment lowered progesterone from d 6 through d 17 post AI (Figure 4-7). Injections of bST are reported to lower progesterone concentrations (Kirby et al., 1997a) in dairy cows which may be due to decreased CL function perhaps by reducing the number of LH receptors (Pinto Andrade et al., 1996), by down-regulating somatotropin receptor mRNA in luteal cells (Kirby et al., 1996), and

(or) by increasing overall metabolism associated with increased DMI and milk production (Etherton and Bauman, 1998) thereby increasing progesterone clearance

(Sangsritavong et al., 2002).

Not only did bST treatment lower progesterone concentration but pregnancy was associated with lower progesterone concentration for the first 11 d following Ovsynch

(Figure 4-6). This same phenomenon was seen in nonlactating dairy cows utilizing the

125

same synchronization protocol (Chapter 3) except the reduction in progesterone was from

d 11 to 17 and was attributed to a possibly greater clearance rate of progesterone by the

uterus of pregnant cows. This is contradictory to earlier reports where uninseminated and

inseminated, but not pregnant, nonlactating dairy cows had a slower rise in plasma

progesterone compared with pregnant, nonlactating dairy cows during the first 16 d

following insemination (Mann and Lamming, 2001). In their study, however, cows were

administered two injections of PGF2α, 11 to 13 d apart, and inseminations occurred 72 or

96 h after the second injection. Their reproductive management system probably did not

induce as precise a timing of ovulation as the system used in the present study. Lack of follicular synchronization and reduced synchrony in CL formation may have contributed to differences in progesterone concentrations between pregnant cows and non-pregnant cows.

Even though progesterone concentrations were less in P cows of the present study,

CL tissue volume was increased from d 7 to 17 and CL tissue volume was increased at

the time of slaughter in P cows (Table 4-3). This could be a result of luteotrophic effects

of PGE2 produced from the embryo/conceptus on CL tissue growth (Arosh et al., 2004).

Components of the GH-IGF system can stimulate early embryo (Moreira et al.,

2000a, 2000b) and fetal development (Gluckman, 1995), and regulate both

preimplantation (Wathes et al., 1998) and placental development (Baker et al., 1993).

Most components of the GH-IGF system can in turn be regulated through nutrition

(Thissen et al., 1994). In this study, genes of the GH and IGF-I family were investigated

to examine the effects of bST, pregnancy and FO (Table 4-3). Because the study had no

pregnant cows fed FO, statistical comparisons could not be made between FO-fed cows

126

and pregnant cows. Differential responses between FO and cyclic control-fed cows can

be made, and whether such differences reflect a pregnancy like response can be inferred

and warrant further investigation. The IGF-I mRNA in endometrial tissue decreased in

pregnant cows fed the control diet and tended to decrease in cows fed FO compared with

cyclic cows fed the control diet. In contrast, IGF-II mRNA was increased in control-fed

cows that were either pregnant or injected with bST, and feeding FO increased IGF-II mRNA without an additive effect of bST. The IGF-I and -II gene responses to FO mimicked those of the pregnant state. Perhaps FO provides a more conducive intrauterine environment for embryo development that enhances embryonic survival.

Both IGF-I and IGF-II can stimulate the development of cultured preimplantation blastocysts (Kaye et al., 1992) and embryonic production of IFN-τ (Ko et al., 1991), and are important for fetal development (Gluckman 1995). Geisert et al. (1991) also showed that endometrial IGF-II mRNA increases in pregnant cows during this time as the uterus is prepared for ensuing implantation. Pregnant cows in the current study had elevated

IGFBP-2 mRNA when injected with bST but nonpregnant cows had reduced IGFBP-2 mRNA when injected with bST. The increase in IGF-II mRNA was correlated with the increase in IGFBP-2 mRNA which may be associated with an increase in IGFBP-2

protein in the endometrium to increase delivery of newly synthesized IGF-II to the

overlying developing conceptus in preparation for implantation and placentation.

The differential dynamics of IGF-I, IGF-II, and IGFBP-2 expression of mRNA

between cyclic and pregnant cows, in addition to responsiveness to bST injections, may reflect direct conceptus-induced alterations in regulation of gene expression due to such agents as IFN-τ, or indirect conceptus-induced alterations within the endometrium (i.e.,

127

ISG-17, STAT factors 1 and 2 [Stewart et al., 2001], β2 microglobulin [Vallet et al.,

1991] interferon regulatory factor -1 [Spencer et al., 1998], Mx protein [Ott et al., 1998], ubiquitin cross reactive protein [Johnson et al., 1999] granulocyte-chemotactic protein-2

[Teixeira et al., 1997] and 2`, 5` - oligoadenylate synthase [Johnson et al., 2001]) that effect responsiveness to FO and bST injections. Spencer et al. (1999) demonstrated that injection of ewes with IFN-τ was necessary to induce endometrial responsiveness to placental lactogen and GH.

Treatments did not differ in endometrial IGFBP-3 mRNA. This result was not unexpected since IGFBP-3 is produced mainly in the liver and is a major transporter of

IGF-I in the peripheral circulation. Not only were there no treatment differences for

IGFBP-3 mRNA expression but there were also no differences in IGFBP-3 or IGFBP-4 protein abundance in the ULF. This was attributed to the large among cow variation and due to the fact that IGFBP may be reduced due to prolonged progesterone exposure.

Pershing et al. (2003) reported substantial amounts of IGFBP in the ULF of lactating dairy cows on d 3 but not on d 7 of a synchronized estrus. Lee et al. (1998) suggested that the loss of IGFBP during diestrus was likely a result of luminal proteolytic cleavage rather than decreased endometrial gene expression of IGFBP. Also, since in this study

IGFBP-3 and IGFBP-4 were positively correlated with each other and IGFBP-4 was negatively correlated with plasma progesterone, one may infer that with increasing concentration of progesterone there is a subsequent decrease in IGFBP in the ULF.

The observed effects of consuming FO on endometrial responses suggest that the uterus does indeed respond to the EPA and DHA fatty acids as candidate ligands that regulate gene expression. Feeding FO increased the amount of EPA and DHA in the

128 endometrium, liver, and mammary tissue and DHA was significantly increased in the milk fat compared with control-fed cows (Chapter 6). Thus these ligands are available to target tissues once absorbed from the digestive tract.

Conclusions

High-producing dairy cows appeared to be deficient in IGF-I which is a potent stimulator of embryo/conceptus growth. Treatment with bST increased plasma IGF-I concentrations to possibly optimal concentration resulting in an increased pregnancy rate due to an increase in conceptus length and enhanced production of the anti-luteolysin,

IFN-τ. Treatment with bST caused a co-stimulation in steady state concentrations of endometrial IGF-II mRNA that may ultimately support continued development of the conceptus and prepare the endometrium for implantation and placentation. Delivery of supplemental UFA to the lower gut for absorption may target reproductive tissues to regulate reproductive function and fertility. Not only did feeding calcium salts of FO increase milk production but also altered gene expression of IGF-I and IGF-II in the endometrium and metabolic hormones (insulin, GH, and IGF-I) in a manner that may be beneficial to pregnancy.

Interactions between a pharmaceutical (i.e., bST) and a nutraceutical (i.e., FO) in which differential bST responses were observed in the uterus and the peripheral system warrants further investigation. The objective of Chapter 5 was to explore the mechanisms by which bST, FO, and pregnancy effect components of the PG cascade.

129

Table 4-1. Ingredient and chemical composition of diets containing 0 or 1.9% calcium salts of fish oil enriched lipid product (FO).

Composition 0% FO 1.9% FO Ingredients,% of DM Corn silage 30.2 30.2 Alfalfa hay 7.5 12.0 Cottonseed hulls 4.9 4.9 Citrus pulp … 5.2 Soy plus 6.3 5.8 Corn meal 23.9 18.5 Soybean meal 7.6 11.0 Whole cottonseeds 14.8 5.8 Mineral and vitamin mix1 4.8 4.8 Ca salt of FO2 … 1.9 Chemical composition 3 NEL Mcal/kg of DM 1.66 1.68 CP,% of DM 16.8 17.1 CP-RDP,% of DM 10.7 10.9 CP-RUP,% of DM4 6.1 6.2 ADF,% of DM 22.6 21.4 NDF,% of DM 33.7 31.2 Lignin,% of DM 5.4 4.7 Ether extract,% of DM 6.0 5.2 NFC,% of DM5 34.4 35.8 Ash,% of DM 9.1 10.7 Ca,% of DM 1.29 1.9 P,% of DM 0.41 0.38 Mg,% of DM 0.53 0.5 K,% of DM 1.34 1.45 Na,% of DM 0.93 0.98 S,% of DM 0.26 0.3 Fe, mg/kg of DM 109 131 Zn, mg/kg of DM 194 199 Cu, mg/kg of DM 56 68 Mn, mg/kg of DM 103 133 1 Mineral mix contained 26.4% CP, 1.74% fat, 10.15% Ca, 0.90% P, 3.1% Mg, 8.6% Na, 5.1% K, 1.5% S, 4.1% Cl, 2231 mg/kg of Mn, 1698 mg/kg of Zn, 339 mg/kg of Fe, 512 mg/kg of Cu, 31 mg/kg of Co, 26 mg/kg of I, 7.9 mg/kg of Se, 67,021 IU/kg of vitamin A, 19,845 IU/kg of vitamin D, and 357 IU/kg of vitamin E (DM basis). 2 EnerG II Reproduction Formula, Virtus Nutrition, Fairlawn, OH. 3 Calculated using NEL values published by NRC (2001). 4 Calculated using ruminally undegradable protein values for individual feedstuffs as given by 2001 NRC. 5 Calculated as (% NFC = 100% -% CP -% NDF -% fat -% ash).

130

Presynch Ovsynch Ultrasound

-27 -20 -10 -3 -10 7 9 11 13 15 16 17 Detect estrus 16 h Daily blood samples GnRH PG GnRH PG GnRH ±TAI

(d44 ± 5 DIM) (d77 ± 12 DIM) ± bST Sacrifice (d94 ± 12 DIM)

Figure 4-1. Experimental protocol illustrating the sequence of injections, collection of samples, and day of ultrasonography. Day 0 represents the time of ovulation from an induced LH surge. Presynch = Presynchronization, PG = PGF2α, TAI = timed AI

131

Table 4-2. Bovine IFN-τ primers and probe sequences used for quantitative real-time reverse transcription-PCR. Primer/ Sequence Probe* (5' to 3') IFN-τ SE TGCAGGACAGAAAAGACTTTGGT IFN-τ AS CCTGATCCTTCTGGAGCTGG IFN-τ Probe TTCCTCAGGAGATGGTGGAGGGCA *SE = sense primer (5' primer), AS = antisense primer (3' primer), Probe was synthesized with a FAM reporter dye and BHQ-1 quencher.

132

) 30

Milk production (kg) production Milk 10

0 10 13 16 19 22 25 28 31 34 37 40 43 46 49 52 55 58 61 64 67 DIM

Figure 4-2. Regression analysis (third order curves) of daily milk production starting 10 DIM until the start of bST treatment and timed AI for cows fed either 0 (Least squares means: ■ ) or 1.9% (Least squares means: □ ) calcium salt of fish oil enriched lipid diets. Pattern of regression curves were different (P < 0.01).

133

1.8 1.6 1.4 1.2 1.0 0.8 0.6

Plasma insulin (ng/ml) 0.4 0.2 0.0 14 17 20 23 26 29 32 35 38 41 44 47 50 53 DIM

Figure 4-3. Linear regression of plasma insulin concentrations for cows fed fish oil enriched lipid (FO) at 0 (Least squares means:■) or 1.9% (Least squares means: □) of dietary DM from 14 to 53 DIM. Feeding FO decreased plasma insulin concentrations compared with control cows in relation to DIM (P < 0.01).

134

9 160

8 140 Plasma IGF-Iconcentrations (ng/ml) 7 120 6 100 5 80 4 60 3 40 2 Plasma GH concentrations (ng/ml) GH concentrations Plasma 1 20 )

0 0 14 17 20 23 26 29 32 35 38 41 44 47 50 53 DIM

Figure 4-4. Overall pooled linear regression equations of GH (Least squares means:■) and IGF-I (Least squares means: □ ) plasma concentrations from 14 to 53 DIM for all cows fed either 0 or 1.9% calcium salt of fish oil enriched lipid diets. No effect of fish oil feeding on plasma GH or IGF-I concentrations, however, a positive linear relationship was detected for IGF-I (P < 0.01) and a negative linear relationship for GH (P < 0.01) in relation to DIM.

135

45 40 35 ) 30 25 20 15 Milk Production (kg) Production Milk 10 5 0 01234567891011121314151617 Days After GnRH (estrus)

Figure 4-5. Regression analysis (second order curves) of daily milk production from d 0 to 17 of a synchronized estrous cycle (d 0) for cyclic and pregnant cows fed the control diet and injected with bST (Least squares means: □ ) or not (Least squares means: ■ ) on d 0 and 11. Pattern of regression curves were different (P < 0.01).

136

8 Cyclic 7 Pregnant 6 5 ** 4 3 ± bST 2 ± bST

Plasma progesterone (ng/ml) progesterone Plasma 1 0 01234567891011121314151617 Days after GnRH (estrus)

Figure 4-6. Concentrations of plasma progesterone of cyclic cows injected or not injected bST (n = 11) (∆) and pregnant cows injected or not injected with bST (n = 10) (□), measured from d 0 to 17 of a synchronized estrous cycle differed (P < 0.05) between d 0 and 11. All cows were fed the control diet. Concentration of progesterone at the day designated with a ** differed at P < 0.05 using PDIFF option of PROC MIXED.

137

) 7 * 6 ** ** 5 4 ** 3 2

Plasma progesterone (ng/ml progesterone Plasma 1 0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Days after GnRH (estrus)

Figure 4-7. Concentrations of plasma progesterone of cyclic and pregnant cows not given bST (n = 10) (□) and those given bST (n = 11) (▲) collected from d 0 to 17 of a synchronized estrous cycle differed (P < 0.05). All cows were fed the control diet. Concentrations of progesterone at days designated with * differed at P < 0.10 or with ** differed at P < 0.05 using PDIFF option of PROC MIXED.

138

35 ± bST 30

) 25

20 ± bST

Plasma GH (ng/ml 10

0 0 1 2 3 4 5 6 7 8 9 1011121314151617 Days after GnRH (estrus)

Figure 4-8. Profiles of plasma GH concentrations of cyclic cows fed control diet (no bST) ( ∆ ), cyclic cows fed control diet with bST injections ( ▲ ), cyclic cows fed FO (- -x- -), cyclic cows fed FO with bST injections (- -o- -), pregnant cows fed control diet (no bST) ( □ ), and pregnant cows fed control diet with bST injections ( ■ ) from d 0 to 17 of a synchronized estrous cycle. All three groups of cows given bST had greater mean GH concentrations than cows not injected with bST (P < 0.01). Of those given bST, cows fed FO and pregnant cows had greater mean GH concentrations than cyclic cows fed the control diet (P < 0.05). Pooled standard errors for bST-treated cows = 3.31 and non-bST treated cows = 1.13.

139

350

300

) 250

200

150

Plasma IGF-I (ng/ml) IGF-I Plasma 100

50 ± bST ± bST

0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Days after GnRH (estrus)

Figure 4-9. Profiles of plasma IGF-I concentrations of cyclic cows fed control diet (no bST) ( ∆ ), cyclic cows fed control diet with bST injections ( ▲ ), cyclic cows fed FO (- -x- -), cyclic cows fed FO with bST injections (- -o- -), pregnant cows fed control diet (no bST) ( □ ), and pregnant cows fed control diet with bST injections ( ■ ) from d 0 to 17 of a synchronized estrous cycle. All three groups of cows given bST had greater mean IGF-I concentrations than cows not injected with bST (P < 0.01). The FO-fed cows injected with bST had less IGF-I plasma concentrations (P < 0.05) and pregnant cows injected with bST had greater IGF-I plasma concentrations than cyclic cows fed the control diet with bST injections (P < 0.05) as detected by Homogeneity of Regression. Pooled standard errors for bST-treated cows =29.9 and non-bST treated cows = 22.2.

140

1.8 No bST 1.6 bST ) 1.4 1.2 1 0.8 0.6 0.4 Plasma Insulin (ng/ml) 0.2 0 CFOP

Figure 4-10. Plasma insulin concentrations of cyclic cows fed a control diet (C), cyclic cows fed the fish oil enriched diet (FO), and pregnant cows fed the control diet (P) from d 0 to 17 of a synchronized estrous cycle. Cows fed FO had less insulin concentrations than cyclic cows fed a control diet (P < 0.05).

Table 4-3. Least squares means and pooled SE for conceptus size, interferon tau (IFN-τ) mRNA (mean fold effect), IFN-τ (µg/total uterine luminal flushing [ULF]), IFN stimulated gene-17 (ISG-17) protein, number of corpora lutea (CL), CL tissue volume (mm3), CL weight (g), uterine endometrial mRNA, ULF protein expression, and hormone concentration at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and d 11. Arbitrary units (AU) were generated by densitometry. The mRNA results were adjusted using glyceraldehydes-3-phosphate dehydrogenase as a covariate. Treatments1 Contrasts2 bST bST Response3 C bST-C FO bST-FO P bST-P S.E. FO bST x FO P bST x P 40 83 Pregnancy rate, % … … … … … … … … … † … (4/10) (5/6) Conceptus size, cm … … … … 34.3 45.4 4.8 … … … … † … IFN-τ mRNA … … … … 1.8 1.6 0.5 … … … … NS … IFN-τ, µg/total ULF … … … … 5.3 9.4 1.2 … … … … * … ISG-17 protein … … … … 11.0 10.0 3.0 … … … … NS …

Number of CL 1.4 1.0 1.0 1.3 1.0 1.2 0.2 NS NS † NS NS † 141 CL volume, mm3 7242 8130 8641 10507 12568 9775 1404 NS NS NS ** NS NS CL weight, g 5.5 5.9 6.7 6.6 7.1 6.2 0.7 NS NS NS NS NS NS Endometrium IGF system IGF-I mRNA, AU 75 76 71 71 67 67 2.1 † NS NS ** NS NS IGF-II mRNA, AU 76 82 82 80 81 86 1.3 † NS ** ** ** NS IGFBP-2 mRNA, AU 80 51 118 58 79 121 10.0 NS * NS * NS * IGFBP-3 mRNA, AU 18 18 17 15 14 17 1.8 NS NS NS NS NS NS ULF IGF system GH, ng/ULF 8 9 13 17 9 8 4.7 NS NS NS NS NS NS IGF-I, ng/ULF 296 244 396 496 219 145 164 NS NS NS NS NS NS IGFBP-3, AU 43 37 124 60 58 14 41 NS NS NS NS NS NS IGFBP-4, AU 31 32 84 57 71 13 30 NS NS NS NS NS NS 1 bST-C = bST-cyclic, bST-FO = bST-fish oil, bST-P = bST-pregnant. 2 †P ≤ 0.10, *P ≤ 0.05, **P ≤ 0.01, NS = non-significant. 3 IGFBP = Insulin-like growth factor binding protein; GH = growth hormone.

142

1 2 3 4 5 6 7 8 9 10 11

44 kDa 40 kDa

28 kDa 24 kDa

Figure 4-11. Representative autoradiograph from ligand blot analysis of uterine luminal IGFBP at d 17 following an induced ovulation. In decreasing mass order, two forms detected were IGFBP-3 (44 and 40 kDa) and IGFBP-4 (28 and 24 kDa). Lanes 1 and 2 were from bST-treated pregnant cows, lanes 3 and 4 were from pregnant cows (no bST), lanes 5 and 6 were from cows fed a fish oil enriched lipid (FO) and injected with bST, lanes 7 and 8 were from cyclic cows fed FO (no bST), lanes 9 and 10 were from a bST-treated cyclic cow fed a control diet, and lane 11 was from a cyclic cow fed a control diet (no bST).

CHAPTER 5 PREGNANCY, BOVINE SOMATOTROPIN, AND DIETARY OMEGA-3 FATTY ACIDS IN LACTATING DAIRY COWS: II. GENE EXPRESSION RELATED TO MAINTENANCE OF PREGNANCY

Introduction

Early pregnancy loss in lactating dairy cattle can have devastating effects on the economic success of dairy farms (Santos et al., 2004a). Nearly 40% of pregnancy losses have been estimated to occur between d 8 to 17 following estrus. This is the critical time period during which the conceptus must produce sufficient quantities of IFN-τ to prevent pulsatile PG secretion and maintain the CL (Thatcher et al., 1995). Changing from a cyclic to a pregnant state not only depends on the production of antiluteolytic signals from the developing conceptus but also the capacity of the endometrium to respond to these signals, thus blocking pulsatile PGF2α production (Binelli et al., 2001b). Such communications between the conceptus and maternal units are not always successful, thus leading to early embryonic loss.

The endometrium plays a critical role in regulating the estrous cycle and establishment of pregnancy. Elevated concentrations of plasma progesterone during the late luteal phase of the estrous cycle caused down regulation of PR in the uterus (Spencer and Bazer, 1995; Wathes and Lamming, 1995; Robinson et al., 2001). Loss of PR in the uterus may activate OTR expression and subsequent luteolysis (Wathes and Lamming,

1995). However, an effect of pregnancy on epithelial PR expression prior to the time of luteolysis could not be detected in either ewes (Spencer and Bazer, 1995) or cows

(Robinson et al., 1999), probably because PR expression was very low. Conversely, ERα

143 144

concentrations are upregulated during luteolysis in sheep. However, it is not clear

whether this upregulation begins before or after the increase in OTR in the luminal

epithelium (Cherny et al., 1991; Wathes and Hamon, 1993).

In pregnant ewes, the expression of ERα also is suppressed during early pregnancy,

and it has been hypothesized that IFN-τ inhibits OTR upregulation by inhibiting a

preceding increase in ERα expression (Spencer and Bazer, 1995). Although the role of

PR and ERα in regards to OTR regulation is obscure, OTR certainly are suppressed by

IFN-τ secreted from the conceptus (Flint et al., 1992; Wathes and Lamming, 1995; Mann

et al., 1999). Intrauterine infusions of recombinant IFN-τ in cyclic ewes from d 11 to 16

post estrus had no effect on PGHS-2 expression in the endometrial epithelium (Kim et al.,

2003). In this latter study, it was suggested that antiluteolytic effects of IFN-τ are to

inhibit ERα and OTR gene transcription, thereby preventing endometrial production of

luteolytic pulses of PGF2α.

In the uterine luminal epithelium, AA is released from phospholipids by hydrolysis

and acted upon by PGHS-2 to form PGH2, which is converted to either PGF2α and (or)

PGE2 through two reductases, PGFS and PGES, respectively. Kim et al. (2003) reported that PGHS-2 mRNA concentrations were greater in endometrium from pregnant than cyclic ewes by d 16 post estrus. It is unknown whether relative expression of the 2 synthetic enzymes, PGFS and PGES, changes during the period of CL maintenance in pregnant lactating dairy cattle.

Programs to optimize reproductive performance in dairy cattle have received considerable attention. Recently, recombinant bST, a commercially available product used to increase milk production, was shown to increase pregnancy rates when given as

145

part of a TAI protocol in lactating dairy cows (Moreira et al., 2000b, 2001). Santos et al.

(2004b) showed that bST increased pregnancy rate through reducing pregnancy loss.

Evidence exists for “cross-talk” between hormone signal-transduction systems such as

ERα with IGF-I (Klotz et al., 2002), or direct affects such as bST increasing IFN-τ

(Badinga et al., 2002). Effects of bST on fertility may involve an interaction between

bST and IFN-τ signaling pathways to regulate PG secretion or other components of the

PG cascade critical for maintenance of pregnancy. However little is known about the molecular and cellular effects of bST on endometrial gene expression at the time of

pregnancy recognition.

Another commercially available product that may benefit fertility of lactating dairy

cows is a calcium salts of FO supplement containing omega-3 fatty acids such as EPA

and DHA. Previous studies indicated that omega-3 fatty acids can decrease PGF2α

secretion by bovine endometrial cells in vitro (Mattos et al., 2003), and supplementation

with fish meal, enriched in these omega-3 fatty acids, reduced oxytocin-induced uterine

synthesis of PGF2α in lactating dairy cows (Mattos et al., 2002).

Little is known about the effects of a FO-enriched supplement and its interaction with bST treatment on endometrial function at the molecular level. The objectives of the present study were to examine the effects of pregnancy, bST treatment, and a FO- supplemented diet on the regulatory enzymes of the PG cascade and how they may regulate genes and proteins in the uterine environment, which are known to influence pregnancy recognition.

146

Materials and Methods

Materials

® ® GnRH (Fertagyl ; Intervet Inc., Milsboro, DE), PGF2α (Lutalyse ; Pfizer Animal

Health, Kalamazoo, MI), and bST (Posilac®; Monsanto Co., St. Louis, MO) were used

for experimental treatments of cows. Other purchased materials included: Trizol, cDNA

Cycle kit, TOPO vector (TOPO TA Cloning Kits), Random Primers DNA Labeling

System (Invitrogen Corp., Carlsbad, CA), Taq polymerase (cat # M166A; Promega,

Madison, WI), PR (cat# 18-0172; Zymed, South San Francisco, CA), and PGHS-2 blocking peptide (cat# 360106; Cayman Chemicals, Ann Arbor, MI). Also purchased was biotin conjugated anti-rabbit IgG (cat# sc-2040; Santa Cruz Biotechnology), normal horse serum, biotinylated horse anti-mouse IgG, horseradish peroxidase-avidin-biotin complex, 3, 3’-diaminobenzidille (DAB kit; Vectastain; Vector Laboratories,

Burlingame, CA), enhanced chemiluminescence (ECL) kit (Renaissance Western Blot

Chemiluminescence Reagent Plus; NEN Life Science Products, Boston, MA), the

ultrasensitive hybridization buffer (ULTRAhybTM;Cat # 8670; Ambion Inc., Austin, TX),

dCTP α-32P (MP Biomedicals, Irvine, CA) and Biotrans Nylon membrane (MP

3 Biomedicals, Irvine, CA), isotopically labeled [5, 6, 8, 11, 12, 14, 15- H]-PGF2α and

PGE2, nitrocellulose membranes (Hybond-ECL), HRP-linked anti-mouse IgG (NA931V), and anti-rabbit IgG (NA934V; Amersham Biosciences Corp., Piscataway, NJ). All other

laboratory materials were from Fisher Scientific (Pittsburgh, PA) and Sigma Chemical

Co. (St. Louis, MO).

Animals and Experimental Diets

A more detailed description of animals, management, and collection of samples is

in Chapter 4. Briefly, forty multiparious Holstein cows in late gestation were fed diets

147

formulated to contain 1.51 Mcal NEL/kg, 13.1% CP, and a cation anion difference of -90

meq/kg (DM basis) beginning approximately 3 wk prior to expected calving date. Upon

calving, cows were fed two dietary treatments containing 0 or 1.9% FO (EnerG-II

Reproduction formula, Virtus Nutrition, Fairlawn, OH). The fatty acid profile of the fat

source as given by the manufacturer was 2.2% C14:0, 41.0% C16:0, 4.2% C18:0, 30.9%

C18:1, 0.2% C18:1 trans, 8.0% C18:2, 0.5% C18:3, 0.4% C20:4, 2.0% C20:5, 2.3%

C22:6, and 2.7% unknown. The control diet contained a greater concentration of whole

cottonseed and therefore was similar in concentration of ether extract and NEL to that containing FO. The control diet was fed to all cows during the first 9 DIM. From 10 to

16 DIM, ten cows were assigned to consume a FO diet containing half the final concentration of the fat product (0.95% of dietary DM) in order to adjust the cows to a new fat source. Starting at 17 DIM, these cows were switched to the 1.9% FO diet and

continued on that diet until the end of the study. Cows fed the ruminally protected FO

consumed approximately 14.8 g/cow per day of EPA and DHA. Thirty cows were

assigned to the control diet for the duration of the study. Cows were milked three times

per day and milk weights were recorded by calibrated electronic milk meters at each

milking. Body weights were measured and BCS (Wildman et al., 1982) assigned weekly

by the same two individuals.

Estrus Synchronization and Tissue Collection

Estrus was presynchronized starting at 44 ± 5 DIM or on d −27 (d 0 = TAI) using

an injection of GnRH (2 mL, 86 µg, i.m.) followed 7 d later with an injection of PGF2α (5 mL, 25 mg, i.m.) on d −20 (DeJarnette and Marshall, 2003; Figure 5-1). Estrus was detected during the next 10 d using the Heatwatch electronic estrus-detection system

148

(DDx Inc., Denver, CO; Rorie et al., 2002). At the end of 10 d, the Ovsynch protocol

(Pursley et al., 1997a) was initiated using a GnRH injection (2 mL, 86 µg, i.m.) followed

7 d later by an injection of PGF2α (5 mL, 25 mg, i. m.). At 48 h after injection of PGF2α,

The cycling group (n = 19) was not inseminated. Inseminated and non-inseminated cows received either an injection of bST (500 mg) or no injection on d 0 (when cows were either inseminated or not) and again on d 11. The bST injections occurred 11 d apart, instead of 14 d, to allow for a sustained continual exposure to GH until d 17 at which time cows were slaughtered. The bST injections were given subcutaneously in the space between the ischium and tail head. Three cows were excluded for various health concerns, and CL regression prior to d 17 was observed in two cows. These five cows were excluded from the study. Cows (n = 35) were slaughtered on d 17 after TAI to collect tissue samples and verify presence of a conceptus. From the pregnant cows that were slaughtered, 6 cows not treated with bST and 1 cow treated with bST were not pregnant. These 7 cows were not used for any analyses on d 17 following TAI. Number of cows used for analyses on d 17 in each group was as follows: control diet had 5 bST- treated cyclic (bST-C), 5 non bST-treated cyclic (C), 5 bST-treated pregnant (bST-P), and 4 non bST-treated pregnant (P) cows; FO diet had 4 bST-treated (bST-FO) and 5 non bST-treated cyclic (FO) cows. Conceptuses and uterine secretions were recovered as described by Lucy et al. (1995). Briefly, 40 mL of PBS was injected into the horn contralateral to the CL from the uterotubal junction and massaged gently through the

149

uterine horn ipsilateral to the CL. Flushing media and conceptus were recovered through

an incision of the ipsilateral horn. Endometrial tissue from the anti-mesometrial border

of the ipsilateral horn of all endometria was cut and frozen in liquid nitrogen for Western

and Northern blots, or fixed in 4% paraformaldehyde for immunohistochemistry.

Ribonucleic Acid Isolation and Northern Blotting

Total RNA was isolated from endometrial tissues (n = 28) with Trizol according to manufacturer’s specifications. Total RNA (30 µg) were electrophoresed in 1% agarose-

formaldehyde gels and blotted to nylon membranes. Membrane RNA was crosslinked by

UV radiation and baked at 80oC for 1 h. Probes were obtained using a reverse

transcription PCR procedure. Complementary DNA was reverse-transcribed from total

RNA (5 µg) prepared from the bovine CL following the manufacturer's protocol with the cDNA Cycle kit, utilizing established primer sets for bovine OTR, PR, and PGES

(Guzeloglu et al., 2004a).

The primers were employed in PCR amplification using an Eppendorf Mastercycler

Gradient Thermocycler (Eppendorf Scientific Inc., Westborg, NY) in a total reaction

volume of 50 µl containing 1 µl cDNA template, 300 ng of each primer, 10 nM dNTPs,

1× PCR buffer (2 mM MgCl2, pH 9.0), and 1 unit of Taq polymerase. The PCR products

were electrophoresed in 1.5% agarose gels and cDNA fragments of the expected size

were subcloned into TOPO vector. The nucleotide sequences of the generated clones

were determined at the nucleotide sequencing facility of the Interdisciplinary Center for

Biotechnology Research of the University of Florida, and compared with respective gene

sequences reported in GenBank. The ERα cDNA was a gift from Dr. N.H. Ing (Texas

A&M University, College Station, Texas). The PGFS (Xiao et al., 1998) and PGHS-2

150

(Liu et al., 2001) cDNAs were a gift from Dr. J. Sirois (University of Montreal, St.

Hyacinthe, Canada).

The blots were prehybridized with ULTRAhyb® buffer for 1 h at 42oC and hybridized with one of the random primed-32P-labelled probes (ERα, OTR, PR, PGHS-2,

PGES, PGFS or GAPDH) overnight at 42oC. The next day, the blots were washed in 2X

SSC/0.1% SDS and twice in 0.1X SSC/0.1% SDS for 20 min each at 42oC. The blots

were then exposed to X-ray film at −80oC. The autoradiographs were quantified using

densitometry.

Immunohistochemical Analyses

Paraffin sections (5 µm) from the anti-mesometrial border of the uterus from 27

cows (5 C, 5 bST-C, 4 FO, 4 bST-FO, 4 P, and 5 bST-P) were prepared. After

deparaffinization, an antigen retrieval procedure was performed by heating sections in a

microwave oven at high power for 5 min in 0.01 M sodium citrate buffer (pH 6.0).

Sections were allowed to cool in microwave for 28 min, and then washed in distilled water and in phosphate buffered saline (0.01 M PBS, pH 7.2). Nonspecific endogenous

peroxidase activity was blocked by treatment with 3% hydrogen peroxide in methanol for

10 min at room temperature. After a 10-min wash in PBS, non-specific binding was

blocked using 2% bovine serum albumin in PBS for ERα, 5% (v/v) normal horse serum

in PBS for PR, and 5% normal goat serum in PBS for PGHS-2 in a humidified chamber

at room temperature for 1 h. Tissue sections were then incubated in the dark at room

temperature with the primary antibody: 1) Monoclonal anti-ERα (NeoMarkers,

Medicorp, Montreal, Quebec) or the negative control mouse IgG at equivalent

concentration diluted 1:500 in 2% BSA, and incubated overnight; 2) Monoclonal anti-PR

151

(NeoMarkers, Lab Vision, Fremont, CA) or the negative control mouse IgG at equivalent concentration diluted 1:500 in 5% horse serum and incubated for 2 h; 3) Polyclonal anti-

PGHS-2 (Cayman Chemical, Cedarlane Lab., Hornby, Ontario) or the negative control,

anti-PGHS-2 preincubated with PGHS-2 blocking peptide (1:5 v/v ratio) for 1 h, diluted

1:200 in PBS and incubated for 2 h. After three 5 min washes in PBS, the sections were incubated in the dark for 1 h at room temperature with a biotinylated horse anti-mouse

IgG for ERα (diluted 1:200 in 2% BSA) and PR (diluted 1:800 in 5% horse serum)

antibodies, or biotinylated goat anti-rabbit IgG for the PGHS-2 antibody (diluted 1:200 in

5% goat serum). Thereafter, three 5 min washes in PBS were performed and tissue

sections were incubated for 30 min at room temperature with horseradish avidin-biotin-

peroxidase complex. Site of the bound enzyme was visualized by the application of 3,

3’-diaminobenzidine in H2O2. Sections were counterstained with hematoxylin and dehydrated before they were mounted with Permount.

Microscopic Image Analysis

Subjective image analysis was performed to estimate the relative abundance of

ERα, PR, and PGHS-2 staining in different cell types. One evaluator assessed

immunostaining on 10 randomly selected fields of intercaruncular endometrium in 3 pieces of endometrium from each cow. Caruncular endometrium was not evident in all

cows. Five uterine compartments were evaluated: luminal epithelium (LE), superficial

glandular epithelium (SGE; close to the uterine lumen), deep glandular epithelium (DGE;

close to the myometrium), superficial intercaruncular stroma (SS; just beneath the

luminal epithelium layer) and deep intercaruncular stroma (DS; between superficial

stroma and the myometrium). Because specific staining for PGHS-2 protein was detectable exclusively in the cytoplasm of endometrial luminal epithelial cells, only those

152 cells were scored. Intensity of staining was scored on a 4-point scale, where 0 = no staining (no brown), 1 = less (light brown), 2 = moderate (brown), and 3 = heavy (dark brown), and the staining intensities were expressed as percentage of positively stained cells for each point in the scale (Boos et al., 2000; Guzeloglu et al., 2004a).

Western Blotting for ERα and PGHS-2 Proteins

Endometrial tissues (300 mg) from 27 cows were sonicated 3 times for 5 s each in

2 mL of whole cell extract buffer (50 mM Tris, pH 8.0, 300 mM NaCl, 20 mM NaF, 1 mM Na3VO4, 1 mM Na4P2O7, 1 mM EDTA, 1 mM EGTA, 0.5 mM PMSF; 10% v/v glycerol, 1% v/v NP-40, and 10 µg/mL each of aprotinin, leupeptin, and pepstatin).

Lysates were then processed by centrifugation (14,000 × g for 10 min), and protein concentrations determined in supernatants (Bradford, 1976). Volumes of whole cell extract from each cow corresponding to 200 µg of protein were loaded onto 7.5% denaturing (for ERα) or nondenaturing (for PGHS-2) acrylamide gels, submitted to SDS-

PAGE, and electrophoretically transferred to nitrocellulose membranes. Membranes were blocked for 2 h in 5% (w/v) nonfat dried milk in Tris-buffered saline (TBS) containing 0.1% Tween-20 (TBST), washed for 15 min in TBST, and probed with mouse

ERα antibody (cat# sc-787; Santa Cruz Biotechnology, Santa Cruz, CA) (1:1000) or rabbit PGHS-2 antibody (cat# 160106; Cayman Chemicals, Ann Arbor, MI) (1:500) diluted in 5% nonfat dried milk in TBST for 2 h. Secondary antibodies were HRP- conjugated anti-mouse IgG or anti-rabbit IgG (1:5000 dilutions in 5% nonfat dried milk in TBST). Proteins were detected using a chemiluminescent substrate and analyzed by densitometry (Alpha lmager 2000).

153

Radioimmunoasssay

Concentrations of PGF2α and PGE2 were measured in uterine flushings by direct

RIA as described by Danet-Desnoyers et al. (1994) and Gross et al. (1988), respectively.

Both antisera were characterized by Dubois and Bazer (1991). The anti-PGF2α antiserum

was diluted 1:5000 and the anti-PGE2 antiserum was diluted 1:1000 in Tris buffer. Intra- assay coefficients of variation for PGF2α and PGE2 assay were,11.8 and 8.7%,

respectively.

Statistical Analyses

Abundances of ERα and PGHS-2 proteins in Western blots as well as ERα, PR,

OTR, PGFS, PGES, and PGHS-2 mRNAs in Northern blots were analyzed using the

GLM procedure of SAS. Main effects of treatment (C, P, FO, bST-C, bST-FO, bST-P),

gel, and treatment × gel interaction were examined, and for mRNA responses, band

intensities of GAPDH mRNA were used as a covariate to adjust for loading differences.

If treatment × gel effects were not significant they were removed from the model.

Predesigned orthogonal contrasts were used to compare treatment means for bST,

pregnancy status and bST x pregnancy status, and bST, FO, and bST x FO.

Total contents of PGF2α and PGE2 in uterine flushings were analyzed using the

GLM procedure of SAS. The model included the main effect of treatment (C, P, FO,

bST-C, bST-P) and orthogonal contrasts were constructed to test treatment means (bST,

FO, pregnancy status and higher order interactions).

Data generated from immunohistochemistry of ERα, PR, and PGHS-2 were

analyzed by the mixed model procedure of SAS (SAS Inst. Inc., Cary, NC) for each type

of cell. The model included treatment (C, FO, P, bST-C, bST-FO and bST-P), class

154

(none, less, moderate, and heavy staining intensity) and treatment × class interaction.

Cow within treatment was the error term used to test for treatment effects. A series of

orthogonal contrasts were constructed to test effects of bST, FO, pregnancy status, class

(none, less, moderate, and heavy staining intensity) and the treatment × class interactions.

Results

Endometrial PR Expression

A 4.3 kb PR mRNA transcript was detected in the endometrium at d 17 following

an induced ovulation, consistent with published reports of PR transcript size (Meikle et

al., 2001). A significant interaction occurred between bST and fish oil effects (Table 5-

1). The bST increased steady state concentrations of PR mRNA in cyclic control-fed

cows as did fish oil alone with no additive effect of bST (Table 5-1). Also, bST

increased steady state concentrations of PR mRNA in cyclic but not pregnant cows

(interaction P < 0.01; Table 5-1).

Immunohistochemical staining of PR was exclusively in the nuclei of the SGE,

DGE, SS, and DS, with little or no staining in the LE. Although overall staining was

very little in LE for PR, the proportion of cells with moderate and heavy staining was

enhanced in response to bST injections of cows fed FO (P < 0.05; Tables 5-2 and 5-3).

Within the SGE, presence of a conceptus or FO (P < 0.05; Figure 5-1C) increased the

amount of moderate and heavy staining (P < 0.01; Tables 5-2 and 5-3). In the DGE, bST

reduced (P < 0.01) moderate and heavy staining in both cyclic and pregnant cows; however bST did not reduce moderate and heavy staining in FO-fed cows (bST x FO interaction; P < 0.01; Tables 5-2 and 5-3). The bST reduced PR staining of SS in the less category and increased the no staining category, in cyclic control-fed cows but pregnancy and feeding FO blocked the bST reduction (P < 0.01; Tables 5-2 and 5-3). In the DS,

155 bST increased (P < 0.01) PR moderate and heavy staining when cows were exposed to

IFN-τ (i.e., pregnancy) but had no effect in cyclic control-fed cows; however FO reduced

PR moderate and heavy staining and bST blocked this reduction (P < 0.05; Tables 5-2 and 5-3).

Endometrial ERα Expression

As observed in sheep (Ing et al., 1996) and cattle (Meikle et al., 2001), a 6.8 kb

ERα mRNA transcript was detected in the endometrium at d 17 following an induced ovulation. Steady state concentrations of ERα mRNA in endometrial tissues tended to be reduced in pregnant cows compared with cyclic cows fed a control diet (P < 0.10; Table

5-1). Pregnancy induced a decrease in abundance of ERα protein in the endometrium (P

< 0.05; Table 5-1) as detected by Western blotting.

Immunohistochemistry was used to localize ERα in the endometrium, and staining was detected exclusively in the nuclei of LE, SGE, DGE, SS, and DS cells. Pregnancy

(Figure 5-1F) and FO decreased ERα abundance in LE (P < 0.01), and pregnancy decreased ERα abundance in the SGE (Figure 5-1F) compared with cyclic control-fed cows (P < 0.05; Tables 5-2 and 5-3). Also, in the SGE, bST blocked the reduction in heavy to moderate staining in FO-fed cows with no effect of bST in cyclic control-fed cows (P < 0.01; Tables 5-2 and 5-3). Pregnancy and FO increased ERα heavy staining in the DGE and these responses were reduced by bST (P < 0.01; Tables 5-2 and 5-3). In the

SS, pregnancy reduced ERα heavy staining but bST increased the heavy staining back to the levels in cyclic control-fed cows (P < 0.01); however, bST increased ERα heavy staining in FO-fed cows (P < 0.01; Tables 5-2 and 5-3). The ERα heavy staining was stimulated in the DS by bST in cyclic control-fed cows but when a conceptus was present

156 bST did not have additive effects (P < 0.05); however, within cyclic cows both FO and bST stimulated ERα heavy staining (P < 0.01; Tables 5-2 and 5-3).

Endometrial OTR Expression

Four transcripts of OTR (5.6, 3.3, 2.1, and 1.5 kb) were detected in endometrial tissue from a cow in estrus (Guzeloglu et al., 2004a). All four transcripts were present at relatively low levels in endometrial tissue at d 17, and the most prominent (5.6 kb) transcript was quantified. Among cyclic control and fish oil fed cows, bST tended to increase OTR mRNA (P < 0.10; Table 5-1). Steady state concentrations of OTR mRNA in pregnancy were decreased compared to cyclic control-fed cows (P < 0.01; Table 5-1).

Endometrial PGHS-2 Expression

A PGHS-2 transcript of 4.4 kb, shown by Liu et al. (2001), and specific 72 kDa

PGHS-2 protein bands were detected in all samples of endometrium at d 17 following an induced ovulation. No differences were detected in steady state concentrations of

PGHS-2 mRNA due to treatments (Table 5-1). In contrast, PGHS-2 protein was increased in response to pregnancy (P < 0.05) as detected by Western blotting (Table 5-

1).

Staining for PGHS-2 protein was localized specifically to the cytoplasm of endometrial LE cells as detected by immunohistochemistry. When primary antibody was first incubated with PGHS-2 blocking peptide, the absence of staining demonstrated the specificity for PGHS-2 (Figure 5-1G). Some light staining also was detected in SGE,

DGE, SS, and DS. However, the staining in these endometrial cell types was inconsistent and not evaluated. Within the LE, pregnancy increased heavy staining (Figure 5-1H) and bST treatment blocked this response (P < 0.01). Feeding fish oil decreased the amount of

PGHS-2 heavy staining in cyclic cows (P < 0.01; Tables 5-2 and 5-3).

157

Endometrial PGFS and PGES mRNA Expression

Transcripts of 1.3 kb for PGES (Arosh et al., 2002) and 1.4 kb for PGFS (Xiao et al., 1998) were detected in the endometrium at d 17 following an induced ovulation. An

interaction was detected between cyclic and pregnant control-fed cows with bST slightly

increasing PGFS mRNA in cyclic but decreasing in pregnant control-fed cows (P < 0.01;

Table 5-1). Relative steady state concentrations of PGES mRNAs were increased in response to bST for cyclic control and fish oil fed cows (P < 0.05; Table 5-1). Likewise, bST stimulated PGES mRNA for cyclic control-fed and pregnant cows (P < 0.01; Table

5-1).

Total Contents of PGF2α and PGE2 in ULF

Volumes of recovered flushing fluids (36.2 mL) and percent recovered (90.4%) did

not differ among treatments. Total PGF2α (645 ± 93 versus 58 ± 87 ng; P < 0.01) and

PGE2 (303 ± 37 versus 39 ± 35 ng, P < 0.01; Table 5-1) contents were greater in ULF of pregnant cows compared with cyclic control-fed cows, respectively. Treatment with bST or FO had no effect on uterine flushing PG content in cyclic cows. Within the pregnant cows, bST significantly increased PGE2 (250 ± 39 versus 357 ± 35 ng; P ≤ 0.05).

Simple and Partial Correlations for the PG Cascade at Day 17

A series of simple (r) and partial (pr) correlations of measurements taken at d 17

were found to be significant (P ≤ 0.05). Significant associations among treatments were

detected for endometrial gene expression, protein abundance and PGs within the uterine

flushings at d 17. Endometrial PR mRNA concentration was correlated negatively with

ERα protein (r = -0.71; partial correlation adjusted for treatment [pr = -0.8]), PGHS-2

protein (r = -0.35 [P < 0.10]; pr = -0.56), and positively correlated with PGES mRNA (r

= 0.74) and PGFS mRNA (r = 0.58; pr = 0.74). Endometrial ERα mRNA expression was

158

positively correlated with OTR mRNA (r = 0.41), PGHS-2 mRNA (r = 0.44), and

negatively correlated with PGHS-2 protein (r = -0.34 [P < 0.10]) and PGF2α in the ULF (r

= -0.44). The ERα protein abundance was positively correlated with PGHS-2 mRNA (r =

0.34 [P < 0.10]) and PGHS-2 protein (r = 0.42; pr = 0.54), and negatively correlated with

PGES mRNA (r = -0.58; pr = -0.69) and PGFS mRNA (r = -0.45; pr = -0.73). The OTR mRNA expression was positively correlated with PGHS-2 mRNA (r = 0.34 [P < 0.10]) and PGFS mRNA (r = 0.37), and negatively correlated with PGE2 (r = -0.49) and PGF2α

(r = -0.52) in the ULF. The PGHS-2 mRNA was positively correlated with PGHS-2 protein (r = 0.41; pr = 0.57). Abundance of PGHS-2 protein was negatively correlated with both PGES (r = -0.45; pr = -0.51) and PGFS (r = -0.32 [P < 0.10]; pr = -0.42) mRNA. Expression of PGES mRNA tended to be positively correlated with PGFS mRNA (r = 0.35 [P < 0.10]; pr = 0.41 [P < 0.10]). The PGFS mRNA expression was negatively correlated with PGE2 (r = -0.40) and PGF2α (r = -0.41) in the ULF. The total

amount of PGE2 was positively correlated with total amount of PGF2α (r = 0.77) in the

ULF.

Discussion

An understanding of the differential regulation of PG secretion in cyclic and

pregnant animals is pivotal to our understanding of pregnancy establishment and the

endometrial response to factors such as bST and FO. In this study, bST tended to

increase pregnancy rates at d 17 (Chapter 4), consistent with previous studies utilizing

large numbers of lactating dairy cows (Moreira et al., 2001; Santos et al., 2004b).

Effects of pregnancy, bST, and FO on steady state concentrations of mRNAs (ERα,

PR, and PGHS-2) and their respective proteins were examined in uterine endometrium.

The PR mRNA was elevated in FO-fed cows and bST did not further stimulate PR

159 mRNA expression compared with cyclic control-fed cows. In contrast, bST stimulated

PR mRNA in cyclic control-fed cows, but in pregnant cows bST had no effect.

Consistent with previous studies (Kimmins and MacLaren, 2001; Robinson et al.,

2001), immunohistochemistry indicated the PR was localized mainly in the stroma and the glandular epithelium. More specifically, immunhistochemistry showed that the heaviest PR staining was in the SGE and DGE. In the SGE, FO appeared to increase PR abundance which would agree with PR mRNA expression. Progesterone not only prepares the uterus for implantation of the embryo but also helps maintain pregnancy by stimulating uterine secretions for nourishment to the developing conceptus. By FO elevating endometrial PR mRNA and PR protein in the SGE, progesterone may have a greater effect on the uterus of cows fed FO.

The PR protein also was detected in the deep glands on d 16 in the bovine endometrium of pregnant cows (Robinson et al., 1999). Previous studies showed that GH treatment in ovariectomized ewes receiving ovarian steroid replacement therapy did not alter expression of PR in the uterus (Spencer et al., 1999). However, in the present study bST appeared to have differential effects on PR protein localization staining intensity depending on the pregnancy status and diet.

On d 17 after GnRH, ERα mRNA and protein concentration were reduced in pregnant compared with cyclic cows, regardless of whether cows received bST or not. In addition, bST stimulated ERα mRNA in cyclic control and FO-fed cows. When examining staining intensity within the different cell types, bST appeared to either block the pregnancy induced reduction (i.e., SGE) or increase (i.e., SS, DS) ERα abundance differentially depending on pregnancy status and FO diet. Spencer et al. (1999) failed to

160

detect any regulatory role of GH on endometrial ERα mRNA expression, or on PR and

OTR gene expression, in sheep. Growth hormone may exert its effect indirectly through

IGF-I, because bST treatment increased serum concentrations of IGF-I in these lactating cows (Chapter 4). The IGF-I increased ERα expression in mammary and pituitary tumor cells (Newton et al., 1994; Lee et al., 1997). Also in other systems, IGF-I induces ER-

dependent gene expression (Klotz et al., 2002). Endometrial IGF-I mRNA levels are increased during the bovine estrous cycle when circulating concentrations of estradiol are high (Meikle et al., 2001). Immunohistochemistry indicated that ERα receptor of the LE,

SGE, and DGE of the endometrium of cyclic cows was greater than that of pregnant

cows. Similarly, an upregulation of ERα mRNA and protein in the luminal epithelium

was detected around d 14 to 16 of the estrous cycle in cyclic cows and expression was

very low in pregnant cows at the same stage (Kimmins and MacLaren, 2001; Robinson et

al., 2001).

Pulsatile secretion of PGF2α from endometrial tissue, that initiates luteolysis, is

thought to be dependent upon an increase in OTR concentration within the luminal

epithelium (McCracken et al., 1999). In the present study, pregnancy decreased steady

state concentrations of OTR mRNA and bST stimulated OTR mRNA in both cyclic

control and FO-fed cows. The decrease in the OTR mRNA concentration in the pregnant

cows treated with or without bST may be due to a concurrent decrease in ERα mRNA

and protein expression in pregnant cows, as reported in sheep (Spencer et al., 1995).

Indeed OTR mRNA was partially correlated with ERα mRNA. The bST stimulation in

OTR mRNA was associated with a concurrent increase in ERα mRNA stimulation in

cyclic control and FO-fed cows. In sheep and cattle, an upregulation of OTR is inhibited

161

by pregnancy, likely due to secretion of IFN-τ by the conceptus (Farin et al., 1990). The

OTR is undetectable in the bovine endometrium during much of the luteal phase, but

increases on or after d 15 of the estrous cycle (Fuchs et al., 1990; Mann and Lamming,

1994; Robinson et al., 1999; 2001). On d 17, at the time of expected initiation of

luteolysis, OTR concentrations were about 10% of what was seen during estrus (Fuchs et

al., 1990). Injection of oxytocin into nonpregnant cows induced the release of PGF2α on

d 16 (Lamming and Mann, 1995). These findings indicate that only subtle increases of

OTR concentrations are needed to induce a luteolytic release of PGF2α. Conversely,

small but significant reduction in OTR mRNA, as detected in the present study, due to

pregnancy may have profound inhibitory effects on pulsatile secretion of PGF2α.

In the endometrium, PGHS-2 protein was localized to the luminal epithelium. This observation is consistent with previous reports, although others have suggested there is some stromal expression (Charpigny et al., 1997a; Boos, 1998; Kim et al., 2003).

Endometrial expression of PGHS-2 mRNA did not differ in response to pregnancy, bST treatments, or FO. However, PGHS-2 protein was increased in endometrium of pregnant cows. The increase in pregnancy was detected both by Western blotting and immunohistochemistry. Immunohistochemistry responses revealed an interaction between bST and pregnancy with bST injections attenuating the pregnancy increase in

PGHS-2 protein in the LE. This attenuation was not statistically significant when quantified with Western blotting although there was a 22% reduction.

Immunohistochemistry allows for a spatial evaluation of PGHS-2 protein that was mainly present in the LE and showed inhibitory effects of bST in pregnant cows and FO-fed cows. Such differences cannot be detected in an endometrial protein homogenate

162 comprised of all cell types. Emond et al. (2004) also reported that endometrial expression of PGHS-2 protein was increased during early pregnancy and in response to intrauterine infusions of IFN-τ. Arosh et al. (2002) showed that the PGHS-2 protein concentrations peaked around d 16 to 18 of the cycle without any changes in PGHS-2 mRNA concentrations. In sheep, PGHS-2 mRNA levels were similar in cyclic and pregnant ewes, although PGHS-2 protein expression was maintained at greater levels in the pregnant rather than cyclic ewes after about d 15 (Salamonsen and Findlay, 1990;

Charpigny et al., 1997a). The expression of PGHS-2 mRNA was found to be greater in pregnant ewes between d 10 and 18, with concentrations decreasing by d 16 in cyclic ewes (Kim et al., 2003).

The present study detected no changes in PGHS-2 mRNA. Collectively, these findings are consistent with an upregulation of endometrial PGHS-2 protein during pregnancy, and support the hypothesis of Charpigny et al. (1997a) that pregnancy may be associated with increased translation efficiency and (or) increased stability of PGHS-2 protein in the absence of changes in steady state concentrations of PGHS-2 mRNA.

Interestingly, this increased expression of PGHS-2 protein in the endometrium of early pregnancy could explain the greater basal concentrations of PGFM reported in pregnant cows (Williams et al., 1983), ewes (Zarco et al., 1988; Payne and Lamming, 1994), and water buffalo (Mishra et al., 2003). However, increased basal concentrations of PGFM reflects a secretion pattern that is not luteolytic or pulsatile in nature (Thatcher et al.,

1984). An absence of luteolytic pulses, but greater basal concentrations of plasma PGFM indicate that pregnancy does not suppress completely the endometrium’s ability to synthesize PGs, but rather alters the pattern of secretions.

163

Pregnancy-induced expression of PGHS-2 protein in the uterus might indicate that

the anti-luteolytic action of IFN-τ to suppress pulsatile secretion of PGF2α is not likely at

the level of PGHS-2 expression. A decline in the concentrations of ERα mRNA, ERα

protein, and OTR mRNA of pregnant cows treated with or without bST may have caused

a suppressive effect on pulsatile secretion of PGF2α by endometrium that would normally

initiate luteolysis. In early pregnancy, constant increases in production of IFN-τ by well-

developed embryos would inhibit the luteolytic pulse generator for secretion of PGF2α.

The increase in PGHS-2 protein of pregnancy could contribute to the greater basal concentrations of PGFM detected in the circulation during early pregnancy (Williams et al., 1983; Mishra et al., 2003). When poorly developed embryos produce small amounts of IFN-τ at the time of pregnancy recognition (Mann and Lamming, 2001), pulsatile secretion of PGF2α may occur leading eventually to luteolysis as a consequence of a lack

in attenuation of OTR and ERα expressions.

Furthermore, pregnancy-associated events such as regulation of local immune function, angiogenesis, regulation of blood flow, and development of implantation sites require presence of PGHS-2 (Lim et al., 1997; Marions and Danielsson, 1999;

Matsumoto et al., 2001; 2002). Increased PGHS-2 in pregnancy may support their localized response but the afferent regulators of PGHS-2 for pulsatile secretion of PGF2α

have been suppressed. Low concentrations of IFN-τ have been shown to be inhibitory to

PGF2α secretion and PGHS-2 mRNA expression by endometrial cells in vitro (Guzeloglu

et al., 2004c; Parent et al., 2003). The reduction in PGF2α secretion may be through

degradation of PGHS-2 mRNA transcripts by low concentrations of IFN-τ (Guzeloglu et

al., 2004b). Therefore underdeveloped embryos, which would produce reduced amounts

164

of IFN-τ, may not survive the process of implantation due to a possible negative effect of

reduced IFN-τ concentrations on PGHS-2 mRNA. However, these responses would

contribute to extended interestrus intervals for cows losing embryos.

It is important to determine the responses of PGFS and PGES mRNAs (i.e., relative gene expression that may or may not be related to enzymatic protein and (or) activity) regarding potential downstream metabolism of PGH2. It is hypothesized that downstream

metabolism of PGH2 to PGF2α could be decreased or conversion of PGH2 into PGE2 increased since luteolytic peaks of PGF2α are reduced in pregnancy. An interaction

between bST and pregnancy occurred in which bST increased PGFS mRNA expression

in cyclic control-fed cows but bST decreased PGFS mRNA expression in pregnant cows.

Also, bST increased PGES mRNA expression in pregnant, cyclic control and FO-fed

cows. Since bST decreased PGFS mRNA and increased PGES mRNA in pregnant cows

this may be potentially associated with more PGE2 and less PGF2α secretions creating a

stronger antiluteolytic signal to maintain pregnancy. This may be another explanation for

an increase in pregnancy rates beyond that of increased conceptus development

contributing to a decrease in early embryonic loss as reported in previous studies

(Moreira et al., 2000b, 2001; Santos et al., 2004b). Also, the reduction in PGFS and

PGES mRNA due to pregnancy may be due to the overall reduction in the hormonal

afferent component regulating the PG cascade (i.e., ERα mRNA and protein, and OTR

mRNA). However, presence of the conceptus differentially modulates endometrial

responsiveness to bST to reduce PGFS mRNA and increase PGES mRNA in a manner to

support pregnancy. When the conceptus was not present, bST stimulated ERα and OTR

mRNA, and this was associated with an increase in PGFS and PGES.

165

Indeed the amount of PGE2 in uterine flushings was elevated in pregnant cows treated with bST. In our study, pregnant cows had far greater concentrations of PGF2α

and PGE2 in uterine flushings than cyclic animals. Others also have reported a greater

PG content in uterine flushings from pregnant than cyclic cattle on d 16 and 19 postestrus

(Lewis et al., 1982; Bartol et al., 1985). Conceptuses recovered from those cattle were able to convert radiolabelled AA into PGs (Lewis et al., 1982). The trophoblastic cells of the ovine conceptus contained large amounts of PGHS-2 during d 10 to 17 of gestation

(Charpigny et al., 1997b). Thus, high luminal content of PGs in pregnant ruminants may be, at least in part, because of production and release by the conceptus. Also, bST increased endometrial PGES mRNA expression in pregnant cows possibly accounting for some of the PGE2 which was increased in bST-treated pregnant cows compared with no bST-treated pregnant cows.

Effect of bST treatment on uterine OTR, ERα, and PR genes, and ERα and PGHS-2 proteins of lactating Holstein cows, was significant and diverse. Critical regulatory components such as mRNAs for OTR, ERα, PGES and PGFS were stimulated in cyclic cows due to bST. However, different responses occurred in pregnant cows which may reflect direct conceptus induced alterations in regulation of gene expression due to such agents as IFN-τ, or indirect conceptus induced alterations within the endometrium (i.e.,

ISG-17, STAT factors 1 and 2 [Stewart et al., 2001], β2 microglobulin [Vallet et al.,

1991] interferon regulatory factor -1 [Spencer et al., 1998], Mx protein [Ott et al., 1998], ubiquitin cross reactive protein [Johnson et al., 1999], granulocyte-chemotactic protein-2

[Teixeira et al., 1997] and 2`, 5` - oligoadenylate synthase [Johnson et al., 2001]) that effect responsiveness to bST. Spencer et al. (1999) demonstrated that pretreatment of

166

ewes with IFN-τ was necessary to induce endometrial responsiveness to placental

lactogen and GH. Badinga et al. (2002) demonstrated in a bovine endometrial cell line that both bovine GH and IFN-τ suppressed phorbol 12,13-dibutyrate induced PGF2α production. When added in combination there was an additive effect in reducing PGF2α secretion. The need for IFN-τ priming for a GH response also appears to be true for responses of the GH-IGF family (Chapter 4).

The FO had little effect on the endometrial components that directly regulate the

PG cascade. This was not unexpected since EPA and DHA exert their regulatory effects as alternative substrates that reduce the lipid pool of AA in the endometrium (Chapter 6).

Such a displacement reduces the overall amount of AA precursor for PGs of the 2 series and increases the precursor pools of EPA and DHA for biosynthesis of 3 series PGs

(Mattos et al., 2003). This in turn may decrease the induced pulsatile release of PGF2α as shown in a previous study (Mattos et al., 2002).

Conclusions

At d 17 of the cycle, the potential luteolytic cascade was affected as pregnancy decreased steady state concentrations of ERα mRNA, ERα protein, OTR mRNA and increased PGHS-2 protein. A decline in the concentrations of ERα and OTR would contribute to attenuation in the endometrial pulsatile secretion of PGF2α that would

initiate luteolysis in cyclic lactating cows. Increased PGHS-2 protein in early pregnancy

could contribute to the greater basal concentrations of PGFM detected in the circulation

and support developmental processes of the conceptus – endometrial unit.

Collectively, this study shows the differential responses (i.e., PGFS) to bST

depending on pregnancy status. The bST may regulate enzymes (i.e., PGES) downstream

167

of PGHS-2 to decrease PGF2α and increase PGE2 thereby maintaining pregnancy.

Pregnancy appears to attenuate gene expression and protein secretion of hormonal

components regulating the PG cascade thereby reducing pulsatile release of PGF2α.

Feeding FO not only increased PR mRNA expression but also had differential cell type responses, with FO increasing PR in the SGE and DGE which may be beneficial for preparation of the uterus to establish and maintain pregnancy. Also, feeding FO reduced localization of ERα (i.e., LE, DGE, and SS) and PGHS-2 (i.e., LE), which may contribute to a reduction in pulsatile release of PGF2α.

In summary, the use of both a pharmaceutical, such as bST, to directly modulate

the PG cascade in concert with increased IFN-τ (Chapter 5), and a nutraceutical, such as

FO, to reduce components of the PG cascade as well as increasing PR provides a uterine environment conducive for embryo development. In addition, FO may reduce the precursor for PG of the 2 series, thereby decreasing the pulsatile release of PGF2α.

Furthermore, FO may provide a healthier product for consumers. The objective of

Chapter 6 is to elucidate how bST, FO, and pregnancy regulate fatty acid distribution

among various tissues including milk fat.

Table 5-1. Least squares means and pooled SE for uterine endometrial mRNA and protein, and uterine luminal flushings (ULF) protein expression at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11 (n = 28). Arbitrary units (AU) were generated by densitometry and mRNA results are adjusted using glyceraldehyde-3- phosphate dehydrogenase as a covariate. Treatments1 Contrasts2 Response3 C bST-C FO bST-FO P bST-P S.E. FO bST bST x FO P bST bST x P PR mRNA, AU 60 69 68 67 61 59 2.1 NS † * * NS ** ERα mRNA, AU 11 15 12 16 11 8 2.1 NS † NS † NS NS ERα protein, AU 70 71 70 73 67 70 1.2 NS NS NS * NS NS OTR mRNA, AU 45 50 49 52 39 41 1.3 NS † NS ** NS NS PGHS-2 mRNA, AU 84 83 85 83 78 82 3.3 NS NS NS NS NS NS PGHS-2 protein, AU 39 48 70 70 91 80 1.8 NS NS NS * NS NS PGFS mRNA, AU 27 28 28 28 27 25 0.6 NS † NS * NS **

PGF2α, ng/ULF 57 60 130 50 618 672 92 NS NS NS ** NS NS 168 PGES mRNA, AU 45 48 46 47 43 46 0.9 NS * NS † ** NS PGE2, ng/ULF 39 39 82 15 250 357 38 NS NS NS ** NS NS 1 bST-C = bST-cyclic, bST-FO = bST-fish oil, bST-P = bST-pregnant. 2 †P ≤ 0.10, *P ≤ 0.05, **P ≤ 0.01, NS = non-significant. 3 PR = Progesterone receptor; ERα = estradiol receptor α; OTR = oxytocin receptor; PGHS-2 = prostaglandin H synthase-2; PGFS = prostaglandin F synthase; PGES = prostaglandin E synthase.

Table 5-2. Least squares means and pooled standard error (SE) for uterine endometrial protein expression responses at d 17 after an induced ovulation (d 0) in lactating dairy cows injected with or without bST on d 0 and 11. Treatments1 Stat2 C bST-C FO bST-FO P bST-P S.E.Code Response3 0 1 2 3 0 1 2 3 0 1 2 3 0 1 2 3 0 1 2 3 0 1 2 3 Progesterone Receptor LE 97 3 0 0 83 17 0 0 86 14 0 0 75 16 6 3 90 10 0 0 82 18 0 0 3 1, 12 SGE 33 55 10 2 42 52 6 0 40 39 16 5 45 35 14 5 38 48 13 0 30 60 10 0 3 2, 13 DGE 8 42 42 8 17 59 24 0 19 40 32 9 14 50 28 8 7 35 43 15 10 50 32 8 3 3, 14 SS 35 56 9 0 45 43 12 0 32 60 8 0 33 61 6 0 38 55 6 0 30 59 11 0 3 4, 15 DS 33 52 14 0 45 44 11 0 40 54 5 1 27 61 13 0 41 50 10 0 28 54 19 0 2 5, 16 Estrogen Receptor alpha

LE 8 19 40 32 10 15 36 39 12 37 38 13 10 28 38 23 10 60 25 5 16 61 19 4 5 6, 17 169 SGE 1 20 46 33 1 22 48 28 7 29 51 14 1 12 45 42 4 27 53 15 2 22 52 23 4 7, 18 DGE 1 13 38 48 0 7 30 61 3 6 35 56 6 14 43 37 1 3 19 78 0 12 31 57 3 8, 19 SS 22 34 35 10 29 27 28 16 26 28 30 16 23 18 32 27 32 37 26 4 18 35 37 10 2 9, 20 DS 29 44 25 2 33 29 21 17 30 27 28 15 21 17 33 29 31 29 31 9 22 27 36 15 3 10, 21 Prostaglandin H Synthase-2 LE 4 13 30 53 3 22 29 46 3 19 37 41 5 29 40 26 1 4 23 72 1 19 41 39 7 11, 22 1C = Cyclic control-fed, bST-C = bST-cyclic control-fed, FO = cyclic fish oil fed, bST-FO = bST-cyclic fish oil fed, P = pregnant, bST-P = bST-pregnant; Staining intensity weighted average (0 = none, 1 = less, 2 = moderate, 3 = heavy staining). 2Numbers match row for statistical values in following table. 3LE = luminal epithelium, SGE = superficial glandular epithelium, DGE = deep glandular epithelium, SS = superficial stroma, DS = deep stroma.

170

Table 5-3. Statistical analyses of uterine endometrial protein expression for Table 5-2. Sources of Variation1,2 Statistics Fish Oil (FO) bST: C vs. FO bST x FO interaction Code3 0 vs. 1 0,1 vs. 2,3 2 vs. 3 0 vs. 1 0,1 vs. 2,3 2 vs. 3 0 vs. 1 0,1 vs. 2,3 2 vs. 3 PR LE (1) ** * NS ** * NS NS * NS SGE (2) ** ** NS ** NS NS NS NS NS DGE (3) † NS NS * ** NS NS ** NS SS (4) ** † NS ** NS NS ** NS NS DS (5) ** NS NS NS NS NS ** * NS ERα LE (6) * ** ** NS † † NS NS NS SGE (7) NS NS NS NS ** ** NS ** ** DGE (8) NS NS ** NS NS NS NS ** ** SS (9) * ** * ** ** ** NS ** NS DS (10) * ** NS ** ** ** * NS NS PGHS-2 LE (11) NS NS ** NS NS † NS NS NS

Statistics P bST: P vs. C bST x P interaction Code3 0 vs. 1 0,1 vs. 2,3 2 vs. 3 0 vs. 1 0,1 vs. 2,3 2 vs. 3 0 vs. 1 0,1 vs. 2,3 2 vs. 3 PR LE (12) † NS NS ** NS NS NS NS NS SGE (13) ** ** NS ** NS NS NS NS NS DGE (14) ** NS † * ** NS NS NS NS SS (15) ** NS NS NS † NS ** NS NS DS (16) * NS NS NS NS NS ** ** NS ERα LE (17) ** ** * NS NS NS NS NS NS SGE (18) NS NS ** NS NS NS NS NS NS DGE (19) NS NS ** NS NS NS NS ** ** SS (20) † * * NS ** NS ** ** ** DS (21) NS ** † NS ** * ** NS * PGHS-2 LE (22) NS NS NS NS NS ** NS NS ** 1 †P ≤ 0.10, *P ≤ 0.05, **P ≤ 0.01, NS = non-significant. 2 Two and three way interactions: FO = fish oil vs. cyclic control-fed cows x staining intensity; bST (FO) =bST vs. no bST-treated fish oil and cyclic control-fed cows x staining intensity; bST x FO = bST (FO) x FO x staining intensity; P = pregnant vs. cyclic control-fed cows x staining intensity; bST (P) = bST vs. no bST-treated pregnant and cyclic control-fed cows x staining intensity; bST x P = bST (P) x P x staining intensity. 3 Statistical analyses for data in Table 2.

171

A B C

D E F

G H I

Figure 5-1. Expression of PR (A, B, C), ERα (D, E, F), and PGHS-2 (G, H, I) in bovine endometrium at d 17 following an induced ovulation. No immunopositive staining was detected when primary antibody was replaced by mouse IgG (A for PR and D for ERα) and when primary antibody was first incubated with PGHS-2 blocking peptide (G for PGHS-2). Staining for ERα and PR was detected exclusively in the nuclei of the epithelial and stromal cells. Fish oil (C) increased (P < 0.05) abundance of PR in the superficial glandular epithelium compared with the cyclic control-fed cows (B). Pregnancy decreased (P < 0.05) ERα staining in the luminal and superficial glandular epithelium (F) compared with the cyclic control-fed cows (E). Staining for PGHS-2 was observed in the cytoplasm of endometrial luminal epithelial cells. Pregnancy (I) increased (P < 0.05) the intensity of staining for PGHS-2 protein in the luminal epithelial cells compared with the cyclic control-fed cows (H). Magnification x 20.

CHAPTER 6 PREGNANCY, BOVINE SOMATOTROPIN, AND DIETARY OMEGA-3 FATTY ACIDS IN LACTATING DAIRY COWS: III. FATTY ACID DISTRIBUTION

Introduction

Some UFA have anticarcinogenic effects and other human health-promoting properties (Bauman et al., 2001). Supplementation of dietary UFA to food-producing animals may increase the concentration of UFA in meat and milk which may be beneficial for human health. Increasing the amount of lipid in the diet of dairy cows improved immune status (Amaral et al., 2005), energy balance (Staples et al., 1998), and fertility (Son et al., 1996; Sklan et al., 1991). In ruminants, biohydrogenation reduces the amount of UFA reaching the small intestine for absorption due to reduction of double bonds and altering isomeric orientation (Harfoot and Hazelwood, 1998). Protection of

UFA from ruminal microbes increases amounts of fatty acids that escape biohydrogenation and their availability for absorption in the small intestine.

Feeding fish oil increased concentrations of the n-3 PUFA, EPA (C20:5), and DHA

(C22:6) in the milk fat and caruncles, and reduced circulating concentrations of PGFM in dairy cows (Mattos et al., 2004). This reduction was attributed to a possible displacement of AA (C20:4), the precursor for PGF2α synthesis, with EPA and DHA. The EPA is a precursor for PGs of the 3 series which are less biologically active than those of the 2

series (Needleman et al., 1979) and may contribute to enhancing the antiluteolytic effect

of the conceptus to maintain pregnancy in dairy cows.

172 173

Not only can FO elevate n-3 fatty acids, but FO also increases concentrations of

CLA in milk fat (Donovan et al., 2000). Conjugated linoleic acid refers to a mixture of positional and geometric isomers of linoleic acid (C18:2) that contain conjugated unsaturated double bonds (i.e., cis-9, trans-11 CLA, trans-10, cis-12 CLA, trans-9 trans-

11 CLA). Both CLA and PUFA, such as EPA and DHA, have been shown to activate

PPAR which can affect GHR expression (Khan and Vanden Heuvel, 2003), PG production (Lim et al., 1999), insulin sensitivity (Berger and Moller, 2002), and implantation (Lim et al., 1997). In various animal models, dietary CLA supplementation has been shown to reduce tumorigenesis (Ip, 1997), decrease atherogenesis (Nicolosi et al., 1997), enhance immune response (Cook et al., 1993), increase feed efficiency (Chin et al., 1994), and reduce body fat (DeLany et al., 1999). The cis-9, trans-11 CLA is considered to be the most biologically active and predominant isomer, comprising approximately 84% of the isomers of CLA in milk fat from dairy cows fed no fish oil or

88 to 92% in cows fed fish oil (Donovan et al., 2000). Ip et al. (1999) showed that this isomer is anticarcinogenic in rats when supplemented in the diet as butter fat.

Fatty acid composition is quite diverse between tissues, and certain tissues may preferentially uptake particular fatty acids which are functional characteristics for that tissue (Abayasekera and Wathes, 1999). Changes in the physiological state (i.e., lactation and (or) pregnancy) of the dairy cow can lead to the partitioning of essential nutrients

(i.e., fatty acids) to particular tissues to sustain a homeorhetic response (Bauman and

Currie, 1980). Understanding what fatty acids are preferentially sequestered during pregnancy in certain tissue pools would allow formulation of diets enriched in the fatty

174

acids of interest to replenish depleted fatty acid stores in late lactation and pregnancy in order to increase partitioning from these tissues in early lactation.

Exogenous bST is used to increase milk production (Bauman et al., 1999b).

Bovine somatotropin stimulates the release of IGF-I from the liver which can mobilize

fatty acids from adipose tissue to increase milk secretion by the mammary gland (Cohick,

1998). Consequently, the fatty acid composition of these tissues is reduced. Whether the

fatty acid profile is altered is unknown.

The objective of this study was to evaluate the effects of exogenous bST,

pregnancy and a diet enriched in FO, as well as their interactions, on the distribution and

concentration of fatty acids within the endometrium, liver, milk fat, mammary tissue,

muscle, subcutaneous adipose tissue, and internal adipose tissue. Information gained

could benefit the management approach of cows during critical biological windows (i.e.,

transition period, lactogenesis, energy partitioning and pregnancy) while also used to help

provide an improved nutritional product and (or) functional food for consumers.

Materials and Methods

Animals and Experimental Diets

For a more detailed description of animals, management, and collection of samples

see Chapter 4. Briefly, forty multiparious Holstein cows in late gestation were fed diets

formulated to contain 1.51 Mcal NEL/kg, 13.1% CP, and a cation anion difference of -90

meq/kg (DM basis) beginning approximately 3 wk prior to expected calving date. Upon

calving, cows were fed one of two dietary treatments containing 0 or 1.9% calcium salt of

a FO-enriched lipid product (EnerG-II Reproduction formula, Virtus Nutrition, Fairlawn,

OH). The fatty acid profile of the fat source as given by the manufacturer was 2.2%

C14:0, 41.0% C16:0, 4.2% C18:0, 30.9% C18:1, 0.2% C18:1 trans, 8.0% C18:2, 0.5%

175

C18:3, 0.4% C20:4, 2.0% C20:5, 2.3% C22:6, and 2.7% unknown. The control diet

contained a greater concentration of whole cottonseed and therefore was similar in

concentration of ether extract and NEL (Table 6-1) to that containing FO. The control

diet (0% FO) was fed to all cows during the first 9 DIM. From 10 to 16 DIM, ten cows

were assigned to consume a FO diet containing half the final concentration of the fat

product (0.95% of dietary DM) in order to adjust the cows to a new fat source. Starting at 17 DIM, these cows were switched to the 1.9% FO diet and continued on that diet until

the end of the study. Cows fed the FO consumed approximately 14.8 g/cow per day of

EPA and DHA combined. Thirty cows were assigned to the control diet for the duration

of the study. Cows were milked three times per day and milk weights were recorded by

calibrated electronic milk meters at each milking. Body weights were measured and BCS

(Wildman et al., 1982) assigned weekly by the same two individuals.

Estrus Synchronization, Ultrasonography of Ovaries, and bST Treatment

Estrus was synchronized as described in detail in Chapter 4. Briefly, cows were

presynchronized starting at 44 ± 5 DIM (d −27 in relation to day of TAI using an

injection of GnRH (2 mL, 86 µg, i.m.) followed 7 d later with an injection of PGF2α (5 mL, 25 mg, i.m.) on d −20 (DeJarnette and Marshall, 2003). At the end of 10 d, the

Ovsynch protocol (Pursley et al., 1997a) was initiated using a GnRH injection (2 mL, 86

µg, i.m.) followed 7 d later by an injection of PGF2α (5 mL, 25 mg, i. m.). At 48 h after

injection of PGF2α, GnRH (2 mL, 86 µg, i.m.) was administered, and 16 cows fed the

control diet were inseminated 16 h later. All inseminations were administered by the

same technician with semen from one Holstein bull of known fertility (Select Sires, Plain

City, OH; 7H05379). The cycling group (n = 19) was not inseminated. Inseminated and

176

non-inseminated cows received either an injection of bST (500 mg) or no injection on d 0

(when cows were either inseminated or not) and again on d 11 post TAI. The bST injections were given 11 d apart instead of 14 d, to allow for a sustained continual

exposure to GH until d 17 at which time cows were slaughtered. The bST injections

were given subcutaneously in the space between the ischium and tail head. Three cows

with various health concerns, and two that underwent CL regression prior to d 17 were

excluded from the study. On d 17 after an induced ovulation cows (n = 35) were

slaughtered to collect tissue samples and verify presence of a conceptus. Pregnancy rates

were defined as number of cows classified pregnant based upon visualization of a

conceptus in the uterine flushing at slaughter divided by number of cows inseminated.

From the inseminated cows that were slaughtered and not pregnant, 6 cows were not

treated with bST and 1 cow was treated with bST. These 7 cows were not used for fatty

acid analyses. Numbers of cows used for tissue analyses on d 17 in each group were as

follows: control diet had 5 bST-treated cyclic (bST-C), 5 non bST-treated cyclic (C), 5

bST-treated pregnant (bST-P), and 4 non bST-treated pregnant (P) cows; the group fed

FO had 4 bST-treated (bST-FO) and 5 non bST-treated cyclic (FO) cows.

Tissue Sample Collection

For each cow, a sample of milk from the morning (1000 h) milking was collected at

75 ± 5 DIM, refrigerated at 4°C, and fat extracted using a detergent solution containing

3% Triton X-100 (wt/vol) and 7% sodium hexametaphosphate in distilled water. Milk fat

was stored in -20°C until fatty acid analysis.

All cows were sacrificed (94 ± 12 DIM) in the abattoir of the Animal Sciences

Department at the University of Florida. Reproductive tracts were collected within 10

min of slaughter, placed on ice and taken to the laboratory. The uterine horn ipsilateral to

177

the CL was cut along the mesometrial border, and the endometrium was dissected from the myometrium. Endometrial tissue from the anti-mesometrial border of the ipsilateral horn was removed, frozen in liquid nitrogen and stored at -80°C. Liver, muscle,

mammary, subcutaneous adipose, and internal adipose tissues were collected at slaughter

and immediately placed in liquid nitrogen, and stored at -80°C. Two sections of

approximately 7 g of each collected tissue were freeze-dried for 24 h using a lyophilizer

(Labconco, Kansas City, MO) to obtain a final mass of approximately 1.5 g of DM. Fatty

acids in dry tissue and milk fat were methylated and separated by gas chromatography as

described below.

Milk Fat Isolation and Analyses of Fatty Acid Composition

Fatty acids in freeze-dried tissue and milk fat samples were converted to methyl

esters in 0.5 M sodium methoxide in methanol followed by a second methylation in

acetyl chloride:methanol (1:10, vol/vol) based on a procedure described by Kramer et al.

(1997) to prevent epimerization and isomerization of conjugated acids.

Methyl esters were separated by GLC (HP 5890, Agilent Technologies, Palo alto,

CA) on a 30 m x 0.25 mm x 0.2 µm-film thickness SP2380 capillary column with split

(100:1) injection. Temperature program used for the tissue fatty acids was 140oC initially

(held for 3 min), and then raised 3.7oC/min to a final temperature of 220oC (held for 20

min). Milk fatty acid methyl esters were run using an initial temperature of 50oC (held

for 2 min) and increased 4oC/min to a final temperature of 250oC (held for 15 min).

Peak identities were done by comparison of retention times to reagent-grade fatty

acid standards. Additional structural identification of the 20:3 peak in liver samples was

done on an Agilent 5975 GC/MS (Agilent Technologies, Palo alto, CA) equipped with a

CP Sil 88 column operated at an initial temperature of 120oC for 5 min, and increased

178

2oC/min to a final temperature of 220oC. The liver peak had a retention time and distinctive ion fragment at 150 that matched that of a 20:3 c8,c11,c14 methyl ester standard, but did not match retention times or ions at 108 and 192 that were distinctive for the 20:3 c5,c8,c11 and 20:3 c11,c14,c17 methyl ester standards. Geometries of double bonds (cis or trans) were not determined.

Identifiable fatty acids for each tissue source and milk fat were as follows: C4:0,

C6:0, C8:0, C10:0, C12:0, C14:0, C14:1, C15:0, C16:0, C16:1, C17:0, C18:0, C18:1- trans, C18:1, cis-9 C18:1, cis-11 C18:1, C18:2, cis-9 trans-11 CLA, cis-12 trans-10 CLA, trans-9 trans-11 CLA, C18:3, C20:0, C20:3n-6, C20:4, C21:0, C22:0, EPA (C20:5), DHA

(C22:6), and C24:0.

The desaturase index (DIX) was used as a proxy for ∆9-desaturase activity

previously defined as: (product of ∆9-desaturase)/(product of ∆9-desaturase + substrate of

∆9-desaturase) (Malau-Aduli et al., 1997; Kelsey et al., 2003). For all tissues except the

endometrium, C14:1 was used as the ∆9-desaturase product and C14:0 as ∆9-desaturase

substrate. In the endometrium, C16:1 was used as the ∆9-desaturase product and C16:0

as ∆9-desaturase substrate since C14:1 was undetectable.

Statistical Analyses

Percentages of fatty acid compositions from each tissue source and milk fat were

analyzed using the general linear model procedure of SAS (SAS Inst. Inc, Cary, NC).

The mathematical models included the main effects of treatment (C, FO, P, bST-FO,

bST-C, and bST-P) and orthogonal contrasts were used to compare treatment means

(bST, pregnancy status, and bST x pregnancy status interaction or bST, FO, and bST x

FO interaction). Because the study had no pregnant cows fed FO, statistical comparisons

could not be made between FO-fed cows and pregnant cows. Analysis of concentrations

179

of LCFA (≥ C18:0) among all tissue and milk fat sources were analyzed using the general linear procedure of SAS. The mathematical model included the main effect of treatment

(C, FO, P, bST-FO, bST-C, and bST-P), tissue source (endometrium, liver, muscle, mammary, subcutaneous adipose, internal adipose tissue, and milk fat) and treatment x tissue source. Orthogonal contrasts were used to compare tissue sources as follows: 1) milk fat and mammary tissue versus endometrium, liver and muscle; 2) milk fat versus mammary tissue; 3) endometrium, liver and muscle versus subcutaneous and internal adipose; 4) subcutaneous versus internal adipose; 5) endometrium versus liver and muscle; 6) liver versus muscle.

Fatty acid composition (Tables 6-1 through 6-10) was analyzed in all tissue sources for all treatment groups (5 C, 4 FO, 4 P, 5 bST-C, 4 bST-FO, and 5 bST-P) and responses with a P ≤ 0.05 are described in the text.

Results

Long Chain Fatty Acid Composition among Tissues

Proportions of fatty acid distribution are shown for the endometrium (Table 6-1), liver (Table 6-3), mammary (Table 6-4), milk fat (Table 6-6), muscle (Table 6-7), subcutaneous (Table 6-9) and internal adipose (Table 6-10) tissues. Many differences were detected in composition of LCFA among tissues. For instance, C18:2 differed (P <

0.01) among milk fat, mammary gland, endometrium, liver and muscle (3.38, 5.42, 12.86,

14.43, and 9.58 ± 0.29%, respectively) with endometrium and liver having the greatest percent of C18:2. No difference in C18:2 was detected between subcutaneous and internal adipose tissues (1.97 vs. 2.10 ± 0.29%, respectively). The C18:3 fatty acid differed (P < 0.01) among endometrium, liver, and muscle (0.90, 0.49, and 0.33 ± 0.01%, respectively) with no differences between milk and mammary gland (0.28 vs. 0.28 ±

180

0.01%, respectively) and between subcutaneous and internal adipose (0.16 vs. 0.17 ±

0.01%, respectively) tissues. Arachadonic acid (C20:4) differed (P < 0.05) among milk

fat, mammary gland, endometrium, liver, and muscle (0.16, 0.78, 14.62, 8.10, and 3.86 ±

0.25%, respectively) with the greatest percentage in the endometrium. There was no difference in C20:4 concentrations between the subcutaneous and internal adipose tissues

(0.06 vs. 0.04 ± 0.25%, respectively). Both EPA and DHA percentages were not different between milk fat and mammary gland (0.02 vs. 0.06 and 0.01 vs. 0.03 ± 0.02%, respectively). The EPA was not detected in the subcutaneous or internal adipose tissues; however, DHA was different (0.004 vs. 0.03 ± 0.02%, respectively). Endometrium, liver and muscle differed (P < 0.01) in both EPA (0.04, 0.76, and 0.19 ± 0.02%, respectively) and DHA (1.16, 0.85, and 0.05 ± 0.05%, respectively). Due to these striking differences in proportions of LCFA among tissues, proportions of individual fatty acids were examined on a per tissue basis.

Fatty Acid Composition in Endometrium at Day 17

In endometrial tissue, an interaction was detected between bST-treated and FO-fed cyclic cows with bST reducing C14:0 in bST-C but increasing C14:0 in bST-FO (P ≤

0.01; Table 6-1). The FO increased concentrations of C15:0, C16:0 (P ≤ 0.05), and

C18:1-trans (P ≤ 0.01) and reduced C16:1 (P ≤ 0.05) and C18:0 (P ≤ 0.01; Table 6-1).

Importantly, concentrations of EPA and DHA were increased (P ≤ 0.01) in FO-fed cows

with a concurrent decrease (P ≤ 0.01) in AA (C20:4, Table 6-1). Interestingly, bST

treatments within cyclic control and FO-fed cows increased concentrations of C18:1 (P ≤

0.01) and DHA (P ≤ 0.01) but decreased concentration of C18:2 (P ≤ 0.05; Table 6-1).

Also, bST injections decreased C18:2 and increased DHA in cyclic control-fed cows but

increased them in pregnant cows (bST by P interaction P ≤ 0.05; Table 6-1).

181

The bST increased the proportion of MUFA with a subsequent decrease (P ≤ 0.01) in PUFA (Table 6-2). The n-6:n-3 ratio was reduced (P ≤ 0.01) due to both FO and bST in cyclic cows. However, if a conceptus was present, bST increased the n-6:n-3 ratio whereas it was decreased in cyclic cows (bST by P interaction P ≤ 0.01; Table 6-2).

Fatty Acid Composition in Liver at Day 17

Among control-fed cyclic and pregnant cows, bST increased C14:1 (P ≤ 0.05;

Table 6-3) in liver. The FO diet increased (P ≤ 0.01) concentrations of C18:3, EPA and

DHA but decreased C20:3 (P ≤ 0.05; Table 6-3). There was an interaction between FO and bST treatment with bST increasing C21:0 in cyclic control-fed cows but decreasing

C21:0 in FO-fed cows (P ≤ 0.01; Table 6-3). Another interaction was detected between bST and FO with bST increasing C22:0 in cyclic control-fed cows but FO elevated C22:0 and bST injections did not have any additional effect (P ≤ 0.01; Table 6-3).

The n-6:n-3 ratio was reduced (P ≤ 0.01) when cyclic cows were fed FO (Table 6-

2). The bST reduced the concentration of PUFA (P ≤ 0.05; Table 6-2) among pregnant and cyclic control-fed cows. The DIX was decreased due to pregnancy (P ≤ 0.01).

Fatty Acid Composition in Mammary Tissue at Day 17

In mammary tissue, FO decreased C14:1, but increased C16:0, C18:3, C20:0, CLA t9t11, EPA, DHA and C24:0 (P ≤ 0.05; Table 6-4). The bST decreased (P ≤ 0.01) C18:3 in FO and control-fed cyclic cows but increased (P ≤ 0.05) C16:1 within pregnant and cyclic control-fed cows (Table 6-4).

The FO diet decreased dramatically the n-6:n-3 ratio (P ≤ 0.01; Table 6-5).

Between cyclic FO and control-fed cows, bST injection increased the DIX in cyclic control-fed cows but reduced the DIX in FO-fed cows (bST by FO interaction P ≤ 0.05;

Table 6-5).

182

Fatty Acid Composition in Milk at Day 17

Within the short chain fatty acids, FO increased (P ≤ 0.01) C4:0 and decreased (P ≤

0.05) C12:0 (Table 6-6). Pregnancy increased C4:0 compared to cyclic cows, but not when cows were injected with bST (bST by P interaction P ≤ 0.05; Table 6-6). Also, bST increased C6:0 in cyclic control-fed and pregnant cows (P ≤ 0.05; Table 6-6). The FO treatment increased C16:0, C18:3, C20:0, CLA c9t11 and DHA but decreased C18:0,

C20:3, C20:4 and C21:0 (P ≤ 0.05; Table 6-6). Interestingly, pregnancy decreased EPA

(P ≤ 0.05; Table 6-6).

The bST injections increased SFA and decreased PUFAs in pregnant and cyclic control-fed cows (P ≤ 0.05; Table 6-5). The FO diet decreased the n-6:n-3 ratio (P ≤

0.01; Table 6-5).

Fatty Acid Composition in Muscle at Day 17

The FO diet decreased C14:1, C18:1 c11 and CLA c9t11 (P ≤ 0.05; Table 6-7).

Both the FO diet and pregnancy increased SFA with a subsequent decrease in UFA when compared with cyclic control-fed cows (P ≤ 0.05; Table 6-8). The FO diet decreased both the n-6:n-3 ratio and the DIX (P ≤ 0.01; Table 6-8). In addition, pregnancy decreased the DIX (P ≤ 0.01; Table 6-8).

Fatty Acid Composition in Subcutaneous Adipose Tissue at Day 17

In subcutaneous adipose tissue, FO diet increased C16:0 and C18:0, and decreased

C18:1 and CLA c9t11 (P ≤ 0.05; Table 6-9). Also, bST increased C16:0 among FO and control-fed cyclic cows (P ≤ 0.05; Table 6-9). The FO diet alone decreased CLA t9t11 and when bST was injected, CLA t9t11 was increased back to the same concentration as control-fed cows (P ≤ 0.05; Table 6-9). Several interactions were detected between bST and pregnancy status. The bST injections decreased C14:1, C16:1, C18:1 and CLA c9t11

183

concentrations in cyclic control-fed cows but increased these concentrations in pregnant

cows (P ≤ 0.05; Table 6-9). However, bST treatments increased concentrations of C16:0 and C18:0 in cyclic control-fed cows but decreased concentrations in pregnant cows (P ≤

0.05; Table 6-9). The EPA was undetectable and DHA was barely detectable.

The FO diet increased SFA and decreased UFA and MUFA when compared with

cyclic control-fed cows (P ≤ 0.01; Table 6-8). Also, FO decreased (P ≤ 0.05) the DIX

within cyclic cows. The bST treatments decreased SFA in pregnant but increased SFA in

cyclic control-fed cows (interaction P ≤ 0.01). Another interaction occurred between bST

and pregnancy in which bST increased UFA, MUFA, and DIX in pregnant cows but

decreased in cyclic control-fed cows (P ≤ 0.01; Table 6-8).

Fatty Acid Composition in Internal Adipose Tissue at Day 17

In internal adipose tissue, the FO increased concentrations of C15:0 but reduced

concentrations of DHA in the internal adipose tissue (P ≤ 0.05; Table 6-10). The bST

injections increased concentrations of C14:1 in cyclic control-fed cows but reduced

concentrations in FO-fed cows (P ≤ 0.01; Table 6-10).

The bST injections increased the n-6:n-3 ratio in internal adipose tissue of pregnant

cows and decreased the ratio in cyclic control-fed cows (P ≤ 0.05; Table 6-8). In

addition, bST injections increased the DIX in cyclic control-fed cows with no change in

FO-fed cows (interaction P ≤ 0.01; Table 6-8). The same interaction occurred for

pregnant and cyclic control-fed cows with bST increasing the DIX in cyclic control-fed

cows with no effect in pregnant cows (P ≤ 0.05; Table 6-8).

Discussion

Cows fed FO had an increased proportion of EPA and DHA in the endometrium

(Table 6-1), liver (Table 6-2), and mammary tissue (Table 6-4), and DHA was increased

184

in the milk fat (Table 6-6) compared with those not fed FO. However, proportions of

DHA and EPA were not increased in subcutaneous and internal adipose tissues. Thus these fatty acid ligands are available differentially to target tissues once absorbed from the digestive tract. Within the endometrium, concentrations of EPA and DHA were increased whereas that of AA was decreased. Consequently, slightly less AA would be available for PGF2α production and other products of the PG 2 series, thereby potentially

reducing secretion of PGF2α and maintaining the CL.

Increasing EPA and DHA in the endometrium increases the amount of precursor

available for PG production of the 3 series which are less biologically active (Needleman

et al., 1979). Burns et al. (2003) reported an increase in EPA with a decrease in AA in

caruncular endometrial tissue on d 18 post estrus from beef cows fed fish meal. In

addition, Mattos et al. (2004) observed an increase in EPA and DHA in caruncular tissue

at parturition in Holstein cows fed fish oil versus olive oil. Also, in the present study,

incorporation of these fatty acids into the endometrium resulted in differential effects on

gene and protein expression of enzymes involved in the PG cascade regardless of bST

injection (Chapter 5). The injections of bST reduced C18:2 and the n-6:n-3 ratio and

increased DHA in the endometrium of the cyclic cows but not in pregnant cows. It is

possible that the secretions from the growing conceptus can alter the uterine

responsiveness to bST injections.

The n-6:n-3 ratio was reduced by FO in tissues and milk fat except for

subcutaneous and internal adipose tissue. Decreasing the ratio of n-6 to n-3 may not only

improve pregnancy maintenance but also immune function. In mice fed an enriched n-3

PUFA diet, inflammatory reactions were reduced, and different types of antibody

185

response to antigenic stimulations were developed compared with mice fed an n-6

enriched diet (Albers et al., 2002). Reducing n-6 fatty acids such as C18:2 and C20:4,

which are not only precursors for the luteolytic PGF2α but also are the precursor of the

pro-inflammatory mediators, PGE2 and leukotriene B4, may improve immune function.

Increasing n-3 fatty acids such as EPA would reduce PGF2α and PGE2 but increase PGE3

and leukotriene B4 which cause less severe inflammatory reactions (Yaqoob and Calder,

1995). Lessard et al. (2004) reported the lymphocyte proliferative response was reduced

in dairy cows fed n-6 PUFA-enriched diet compared with cows receiving the n-3 PUFA

diet during the transition period. Since FO reduced the n-6:n-3 ratio in most tissues, FO

may improve immune function in addition to CL maintenance in dairy cows.

Similar to endometrial tissue, the FO diet also increased C18:3, EPA, and DHA in

the liver. These PUFAs are ligands for PPARs which are nuclear transcription factors

that can affect gene transcription. The following three PPAR isoforms, encoded by

separate genes, have been identified thus far: PPARγ, PPARα, and PPARδ. The PPARγ

is expressed in a broad range of tissues including heart, skeletal muscle, colon, small and

large intestines, kidney, pancreas, adipose, and spleen. The PPARγ is necessary and sufficient to differentiate adipocytes, and regulate genes that control cellular energy homeostasis and insulin action (Berger and Moller, 2002). In rodents and humans,

PPARα is expressed in numerous metabolically active tissues including liver, kidney,

heart, skeletal muscle, ovary and brown fat (Nunez et al., 1997; Braissant et al., 1996;

Auboeuf et al., 1997). It is also present in monocytic (Chinetti et al., 1998), vascular endothelial (Inoue et al., 1998), uterine epithelial (Nunez et al., 1997) and vascular smooth muscle cells (Staels et al., 1998). The PPARα has been shown to play a critical

186

role in the regulation of cellular uptake, activation, and β-oxidation of fatty acids (Berger

and Moller, 2002). Long-chain UFA such as linoleic acid, PUFA, including AA, EPA, and linolenic acid, as well as the branched-chain fatty acid phytanic acid, bind to PPARα with reasonable affinity (Willson et al., 2000). Also, GH reduces PPARα expression in

COS-1 cells (Zhou and Waxman, 1999), and both PPARα and PPARγ decrease

expression of GH-activated genes in COS-1 cells (Shipley and Waxman, 2003). In

addition, PPARα decreased expression of GH-activated genes in rat liver (Corton et al.,

1998). The “crosstalk” between the PPAR isomers and GH may reduce the IGF-I

response to exogenous bST injections as reported in Chapter 4. In contrast to PPARα,

PPARγ has a preference for PUFAs over MUFAs (Khan and Heuvel, 2003). The PPARδ

is expressed in a wide range of tissues and cells, with relatively higher levels of

expression noted in brain, adipose, and skin (Braissant et al., 1996; Amri et al., 1995).

Importantly, in the endometrium, PPARδ is vital for normal fertility serving as a

regulator of PG production and vital to embryo implantation in rodent models (Lim et al.,

1997; Lim et al., 1999). The PPARs appear to be one possible route via which PUFAs

can have beneficial effects in humans through regulation of atherosclerotic plaque

formation and stability, vascular tone, angiogenesis, anti-inflammation, cellular

differentitiation, and anti-carcinogenic (Berger and Moller, 2002).

Proportions of fatty acids were different among tissue sources. Milk fat and

mammary tissue appeared to be similar in several fatty acids such as C18:3, EPA and

DHA. This could be due to the amount of milk still in the mammary tissue cells. Also

subcutaneous and internal adipose were similar for several LCFA. Although there are

some tissues that are similar, a wide variation exists in proportions of PUFAs, MUFAs,

187

and SFA across all tissues. These large tissue differences in proportions of fatty acids

could be an indication of the particular fatty acid(s) needed for proper tissue

functionality.

Both MUFAs and PUFAs may reduce cardiac disease in humans by lowering

serum cholesterol concentration. In contrast, increased intake of SFA have been

associated with an increased concentration of both serum cholesterol and low density

lipoprotein cholesterol which are factors associated with increased risk of coronary heart

disease (Nestel, 1995; Menotti, 1999).

Stearoyl-CoA desaturase enzyme, also known as ∆9-desaturase, is responsible for

the oxidation reaction converting SFA to MUFA by the addition of a cis double bond

between carbons 9 and 10 of some medium- and long-chain fatty acids (Tocher et al.,

1998). The DIX has previously been used to measure the amount of ∆9-desaturase

activity in the mammary gland, which has been reported to be correlated positively with

∆9-desaturase mRNA levels (Singh et al., 2004). Endogenously, one of the fatty acids

that ∆9-desaturase enzyme converts is vaccenic acid (trans-11 18:1) into cis-9, trans-11

CLA which is the predominant CLA found in the rumen (Bauman et al., 2003). The

benefits of cis-9, trans-11 CLA and MUFAs on human health have led to widespread

interest in increasing their concentration in the human diet. By evaluating the ∆9-

desaturase enzyme activity in various tissues, the concentrations of cis-9, trans-11 CLA

and MUFAs within the meat and milk for human consumption may be increased. The

DIX index has been previously defined using the following equation: [product of ∆9- desaturase]/[product of ∆9-desaturase + substrate of ∆9-desaturase](Malau-Aduli et al.,

1997; Kelsey et al., 2003). Kelsey et al. (2003) calculated a DIX for four pairs of fatty

188

acids that represented products and substrates for ∆9-desaturase and reported that all four

∆9-desaturase indexes were highly correlated to ∆9-desaturase enzyme activity. The

lower the DIX, the less active the∆9-desaturase is thought to be.

In this study, C14:1/(C14:1 + C14:0) was used as the DIX in all tissues except the

endometrium which had undectable levels of C14:1. Therefore, C16:1/(C16:1 + C16:0)

was used to calculate DIX in endometrial tissue. The FO diet decreased the ∆9-

desaturase activity in the muscle and subcutaneous adipose tissue with a concurrent increase in SFA percent and a decrease in UFA percent. In addition, the FO diet

decreased the ∆9-desaturase activity in the endometrium. In the mammary and internal

adipose tissues when bST was injected into cyclic control-fed cows, the DIX increased

whereas bST injected into FO-fed cows, resulted in a decreased DIX with no difference

in the proportions of SFA and UFA. This illustrates that bST injections can influence the

effects of FO on the ∆9-desaturase activity in some bovine tissues.

Previous studies have shown that insulin can increase ∆9-desaturase mRNA

expression (Daniel et al., 2004; Ntambi et al., 1996). In this study, FO reduced insulin

concentrations in plasma with no additive effects of bST. In addition, cyclic control-fed

cows given bST had reduced insulin concentrations (Chapter 4). It appears that FO and

bST effects on ∆9-desaturase enzyme activity may not be acting through insulin but

possibly through directly regulating enzyme expression. In rodents, dietary PUFAs have

been shown to directly repress a variety of genes at the level of transcription, including

stearoyl CoA desaturase (Sampath and Ntambi, 2005).

The cis-9, trans-11 CLA was increased in the milk fat by feeding the FO-enriched

lipid but decreased in the muscle and subcutaneous adipose tissue. Also trans-9, trans-11

189

CLA was increased in mammary tissue and milk fat in FO-fed cows, and decreased in subcutaneous fat in FO-fed cows not injected with bST. This increase in milk CLA may not be due only to both modified gene expression and enzymatic protein synthesis but also due to regulation of enzyme activity since DIX was decreased in the mammary gland tissue. Furthermore, mobilization of CLAs from other tissue sources (i.e., muscle and subcutaneous adipose) or via the fatty acids in the FO supplemented diet may increase

CLA.

Previous studies demonstrated that the CLA concentration of milk fat was dependent partially on the proportion of UFA in the diet (Griinari et al., 1996) and that

CLA concentrations in milk fat increased as dietary concentration of corn oil increased

(McGuire et al., 1996). In contrast, Kelly et al. (1988) reported that lactating dairy cows fed peanut oil (high in oleic acid), sunflower oil (high in linoleic acid), or linseed oil

(high in linolenic acid) did not affect CLA concentration in milk fat. Although CLA concentration was increased in the milk of the present study, this may be at the expense of mobilizing CLAs from subcutaneous adipose and muscle tissue. Recently Beaulieu et al. (2002) reported increased total C18:1-trans concentrations in tissues of Angus-Wagyu heifers fed a high corn diet supplemented with soybean oil (high in linoleic acid); however cis-9, trans-11 CLA content was highest in the subcutaneous fat but was not altered in any tissue of animals supplemented with soybean oil at 2.5 and 5.0% of dietary

DM. Madron et al. (2002) found greater proportions of cis-9, trans-11 CLA in the intramuscular, intermuscular, and subcutaneous fat in crossbred Angus steers fed diets containing 12.7 to 25.6% extruded full-fat soybeans. However, diets containing a high proportion of linolenic acid, such as fresh grass, grass silage, concentrate containing

190

linseed, and pasture feeding during the finishing period, resulted in an increased

deposition of cis-9, trans-11 CLA in muscle (French et al., 2003; Scollan et al., 2003;

Enser et al., 1999; Poulson et al., 2001).

Biohydrogenation of C18:3 by ruminal microorganisms do not include cis-9, trans-

11 CLA as an intermediate (Harfoot et al., 1998). Griinari and Bauman, (1999) concluded that a relatively small proportion of cis-9, trans-11 CLA formed in the rumen

escapes and is available for deposition in the muscles. Therefore, the conversion of

C18:2 to cis-9, trans-11 CLA by ruminal microorganisms does not appear to be the major

source of cis-9, trans-11 CLA in meat. Thus the activity of the desaturase enzyme and

mobilization from tissues to support physiological functions may play important roles in

the distribution of CLAs in various tissues and milk.

The fatty acid composition of ruminal bacteria is characterized by a large

proportion of odd and branched chain fatty acids in their membrane lipids (Kaneda,

1991). Microbial odd chain fatty acids (C15:0 and C17:0) are formed through elongation

of propionate or valerate (Kaneda, 1991). Keeney et al. (1962) and Dewhurst et al.

(2000) suggested that odd and branched chain fatty acids in duodenal digesta and milk

could provide a qualitative description of the proportions of different classes of microbes

leaving the rumen. The amount of odd and branched chain fatty acids leaving the rumen

could be an indicator of microbial metabolism. In this study, FO increased the amount of

C15:0 in the endometrium and internal adipose but tended to decrease C15:0 in the milk

fat. This could be due to FO affecting ruminal microbes and metabolism along with

tissue specific uptake.

191

Milk fatty acids originate from two sources, de novo synthesis (C4:0 to C14:0 plus part of C16:0) and uptake of preformed lipids (≥C18:0 plus part of C16:0) from the circulation (Bauman and Davis, 1974). Dietary FO has resulted in decreased milk fat synthesis in dairy cows mainly due to a decrease in the synthesis of short-chain fatty acids, and depressed expression of key enzymes in the lipogenic pathway, such as stearoyl-CoA desaturase (Ahnadi et al., 2002). In this study, FO had differential effects on the amount of both short-chain and long-chain fatty acids with no apparent pattern.

The DIX was reduced due to FO feeding in several tissues but not all tissues possibly indicating that FO may both alter rumen metabolism to change the type of fatty acids leaving the rumen, influence the mobilization of fatty acids among tissues, and (or) alter lipogenic enzymes to change de novo synthesis. These effects appear to be tissue specific.

Increases in milk yield of dairy cows treated with bST are the result of coordinated metabolic adaptations in various tissues (Lanna et al., 1995). The overall effects of bST are to enhance growth and (or) lactation by utilizing nutrients while simultaneously coordinating other physiological processes in a manner that supports enhanced performance (Etherton and Bauman, 1998). Treatments with bST have shown to affect directly both lipogenesis and lipolysis, and this may be via the actions of IGF-I, insulin or directly by GH (Etherton and Bauman, 1998). The bST injections in the present experiment may have increased stearoyl-CoA desaturase expression. In the rat, GH treatment increased fatty-acid synthase, stearoyl-CoA desaturase, and sterol regulatory element-binding protein c in the liver (Frick et al., 2002). When insulin and GH treatment were used in combination, effects were not additive and instead, insulin blunted

192 the effects of GH on expression of these genes. In contrast to the liver, adipose tissue gene expression was not influenced by GH. This could explain the interacting effects of bST injections with FO feeding seen in this experiment since FO lowered insulin concentrations in the plasma (Chapter 4). Also, this could explain tissue specific variation in effects by bST injections and FO feeding.

In the present study, bST reduced the amount of PUFAs in the endometrium in cyclic cows and reduced PUFAs in the mammary tissue and milk fat in pregnant cows.

Also in the subcutaneous adipose tissue there were interactions between bST and pregnancy with bST treatment increasing the proportion of MUFAs in pregnant cows but decreasing them in nonpregnant cows. It is unknown how the presence of a conceptus may be regulating various tissues outside the reproductive tract. However, the conceptus does secrete proteins that induce holistic physiological changes in the endometrium and systemically via such proteins as IFN-τ to maintain the CL and sustain progesterone concentrations. Perhaps the conceptus secretes proteins that may directly or indirectly affect fatty acid biosynthesis, metabolism, mobilization, lipogenesis, lipolysis and distributions within various tissues throughout the body. The bST injections increased conceptus sizes and secretions (Chapter 4) which may be the cause for the bST by pregnancy interactions on fatty acid distributions in various tissues.

Conclusions

Dietary supplementation of a FO-enriched lipid, bST treatment, and early pregnancy can have altering effects on fatty acid percentages and distribution in reproductive and other tissues such as adipose, muscle, liver and mammary gland.

Feeding FO altered the endometrium by partially replacing AA with EPA and DHA which may aid in decreasing luteolytic pulsatile secretion of PGF2α. The FO also reduced

193

the n-6:n-3 ratio which may improve immune function. Cows fed FO also had increased

CLA concentrations in the milk fat which may provide a more nutritional product for consumers. Influence of bST injections on the fatty acid profile of tissues was influenced

by pregnancy state. Further investigation is needed to elucidate the action of bST and

pregnancy on fatty acid metabolism and tissue distributions in lactating dairy cows. In

addition, understanding which fatty acids have beneficial effects on reproductive function

would allow for the formulation of diets enriched in those particular fatty acids. Chapter

7 explores the effects of 4 diets enriched in different fatty acids on oocyte quality and

follicular function in lactating dairy cattle.

Table 6-1. Least squares means and pooled SE of the endometrium fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11. Treatments1 Contrasts2 Fatty acid C bST-C FO bST-FO P bST-P S.E. FO bST bST x FO P bST bST x P C12:0 0.48 0.52 0.42 0.41 0.46 0.47 0.05 † NS NS NS NS NS C14:0 0.32 0.25 0.29 0.38 0.26 0.27 0.03 NS NS ** NS NS NS C15:0 0.30 0.30 0.41 0.42 0.27 0.28 0.04 * NS NS NS NS NS C16:0 12.57 13.00 13.40 13.77 12.33 12.81 0.34 * NS NS NS NS NS C16:1 0.31 0.35 0.24 0.28 0.33 0.31 0.04 * NS NS NS NS NS C18:0 20.49 20.14 19.4519.24 20.50 20.37 0.32 ** NS NS NS NS NS C18:1,trans 0.55 0.49 0.71 0.89 0.62 0.62 0.10 ** NS NS NS NS NS C18:1 12.73 14.65 13.0815.28 13.87 13.87 0.72 NS ** NS NS NS NS C18:2 13.61 10.94 14.5411.99 12.64 13.46 0.81 NS ** NS NS NS *

C18:3 0.91 0.88 0.94 0.90 0.88 0.88 0.06 NS NS NS NS NS NS 194 CLA c9t11 0.19 0.17 0.15 0.21 0.20 0.13 0.03 NS NS NS NS NS NS C20:3 3.99 3.54 3.45 3.55 3.65 3.81 0.22 NS NS NS NS NS NS C20:4 14.81 15.85 13.5514.00 15.00 14.50 0.51 ** NS NS NS NS NS EPA C20:5 <0.01 <0.01 0.10 0.15 <0.01 <0.01 0.03 ** NS NS NS NS NS DHA C22:6 0.92 1.14 1.42 1.59 1.01 0.89 0.07 ** ** NS NS NS * Other 17.81 17.76 17.89 16.96 17.98 17.35 0.63 NS NS NS NS NS NS 1 bST-C = bST-cyclic, bST-FO = bST-fish oil, bST-P = bST-pregnant. 2 †P ≤ 0.10, *P ≤ 0.05, **P ≤ 0.01, NS = non-significant

Table 6-2. Least squares means and pooled SE for different fatty acid percentages in endometrium and liver tissue at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11. Treatments1 Contrasts2 Response3 C bST-C FO bST-FO P bST-P S.E. FO bST bST x FO P bST bST x P Endometrium SFA 41.57 41.62 41.36 41.20 41.23 41.38 0.32 NS NS NS NS NS NS UFA 58.43 58.38 58.65 58.80 58.77 58.63 0.32 NS NS NS NS NS NS MUFA 16.54 18.86 17.07 19.80 18.08 17.89 0.87 NS ** NS NS NS NS PUFA 41.89 39.52 41.57 39.00 40.70 40.74 0.91 NS ** NS NS NS NS N6:n34 15.63 13.31 11.56 9.87 14.66 15.98 0.70 ** ** NS NS NS ** DIX5 0.02 0.03 0.01 0.02 0.03 0.02 <0.01 ** NS NS NS NS NS Liver SFA 49.21 49.51 49.45 49.90 48.37 50.79 0.70 NS NS NS NS † NS

UFA 50.78 50.50 50.54 50.10 51.62 49.23 0.69 NS NS NS NS † NS 195 MUFA 16.36 18.41 17.33 19.61 15.67 21.45 2.11 NS NS NS NS † NS PUFA 34.43 32.09 33.21 30.49 35.96 27.77 2.52 NS NS NS NS * NS N6:n34 16.70 17.50 6.82 7.60 13.83 16.43 1.65 ** NS NS NS NS NS DIX6 0.08 0.11 0.08 0.10 0.04 0.07 0.02 NS NS NS ** † NS 1 bST-C = bST-cyclic, bST-FO = bST-fish oil, bST-P = bST-pregnant. 2 †P ≤ 0.10, *P ≤ 0.05, **P ≤ 0.01, NS = non-significant. 3 SFA = saturated fatty acids, UFA = unsaturated fatty acids, MUFA = monounsaturated fatty acids, PUFA = polyunsaturated fatty acids. 4 N6:n3 = (C18:2 + C20:4)/(C18:3 + C20:5 + C22:6). 5 DIX = desaturase index (C16:1/(C16:0 + C16:1)). 6 DIX = desaturase index (C14:1/(C14:0 + C14:1)).

Table 6-3. Least squares means and pooled SE of the liver fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11. Treatments1 Contrasts2 Fatty acid C bST-C FO bST-FO P bST-P S.E. FO bST bST x FO P bST bST x P C12:0 0.32 0.28 0.28 0.40 0.31 0.28 0.04 NS NS † NS NS NS C14:0 1.62 1.43 1.70 1.75 1.36 2.15 0.23 NS NS NS NS NS † C14:1 0.14 0.17 0.15 0.16 0.06 0.15 0.03 NS NS NS † * NS C15:0 0.30 0.29 0.32 0.31 0.26 0.42 0.06 NS NS NS NS NS NS C16:0 18.59 19.24 20.4123.06 16.83 23.68 1.67 NS NS NS NS † NS C16:1 0.83 1.12 1.07 1.09 0.83 1.55 0.31 NS NS NS NS NS NS C18:0 27.48 27.09 25.8223.55 28.43 23.12 1.81 NS NS NS NS NS NS C18:1,trans 1.32 1.23 1.43 1.48 1.34 1.52 0.15 NS NS NS NS NS NS C18:1 14.07 15.89 14.6816.88 13.44 18.23 1.76 NS NS NS NS † NS

C18:2 14.78 14.06 15.1814.67 15.34 13.13 0.93 NS NS NS NS NS NS 196 C18:3 0.46 0.42 0.63 0.55 0.44 0.46 0.04 ** NS NS NS NS NS C20:0 0.65 0.79 0.66 0.69 0.84 0.84 0.13 NS NS NS NS NS NS CLA c9t11 0.31 0.28 0.28 0.29 0.29 0.30 0.03 NS NS NS NS NS NS C21:0 0.20 0.27 0.17 0.08 0.22 0.18 0.03 ** NS ** NS NS † C22:0 0.06 0.13 0.10 0.07 0.11 0.13 0.02 NS NS * NS † NS C20:3 8.68 7.75 6.92 5.04 8.96 6.49 0.97 * NS NS NS † NS C20:4 8.85 8.71 7.50 7.54 9.32 6.65 1.02 NS NS NS NS NS NS EPA C20:5 0.57 0.67 1.10 0.95 0.71 0.11 0.10 ** NS NS NS NS NS DHA C22:6 0.78 0.21 1.62 1.46 0.90 0.14 0.35 ** NS NS NS † NS Other 17.31 16.69 17.12 16.24 17.59 16.41 0.91 NS NS NS NS NS NS 1bST-C = bST-cyclic, bST-FO = bST-fish oil, bST-P = bST-pregnant. 2 †P ≤ 0.10, *P ≤ 0.05, **P ≤ 0.01, NS = non-significant.

Table 6-4. Least squares means and pooled SE for the mammary tissue fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11. Treatments1 Contrasts2 Fatty acid C bST-C FO bST-FO P bST-P S.E. FO bST bST x FO P bST bST x P C8:0 0.67 0.57 0.65 0.61 0.74 0.75 0.13 NS NS NS NS NS NS C10:0 1.50 1.38 1.38 1.16 1.77 1.68 0.28 NS NS NS NS NS NS C11:0 0.12 0.12 0.12 0.08 0.10 0.12 0.02 NS NS NS NS NS NS C12:0 1.85 1.60 1.55 1.30 2.15 1.94 0.29 NS NS NS NS NS NS C14:0 6.99 5.96 6.07 5.60 6.89 6.60 0.71 NS NS NS NS NS NS C14:1 0.40 0.43 0.39 0.24 0.35 0.38 0.05 * NS † NS NS NS C15:0 0.75 0.61 0.66 0.61 0.68 0.81 0.07 NS NS NS NS NS † C16:0 29.00 28.54 29.55 30.64 28.62 27.74 0.65 * NS NS NS NS NS C16:1 1.04 1.53 1.22 1.28 1.19 1.27 0.15 NS † NS NS * NS C18:0 18.78 18.26 17.54 17.40 18.33 18.88 1.08 NS NS NS NS NS NS C18:1,trans 3.17 2.51 3.25 3.22 3.11 3.01 0.35 NS NS NS NS NS NS C18:1 25.83 29.50 27.00 27.75 27.17 27.60 1.59 NS NS NS NS NS NS C18:1 c11 1.20 1.13 1.10 1.17 1.04 1.21 0.09 NS NS NS NS NS NS 197 C18:2 6.14 5.38 6.57 6.13 5.54 5.56 0.45 NS NS NS NS † NS C18:3 0.31 0.25 0.38 0.34 0.28 0.28 0.02 ** ** NS NS † NS C20:0 0.14 0.17 0.26 0.24 0.21 0.18 0.02 ** NS NS † NS NS CLA c9t11 0.50 0.44 0.52 0.47 0.46 0.47 0.04 NS NS NS NS NS NS CLA t9t11 0.08 0.08 0.11 0.11 0.09 0.09 0.01 * NS NS NS NS NS C21:0 0.02 0.01 0.02 0.01 0.02 0.03 <0.01 NS NS NS NS NS NS C20:3 0.50 0.49 0.50 0.46 0.39 0.46 0.04 NS NS NS NS NS NS C20:4 0.82 0.90 0.89 0.92 0.73 0.83 0.13 NS NS NS NS NS NS C22:0 0.07 0.06 0.09 0.08 0.07 0.06 0.01 † NS NS NS NS NS EPA C20:5 0.05 0.05 0.10 0.10 0.05 0.05 0.01 ** NS NS NS NS NS DHA C22:6 0.04 0.00 0.07 0.06 0.01 0.00 0.02 ** NS NS NS NS NS C24:0 0.03 0.03 0.04 0.03 0.04 0.03 <0.01 * NS NS NS NS NS Other 5.31 5.62 6.11 5.45 6.07 5.89 0.52 NS NS NS NS NS NS 1 bST-C = bST-cyclic, bST-FO = bST-fish oil, bST-P = bST-pregnant. 2 †P ≤ 0.10, *P ≤ 0.05, **P ≤ 0.01, NS = non-significant.

Table 6-5. Least squares means and pooled SE for different fatty acid percentages in mammary tissue and milk fat at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11. Treatments1 Contrasts2 Response3 C bST-C FO bST-FOP bST-P S.E. FO bST bST x FO P bST bST x P Mammary Tissue SFA 59.91 57.29 57.90 57.74 59.58 58.78 1.77 NS NS NS NS NS NS UFA 40.09 42.70 42.11 42.26 40.42 41.22 1.77 NS NS NS NS NS NS MUFA 31.65 35.12 32.97 33.66 32.88 33.48 1.71 NS NS NS NS NS NS PUFA 8.44 7.59 9.13 8.60 7.55 7.74 0.61 NS NS NS NS NS NS N6:n3 18.64 20.91 13.56 13.78 18.70 19.56 1.46 ** NS NS NS NS NS DIX 0.05 0.07 0.06 0.04 0.05 0.05 <0.01 * NS * NS NS † Milk Fat SFA 67.43 69.71 67.81 68.82 68.01 69.97 1.29 NS NS NS NS * NS

UFA 32.57 29.29 32.19 31.18 31.99 30.03 1.15 NS NS NS NS † NS 198 MUFA 26.31 24.49 26.31 25.38 26.18 25.63 0.98 NS NS NS NS NS NS PUFA 6.26 4.80 5.88 5.80 5.46 4.40 0.36 NS NS NS NS * NS N6:n3 12.62 13.28 9.63 9.96 13.86 13.41 0.50 ** NS NS NS NS NS DIX 0.09 0.09 0.10 0.08 0.08 0.09 <0.01 NS NS NS NS NS NS 1 bST-C = bST-cyclic, bST-FO = bST-fish oil, bST-P = bST-pregnant. 2 †P ≤ 0.10, *P ≤ 0.05, **P ≤ 0.01, NS = non-significant. 3 SFA = saturated fatty acids, UFA = unsaturated fatty acids, MUFA = monounsaturated fatty acids, PUFA = polyunsaturated fatty acids, DIX = desaturase index (C14:1/(C14:0 + C14:1)), N6:n3 = (C18:2 + C20:4)/(C18:3 + C20:5 + C20:6).

Table 6-6. Least squares means and pooled SE for the milk fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11. Treatments1 Contrasts2 Fatty acid C bST-C FO bST-FO P bST-P S.E. FO bST bST x FO P bST bST x P C4:0 4.15 4.62 5.09 5.23 4.76 4.37 0.20 ** NS NS NS NS * C6:0 1.86 2.27 2.02 2.07 2.06 2.14 0.12 NS † NS NS * NS C8:0 0.72 0.92 0.68 0.72 0.80 0.86 0.08 NS NS NS NS † NS C10:0 2.22 2.56 1.77 2.10 2.32 2.55 0.22 † NS NS NS NS NS C12:0 2.68 2.88 2.08 2.44 2.70 2.94 0.24 * NS NS NS NS NS C14:0 9.45 9.46 8.75 9.48 9.00 10.04 0.44 NS NS NS NS NS NS C14:1 0.91 0.90 0.93 0.77 0.83 0.94 0.07 NS NS NS NS NS NS C15:0 0.89 0.83 0.67 0.72 0.78 0.86 0.09 † NS NS NS NS NS C16:0 28.30 28.98 31.81 32.03 27.70 28.61 0.84 ** NS NS NS NS NS C16:1 1.22 1.31 1.41 1.40 1.22 1.19 0.07 † NS NS NS NS NS C17:0 0.49 0.45 0.43 0.44 0.45 0.45 0.02 NS NS NS NS NS NS C18:0 13.70 14.13 11.88 10.98 14.65 14.50 0.95 ** NS NS NS NS NS C18:1,trans 3.74 2.75 3.41 3.78 3.36 2.99 0.45 NS NS NS NS NS NS 199 C18:1 19.06 18.82 19.36 18.22 19.48 18.27 0.82 NS NS NS NS NS NS C18:2 3.70 3.11 3.50 3.34 3.45 3.20 0.21 NS NS NS NS † NS C18:3 0.29 0.23 0.34 0.31 0.25 0.25 0.02 ** * NS NS † † C20:0 0.16 0.14 0.18 0.17 0.15 0.16 0.01 * NS NS NS NS NS CLA c9t11 0.44 0.34 0.49 0.51 0.39 0.38 0.04 ** NS NS NS NS NS CLA c12t10 0.01 0.01 0.01 0.01 0.01 0.01 <0.01 NS NS NS NS NS NS CLA t9t11 0.01 0.05 0.07 0.09 0.06 0.05 0.01 † NS † NS NS NS C20:3 0.17 0.17 0.11 0.14 0.17 0.13 0.02 * NS NS NS NS NS C20:4 0.17 0.17 0.12 0.15 0.17 0.15 0.01 * NS NS NS NS NS C21:0 0.02 0.02 0.01 0.00 0.01 0.01 <0.01 * NS NS NS NS NS C22:0 0.00 0.00 0.03 0.00 0.01 0.01 <0.01 † † † NS NS NS EPA C20:5 0.02 0.02 0.02 0.03 0.01 0.01 <0.01 NS NS NS * NS NS DHA C22:6 0.00 0.00 0.02 0.02 0.00 0.00 <0.01 ** NS NS NS NS NS C24:0 0.01 0.02 0.01 0.01 0.02 0.01 <0.01 NS NS NS NS NS NS Other 5.56 4.87 4.85 4.89 5.18 4.95 0.26 NS NS NS NS † NS 1 bST-C = bST-cyclic, bST-FO = bST-fish oil, bST-P = bST-pregnant. 2 †P ≤ 0.10, *P ≤ 0.05, **P ≤ 0.01, NS = non-significant.

Table 6-7. Least squares means and pooled SE for the muscle fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11. Treatments1 Contrasts2 Fatty acid C bST-C FO bST-FO P bST-P S.E. FO bST bST x FO P bST bST x P C12:0 0.12 0.14 0.090.19 0.11 0.06 0.04 NS † NS NS NS NS C14:0 1.95 1.75 1.761.91 2.20 2.20 0.31 NS NS NS NS NS NS C14:1 0.43 0.47 0.210.21 0.33 0.38 0.08 ** NS NS NS NS NS C15:0 0.24 0.23 0.270.27 0.28 0.27 0.04 NS NS NS NS NS NS C16:0 23.50 22.25 23.8923.84 23.79 24.78 1.17 NS NS NS NS NS NS C16:1 2.55 2.65 1.671.85 2.39 2.51 0.49 † NS NS NS NS NS C18:0 17.34 17.12 19.4120.24 19.39 19.11 1.45 † NS NS NS NS NS C18:1,trans 1.79 1.49 1.66 1.90 1.87 1.70 0.22 NS NS NS NS NS NS C18:1 c9 33.13 31.32 28.18 27.73 32.07 32.71 2.70 NS NS NS NS NS NS

C18:1 c11 1.83 1.85 1.45 1.51 1.64 1.58 0.16 * NS NS NS NS NS 200 C18:2 10.86 12.06 13.0612.16 9.74 8.86 1.93 NS NS NS NS NS NS C18:3 0.36 0.39 0.440.44 0.33 0.34 0.04 NS NS NS NS NS NS C20:0 0.13 0.15 0.090.17 0.14 0.09 0.03 NS NS NS NS NS NS CLA c9t11 0.31 0.29 0.20 0.23 0.28 0.21 0.04 ** NS NS NS NS NS C22:0 0.14 0.04 0.020.03 0.02 0.02 0.07 NS NS NS NS NS NS C20:3 0.09 0.09 0.040.06 0.02 0.04 0.04 NS NS NS NS NS NS C20:4 1.56 1.90 1.861.70 1.29 1.33 0.51 NS NS NS NS NS NS EPA C20:5 3.64 5.61 5.30 5.12 3.93 3.65 1.50 NS NS NS NS NS NS DHA C22:6 0.15 0.25 0.29 0.28 0.17 0.19 0.08 NS NS NS NS † NS Other 0.00 0.00 0.17 0.17 0.04 0.00 0.03 NS NS NS NS NS NS 1 bST-C = bST-cyclic, bST-FO = bST-fish oil, bST-P = bST-pregnant. 2 †P ≤ 0.10, *P ≤ 0.05, **P ≤ 0.01, NS = non-significant.

Table 6-8. Least squares means and pooled SE for different fatty acid percentages in muscle, subcutaneous adipose, and internal adipose tissue at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11. Treatments1 Contrasts2 Response2 C bST-C FO bST-FO P bST-P S.E. FO bST bST x FO P bST bST x P Muscle SFA 43.39 41.73 45.53 46.69 45.94 46.54 1.71 * NS NS * NS NS UFA 56.62 58.26 54.47 53.30 54.06 53.45 1.69 * NS NS * NS NS MUFA 39.73 37.77 33.17 33.20 38.29 38.88 3.38 NS NS NS NS NS NS PUFA 16.88 20.50 21.30 20.10 15.77 14.57 3.87 NS NS NS NS NS NS N6:n3 29.41 27.67 20.57 19.29 25.71 24.03 3.20 ** NS NS NS NS NS DIX 0.17 0.22 0.11 0.10 0.13 0.15 0.02 ** NS NS ** NS NS Subcutaneous Adipose SFA 48.79 55.31 58.17 61.49 58.89 47.50 2.82 ** † NS NS NS ** UFA 51.21 44.69 41.83 38.51 41.11 52.50 2.81 ** † NS NS NS ** MUFA 47.96 42.05 38.07 35.63 38.71 49.82 2.69 ** NS NS NS NS ** 201 PUFA 3.25 2.63 3.76 2.88 2.40 2.68 0.37 NS † NS NS NS NS N6:n3 12.59 11.56 12.85 10.51 13.09 12.50 1.05 NS NS NS NS NS NS DIX 0.21 0.13 0.07 0.06 0.08 0.25 0.04 * NS NS NS NS ** Internal Adipose SFA 63.73 63.06 64.60 66.10 64.29 65.87 2.06 NS NS NS NS NS NS UFA 36.27 36.93 35.41 33.88 35.72 34.14 2.06 NS NS NS NS NS NS MUFA 33.12 33.80 32.37 30.90 32.97 31.71 2.20 NS NS NS NS NS NS PUFA 3.14 3.13 3.04 2.98 2.75 2.43 0.31 NS NS NS † NS NS N6:n3 11.67 9.99 11.95 12.23 9.08 13.63 1.40 NS NS NS NS NS * DIX 0.06 0.10 0.06 0.04 0.05 0.04 0.01 ** NS ** ** † * 1 bST-C = bST-cyclic, bST-FO = bST-fish oil, bST-P = bST-pregnant. 2 †P ≤ 0.10, *P ≤ 0.05, **P ≤ 0.01, NS = non-significant. 3 SFA = saturated fatty acids, UFA = unsaturated fatty acids, MUFA = monounsaturated fatty acids, PUFA = polyunsaturated fatty acids, DIX = desaturase index (C14:1/(C14:0 + C14:1)), N6:n3 = (C18:2 + C20:4)/(C18:3 + C20:5 + C22:6).

Table 6-9. Least squares means and pooled SE for subcutaneous adipose tissue fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11. Treatments1 Contrasts2 Fatty acid C bST-C FO bST-FO P bST-P S.E. FO bST bST x FO P bST bST x P C12:0 0.08 0.08 0.070.08 0.08 0.10 0.01 NS NS NS NS NS NS C14:0 3.10 3.52 2.953.26 3.23 3.51 0.30 NS NS NS NS NS NS C14:1 0.98 0.52 0.240.23 0.30 1.33 0.28 † NS NS NS NS ** C15:0 0.35 0.35 0.300.37 0.36 0.32 0.05 NS NS NS NS NS NS C16:0 24.81 28.54 28.5229.42 27.57 25.76 1.02 * * NS NS NS ** C16:1 3.88 2.23 1.811.67 1.84 5.64 1.00 NS NS NS NS NS * C18:0 16.97 19.71 22.9324.82 24.21 14.50 2.58 * NS NS NS NS * C18:1,trans 2.21 2.14 2.21 2.81 2.70 1.83 0.27 NS NS NS NS † NS C18:1 37.45 34.88 31.7028.98 31.77 37.38 1.42 ** † NS NS NS **

C18:2 2.15 1.80 2.542.08 1.63 1.61 0.22 NS † NS † NS NS 202 C18:3 0.17 0.16 0.130.20 0.14 0.14 0.02 NS NS † NS NS NS C20:0 0.14 0.11 0.130.13 0.21 0.12 0.05 NS NS NS NS NS NS CLA c9t11 0.45 0.32 0.20 0.26 0.31 0.48 0.07 * NS NS NS NS * CLA t9t11 0.06 0.05 0.03 0.07 0.05 0.05 0.01 NS † * NS NS NS C20:3 0.12 0.10 0.600.07 0.08 0.12 0.20 NS NS NS NS NS NS C20:4 0.06 0.05 0.050.05 0.06 0.09 0.02 NS NS NS NS NS NS C22:0 0.02 0.02 0.030.05 0.03 0.01 0.01 NS NS NS NS NS NS DHA C22:6 0.00 0.01 0.00 0.00 0.00 0.00 <0.01 NS NS NS NS NS NS Other 6.99 5.42 5.57 5.47 5.45 7.04 0.60 NS NS NS NS NS ** 1 bST-C = bST-cyclic, bST-FO = bST-fish oil, bST-P = bST-pregnant 2 †P ≤ 0.10, *P ≤ 0.05, **P ≤ 0.01, NS = non-significant.

Table 6-10. Least squares means and pooled SE for internal adipose tissue fatty acid profile (% total fatty acids) at d 17 after a synchronized estrus (d 0) in lactating cyclic (C) cows fed a control diet, pregnant (P) cows fed a control diet, and cyclic cows fed a fish oil enriched lipid (FO) diet and injected with or without bST on d 0 and 11. Treatments1 Contrasts2 Fatty acid C bST-C FO bST-FO P bST-P S.E. FO bST bST x FO P bST bST x P C12:0 0.07 0.08 0.08 0.07 0.08 0.07 0.01 NS NS NS NS NS NS C14:0 2.56 2.55 2.73 2.42 3.01 2.65 0.20 NS NS NS NS NS NS C14:1 0.15 0.24 0.18 0.10 0.15 0.12 0.04 † NS ** † NS † C15:0 0.28 0.33 0.36 0.36 0.31 0.28 0.03 * NS NS NS NS NS C16:0 24.32 25.45 27.03 26.36 25.99 24.89 1.01 † NS NS NS NS NS C16:1 0.93 1.03 1.05 0.92 1.22 0.85 0.13 NS NS NS NS NS † C18:0 32.78 31.56 30.5632.89 30.79 34.35 2.35 NS NS NS NS NS NS C18:1,trans 2.68 2.62 2.93 3.23 2.99 2.67 0.30 NS NS NS NS NS NS C18:1 27.66 27.40 26.4824.97 26.72 26.54 2.14 NS NS NS NS NS NS

C18:2 2.32 2.06 2.24 2.19 1.89 1.77 0.24 NS NS NS NS NS NS 203 C18:3 0.19 0.17 0.19 0.18 0.17 0.13 0.03 NS NS NS NS NS NS C20:0 0.29 0.33 0.28 0.33 0.37 0.34 0.05 NS NS NS NS NS NS CLA c9t11 0.22 0.24 0.22 0.24 0.25 0.19 0.02 NS NS NS NS NS † CLA t9t11 0.09 0.13 0.08 0.09 0.13 0.09 0.02 NS NS NS NS NS † C20:3 0.09 0.09 0.10 0.08 0.06 0.09 0.03 NS NS NS NS NS NS C20:4 0.04 0.04 0.04 0.04 0.04 0.04 0.01 NS NS NS NS NS NS C22:0 0.06 0.08 0.06 0.07 0.08 0.07 0.02 NS NS NS NS NS NS DHA C22:6 0.04 0.06 0.00 0.00 0.06 0.00 0.02 * NS NS NS NS † Other 5.27 5.56 5.40 5.50 5.69 4.87 0.35 NS NS NS NS NS NS 1 bST-C = bST-cyclic, bST-FO = bST-fish oil, bST-P = bST-pregnant. 2 †P ≤ 0.10, *P ≤ 0.05, **P ≤ 0.01, NS = non-significant.

CHAPTER 7 EFFECTS OF DIETS ENRICHED IN DIFFERENT FATTY ACIDS ON OOCYTE QUALITY AND FOLLICULAR DEVELOPMENT IN LACTATING DAIRY COWS IN SUMMER

Introduction

Dietary supplementation of fat can improve reproductive function of lactating dairy cows. In particular, supplementation of diets with calcium salts of LCFA (Staples et al.,

1998), calcium salts of palm and soybean oil (Cullens et al., 2004), tallow (Son et al.,

1996), rolled and cracked safflower seeds, soybeans, or sunflower seeds (Bellows et al.,

1999), and protein-aldehyde protected dehulled cottonseeds (Wilkins et al., 1996) improved overall pregnancy rates. Collectively, these findings support the concept that feeding of supplemental fats enhances reproductive performance in cattle. Previous studies have shown that fat supplementation can have beneficial effects on the follicle

(Lucy et al., 1992), oocyte (Zeron et al., 2002), embryo (Cerri et al., 2004) and uterus

(Mattos et al., 2000) in dairy cattle. However, the precise fatty acids and mechanisms, by

which fat supplementation increases pregnancy rate, has yet to be determined.

Fatty acids play an important role in changing the biophysical properties and

activity of biological membranes including fluidity and cell proliferation (Shinitzky,

1984). Lipids make up a large portion of cellular membranes, and length of the fatty acid

acyl chain, number, and position of double bonds influences membrane properties

(Stubbs and Smith, 1984). Zeron et al. (2001) examined the effects of seasonal changes

in fatty acid composition of phospholipids from follicular fluid, granulosa cells, and oocytes collected from dairy cattle in both the summer and winter. Percentages of SFA

204 205 in oocytes and granulosa cells were greater in the summer, and percentages of MUFA and PUFA were higher in oocytes and granulosa cells during the winter. Furthermore, relationships between PUFA content, embryonic development, and fertility were detected. The PUFA content of follicular fluid decreased in the summer in association with a decrease in embryo development and dairy cow fertility. Follicle number, oocyte quality, chilling sensitivity, lipid composition in follicular components and lipid phase transition in oocytes were examined in ewes fed a diet supplemented with PUFAs for 13 weeks (Zeron et al., 2002). The PUFA fed ewes had more follicles and oocytes, better quality oocytes, improved integrity of oocyte membranes, and increased proportion of long chain UFA in plasma and cumulus cells.

Feeding a diet high in calcium salts of palm and soybean oil to lactating dairy cows increased the number of blastocysts produced in vitro following transvaginal ovum pick- up (OPU) compared to a diet low in calcium salts of palm and soybean oil (Fouladi-

Nashta et al., 2004). Conception rate to first service was increased when lactating dairy cows were fed a mixture of calcium salts of linoleic and trans fatty acids compared to palm oil (Juchem et al., 2004). In a sub-sample of the cows, fertilization rate, number of total cells, percentage of live cells, and percentage of embryos graded 1 and 2 were greater for linoleic and trans fatty acids versus palm oil fed cows. In addition, the number of accessory sperm cells attached to the zona pellucida was greater (Cerri et al.,

2004). Whether the beneficial effects are due to an enrichment of linoleic and (or) trans fatty acids cannot be determined.

Fatty acid composition of the diet may also affect PG metabolism. Mattos et al.

(2003) observed that addition of specific LCFA to a bovine endometrial cell line in vitro

206

had different effects on the PG cascade. Furthermore, feeding a diet enriched in omega-3 fatty acids to lactating dairy cows resulted in reduced plasma PGFM concentrations early postpartum (Mattos et al., 2002) and following an oxytocin challenge (Mattos et al.,

2004). Diets enriched in omega-6 (C18:2) fatty acids increased plasma PGFM in beef heifers (Filley et al., 2000).

Collectively, these studies indicate that various fatty acids have differential effects on reproductive responses and can also effect oocyte and embryo development.

Understanding which fatty acids have beneficial effects on oocyte and embryo

development may permit feeding of diets enriched in certain fatty acid(s) to enhance

fertility. The objective of this experiment was to examine the effects of feeding four

different sources of supplemental fats enriched in either omega-9 cis (C18:1c), omega-9

trans (C18:1t), omega-6 (C18:2), and omega-3 (C18:3) fatty acids on oocyte quality and

follicular development in lactating dairy cows during the summer.

Materials and Methods

Materials

The media HEPES-Tyrode’s Lactate, IVF-Tyrode’s Lactate, and Sperm-Tyrode’s

Lactate were purchased from Caisson (Sugar City, ID) and used to prepare HEPES-

Tyrodes albumin lactate pyruvate (TALP), IVF-TALP, and Sperm-TALP as previously described (Parish et al., 1986). Oocyte collection medium (OCM) was Tissue Culture

Medium-199 with Hanks salts without phenol red (Atlanta Biologicals, Norcross, GA)

supplemented with 2% (v/v) bovine steer serum (Pel-Freez, Rogers, AR) containing 100

U/mL heparin, 100 U/mL penicillin-G, 0.1 mg/mL streptomycin, and 1 mM glutamine.

Oocyte maturation medium (OMM) was Tissue Culture Medium-199 (Gibco; Grand

Island, NY) with Earle salts supplemented with 10% (v/ v) bovine steer serum, 2 µg/mL

207

estradiol 17-ß, 20 µg/mL bovine FSH (Folltropin-V; Vetrepharm Canada, London, ON),

22 µg/mL sodium pyruvate, 50 µg/mL gentamicin sulfate, and 1 mM glutamine. Percoll

was from Amersham Pharmacia Biotech (Uppsala, Sweden). Frozen semen from various

Angus bulls was donated by Southeastern Semen Services (Wellborn, FL). Potassium

simplex optimized medium (KSOM) containing 1 mg/mL BSA was obtained from

Caisson (Sugar City, ID). On the day of use, KSOM was modified for bovine embryos to

produce KSOM-BE2 as described elsewhere (Soto et al., 2003). Essentially fatty-acid

free BSA was from Sigma (St. Louis, MO) and fetal bovine serum was obtained from

Atlanta Biologicals (Norcross, GA).

The In Situ Cell Death Detection Kit (tetra methyl rhodamine red) was obtained

from Roche (Indianapolis, IN). Hoechst 33342 and glycerol were purchased from Sigma.

Polyvinylpyrrolidone (PVP) was purchased from Eastman Kodak (Rochester, NY) and

RQ1 RNase-free DNase was from Promega (Madison, WI). All other reagents were

purchased from Sigma or Fisher Scientific (Pittsburgh, PA).

Animals and Experimental Diets

The experiment was conducted at the University of Florida Dairy Research Unit

(Hague, FL) during the months of May 2004 through November 2004. All experimental

animals were managed according to the guidelines approved by the University of Florida

Animal Care and Use Committee. Primiparous (n = 22) and multiparous (n = 32)

Holstein cows in late gestation were assigned randomly to experimental treatments

according to mature milk equivalent and (or) body weight. Before calving, cows were

housed in sod-based pens and fed individually utilizing shaded Calan gates (American

Calan Inc., Northwood, NH) beginning 5 weeks prior to expected calving date. Upon

calving, cows were moved to a free-stall barn equipped with fans, sprinklers, and Calan

208

gates. All cows received their respective dietary treatment for at least 3 weeks prior to

actual calving date and continued until approximately 107 DIM. The four diets, each

enriched with a different omega fatty acid, were as follows: 1) high oleic sunflower oil

(Trisun, Humko Oil, Memphis, TN) enriched in omega-9 cis (C18:1c; n = 8 multiparous

cows and 6 primiparous cows), 2) calcium salts of trans fatty acids (Virtus Nutrition,

Fairlawn, OH) enriched in omega-9 trans (C18:1t; n = 8 multiparous cows and 6

primiparous cows), 3) calcium salts of palm and soybean oil (Megalac-R®, Church &

Dwight Co., Princeton, NJ) enriched in omega-6 (C18:2; n = 8 multiparous cows and 5

primiparous cows), 4) linseed oil (Archer Daniels Midland, Red Wing, Minnesota)

enriched in omega-3 (C18:3; n = 8 multiparous cows and 5 primiparous cows). Diets

were formulated to meet or exceed NRC (NRC, 2001) recommendations for Holstein

cows in either late gestation or early lactation that weigh 650 kg and produce 35 kg of

3.5% fat corrected milk (FCM). Diets prepartum were formulated to have a cation-anion difference of -9 meq/kg (DM basis). The ingredient composition for the prepartum diets consisted of corn silage, bermuda hay, ground corn, citrus pulp, mineral, soybean meal and trace mineralized salt. The ingredient compositions for the postpartum diets were corn silage, alfalfa hay, ground corn, citrus pulp, cottonseed hulls, mineral, soyplus®

(West Central Soy; Ralston, IA) and soybean meal. The ingredient composition for both prepartum and postpartum diets were similar between treatments. Chemical compositions were formulated for the four dietary treatments to have a net energy of lactation of 1.74 Mcal/kg DM, a crude protein of 15.33% DM, and a neutral detergent fiber of 34.54% DM. Prepartum rations were formulated to provide approximately 151 g/d of sunflower oil, 76 g/d of calcium salts of trans fatty acids, 152 g/d of calcium salts

209

of palm and soybean oil, and 89 g/d of linseed oil. Assumed average DMI was 10 kg/d

for the prepartum diets and 15 kg/d for the postpartum diets. Postpartum rations were

formulated to provide approximately 320 g/d of sunflower oil, 181 g/d of calcium salts of

trans fatty acids, 367 g/d of calcium salts of palm and soybean oil, and 189 g/d of linseed

oil. Because of anticipated lower DMI in the prepartum period, nonlactating cow rations

were formulated to contain 1.35% oil (DM basis). Postpartum lactating cow rations were

formulated to contain 1.5% oil (DM basis) for the sunflower and linseed oil. As a result,

two of the four diets containing calcium salts were formulated to contain 1.75% for the

calcium salts of trans fatty acids and calcium salts of palm and soybean oil to make the

diets isolipid. This allowed equal energy densities of the diets since the calcium soaps contain approximately 88% of the energy of the oils (NRC, 2001). Fatty acid compositions of the four experimental diets are presented in Table 7-1.

The concentrate portions of the diets were mixed and stored in metal bins of 1.8 ton capacity. Oils were premixed using ground corn as a carrier. Concentrate mixtures and forage sources were mixed in a weighing and mixing unit (American Calan, Inc.) and offered three times daily to allow 5 to 10% orts (as-fed basis). Calan gates were used to monitor individual feed intake of cows. Orts from each diet were collected once daily and weighed. The DM concentration of silage was monitored once weekly (55°C for 48 h) to maintain the proper forage-to-concentrate ratio of diets. Cows were milked 3 times per d, and calibrated electronic milk meters were used at each milking to record milk weights.

Body condition scores and BW were assessed weekly by the same individual.

Synchronization for OPU and TAI

Multiparous and primiparous cows were grouped on a weekly basis and synchronized for OPU using a modified Ovsynch protocol (Bartolome et al., 2005). An

210

injection of GnRH (Cystorelin, Merial, Athens, GA; 2 mL, 100 µg, i.m.) was

administered along with the insertion of a CIDR (CIDR-B®, Pharmacia, Kalamazoo, MI;

1.38 g of progesterone) at 47 ± 3 DIM followed 7 d later (54 DIM) by an injection of

PGF2α (Lutalyse, Pfizer, Kalamazoo, MI; 5 mL, 25 mg, i.m.) and removal of the CIDR

insert (Figure 7-1). Approximately 48 h following PGF2α, a second injection of GnRH

(56 DIM) was administered to induce ovulation at 57 DIM. Beginning 4 d following the

second GnRH injection (3 d following ovulation), OPU was conducted every 3 to 4 d for

5 consecutive sessions (60, 63, 66, 69, and 72 DIM or d 3, 6, 9, 12, and 16 of the

synchronized estrous cycle; Figure 7-1).

The TAI was conducted as follows. Following OPU, a PGF2α injection was given 3 d following the last OPU session (75 DIM) followed by a GnRH (5 mL, 100 µg, i.m.)

injection 72 h later (78 DIM). Approximately 16 to 20 h following GnRH injection, all

cows were inseminated (79 DIM) with semen from a single Holstein bull of good fertility. All cows received a recommended commercial dose (500 mg) of bST

(Posilac®; Monsanto Co., St. Louis, MO) at TAI and biweekly thereafter. The bST

injections were given subcutaneously in the space between the ischium and tail head.

Blood and Temperature Sampling

Blood samples (7 mL) were collected just prior to all synchronization injections (d

47 ± 3, 54, 56, 75, and 78 DIM), prior to each OPU session (d 60, 63, 66, 69, and 72

DIM) and on d 7 following TAI (d 0). Blood samples were collected using 20-g

Vacutainer blood collection needles (Benton Dickinson and Company, Franklin Lakes,

NJ) from the coccygeal vein or artery in three different locations, which were rotated at each bleeding to minimize irritation. Samples were collected in evacuated heparinized

211

tubes (Vacutainer; Becton Dickson, East Rutherford, NJ). Immediately following sample

collection, blood was stored on ice until centrifugation (3000 × g for 20 min at 4˚C) and

collection of plasma within 6 h. Plasma was stored at –20˚C until assayed for progesterone. Rectal temperatures were taken from all cows prior to each OPU session.

Ultrasonography and OPU Procedure

Ovaries were evaluated by real-time ultrasonography (Aloka SSD-500, Aloka Co.

Ltd., Tokyo, Japan) with a 5-MHz linear-array transrectal transducer at 54 and 56 DIM during synchronization for OPU, 75 and 78 DIM of synchronization for TAI, 79 DIM of

TAI, 86 DIM after ovulation, and 107 and 124 DIM for d 28 and d 45 pregnancy diagnoses, respectively. Pregnancy rate was defined as the number of cows confirmed pregnant based on ultrasonography of fetal heartbeat divided by the number of cows inseminated. An ovarian map was made to measure the tissue volume (mm3), number of

CL, and the largest follicle (mm). The volume of CL tissue was calculated using the following equation: volume = 1.333 * π * radius3, where radius = (length/2 + width/2)/2.

For CL with a fluid-filled cavity, the volume of the cavity was calculated and subtracted

from the total volume of the CL.

At the time of OPU, animals were restrained in a squeeze chute and given

anesthesia via a caudal epidural injection of 5 mL of 2% lidocaine (AgTech Inc.,

Manhattan, KS) to provide relaxation to the rectovaginal region. Follicles were aspirated

with the aid of an Aloka 500 portable ultrasound scanner equipped with a needle guide

and connected to a 5 MHz vaginal sector transducer probe. The 4 cm 17 gauge needle

(COOK, Queensland, Australia) with echogenic tip was connected to a regulated vacuum

pump (Pioneer Medical Inc., Melrose, MA) which created a constant vacuum pressure of

75 mmHg when pressure was applied to the attached foot pedal. For each cow, in each

212

OPU session, the number of visibly aspirated follicles and size and number of CL were recorded. Follicular contents from all visible 3-12 mm follicles were collected into a

single 50-mL conical tube containing 10 to 15 mL of OCM.

Following OPU, the aspirate from each donor animal was filtered through a 100

µm cell strainer into a petri dish and the petri dish searched with a dissecting microscope

for cumulus oocyte complexes (COC). Recovered COCs were graded on a scale of 1 to 3

with the following criteria: Grade 1 COC’s had 3 or more layers of cumulus cells with a

homogeneous ooplasm uniform in size, color, and texture; Grade 2 COC’s had 1- 3 layers

of cumulus cells with a homogeneous or slightly degenerated ooplasm; Grade 3 COC’s

had a completely degenerated ooplasm, expanded cumulus cells, or were denuded.

For the first 4 OPU sessions, Grades 1 and 2 COC’s from each individual donor

were washed three times in OCM and placed into 2 mL microcentrifuge tubes containing

approximately 2 mL of OMM which had been pre-warmed and equilibrated at 38.5°C in

5% CO2 in humidified air. For the 5th OPU session, Grades 1, 2, and 3 COC’s were

selected and processed as described above except that COC’s from each individual donor

were also separated by grade. The tubes containing the collected oocytes were placed

into a portable incubator (Minitube, Verona, WI) set at 39°C and held at the farm until

collections from all donor animals were complete (~ 3 h). Following the collection of all

donor animals, COC’s were transported to the laboratory.

In Vitro Production of Embryos from Oocytes Collected by OPU

Upon arrival at the laboratory, COCs were washed 3 times in OMM and placed into

50 uL drops of OMM (1-5 COC’s/drop) overlaid with mineral oil. The recovered COC’s

were allowed to mature for 21-24 h at 38.5°C in 5% CO2 in humidified air. Following

213

maturation, COC’s from the 5th aspiration were denuded of cumulus cells by vortexing in

HEPES-TALP containing 1000 units/mL hyaluronidase type IV for 5 min. After

vortexing, denuded oocytes were processed as described below for the assessment of

meiotic maturation, caspase activity, and (TUNEL) terminal deoxynucleotidyl

transferase-mediated dUTP nick end labeling).

For the first four OPU aspirations, COC’s were washed once in HEPES-TALP after

maturation and placed in their respective groups in 4-well plates (1-5 oocytes per well)

containing 600 µl IVF-TALP per well. Semen from three random Angus bulls was

Percoll-purified and added to each well at a concentration of 1 x 106 spermatozoa/mL.

Following addition of sperm, 25 µL of a solution of 0.5 mM penicillamine, 0.25 mM

hypotaurine, and 25 µM epinephrine in 0.9% [w/v] NaCl was added per well. Sperm and

COCs were coincubated for 8 h at 38.5°C in 5% CO2 in humidified air. After

coincubation, putative zygotes were denuded of cumulus cells by suspending them in

HEPES-TALP medium containing 1000 units/mL hyaluronidase type IV and vortexing

for 5 min.

Following vortexing, presumptive zygotes were washed three times in HEPES-

TALP and once in KSOM-BE2. Presumptive zygotes were then placed into 22.5 µl

culture drops of KSOM-BE2 (1-5 oocytes/drop). Oocytes were cultured at 38.5 °C in 5%

O2, 5% CO2, and 90% N2 in humidified air until d 8 postinsemination. The proportion of

oocytes that cleaved as well as the proportion of embryos at either the 2 to 3, 4 to 7 or > 8 cell stage were recorded at d 3 postinsemination and 2.5 uL of fetal calf serum (to a final concentration of 10% v/v) was added to each culture drop. The proportion of oocytes that developed to the morulae (compacted cell mass), early blastocyst (rudimentary

214 blastocoel cavity), blastocyst (fully formed blastocoel cavity) and advanced blastocyst stages such as expanded (thinned zona pellucida with stretched blastocoel cavity), hatching (zona pellucida breaks and the blastocyst begins to protrude) or hatched (empty zona pellucida with free blastocyst) were recorded on d 8 postinsemination. The TUNEL assay was performed, and number of cells was counted on all morulae and blastocysts.

In Vitro Production of Embryos from Ovaries Collected from an Abattoir

During the same months as the OPU aspirations, ovaries from Holstein and non-

Holstein cows were obtained from a local abattoir (approximately 1.5 h from the laboratory) and transported to the laboratory in 0.9% (w/v) NaCl at room temperature.

The ovaries were sliced and COCs were collected into a beaker containing OCM (which contained 2 U/mL of heparin). All grades 1 and 2 COC’s were separated by breed and matured, fertilized and cultured as described above for OPU oocytes.

Group II Caspase Activity

Group II caspase activity (i.e., caspases-2, -3, and -7) was measured based on cleavage of a synthetic substrate specific for group II caspases (those recognizing the amino acid motif DEXD) and the resultant emission of green fluorescence. Denuded oocytes were washed three times in 50-µl drops of prewarmed HEPES-TALP. Oocytes were then incubated in 25-µl microdrops of HEPES-TALP containing 5 µM PhiPhiLux-

G1D2 at 39°C for 40 min in the dark. Negative controls (oocytes recovered from the abattoir) were incubated in HEPES-TALP only. Following incubation, oocytes were washed three times in 50-µl drops of HEPES-TALP and placed on two-well glass slides containing 100 µl of prewarmed HEPES-TALP. Fluorescence was observed using a

Zeiss Axioplan 2 epifluorescence microscope (Zeiss, Göttingen, Germany). Digital

215

images were acquired using AxioVision software (Zeiss) and a high-resolution black and

white Zeiss AxioCam MRm digital camera.

The TUNEL Assay, Assessment of Total Cell Number, and Progression to Metaphase II

The TUNEL assay was used to detect DNA fragmentation associated with late

stages of the apoptotic cascade as described previously (Jousan and Hansen, 2004).

Embryos were removed from KSOM-BE2 and washed three times in 50-µl drops of 10

mM KPO4 pH 7.4 containing 0.9% (w/v) NaCl (PBS) and 1 mg/mL PVP (PBS-PVP) by

transferring the embryos from drop to drop. Zona pellucida-intact embryos and oocytes

(after measurement of caspase activity as described above) were fixed in a 50-µl drop of

4% (w/v) paraformaldehyde in PBS for 15 min at room temperature, washed three times

in PBS-PVP, and stored in 500 µl of PBS-PVP at 4°C until the time of assay. All steps of the TUNEL assay were conducted using microdrops in a humidified box.

On the day of the TUNEL assay, embryos and oocytes were transferred to a 50-µl drop of PBS-PVP and then permeabilized in 0.1% (v/v) Triton X-100 containing 0.1%

(w/v) sodium citrate for 10 min at room temperature. Positive controls for the TUNEL

assay (oocytes from ovaries obtained at the abattoir) were incubated in 50 µl of RQ1

RNase-free DNase (50 U/mL) at 37°C in the dark for 1 h. Positive controls and treated

oocytes and embryos were washed in PBS-PVP and incubated in 25 µl of TUNEL

reaction mixture containing tetra methyl rhodamine red conjugated dUTP and the enzyme

terminal deoxynucleotidyl transferase as prepared by and following the guidelines of the manufacturer) for 1 h at 37°C in the dark. Negative controls were incubated in the

absence of terminal deoxynucleotidyl transferase. Oocytes and embryos were then

washed three times in PBS-PVP and incubated in a 25-µl drop of Hoechst 33258 (1

216

µg/mL) for 15 min in the dark. Oocytes and embryos were washed three times in PBS-

PVP to remove excess Hoechst 33258 and mounted on 10% (w/v) poly-L-lysine coated slides in glycerol. Total cell number (embryos), completion of metaphase II (oocytes; based on observation of two polar bodies), and TUNEL positive nuclei (embryos and oocytes) were assessed using a Zeiss Axioplan 2 epifluorescence microscope (Zeiss,

Göttingen, Germany). Digital images were acquired using AxioVision software and a high-resolution black and white Zeiss AxioCam MRm digital camera.

Statistical Analyses

All oocyte and embryo responses were analyzed using the GLIMMIX procedure of

SAS (SAS Inst. Inc., Cary, NC). The model included treatment (C18:1c, C18:1t, C18:2, and C18:3), parity (primiparous and multiparous), and experimental day (d 3, 6, 9 and 12) with the higher order interactions. If the higher order interactions were not significant, they were removed from the model. Cow within treatment or cow within treatment x parity were random effects specified in the models. The covariance structure used was an autoregressive order 1. Predesigned orthogonal contrasts were used to make comparisons between groups of treatments and probability differences (PDIFF) were used to compare individual treatment means. A maximum of 50 was used for the number of iterations to be performed in order to meet convergence criteria. An error statement was used to specify the data distribution as either poisson for continuous non-normally distributed data and binomial for discreet non-normally distributed data. Also, a link statement was used to specify that a log calculation was used for a poisson distribution and logit for a binomial distribution.

Pregnancy rates, maturation to metaphase II, group II caspase activity, and TUNEL analysis from oocytes collected on the 5th OPU session were analyzed using the Logistic

217

Regression procedure of SAS to examine the main effects of treatment, parity and treatment x parity.

During the OPU aspirations, progesterone concentration, number of CL and follicles, and CL tissue volume were analyzed using the Mixed Model procedure of SAS

(Littell et al., 1996). This procedure applies methods based on the mixed model with special parametric structure on the covariance matrices. The dataset was tested to determine the covariance structure that provided the best fit for the data. Covariance structures tested included compound symmetry, autoregressive order 1 and unstructured.

The covariance structure used was autoregressive order 1. Cow within treatment x parity was specified as a random effect in the model. The model consisted of treatment, parity and day with the higher order interactions. If the higher order interaction were not significant they were removed from the model. The CL tissue volume was adjusted using

CL number as a covariate.

Size of the largest follicle on d 0 and 7, CL number and volume on d 7, and plasma progesterone concentration on d 7 following TAI were analyzed using the GLM procedure of SAS. The main effects of treatment (C18:1c, C18:1t, C18:2, and C18:3), parity and the interaction of treatment x parity were examined with the number of CL used as a covariate for CL volume. Predesigned orthogonal contrasts were used to make comparisons between groups of treatments, and probability differences (PDIFF) were used to compare individual treatment means.

Results

Dry Matter Intake, Body Weight, and Milk Yield

There were no differences among treatments for individual DMI prepartum (8.8,

9.2, 8.7, and 9.4 ± 0.5 kg/d) and postpartum (16.6, 16.2, 15.8, and 16.6 ± 0.6 kg/d), milk

218 yield (34.5, 34.7, 32.2, and 34.0 ± 1.4 kg/d), milk true protein concentration (2.8, 2.8, 2.8, and 2.8 ± 0.1%), and BW postpartum (586, 575, 555, and 558 ± 15 kg) for diets enriched in C18:1 cis, C18:1 trans, C18:2 and C18:3 fatty acids, respectively (Amaral et al., 2005).

Follicle and Oocyte Responses to Different Diets

Body temperatures and number of follicles aspirated per cow were not different among treatment groups (Table 7-2). There were more visible follicles aspirated in primiparous cows compared with multiparous cows (4.2 vs. 5.1 ± 0.3, respectively; P <

0.01). A total of 316, 236, 191, and 268 oocytes were collected from cows fed diets enriched in C18:1 cis, C18:1 trans, C18:2 and C18:3 fatty acids, respectively. An average of 4.6 ± 0.4 follicles per cow were aspirated with an average of 3.7 ± 0.3 oocytes per cow recovered (80% recovery rate). More oocytes were collected (P < 0.05) and recovery rate was greater (P < 0.05) from cows fed C18:1 cis than all other diets (4.7 vs.

3.5, 3.1, 3.7 ± 0.5 and 96.4 vs. 70.8, 70.5, 80.8 ± 9.1%, respectively; Table 7-2). Of the oocytes collected, there was no interaction between diet and grade on the distribution of oocytes graded 1, 2, or 3. The average percent of grades 1, 2 or 3 oocytes among all treatments were 36.5% (77/211), 49.8% (105/211), and 13.7% (29/211), respectively.

Diet did not affect cleavage rate (Table 7-2) or the stage of embryonic development at d 3. The number of oocytes that became morula or blastocysts and the number of oocytes that became blastocysts were not different among treatment groups (Table 7-2.).

However, when individual treatments were compared, oocytes from cows fed the diet enriched in C18:1 cis compared with oocytes from cows fed the diet enriched in C18:2 had lower development to morulae or blastocyst stage (P < 0.10) and lower development to the blastocyst stage (P < 0.05). This was apparent whether development was expressed as a percentage of oocytes (14.0 vs. 5.2 ± 3.5% and 8.4 vs. 2.0 ± 2.4%,

219

respectively; Table 7-2) or cleaved embryos (19.7 vs. 6.7 ± 5.3% and 13.1 vs. 3.0 ± 3.6%,

respectively; Table 7-2).

The number of blastomeres in morulae and blastocysts on d 8 were not different

among treatment groups. When individual means were compared for the percentage of

blastomeres that were TUNEL positive, oocytes from cows fed the C18:1 trans enriched

diet resulted in embryos with reduced (P < 0.05) percentage of TUNEL-positive

blastomeres compared with embryos produced from oocytes obtained from cows fed the

C18:1 cis enriched diet (5.9 vs. 2.7 ± 1.6%, respectively; Table 7-2). Oocytes from

primiparous cows tended (P < 0.10) to result in embryos with a reduced number of

TUNEL positive cells compared with oocytes from multiparous cows (3.1 vs. 5.5 ± 1.2%,

respectively).

Follicle and Oocyte Responses to Different Days of the Estrous Cycle

The number of visible follicles was greater on d 3 following induced ovulation

versus all other days of aspiration (P < 0.01; Table 7-3). Number of oocytes collected

was also greater on d 3 and 6 as compared with d 9 and 12 (P < 0.01; Table 7-3).

However, the recovery rate was greater for d 6 compared with d 9 and 12 (P < 0.05;

Table 7-3). There was no interaction between oocyte grade and day of the estrous cycle

on the distribution of oocytes that graded 1, 2, or 3. The percent of cleaved embryos

tended to be greater on both d 3 and 6 compared with d 9 and 12 (P < 0.10; Table 7-3).

Oocyte Quality for the 5th OPU session

On the 5th OPU session (approximately d 16 of the estrous cycle), 151 oocytes were collected and proportions exhibiting caspase activity, TUNEL positive, and progressed to metaphase II was assessed. There was no effect of C18:1 cis, C18:1 trans, C18:2 or

C18:3 enriched diets on percent of oocytes with caspase activity (9.4% [3/32], 7.7%

220

[2/26], 9.1% [5/55], and 2.6% [1/38], respectively), percent TUNEL positive (33.3%

[10/30], 8.3% [2/24], 7.3% [4/55], and 18.9% [7/37], respectively), or percent that

progressed to metaphase II (65.5% [19/29], 77.8% [14/18], 76.9% [40/52], and 80.6%

[29/36], respectively). However, the percent of oocytes with caspase activity was decreased in grades 1 and 2 versus grade 3, and the percent that matured to metaphase II

was increased in grades 1 and 2 compared to grade 3 (P < 0.01; Table 7-4). No

difference among grades for the percent oocytes that were TUNEL positive (Table 7-4).

Internal IVF Control from Slaughterhouse Ovaries

Holstein (n = 115) and non-Holstein (n = 112) oocytes were collected from

slaughterhouse ovaries and those of grades 1 and 2 were fertilized in vitro. There was no

effect of breed on the proportion of oocytes that cleaved (non-Holstein 78.9 ± 6.7%

[88/112] vs. Holstein 68.0 ± 6.7% [76/115]) by d 3. At d 3 postinsemination, there was a

tendency for an increase in the percent cleaved embryos that reached the >8 cell stage for

embryos from non-Holstein oocytes compared with embryos from Holstein oocytes

(breed x stage interaction, P < 0.10; Figure 7-2). The percentage of oocytes that became

blastocysts on d 8 tended to be reduced for Holstein oocytes (21.2 ± 11.4% [22/115]) as

compared with non-Holstein oocytes (35.1 ± 12.3% [41/112]; P < 0.10). There was no

breed difference in the proportion of cleaved embryos that were blastocysts on d 8 (non-

Holstein 40.2 ± 15.0% [41/88] vs. Holstein 33.3 ± 14.9% [22/76]). However, the stage of

blastocyst development was more advanced in the non-Holsteins (P < 0.05; Figure 7-3).

Progesterone, Ovarian, and Pregnancy Responses

No difference in plasma progesterone was detected among treatments at 47 ± 3

DIM (at the start of synchronization; 3.0 ± 0.7 ng/mL) and during each OPU session (4.0

± 0.4 ng/mL). There was no main effect of diet on CL number (1.0 ± 0.1), or CL volume

221

(8497 mm3). There was, however, an effect of parity on CL number with primiparous cows having less CL than multiparous cows (0.9 vs. 1.2 ± 0.1) during the first 4 OPU aspirations. As expected, there was a main effect of day with both CL volume and

progesterone increasing from d 3 to d 16 following a synchronized estrus (P < 0.01;

Figure 7-4). At TAI, the largest follicle was increased in cows fed diets enriched in

C18:2 or C18:3 (P < 0.05; Table 7-5). Subsequently, CL volume was larger in cows fed

diets enriched in C18:2 or C18:3 (P < 0.05; Table 7-5). There was, however, no effect of

treatment on plasma progesterone concentration on d 7 (Figure 7-4). CL number tended

to be greater for cows fed a C18:1 trans-enriched diet (diet x parity interaction, P < 0.10;

Table 7-5). The largest follicle on d 7 was reduced in cows fed a diet enriched in C18:1

cis compared with all other diets (P < 0.05; Table 7-5). Pregnancy rate did not differ on

either d 28 or d 45 following TAI (Table 7-5).

Discussion

In this study, the source of supplemental fat enriched in different omega fatty acids

affected oocyte quality as determined by subsequent capacity to form a developing

embryo after in vitro fertilization, and affected follicle and CL sizes in lactating dairy

cows during summer. When individual diets were compared, the proportion of oocytes

and cleaved embryos that developed to the morulae and blastocyst stages were reduced in

cows fed a diet enriched in C18:2 versus C18:1 cis. In a study by Hochi et al. (1999),

embryos cultured in 0.3% linoleic acid-BSA had a reduced development to the morulae

stage and further reduced development to the blastocyst stage compared to embryos

cultured in 0.3% BSA. Possibly increasing the linoleic acid in the diet would have

increased the amount of linoleic acid in the oocyte subsequently decreasing embryo development in vitro as shown in the present study.

222

The detrimental effect of a high concentration of linoleic acid (C18:2) on oocyte capacity for development following in vitro fertilization may be related to damage to the oocyte (or possibly the resultant embryo) caused by lipid peroxide radicals derived from linoleic acid. Linoleic acid inhibited the in vitro development of 1- or 2-cell stage mouse embryos, and the inhibitory effect was reversed by addition of antioxidants (Nonogaki et al., 1994). Homa and Brown, (1992) cultured bovine oocytes, from slaughterhouse ovaries, with linoleic acid and noticed a significant reduction in spontaneous germinal vesicle breakdown compared with oocytes cultured without fatty acids. In addition, follicular fluid from small versus large follicles was analyzed for fatty acid concentrations, and linoleic acid was the only fatty acid significantly reduced in large but not small follicles. It is only after the follicle has grown to the large preovulatory stage that the inhibitory influence on resumption of meiosis in oocytes is released, under the influence of LH (McGaughey, 1983).

In the study by Homa and Brown, (1992), linoleic acid inhibited germinal vesicle breakdown and progression to metaphase II compared to unsupplemented oocytes (35 vs.

81%) illustrating that linoleic acid can affect nuclear maturation. However, in the present study, diet did not effect nuclear maturation as measured by caspase activity, TUNEL labeling and progression to metaphase II but possibly exerted its affects on cytoplasmic maturation owing to the decrease in embryo development to both the morulae and blastocysts stage.

Holstein and non-Holstein oocytes from slaughterhouse ovaries were used as an internal IVF control relative to OPU collected lactating Holstein oocytes. Development to the blastocyst stage from Holstein versus non-Holstein slaughterhouse oocytes was

223 reduced on d 8 (21.2 vs. 35.1%). In addition, the average blastocyst development from all diets of OPU collected oocytes (5.6%) was lower than the Holstein slaughterhouse oocytes on d 8.

Reduction of blastocysts development in OPU oocytes appears to not only be due to the effect of breed but may be due to many factors. Lactation may play a large part in the reduction of embryo development in OPU collected lactating dairy cow oocytes versus slaughterhouse oocytes which were most likely from nonlactating cows.

Gwazdauskas et al. (2000) collected oocytes throughout lactation by twice weekly OPU and concluded that stage of lactation and dietary energy influenced oocyte quality. They also reported reduced oocyte quality and embryo development in lactating versus nonlactating cows. Recently, Sartori et al. (2002b) showed that embryos flushed from lactating cows were of lower quality than nonlactating cows.

Another possibility is that slaughterhouse oocytes underwent a 4 h period before their removal from follicles and placement into maturation media; whereas OPU oocytes were placed into maturation media within 30 min following removal from the follicle.

Blondin et al. (1997) collected slaughterhouse ovaries and held them in warm saline for different times post slaughter. The immature oocytes were then collected and IVF was performed. The maximum number of blastocysts obtained was after 4 h of incubation in warm saline (30%) compared to half of that at 2 h (15%). Oocytes collected from slaughterhouse ovaries undergo a post-mortem effect where the COC becomes less tightly connected to the follicle wall and therefore is collected with a more complete morphology (Blondin et al., 1997). The post-mortem effect induces prematuration events

224

which have beneficial effects on oocytes collected from slaughterhouse ovaries since

embryo development was increased in vitro.

Competence of the oocyte and embryo is related to fatty acid composition;

specifically, phospholipid content of the cellular membrane plays a vital role in development during and after fertilization (McEvoy et al., 2000). Previous studies showed that C16:0 and C18:1 acids were the most abundant fatty acids in the phospholipid fraction of oocytes from cattle and may function as energy reserves (Kim et al., 2001; Zeron et al., 2001). However, most studies on fatty acids in the oocytes or embryos of ruminant species address their accumulation in culture or highlight their damaging influence during cryopreservation rather than the importance of their

composition or contribution to cell structure, function and metabolism.

Temperature modulates the physical properties of the lipids in cell membranes and

changes lipid composition of the membrane (Quinn, 1985). Zeron et al. (2001) showed

that oocyte membrane fluidity is affected by temperature alterations between seasons, as

well as by changes in fatty acid composition. Furthermore, a relationship was

documented between decreased PUFA content, a change in biophysical behavior of

oocytes, and low fertility of dairy cows during summer. The number of high quality

oocytes was higher in ewes fed PUFAs than in control ewes (74.3% and 57.0%,

respectively), and PUFA supplementation increased the proportion of long chain UFA in

the plasma and cumulus cells (Zeron et al., 2002). However, these changes in fatty acid

composition were relatively small in oocytes, indicating that uptake of PUFAs to the

oocyte is either selective or highly regulated.

225

A major difference between the study in ewes and the present study, in which

oocyte quality was reduced by the diet enriched in C18:2 as illustrated by reduced

embryo development in vitro, is that lactating dairy cows have a high utilization of fatty

acids for lactation. An additional point in the present study was that dietary differences

reflected different degrees of desaturation, isomerization and classification of C18 fatty acids and there was no treatment group without supplementation of fatty acids. Perhaps oocyte quality may have been reduced from those harvested from cows not supplemented with fatty acids in comparison with cows supplemented with fatty acids. This study was conducted during the summer heat stress season and is a season in which Zeron et al.

(2001) showed that MUFA and PUFA contents are lower in oocytes and granulosa cells compared to the winter season in dairy cattle. In the lactating cows of the present study, there may have been a preferential uptake and utilization of fatty acids by tissues such as the mammary gland that did not permit a change or sustained the reduced follicular contents of MUFA and PUFA. Consequently, the MUFA or PUFA enriched diets did not have profound effects on oocyte quality in vivo as measured by subsequent embryo quality in vitro.

The UFA may have a more profound effect on the environment surrounding the oocyte which provides essential nutrients for oocyte/embryo survival post ovulation.

During the periovulatory period, oocytes go through nuclear and cytoplasmic maturation

and fatty acids are acquired for cell structure, function and metabolism. Storage of fatty

acids, proteins and mRNA are critical to an early embryos survival before activation of

its own genome. Since in this study, diets enriched in PUFAs had effects on the

dominant follicle with the largest follicle at TAI being increased in cows fed diets rich in

226

PUFA versus cows fed diets rich in MUFA (Table 7-5). A majority of the oocyte maturation occurs during its time in the dominant follicle. The present experimental approach of targeting oocytes from smaller follicles may not reflect the environment and control systems of the dominant periovulatory follicle. In smaller follicles, the fatty acids may not have been in sufficient amounts to have a beneficial affect on both the oocyte, cumulus cells and (or) follicular fluid. For example, oocytes were aspirated from 3 to 12 mm follicles which would not be pre-ovulatory follicles in a lactating dairy cow (Sartori et al., 2002a).

Other studies have shown that supplemental fat increases the average size of the dominant follicle in lactating dairy cows (Lucy et al., 1991b; Lucy et al., 1993b; Beam and Butler, 1997). Dominant follicle size was increased in cows fed diets enriched in

PUFAs compared with cows fed a diet enriched in MUFAs indicating that it was PUFAs that were most effective (Staples et al., 2000). In the present experiment, the first wave dominant follicle was increased in cows fed diets enriched in C18:1 trans, C18:2 and

C18:3 when compared with the diet enriched in C18:1 cis. Oldick et al. (1997) infused abomasally lactating dairy with water, glucose, tallow or yellow grease and observed that first wave dominant follicles grew faster and were larger in cows infused with yellow grease versus tallow. It appears that diets enriched in different fatty acids can have differential effects on follicle development.

Larger ovulating dominant follicles in heifers, nonlactating, and lactating dairy cows resulted in larger CLs (Sartori et al., 2002a; Moreira et al., 2000a). The CL volume was increased in cows fed PUFA enriched diets compared with cows fed MUFA enriched diets. Lactating dairy cows fed an enriched diet of C18:2 had CL 5 mm larger than

227

control-fed cows (Garcia-Bojalil et al., 1998). Larger CLs were found with lactating

dairy cows that received high levels of omega-3 fatty acids through the diet as formaldehyde-treated linseed or as a mixture of formaldehyde–treated linseed and fish oil

(Petit et al., 2002). Larger CLs may not only be due to ovulation of a larger follicle but also through direct effects on the CL. Electron microscopic examination of CL tissue revealed that lipid content was greater in luteal cells from beef heifers fed calcium salts of LCFA compared with unsupplemented controls (Hawkins et al., 1995).

Although there were larger CL volumes in PUFA fed cows during the aspiration cycle (d 3-16 of the synchronized estrous cycle), progesterone concentrations did not differ between diets and did not differ on d7 after TAI. Previous studies have reported an increase (Staples et al., 1998), no effect (Chapter 4; Mattos et al., 2002), or decrease

(Robinson et al., 2002) in plasma progesterone in dairy cows supplemented with LCFA.

Another biological window in which fatty acids may have a beneficial effect is on

the follicular, oviductal and (or) uterine environments. Cerri et al. (2004) fed lactating

dairy cows a diet enriched in a mixture of linoleic and 18:1 trans fatty acids and found an

increase in fertilization rate, accessory sperm per structure, amount of high quality

embryos and cell number when cows were flushed on d 5 following TAI. In their model,

oocyte maturation, fertilization, and embryo development occurred in vivo. Unsaturated

fatty acids have been shown to have beneficial effects on the uterine environment. In

Chapter 4 and 5, feeding calcium salts of fish oil to lactating dairy cows altered gene

expression in the endometrium of cyclic cows in a manner that mimicked gene

expression of pregnant cows. Also, the fish oil changed the fatty acid composition of the endometrium (i.e., increased EPA and DHA, and reduced AA; Chapter 6) in a manner

228

that would reduce secretion of PGF2α as reported in lactating dairy cows (Mattos et al.,

2002).

By modulating PG production through fat feeding, it may be possible to change the follicular, oviductal, and uterine environments in a manner that alters both oocyte and embryo development. Prostaglandins E2 and F2α are important mediators of the ovulatory

process. Their concentration in follicular fluid increases sharply before ovulation at a

time when the oocyte is going through its final maturation process. Scenna et al. (2004)

cultured bovine embryos with PGE2 or PGF2α, and observed that PGF2α reduced

development to the blastocyst stage and PGE2 had no effect. In addition, results from

Lozano et al. (2003) indicated that a diet that increased PGF2α production by the uterine

tissue in sheep also decreased oocyte quality and early embryo development. In mouse

oviducts, maximal PGI2 was produced on d 2 to 3 after conception and was shown to

enhance embryonic development (Huang et al., 2004). Thus, alterations in PG classes via

dietary manipulation may change oocyte and embryo quality.

Stage of the estrous cycle effected oocyte responses with the first two aspirations

(i.e., d 3 and 6 of the estrous cycle) generally being better than the last two aspirations

(i.e., d 9 and 12). When dairy cow follicles were aspirated on d 2, 5 or 8 of an induced follicular wave, the proportion of oocytes competent to develop a blastocyst was increased on d 2 and 5 compared with d 8 (Hendriksen et al., 2004). Lower rates of blastocyst development were reported when OPU was performed once a week in comparison with OPU every 3 to 4 d (Goodhand et al., 1999; Hanenberg and van

Wagtendonk-de Leeuw, 1997). Presumably, the higher frequency of OPU prevents the establishment of a dominant follicle. A dominant follicle clearly reduces the competence

229 of oocytes from subordinate follicles. This impairment occurs, however, rather late during the non-growing phase of the dominant follicle (Hendriksen et al., 2004). In addition, Hendriksen et al. (2000) reported follicles in the beginning of atresia had more competent oocytes that developed into a blastocysts compared with oocytes from follicles that are not beginning atresia. Also when an LH surge is induced prior to oocyte collection, prematurational events occur in the oocyte and further maturation of the follicle allowing for an increased oocyte competence and subsequent embryo development (Hendriksen et al., 2000).

In our study, cows were synchronized before OPU with an Ovsynch protocol plus a

CIDR insert. Aspirations began 3 to 4 d following the last GnRH injection that ovulated the dominant follicle leaving the slightly atretic subordinate follicles with oocytes undergoing prematurational events possibly owing to better oocyte quality, recovery and cleavage rate on the first OPU session versus the other four sessions. Bols et al. (1998) showed, using OPU sessions of 3 and 4 d intervals, a decline from 9.6 oocytes per first

OPU session to 3.9 in the second and an average of 6.2 oocytes from the fourth session onwards. In addition, Merton et al. (2003) used a similar OPU scheme with the first session performed at random stages of the cycle without prior removal of the dominant follicle. First collection averaged 14 oocytes per pregnant heifer declining thereafter to about 9 per session. Also, Petyim et al. (2003) found that presence of CL producing progesterone had no influence on oocyte yields and quality, whereas presence of dominant follicles appeared to decrease the number of recovered oocytes.

Conclusions

Type of fat with respect to specific composition of omega fatty acids of the 18 carbon series can alter oocyte quality and follicular dynamics in lactating dairy cows.

230

Effect of feeding PUFAs as compared to MUFAs affected oocyte quality demonstrated by subsequent embryo development in which the C18:2 enriched diet reduced embryo

development compared to C18:1 cis enriched diet. This suggests the previously

documented benefits of PUFAs reflect actions at alternative biological windows. In this

study, only small follicles (3-10 mm) were aspirated so effects on periovulatory follicles

would not be observed. Possible beneficial effects of PUFAs on the periovulatory follicle

and CL are evident by the increase in dominant follicle size and CL volume due to

feeding PUFAs (i.e., 18:2 and 18:3). Also, local effects of the fatty acid environment

during nuclear and cytoplasmic maturation were eliminated because maturation occurred

in vitro. Fatty acid composition of the diet could also alter the oviductal or uterine

environment (i.e., gene expression) to promote embryo development. Further research is

warranted in isolating particular fatty acids that may have beneficial effects on various

biological windows that may alter fertility in lactating dairy cows.

231

Table 7-1. The percent of fatty acids from the total fatty acids in the supplemental fat sources.ab Treatment High oleic Ca salts of trans Ca salts of palm Fatty Acid sunflower oil fatty acids and soybean oil Linseed oil C16:0 3.7 12.2 17.4 5.8 C18:0 5.4 6.7 2.1 3.4 C18:1 transc < 1.0 57.5 1.5 18.0 C18:1 cisc 81.3 10.0 32.1 < 1.0 C18:2 9.0 2.0 30.5 16.4 C18:3 < 1.0 < 1.0 2.4 55.9 a Data are percent of total fatty acids (w/w). b Ca = calcium. c The different C18:1 trans and cis isomers could not be identified.

232

Ovsynch Ovum Pick-up Ultrasound

G PG G 1st 2nd 3rd 4th 5th PG G TAI d 7 d 28 d 45 CIDR

47±3 DIM 54 56 60 63 66 69 72 75 78 79 86 107 124 Estrous cycle d 3+1 6 9 12 16

Figure 7-1. Experimental protocol illustrating the days in milk (DIM) for synchronization injections, ultrasonography, ovum pick-up, and timed artificial insemination (TAI; d 0). G = GnRH, PG = PGF2α, CIDR = controlled internal drug releasing insert containing 1.38 g of progesterone.

233

Table 7-2. Body temperature, and follicular and oocyte responses of lactating multiparous and primiparous cows fed diets enriched in either C18:1 cis (n=14), C18:1 trans (n = 14), C18:2 (n=13) or C18:3 (n =13).a Treatments Contrasts Trt. 1 Trt. 2 Trt. 3 Trt. 4 1 vs. 2 vs. 3 vs. Response S.E. C18:1c C18:1t C18:2 C18:3 2,3,4 3,4 4 Temperature,°C 38.7 38.8 38.8 38.7 0.1 NS NS NS Follicle number 4.9 4.9 4.2 4.6 0.4 NS NS NS Oocyte number 4.7b 3.5 3.1c 3.7 0.5 * NS NS Oocyte 96.4b 70.8c 70.5c 80.8 9.1 * NS NS recovery,% Cleaved,% of oocytes 51.6 61.3 53.2 52.9 5.3 NS NS NS (117/227) (104/171) (76/144) (101/186) M + BL,% of oocytes 14.0x 10.5 5.2y 10.4 3.5 NS NS NS (36/192) (20/148) (8/126) (22/157) M + BL,% of cleaved 19.7x 14.0 6.7y 16.2 5.3 NS NS NS embryos (36/117) (20/104) (8/76) (22/101)

M + BL cell no. 111.3 101.8 82.5 110.7 11.9 NS NS NS BL,% of oocytes 8.4b 6.9x 2.0c,y 5.2 2.4 NS NS NS (32/192) (18/148) (4/126) (19/157) BL,% of 13.1b 9.2 3.0c 9.1 3.6 NS NS NS cleaved embryos (32/117) (18/104) (4/76) (19/101) TUNEL + 5.9b 2.7c 5.0 3.6 1.6 NS NS NS blastomeres,% a Data outside of parentheses represent least-squares means and pooled SE. Data in parentheses represent the fraction of follicles that yielded a recoverable oocyte (recovery), or the fraction of oocytes or cleaved embryos that became morulae (M) and (or) blastocysts (BL). b,c x,y P < 0.05, P < 0.10, * P < 0.05, NS = non-significant.

234

Table 7-3. Follicular and embryonic responses of lactating multiparous and primiparous cows fed diets enriched in either C18:1 cis (n=14), C18:1 trans (n = 14), C18:2 (n=13) or C18:3 (n =13) and transvaginaly aspirated on d 3, 6, 9 and 12 of a synchronized estrous cycle.a Day of Estrous Cycle ± 1 Contrasts 3 vs. 6 vs. 9 vs. Response 3 6 9 12 S.E. 6,9,12 9,12 12 Follicle 5.3b 4.6c 4.1c 4.5c 0.3 ** NS NS number Oocyte 4.7b 4.1b 3.2c 3.0c 0.4 ** ** NS number Oocyte 87.8b 88.4b 75.4b,c 66.5c 7.5 NS * NS recovery,% Cleaved,% 60.6b 58.3b 47.7c 52.4b,c 6.2 † † NS of oocytes (135/224) (113/195) (71/154) (79/155) a Data outside of parentheses represent least-squares means and pooled SE. Data in parentheses represent the fraction of cleaved embryos from total oocytes. b,c x,y P < 0.05, P < 0.10, * P < 0.05, ** P < 0.01, NS = non-significant.

235

Table 7-4. Oocyte quality responses from lactating multiparous and primiparous cows fed diets enriched in either C18:1 cis (n=14), C18:1 trans (n = 14), C18:2 (n=13) or C18:3 (n =13). a Grade of Oocytes Contrasts Response 1 2 3 1 vs. 2,3 2 vs. 3 Caspase activity,% 1.5b 1.6b 37.5c * ** (1/65) (1/62) (9/24) TUNEL labeling,% 14.5 13.6 24.0 NS NS (9/62) (8/59) (6/25)

Metaphase II,% 76.3b 80.7b 57.9c NS ** (45/59) (46/57) (11/19) a Percent of oocytes, transvaginally aspirated on d 16 of the synchronized estrous cycle, with group II caspase activity, TUNEL labeling in the pronucleus, and that completed nuclear maturation to metaphase II after maturation in vivo. b,c P < 0.05, * P < 0.05, ** P < 0.01, NS = non-significant.

236

50 45 40 Holstein 35 Non-Holstein 30 25 20 15 10 5 Cleaved Embryos on Embryos dCleaved 3 (%) 0 2 to 3 4 to 7 > 8 Cell Number

Figure 7-2. Percent of cleaved embryos at either the 2 to 3, 4 to 7 or > 8 cell stage on d 3 following insemination of either Holstein (n = 115) or Non-Holstein (n = 112) oocytes collected from slaughterhouse ovaries with semen from Angus bulls. Percent of > 8 cell stage embryos were reduced for embryos from Holstein oocytes compared with embryos from Non-Holstein oocytes (breed x stage interaction, P < 0.10).

237

30 Holstein Non-Holstein 25

5 Stage of Embryos on d 8 (%) on d 8 Embryos of Stage 0 Morula & Early Blastocyst & Hatching & Hatched Blastocyst Expanded Blastocyst Blastocyst

Figure 7-3. Percent of embryos on d 8 following insemination based on stage of development as affected by oocyte genotype. Stages of development were as follows: morula, early blastocyst, blastocyst, expanded blastocyst, hatching blastocyst, or hatched blastocyst. Embryos were produced from either Holstein (n = 115) or non-Holstein (n = 112) oocytes collected from slaughterhouse ovaries. Stage of blastocyst development on d 8 was more advanced in embryos from non-Holstein embryos (breed x stage interaction, P < 0.05).

238

12000 8 CL Volume 7 10000 P4 6 3 8000 5

6000 4

3 4000 CL Volume (mm ) (mm Volume CL

2 (ng/ml) Progesterone 2000 1

0 0 3691216 Days After Induced Ovulation (+/- 1)

Figure 7-4. Plasma progesterone concentration (ng/mL) and corpus luteum (CL) volume (mm3) collected on d 3, 6, 9, 12, and 16 of a synchronized estrous cycle from lactating multiparous and primiparous cows fed diets enriched in either C18:1 cis (n=14), C18:1 trans (n = 14), C18:2 (n=13) and C18:3 (n =13). The CL volume and progesterone concentration increased from d 3 to d 16 following an induced ovulation (d 0; P < 0.01).

239

Table 7-5. Follicle, corpus luteum (CL) and pregnancy responses from lactating multiparous and primiparous cows fed diets enriched in either C18:1 cis (n=14), C18:1 trans (n = 14), C18:2 (n=13) and C18:3 (n =13) and transvaginally aspirated.a Treatments Contrasts Trt. 1 Trt. 2 Trt. 3 Trt. 4 1 vs. 2 vs. 3 vs. Response S.E. C18:1c C18:1t C18:2 C18:3 2,3,4 3,4 4 Response on d 0 Diameter, largest 15.0x 14.9x 16.8y 16.2x,y 0.7 NS * NS follicle, mm

Response on d 7 CL number 1.7 1.6 1.8 1.9 0.3 NS NS NS CL volume,mm3 6033x 5495x 7323x,y 8208y 644 NS * NS Progesterone, 3.6 3.4 3.6 3.8 0.4 NS NS NS ng/mL Diameter largest 17.4b 20.1c 18.7b,c 19.5c 0.6 * NS NS follicle, mm Pregnancy rate D 28 28.6 30.8 16.7 23.1 … NS NS NS D 45 28.6 23.1 16.7 23.1 … NS NS NS a Least squares means and pooled SE for the largest follicle (mm) on d 0 and 7, CL number and volume (mm3) on d 7, plasma progesterone concentration (ng/mL) on d 7, and pregnancy rate on d 28 and 45 following timed AI (d 0). b,c x,y P < 0.05, P < 0.10, * P < 0.05, NS = non-significant.

CHAPTER 8 GENERAL DISCUSSION AND CONCLUSIONS

Changes in dairy farms in the United States toward increased herd sizes and milk production has been associated with increased reproductive inefficiencies. One component for the decline in fertility is a large amount of early embryonic loss. Early embryonic loss in lactating dairy cows has been estimated to be as high as 40% between d 7 and 19 after insemination which coincides with the time in which the conceptus must secrete sufficient amounts of IFN-τ to inhibit PGF2α secretion and sustain the CL to maintain pregnancy. Decreasing early embryonic loss without compromising milk production would be beneficial to the economic success of commercial dairy enterprises.

A widely used practice of increasing milk production is through the use of exogenous bST. Recent reports indicate that bST can increase pregnancy rates in lactating dairy cows (Moreira et al., 2000b, 2001; Santos et al., 2004b; Morales-Roura et al., 2001). However, the mechanisms via which bST enhances pregnancy rates are not fully documented. The first experiment (Chapter 3) utilized nonlactating dairy cows as a model to eliminate the homeorhetic drive of lactation in evaluating bST effects on d 17 after estrus on reproductive and conceptus tissues, and endocrine responses of cyclic and pregnant cows. To our dismay, bST reduced pregnancy rates but increased conceptus lengths and IFN-τ concentrations. The 2 fold increase in conceptus lengths and 3 fold increase in IFN-τ concentrations may have caused an asynchronous uterine environment as reflected by a decrease in pregnancy rate. This advanced embryonic growth may have been due to bST injections causing a hyperstimulation in IGF-I concentrations of plasma.

240 241

The IGF-I concentrations are already at sufficient levels in nonlactating cows to sustain

embryonic growth as seen by a greater pregnancy rate in the non-bST treated cows.

However, in our second experiment with lactating cows (Chapter 4), bST increased

plasma concentrations of IGF-I to the basal concentrations of nonlactating dairy cows not

treated with bST and the lactating cows (Figure 8-2) had an increased pregnancy rate. In

addition, conceptus lengths and IFN-τ concentrations were increased but not to the extent

of the nonlactating cows. There appears to be an optimal level in which IGF-I levels can

exert beneficial effects on embryo development and survival that increases pregnancy

rate.

Another possibility for the decreased pregnancy rate in nonlactating dairy cows

may be due to the hyperstimulation of plasma insulin caused by bST (Figure 8-3).

Previous reports indicate that high insulin concentrations can effect negatively both

oocytes and embryos in dairy cattle (Armstrong et al., 2003), mice (Chi et al., 2000) and humans (Sagle et al., 1988). This difference in response to bST illustrates the complex

relationship between physiological and nutritional status (i.e., lactating vs. nonlactating states) and reproduction. The increase in fertility seen in dairy cows injected with bST appears to be specific for cows during lactation. Injecting bST into nonlactating cows or other target populations such as heifers or beef cows with sufficient production of IGF-I may have no effect or possibly reduce fertility as documented in chapter 3.

Another way in which bST may be decreasing early embryonic loss in lactating dairy cows is through regulation of components of the PG cascade (Figure 8-4).

Downstream metabolism of PGH2 to either PGF2α or PGE2 is regulated by PGFS and

PGES enzymes, respectively. In chapter 5, bST reduced PGFS mRNA and increased

242

PGES steady state concentrations of mRNA in the endometrium. This may favor a decrease in PGF2α and a subsequent increase in PGE2 secretion that would support maintenance of the CL. Furthermore, bST increased PGE2 in the uterine flushing fluids of pregnant lactating dairy cows without an increase in PGF2α. Although it is not possible to identify whether PGE2 is coming from the conceptus or endometrium, it is reasonable to assume that an increased amount of PGE2 is coming from the endometrium since PGF2α was not increased. Moreover, the presence of a conceptus and its secretions influenced the endometrium so that it responds differentially to bST in a manner that may benefit pregnancy. For example, in lactating pregnant cows injected with bST, the bST decreased steady state concentrations of PGFS mRNA and increased steady state concentrations of PGES, IGF-II, and IGFBP-2 mRNA compared with lactating pregnant cows not injected with bST. In addition, in some gene and protein responses bST had differential effects in cyclic cows compared to pregnant cows. For example, bST increased steady state concentrations of PR mRNA in cyclic cows but had no effect in pregnant cows. Furthermore IGFBP-2 mRNA was decreased in bST-treated cyclic cows but increased in bST-treated pregnant cows. This reflects direct conceptus induced alterations in regulation of gene expression due to secretions such as IFN-τ, or indirect induced alterations within the endometrium that effect responsiveness to bST.

Pregnancy attenuated gene expression and protein secretion associated with the PG cascade which most likely reduces the pulsatile release of PGF2α (Figure 8-5; Chapter 5).

The PGHS-2 mRNA was unaffected by pregnancy. However PGHS-2 protein was increased illustrating that pregnancy may regulate the activity of the PGHS-2 enzyme in a manner to decrease pulsatile PGF2α secretion through a reduction in upstream regulatory

243

components such as ERα and OTR that were indeed reduced in the endometrium of

pregnant cows. The PGHS-2 appears to be important for basal production of PGs which

are beneficial for pregnancy. An earlier study showed that basal levels of PGFM increase

in pregnant versus cyclic cows (Williams et al., 1983), ewes (Payne and Lamming, 1994),

and water buffalo (Mishra et al., 2003). Further research is warranted in developing

strategies to inhibit only pulsatile release of PGF2α without decreasing basal

concentrations of PGs.

The diet enriched in calcium salts of fish oil increased milk production but lowered plasma insulin compared to cows fed a diet of equal energy density. Furthermore, in cows fed the fish oil enriched diet, plasma concentrations of GH were elevated due to

bST injections, but subsequent concentrations of IGF-I were not elevated to the same

extent as control cows receiving bST. Increased concentrations of insulin in the blood

are known to increase GHR expression in liver and adipose tissues and to double

concentrations of IGF-I in plasma of lactating dairy cows (Rhoads et al., 2004). Since

insulin was decreased due to FO feeding, GHR expression may have been reduced and

contributed to the elevated concentrations of GH without subsequent elevated

concentrations of IGF-I in plasma. This was also apparent when examining the endocrine

response of nonlactating cows (Chapter 3). Nonlactating cows treated with bST had

elevated levels of insulin and IGF-I and low concentrations of GH (Figure 8-1) as

compared to the lactating dairy cows. Formulating diets that increase insulin levels may

possibly increase liver responsiveness to bST allowing for a greater IGF-I output. A

greater IGF-I output may, in turn, increase embryonic survival and promote an increase

244

in milk production. This could also be a reason for farm-to-farm differences in bST milk

response due to different types of fat in the diet.

The fish oil enriched diet altered gene expression of IGF-I and IGF-II in the

endometrium in a manner that mimicked pregnancy (Chapter 5). Around d 17 there is a

transition from growth of the conceptus to a coordinated switch that focuses on

preparation of the uterus for implantation. The fish oil enriched dietary effect to reduce

steady state concentrations of IGF-I mRNA (which promotes embryo development) and

stimulation of steady state concentrations of IGF-II mRNA (which may prepare the

uterus for implantation), may be a coordinated response that mimics the pregnancy state

and was evident in the endometrium of pregnant cows versus cyclic control cows at this

time. The fish oil enriched diet decreased steady state concentrations of IGF-I mRNA

and stimulated steady state concentrations of IGF-II mRNA which mimicked the

pregnancy response when comparing cyclic and pregnant control cows. Furthermore in

cyclic cows fed FO and pregnant cows injected with bST, steady state concentrations

IGF-II mRNA and IGFBP-2 mRNA were increased compared with control-fed cows.

Increasing steady state concentrations of IGFBP-2 mRNA may be associated with an

increase in IGFBP-2 protein that could target localization and delivery of IGF-II to the overlying conceptus that is undergoing developmental changes in preparation for implantation and placentation.

Feeding a FO enriched diet may help to reduce the pulsatile secretion of PGF2α. In chapter 5, FO increased PR in the SGE and DGE which may be beneficial for preparation of the uterus for establishment and maintenance of pregnancy. Furthermore FO reduced

ERα protein in the LE, DGE, and SS, and PGHS-2 protein in the LE. In chapter 6, FO

245

reduced the amount of AA a precursor for the biosynthesis of the prostaglandin 2 series.

The FO reduction in regulatory components and precursor fatty acid of the PG cascade

may be beneficial to maintain the CL (Figure 8-6). Since one possible reason for early embryonic loss is reduced development of conceptuses that are unable to secrete sufficient amounts of IFN-τ, then a nutritional management scheme such as feeding a FO enriched fat supplement may provide an additive or synergistic antiluteolytic signal to maintain pregnancy. This strategy is utilizing dietary supplementation of functional nutrients or nutraceuticals as a means to improve reproductive performance.

In addition to providing a more conducive environment for establishing and maintaining pregnancy, FO may provide a nutritional product for consumers. In chapter

6, FO increased CLA concentrations in the milk fat and decreased the n-6:n-3 ratio. The

CLA and omega-3 fatty acids have been shown to have human health promoting properties (Bauman et al., 2001). Furthermore, FO may replenish depleted stores of fatty acids in various tissues that were preferentially utilized for lactation. This may improve functionality of these tissues.

Fatty acids appear to have profound effects on reproductive responses.

Understanding which fatty acids are having beneficial effects and formulating diets enriched in those particular fatty acids may improve reproductive performance. In chapter 7, a diet enriched in C18:2 reduced oocyte quality in vivo demonstrated by subsequent reduced embryo development in vitro compared to a diet enriched in C18:1 cis. However previous studies have shown that diets enriched in C18:2 increased pregnancy rates (Cullens et al., 2004; Boken et al., 2005). This suggests that the beneficial effects of fatty acids are acting via a variety of biological windows. For

246

example, in chapter 7 the oocytes were aspirated from small follicles that would not

ovulate in a lactating dairy cow. This system eliminated the effects of fatty acids on in

vivo nuclear and cytoplasmic maturation, which occur during the periovulatory period. In the present study maturation processes were examined in vitro. However, PUFA

enriched diets increased the periovulatory follicle and subsequent CL size in comparison

with MUFA. Furthermore PUFA increased the size of the first wave follicle. The PUFA

may improve fertility by providing beneficial effects on the dominant follicle as shown

herein and in other studies (Staples et al., 1998). In addition the PUFA may modulate the

uterine environment, as shown in chapters 4 and 5, to provide a more conducive

environment for embryo establishment and maintenance of pregnancy.

Particular fatty acids appear to have different effects on various physiological

processes in the lactating dairy cow. It may be beneficial to feed certain fatty acids at

particular times during a cows life in order to improve specific responses. For example,

feeding a diet enriched in C18:2 which can be converted to AA, the precursor for PGE2

and leukotriene B4 (which are proinflammatory mediators) and PGF2α (which is

luteolytic), may contribute to increased immuno-competence in the early postpartum

period. However, feeding a diet enriched in EPA and DHA decreases PGF2α which

would be beneficial for CL maintenance and embryo survival around 60 DIM when the

producer begins breeding. Further investigation is warranted in elucidating the effects of

particular fatty acids on physiological responses of the lactating dairy cow. Coupling

both nutritional and reproductive management schemes may improve reproductive

efficiency, herd health, milk production and milk composition that would have an overall

benefit to producers and consumers. In addition, injecting bST into lactating dairy cows

247 will stimulate sufficient growth factor production in order to improve both milk production and fertility in a well managed TAI synchronization program.

248

10 Plasma GH (ng/ml) 5

0 01234567891011121314151617 ± bST Days after GnRH (i.e.estrus) ± bST

Figure 8-1. Plasma GH (ng/mL) of pregnant cows that were nonlactating or lactating. Cows received injections of bST (+/-; 500 mg) on days 0 (i.e., day of GnRH) and 11 after a synchronized insemination (Days 0 to 17). Nonlactating pregnant no bST (; n = 14); Nonlactating pregnant bST ( ; n = 9); Lactating pregnant no bST (S; n = 4); Lactating pregnant bST (U; n = 5).

249

Figure 8-2. Plasma IGF-I (ng/mL) of pregnant cows that were nonlactating or lactating. Cows received injections of bST (+/-; 500 mg) on days 0 (i.e., day of GnRH) and 11 after a synchronized insemination (Days 0 to 17). Nonlactating pregnant no bST (; n = 14); Nonlactating pregnant bST ( ; n = 9); Lactating pregnant no bST (S; n = 4); Lactating pregnant bST (U; n = 5).

250

3 Detrimental to Pregnancy

Plasma Insulin (ng/ml) Insulin Plasma 1

0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 ± bST Days of GnRH (i.e., estrus) ± bST

Figure 8-3. Plasma insulin (ng/mL) of pregnant cows that were nonlactating or lactating. Cows received injections of bST (+/-; 500 mg) on days 0 (i.e., day of GnRH) and 11 after a synchronized insemination (Days 0 to 17). Nonlactating pregnant no bST (; n = 14); Nonlactating pregnant bST ( ; n = 9); Lactating pregnant no bST (S; n = 4); Lactating pregnant bST (U; n = 5).

251

Blood INF-τ OT E2 P4

OTr JAK TYK

E2 E2 P4 P4 ISG PLC ER PR Ligand Ligand PPAR α RXR PPAR δ RXR ? ? Decrease pulsatile

release of PGF2α DAG PGES PGE AA 2 PGHS-2 PGH2 PGFS PGF PLA2 2α AA AA AA

Uterine Lumen Figure 8-4. Model diagram representing the effects of bST on genes and proteins of the prostaglandin cascade in the endometrial cell of pregnant lactating dairy cows. The bST increased conceptus lengths thereby increasing IFN-τ. In addition, bST reduced PGFS mRNA and increased PGES mRNA, which may reduce the amount of PGF2α produced.

252

Blood

OT E2 P4 IFN-τ

OTr JAK TYK

E2 E2 P4 P4 ISG PLC ER PR Ligand Ligand PPAR α RXR PPAR δ RXR ? ? Decrease pulsatile release of PGF DAG 2α PGES PGE AA 2 PGHS-2 PGH2 PGFS PGF PLA2 2α AA AA AA

Uterine Lumen Figure 8-5. Model diagram representing the effects of pregnancy on genes and proteins of the prostaglandin cascade in the endometrial cell of lactating dairy cows. Pregnancy decreased ERα protein, OTR mRNA, PGES mRNA and PGFS mRNA, which would ultimately decrease pulsatile release of PGF2α.

253

Blood

OT E2 P4

OTr

E2 E2 P4 P4 ISG PLC ER PR Ligand Ligand Decrease pulsatile PPAR α RXR PPAR δ RXR release of ? ? PGF EPA 2α PGH3 PG3 DAG PGHS-2 PGES PGE2 AA PGH2 PGFS PGF PLA2 2α AA EPA EPA EPA AA AA Enriched EPA Uterine Lumen Figure 8-6. Model diagram representing the effects of an enriched fish oil diet on genes and proteins of the prostaglandin cascade in the endometrial cell of lactating cyclic dairy cows. The fish oil increased PGHS-2 protein mimicking pregnancy effect. Fish oil also increased PR mRNA which may improve uterine environment. In addition, fish oil enriched the cell membranes with EPA and DHA which may reduce the precursor for prostaglandins of the 2 series. However, EPA is a precursor for prostaglandins of the 3 series which are less biologically active.

LIST OF REFERENCES

Abayasekara, D. R. E., and D. C. Wathes. 1999. Effects of altering dietary fatty acid composition on prostaglandin synthesis and fertility. Prost. Leukot. Ess. Fatty Acids 61:275-287.

Ahmad, N., E. C. Townsend, R. A. Dailey, and E. K. Inskeep. 1997. Relationships of hormonal patterns and fertility to occurrence of two or three waves of ovarian follicles, before and after breeding, in beef cows and heifers. Anim. Reprod. Sci. 49:13–28.

Ahnadi, C. E., N. Beswick, L. Delbecchi, J. J. Kennelly, and P. Lacasse. 2002. Addition of fish oil to diets for dairy cows. II. Effects on milk fat and gene expression of mammary lipogenic enzymes. J. Dairy Res. 69:521-531.

Albers, R., M. Bol, R. Bleumink, A. Willems, C. Blonk, and R. Pieters. 2002. Effects of dietary lipids on immune function in a murine sensitization model. Br. J. Nutr. 88:291-299.

Al-Katanani, Y. M., D. W. Webb, and P. J. Hansen. 1999. Factors affecting seasonal variation in non-return rate to first service in lactating Holstein cow in a hot climate. J. Dairy Sci. 82:2611–2616.

Allen, M. S. 2000. Effects of diet on short-term regulation of feed intake by lactating dairy cattle. J. Dairy Sci. 83:1598-1624.

Almier, M., G. De Rosa, F. Grasso, F. Napolitana and A. Bordi. 2002. Effect of climate on the response of three oestrus synchronization techniques in lactating dairy cows. Anim. Reprod. Sci. 71:157–168.

Amaral, do B. C., C. R. Staples, O. Sa Filho, T. R. Bilby, J. Block, F. Silvestre, F. M. Cullens, L. Badinga, P. J. Hansen, and W. W. Thatcher. 2005. Effect of supplemental fat source on production, immunity, and reproduction of periparturient Holstein cows in summer. J. Dairy Sci. 88:(Suppl.1):178. (Abstr.)

Amri, E. Z., F. Bonino, and G. Ailhand. 1995. Cloning of a protein that mediates transcriptional effects of fatty acids in preadipocytes. Homology to peroxisome proliferator-activated receptors. J. Biol. Chem. 270:2367-2371.

Andrew, S. M., H. F. Tyrrell, C. K. Reynolds, and R. A. Erdman. 1991. Net energy for lactation of calcium salts of long-chain fatty acids for cows fed silage-based diets. J. Dairy Sci. 74:2588-2600.

254 255

Arbel, R., Y. Bigun, E. Ezra, H. Sturman, and D. Hojman. 2001. The effect of extended calving intervals in high lactating cows on milk production and profitability. J. Dairy Sci. 84:600-608.

Arechiga, C. F., A. D. Ealy, and P. J. Hansen. 1995. Evidence that glutathione is involved in thermotolerance of preimplantation mouse embryos. Biol. Reprod. 52:1296-1301.

Armstrong, D. G., J. G. Gong, and R. Webb. 2003. Interactions between nutrition and ovarian activity in cattle: physiological, cellular and molecular mechanisms. Reprod. Suppl. 61:403-414.

Armstrong, J. D., E. A. Goodall, F. J. Gordon, D. A. Rice, and W. J. McCaughey. 1990. The effects of levels of concentrate offered and inclusion of maize gluten or fish meal in the concentrate on reproductive and blood parameter of dairy cows. Anim. Prod. 50:1-10.

Armstrong, D. G., T. G. McEvoy, G. Baxter, J. J. Robinson, C. O. Hogg, K. J. Woad, R. Webb, and K. D. Sinclair. 2001. Effect of dietary energy and protein on bovine follicular dynamics and embryo production in vitro: associations with the ovarian insulin-like growth factor system. Biol. Reprod. 64:1624-1632.

Arosh, J. A., S. K. Banu, S. Kimmins, P. Chapdelaine, L. A. MacLaren, and M. A. Fortier. 2004. Effect of interferon-tau on prostaglandin biosynthesis, transport, and signaling at the time of maternal recognition of pregnancy in cattle: evidence of polycrine actions of prostaglandin E2. Endocrinology 145:5280-5293.

Arosh, J. A., J. Parent, P. Chapdelaine, J. Sirois, and M. A. Fortier. 2002. Expression of cyclooxygenases 1 and 2 and prostaglandin E synthase in bovine endometrial tissue during the estrous cycle. Biol. Reprod. 67:161-169.

Ashes, J. R., B. D. Siebert, S. K. Gulati, A. Z. Cuthbertson, and T. W. Scott. 1992. Incorporation of n-3 fatty acids of fish oil into tissue and serum lipids of ruminants. Lipids 27:629-631.

Auboeuf, D., J. Rieusset, and L. Fajas. 1997. Tissue distribution and quantification of the expression of mRNAs of peroxisome proliferator-activated receptors and liver X receptorα in humans. Diabetes 46:1319-1327.

Ayalon, N. 1978. A review of embryonic mortality in cattle. J. Reprod. Fertil. 54:483- 493.

Badinga, L., R. J. Collier, W. W. Thatcher, and C. J. Wilcox. 1985. Effect of climatic and management factors on conception rate of dairy cattle in subtropical environment. J. Dairy Sci. 68:78–85.

256

Badinga, L., R. J. Collier, W. W. Thatcher, C. J. Wilcox, H. H. Head, and F. W. Bazer. 1991. Ontogeny of hepatic bovine growth hormone receptors in cattle. J. Anim. Sci. 69:1925-1934.

Badinga, L., A. Guzeloglu, and W. W. Thatcher. 2002. Bovine somatotropin attenuates phorbol ester-induced prostaglandin F2α production in bovine endometrial cells. J. Dairy Sci. 85:537–543.

Baker, J., J.-P. Liu, E. J. Robertson, and A. Efstratiadis. 1993. Role of insulin-like growth factors in embryonic and postnatal growth. Cell 75:73-82.

Balaguer, S. A., R. A. Pershing, C. Rodriguez-Sallaberry, W. W. Thatcher, and L. Badinga. 2005. Effects of bovine somatotropin on uterine genes related to the prostaglandin cascade in lactating dairy cows. J. Dairy Sci. 88:543-552.

Balen, A. H., S. I. Tan, J. MacDougall, and H. S. Jacobs. 1993. Miscarriage rates following in-vitro fertilization are increased in women with polycystic ovaries and reduced by pituitary desensitization with buserelin. Hum. Reprod. 8:959-964.

Banni, S., C. S. D. Heys, and K. W. J. Wahle. 2003. Conjugated linoleic acid as anticancer nutrients: studies in vivo and cellular mechanisms. J. Sebedio, W. W. Christie and R. Adolf (ed) Advances in Conjugated Linoleic Acid Research, Vol. 2. pp:267-281. AOCS Press.

Bartol, F. F., R. M. Roberts, F. W. Bazer, G. S. Lewis, J. D. Godkin, and W. W. Thatcher. 1985. Characterization of proteins produced in vitro by periattachment bovine conceptuses. Biol. Reprod. 32:681-693.

Bartolome, J. A., A. Sozzi, J. McHale, K. Swift, D. Kelbert, L. F. Archbald, and W. W. Thatcher. 2005. Resynchronization of ovulation and timed insemination in lactating dairy cows III: administration of GnRH 23 days post AI and ultrasonography for nonpregnancy diagnosis on day 30. Theriogenology 63:1643- 1658.

Bauman, D. E. 1992. Bovine somatotropin: review of an emerging animal technology. J. Dairy Sci. 75:3432-3451.

Bauman, D. E. 1999. Bovine somatotropin and lactation: from basic science to commercial application. Domest. Anim. Endocrinol. 17:101-16.

Bauman, D. E., L. H. Baumgard, B. A. Corl, and J. M. Griinari. 1999a. Biosynthesis of conjugated linoleic acid in ruminants. Proceedings of the American Society of Animal Science.

Bauman, D. E., B. A. Corl, L. H. Baumgard, and J. M. Griinari. 2001. Conjugated linoleic acid (CLA) and the dairy cow. Pages 221-250 in Recent Advances in Animal Nutrition. P. C. Garnsworthy and J. Wiseman, ed. Nottingham Univ. Press, Nottingham, U. K.

257

Bauman, D. E., B. A. Corl, and D. G. Peterson. 2003. The biology of conjugated linoleic acids in ruminants. Pages 146-173 in Advances in Conjugated Linoleic Acid Research, Volume 2. Sebedio, J.-L., W. W. Christie, and R. O. Adlof, ed., AOCS Press, Champaign, IL.

Bauman, D. E., and W. B. Currie. 1980. Partitioning of nutrients during pregnancy and lactation: a review of mechanisms involving homeostasis and homeorhesis. J. Dairy Sci. 63:1514-1529.

Bauman, D. E., and C. L. Davis. 1974. Biosynthesis of milk fat. Pages 31-75 in Lactation: A Comprehensive Treatise. Vol. 2. B. L. Larson and V. R. Smith, eds. Academic Press, New York.

Bauman, D. E., M. J. Degeeter, C. J. Peel, G. M. Lanza, R. C. Gorewit, and R. W. Hammond. 1982. Effect of recombinantly derived bovine growth hormone (bGH) on lactational performance of high yielding dairy cows. J. Dairy Sci. 65(Suppl.1):121. (Abstr.)

Bauman, D. E., P. J. Eppard, M. J. DeGeeter, and G. M. Lanza. 1985. Responses of high-producing dairy cows to long-term treatment with pituitary somatotropin and recombinant somatotropin. J. Dairy. Sci. 68:1352-1362.

Bauman, D. E., R. W. Everett, W. H. Weiland, and R. J. Collier. 1999b. Production responses to bovine somatotropin in northeast dairy herds. J. Dairy Sci. 82:2564– 2573.

Bauman, D. E. and J. M. Griinari. 2003. Nutritional regulation of milk fat synthesis. Annu. Rev. Nutr. 23:203-227.

Baumann, G. 1991. Growth hormone heterogeneity: genes, isohormones, variants, and binding proteins. Endocrine Rev. 12:424-449.

Baumgard, L. H., B. A. Corl, D. A. Dwyer, A. Saebo, and D. E. Bauman. 2000. Identification of the conjugated linoleic acid isomer that inhibits milk fat synthesis. Am. J. Physiol. 278:R179-184.

Baumgard, L. H., E. Matitashvili, B. A. Corl, D. A. Dwyer, and D. E. Bauman. 2002. Trans-10, cis-12 conjugated linoleic acid decreases lipogenic rates and expression of genes involved in milk lipid synthesis in dairy cows. J. Dairy Sci. 85:2155- 2163.

Baumrucker, C. C., and B. H. Stemberger. 1989. Insulin and insulin-like growth factor-I stimulate DNA synthesis in bovine mammary tissue in vitro. J. Anim. Sci. 67:3503–3514.

Baxter, R. C., J. M. Bryson, and J. R. Turtle. 1980. Somatogenic receptors of rat liver: regulation by insulin. Endocrinology 107:1176-1181.

258

Beal, W. E., R. E. Short, R. B. Staigmiller, R. A. Bellows, C. C. Kaltenbach, and T. G. Dunn. 1978. Influence of dietary energy intake on bovine pituitary and luteal function. J. Anim. Sci. 46:181-188.

Beam, S. W., and W. R. Butler. 1994. Ovulatory follicle development during the first follicular wave postpartum in cows differing in energy balance. J. Anim. Sci. 72(Suppl.1):77. (Abstr.)

Beam, S. W., and W. R. Butler. 1997. Energy balance and ovarian follicle development prior to the first ovulation postpartum in dairy cows receiving three levels of dietary fat. Biol. Reprod. 56:133-142.

Beam, S. W., and W. R. Butler. 1998. Energy balance, metabolic hormones, and early postpartum follicular development in dairy cows fed prilled lipid. J. Dairy Sci. 81:121-131.

Beam, S. W., and W. R. Butler. 1999. Effects of energy balance on follicular development and first ovulation in postpartum dairy cows. J. Reprod. Fertil. 54:411-424.

Beaudeau, F., H. Seegers, V. Ducrocq, C. Fourichon, and N. Bareille. 2000. Effect of health disorders on culling in dairy cows: a review and a critical discussion. Annales de Zootechnie, 49:293–311.

Beaulieu, A. D., J. K. Drackley, and N. R. Merchen. 2002. Concentrations of conjugated linoleic acid (cis-9, trans-11-octadecadienoic acid) are not increased in tissue lipids of cattle fed a high-concentrate diet supplemented with soybean oil. J. Anim. Sci. 80:847-861.

Beede, D. K., and R. J. Collier. 1986. Potential nutritional strategies for intensively managed cattle during heat stress. J. Anim. Sci. 62:543-554.

Bell, A. W. 1995. Regulation of organic nutrient metabolism during transition from late pregnancy to early lactation. J. Anim. Sci. 73:2804-2819.

Bellows, R. A. 1999. Some effects of feeding supplemental fat to beef cattle. Proc. Range Cow Symp. XVI. Greeley, CO. Coop. Ext. Serv. of CO, SD, WY, and NE.

Belury, M. A., 2003. Conjugated linoleic acids in type 2 diabetes mellitus: implications and potential mechanisms. J. Sebedio, W. W. Christie and R. Adolf (ed) Advances in Conjugated Linoleic Acid Research, Vol. 2. pp:302-315. AOCS Press.

Berger, J., and D. E. Moller. 2002. The mechanism of action of PPARs. Ann. Rev. Med. 53:409-435.

Bichell, D. P., K. Kikuchi, and P. Rotwein. 1992. Growth hormone rapidly activates insulin-like growth factor I gene transcription in vivo. Mol. Endocrinol. 6:1899- 1908.

259

Biggers, B. G., R. D. Geisert, R. P. Wettemann, and D. S. Buchanan. 1987. Effect of heat stress on early embryonic development in the beef cow. J. Anim. Sci. 64:1512-1518.

Bilby, C. R., J. F. Bader, B. E. Salfen, R. S. Youngquist, C. N. Murphy, H. A. Garverick, B. A. Crooker, and M. C. Lucy. 1999. Plasma GH, IGF-I, and conception rate in cattle treated with low doses of recombinant bovine GH. Theriogenology 51:1285- 1296.

Binelli, M., P. Subramanian, T. Diaz, G. A. Johnson, T. R. Hansen, L. Badinga, and W. W. Thatcher. 2001a. Bovine interferon-tau stimulates the Janus kinase-signal transducer and activator of transcription pathway in bovine endometrial epithelial cells. Biol. Reprod. 64:654-665.

Binelli, M., W. W. Thatcher, R. Mattos, and P. S. Baruselli. 2001b. Antiluteolytic strategies to improve fertility in cattle. Theriogenology 56:1451-1463.

Binelli, M., W. K. Vanderkooi, L. T. Chapin, M. J. Vandehaar, J. D. Turner, W. M. Moseley, and H. A. Tucher. 1995. Comparison of growth hormone-releasing factor and somatotropin: body growth and lactation of primiparous cows. J. Dairy Sci. 78:2129-2139.

Blondin, P., K. Coenen, L. A. Guilbault, and M. A. Sirard. 1997. In vitro production of bovine embryos: developmental competence is acquired before maturation. Theriogenology 47:1061-1075.

Boken, S. L., C. R. Staples, L. E. Sollenberger, T. C. Jenkins, and W. W. Thatcher. 2005. Effect of grazing and fat supplementation on production and reproduction of Holstein cows. J. Dairy Sci. (in press)

Boland, M. P., P. Lonergan, and O’Callaghan. 2001. Effect of nutrition on endocrine parameters, ovarian physiology, and oocyte and embryo development. Theriogenology 55:1323-1340.

Bols, P. E. J., M. T. Ysebaert, A. Lein, M. Coryn, A. Van Soom, and A. de Kruif. 1998. Effects of long-term treatment with bovine somatotropin on follicular dynamics and subsequent oocyte and blastocysts yield in an OPU-IVF program. Theriogenology 49:983-995.

Boos, A. 1998. Immunohistochemical assessment of prostaglandin H-synthase in bovine endometrial biopsy samples collected throughout the estrous cycle. Anim. Reprod. Sci. 51:261-273.

Boos, A., J. Kohtes, A. Stelljes, H. Zerbe, and H. H. Thole. 2000. Immunohistochemical assessment of progesterone, oestrogen and glucocorticoid receptors in bovine placentomes during pregnancy, induced parturition, and after birth with or without retention of fetal membranes. J. Reprod. Fertil. 120:351-360.

260

Bradford, M. M. 1976. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254.

Bradley, R. 2000. 1000 years of climate change. Science 288:1353-1355.

Braissant, O., F. Foufelle, and C. Scotto. 1996. Differential expression of peroxisome proliferator-activated receptors (PPARs): tissue distribution of PPAR-alpha, -beta, and –gamma in the adult rat. Endocrinology 137:354-366.

Braulke, T., S. Tippmer, E. Neher, and K. von Figura. 1989. Regulation of the mannose- 6-phosphate/IGF-II receptor expression at the cell surface by mannose 6-phosphate, insulin-like growth factors and epidermal growth factor. J. Embo. 8:681-686.

Bremmer, D. R., L. D. Ruppert, J. H. Clark, and J. K. Drackley. 1998. Effects of chain length and unsaturation of fatty acid mixtures infused into the abomasums of lactating dairy cows. J. Dairy Sci. 81:176-188.

Bruckental, I., D. Dori, M. Kaim, H. Lehrer, and Y. Folman. 1989. Effects of source and level of protein on milk yield and reproductive performance of high-producing primiparous and multiparous dairy cows. Anim. Prod. 48:319-329.

Burke, J. M., C. R. Staples, C. A. Risco, R. L. De La Sota, and W. W. Thatcher. 1996. Effect of ruminant grade menhaden fish meal on reproductive and productive performance of lactating dairy cows. J. Dairy Sci. 80:3386-3398.

Burns, P. D., T. E. Engle, M. A. Harris, R. M. Enns, and J. C. Whittier. 2003. Effect of fish meal supplementation on plasma and endometrial fatty acid composition in nonlactating beef cows. J. Anim. Sci. 81:2840-2846.

Burton, J. H., G. K. MacLeod, B. W. McBride, J. L. Burton, K. Bateman, I. McMillan, and R. G. Eggert. 1990. Overall efficacy of chronically administered recombinant bovine somatotropin to lactating dairy cows. J. Dairy Sci. 73:2157-2167.

Burton, J. L., B. W. McBride, E. Block, D. R. Glimm, and J. J. Kennelly. 1994. A review of bovine growth hormone. Can. J. Anim. Sci. 74:167-201.

Butler, W. R. 1998. Review: effect of protein nutrition on ovarian and uterine physiology in dairy cattle. J. Dairy Sci. 81:2533-2539.

Butler, W. R. 2000. Nutritional interactions with reproductive performance in dairy cattle. Anim. Reprod. Sci. 60-61:449-457.

Butler, W. R., J. J. Calaman, and S. W. Beam. 1996. Plasma and milk urea nitrogen in relation to pregnancy rate in lactating dairy cattle. J. Anim. Sci. 74:858-865.

Butler, W. R., and R. D. Smith. 1989. Interrelationships between energy balance and postpartum reproductive function in dairy cattle. J. Dairy Sci. 72: 167-178.

261

Butterwick, R. F., P. Rowlinson, T. E. C. Weeks, D. S. Parker, and D. G. Armstrong. 1998. The effect of long-term daily administration of bovine somatotropin on the performance of dairy heifers during their first lactation. Anim. Prod. 46:483 (Abstr.)

Calder, P. C., P. Yaqoob, F. Thies, F. A. Wallace, and E. A. Miles. 2002. Fatty acids and lymphocyte functions. Brit. J. Nutr. 87:S31-S48.

Capuco, A. V., D. L. Wood, R. Baldwin, K. Mcleod, and M. J. Paape. 2001. Mammary cell number, proliferation, and apoptosis during a bovine lactation: relation to milk production and effect of bST. J. Dairy Sci. 84:2177-2187.

Carroll, D. J., F. R. Hossain, and M. R. Keller. 1994. Effect of supplemental fish meal on the lactation and reproductive performance of dairy cows. J. Dairy Sci. 77:3058-3072.

Carter-Su, C., A. P. J. King, L. S. Smit, J. A. Vanderkuur, L. S. Argetsinger, G. S. Campbell, and W. Huo. 1997. Molecular mechanisms of growth hormone action. J. Anim. Sci. 75:1-10.

Carter-Su, C., J. Schwartz, and L. S. Smit. 1996. Molecular mechanism of growth hormone action. Annu. Rev. Physiol. 58:187-207.

Casida, L. E. 1961. Present status of the repeat-breeder cow problem. J. Dairy Sci. 44:2323-2329.

Cavestany, D., A. B. El-Whishy, and R. H. Foot. 1985. Effect of season and high environmental temperature on fertility of Holstein cattle. J. Dairy Sci. 68:1471– 1478.

Cerri, R. L. A., R. G. S. Bruno, R. C. Chebel, K. N. Galvao, H. Rutgliano, S. O. Juchem, W. W. Thatcher, D. Luchini, and J. E. P. Santos. 2004. Effect of fat sources differing in fatty acid profile on fertilization rate and embryo quality in lactating dairy cows. J. Dairy Sci. 87(Suppl. 1):310. (Abstr.)

Chakravorty, A., M. I. Joslyn, and J. S. Davis. 1993. Characterization of insulin and insulin-like growth factor-I actions in the bovine luteal cell: regulation of receptor kinase activity, phosphatidylinositol-3-kinase and deoxyribonucleic acid synthesis. Endocrinology 118:888-890.

Charpigny, G., P. Reinaud, J. P. Tamby, C. Creminon, and M. Guillomot. 1997b. Cyclooxygenase-2 unlike cyclooxygenase-1 is highly expressed in ovine embryos during the implantation period. Biol. Reprod. 57:1032-1040.

Charpigny, G., P. Reinaud, J. P. Tamby, C. Creminon, J. Martal, J. Maclouf, and M. Guillomot. 1997a. Expression of cyclooxygenase-1 and -2 in ovine endometrium during the estrous cycle and early pregnancy. Endocrinology 138:2163-2171.

262

Chase, Jr., C. C., C. J. Kirby, A. C. Hammond, T. A. Olson, and M. C. Lucy. 1998. Patterns of ovarian growth and development in cattle with a growth hormone receptor deficiency. J. Anim. Sci. 76:212-219.

Chi, M. Y., A. L. Schlein, and K. H. Moley. 2000. High insulin-like growth factor I (IGF-1) and insulin concentrations trigger apoptosis in the mouse blastocyst via down-regulation of the IGF-1 receptor. Endocrinology 141:4784-4792.

Chillard, Y. 1989. Long-term effects of recombinant bovine somatotropin (rBST) on dairy cow performances: a review. In: Use of Somatotropin in Livestock Production, edited by K. Sejrsen, M. Vestergaard, and A. Neimann-Sorensen. New York: Elsevier Applied Science. p. 61-87.

Chilliard, Y., J. M. Chardigny, J. Chabrot, A. Ollier, J. L. Sebedio, and M. Doreau. 1999. Effects of ruminal or postruminal fish oil supply on conjugated linoleic acid (CLA) content of cows milk fat. Proc. Nutr. Soc. 58:70A. (Abstr.)

Chin, S. F., J. M. Storkson, K. J. Albright, M. E. Cook, and M. W. Pariza. 1994. Conjugated linoleic acid is a growth factor for rats as shown by enhanced weight gain and improved feed efficiency. J. Nutr. 124:2344–2349.

Chinetti, G., S. Griglio, and M. Antonucci. 1998. Activation of peroxisome proliferator- activated receptors alpha and gamma induces apoptosis of human monocyte- derived macrophages. J. Biol. Chem. 273:25573-25580.

Choi, B.R., and D. L. Palmquist. 1996. High fat diets increase plasma cholecystokinin and pancreatic polypeptide, and decrease plasma insulin and feed intake in lactating cows. J. Nutr. 126:2913-2919.

Chouinard, P. Y., L. Corneau, M. L. Kelly, J. M. Griinari, and D. E. Bauman. 1998. Effect of dietary manipulation on milk conjugated linoleic acids in dairy cows. J. Dairy Sci. 81(Suppl.1):233. (Abstr.)

Chouinard, P. Y., V. Girard, and G. J. Brisson. 1997. Lactational response of cows to different concentrations of calcium salts of canola oil fatty acids with or without bicarbonates. J. Dairy Sci. 80:1185-1193.

Chow, J. C., P. R. Ling, Z. Q. L. Laviola, A. Ciccarone, B. R. Bistrian, and R. J. Smith. 1996. Growth hormone stimulates tyrosine phosphorylation of JAK2 and STAT5, but not insulin receptor substrate-1 or SHC proteins in liver and skeletal muscle of normal rats in vivo. Endocrinology 137:2880-2886.

Clarke, S. D. 2001. Polyunsaturated fatty acid regulation of gene transcription: a molecular mechanism to improve the metabolic syndrome. J. Nutr. 131:1129- 1132.

Cohick, W. S. 1998. Role of the insulin-like growth factors and their binding proteins in lactation. J. Dairy Sci. 81:1769-1777.

263

Cole, W. J., P. J. Eppard, B. G. Boysen, K. S. Madsen, R. H. Sorbet, M. A. Miller, R. L. Hintz, T. C. White, W. E. Ribelin, B. G. Hammond, R. J. Collier, and G. M. Lanza. 1992. Response of dairy cows to high doses of a sustained-release bovine somatotropin administered during two lactations. 2. health and reproduction. J. Dairy Sci. 75:111-123.

Cole, W. J., K. S. Madsen, R. L. Hintz, and R. J. Collier. 1991. Effect of recombinantly- derived bovine somatotropin on reproductive performance of dairy cattle. Theriogenology 36:573-595.

Cook, M. E., C. C. Miller, Y. Park, and M. W. Pariza. 1993. Immune modulation by altered nutrient metabolism: nutritional control of immune-induced growth depression. Poult. Sci. 72:1301–1305.

Cook, H. W. Fatty acid desaturation and chain elongation in eukaryotes. In Biochemistry of lipids, lipoproteins and membranes. 1996. pp. 129-152. Ed. Vance and J. Vance. Elsevier, Amsterdam.

Corl, B. A., L. H. Baumgard, D. A. Dwyer, J. M. Griinari, B. S. Phillips, and D. E. Bauman. 2001. The role of delta (9)-desaturase in the production of cis-9, trans-11 CLA. J. Nutr. Biochem. 12:622-630.

Corton, J. C., L. Q. Fan, S. Brown, S. P. Anderson, C. Bocos, R. C. Cattley, A. Mode, and J. A. Gustafsson. 1998. Down-regulation of cytochrome P450 2C family members and positive acute-phase response gene expression by peroxisome proliferator chemicals. Mol. Pharmacol. 54:463-473.

Cullens, F. M., C. R. Staples, T. R. Bilby, F. Silvestre, J. Bartolome, A. Sozzi, L. Badinga, W. W. Thatcher, and J. D. Arthington. 2004. Effect of timing of initiation of fat supplementation on milk production, plasma hormones and metabolites, and conception rates of Holstein cows in summer. J. Dairy Sci. 86(Suppl.1):308. (Abstr.)

Cunningham, B. C., and J. A. Wells. 1989. High-resolution epitope mapping of hGH- receptor interactions by alanine-scanning mutagenesis. Science 244:1081-1084.

Cuttler, L. 1996. The regulation of growth hormone secretion. Endocrinol. Metab. Clinics of North America 25:541-571.

D’Ercole, A. J., A. D. Stiles, and L. E. Underwood. 1984. Tissue concentrations of somatomedin C: further sites of synthesis and paracrine or autocrine evidence for multiple mechanisms of action. Proc. Natl. Acad. Sci. U. S. A. 81:935-939.

Danet-Desnoyers, G., C. Wetzels, and W. W. Thatcher. 1994. Natural and recombinant bovine interferons regulate basal and oxytocin-induced secretion of PGF2α and PGE2 by endometrial epithelial and stromal cells. Reprod. Fertil. Dev. 6:193-202.

264

Daniel, Z. C., S. E. Richards, A. M. Salter, and P. J. Buttery. 2004. Insulin and dexamethasone regulate stearoyl-CoA desaturase mRNA levels and fatty acid synthesis in ovine adipose tissue explants. J. Anim. Sci. 82:231-237.

Darnell Jr., J. E. 1997. STATs and gene regulation. Science 277:1630-1635.

Darwash, A.O. and G. E. Lamming. 1998. The importance of milk progesterone concentrations during early pregnancy in the cow. J. Anim. Breed. 2:41-43.

Daughaday, W. H., and P. Rotwein. 1989. Insulin-like growth factors I and II. Peptide messenger ribonucleic acid and gene structures, serum, and tissue concentrations. Endocr. Rev. 10:68-91.

Dawson, R. M. C., N. Hemington, and G. P. Hazlewood. 1977. On the role of higher plant and microbial lipases in the ruminal hydrolysis of grass lipids. Br. J. Nutr. 38:225-232.

Dawson, R. M. C., and P. Kemp. 1970. Biohydrogenation of dietary fats in ruminants. In A. T. Phillipson (Ed.) Physiology of Digestion and Metabolism in the Ruminant. Pp 504-518. Oriel Press, Newcastle upon Tyne, U. K.

De la Sota, R. L., M. C. Lucy, C. R. Staples, and W. W. Thatcher. 1993. Effects of recombinant bovine somatotropin (sometribove) on ovarian function in lactating and nonlactating dairy cows. J. Dairy Sci. 76:1002-1013.

De la Sota, R. L., F. A. Simmen, T. Diaz, and W. W. Thatcher. 1996. Insulin-like growth factor system in bovine first-wave dominant and subordinate follicles. Biol. Reprod. 55:803-812.

DeJarnette, J. M., and C. E. Marshall. 2003. Effects of pre-synchronization using combinations PGF (2alpha) and (or) GnRH on pregnancy rates of Ovsynch- and Cosynch-treated lactating Holstein cows. Anim. Reprod. Sci. 77:51-60.

DeLany, J. P., F. Blohm, A. A. Truett, J. A. Scimeca, and D. B. West. 1999. Conjugated linoleic acid rapidly reduces body fat content in mice without affecting energy intake. Am. J. Physiol. 276(Suppl.):R1172–R1179.

Delarue, J., C. LeFoll, C. Corporeau, and D. Lucas. 2004. N-3 long chain polyunsaturated fatty acids: a nutritional tool to prevent insulin resistance associated to type 2 diabetes and obesity? Reprod. Nutr. Dev. 44:289-299.

Dematawewa, C. M., and P. J. Berger. 1998. Genetic and phenotypic parameters for 305-day yield, fertility, and survival in Holsteins. J. Dairy Sci. 81:2700-2709.

Desvergne, B., and W. Wahli. 1999. Control of metabolism by PPARs. Endocr. Rev. 20:649–688.

265

Dewhurst, R. J., D. R. Davies, and R. J. Merry. 2000. Microbial protein supply from the rumen. Anim. Feed Sci. Technol. 85:1-21.

Dey, B. R., K. Frick, W. Lopaczynski, S. P. Nissley, and R. W. Furlanetto. 1996. Evidence for the direct interaction of the insulin-like growth factor I receptor with IRS-1, Shc, and Grb10. Mol. Endocrinol. 10:631-641.

Diskin, M. G., and J. M. Sreenan. 1980. Fertilization and embryonic mortality rates in beef heifers after artificial insemination. J. Reprod. Fertil. 59:463-468.

Dobson, H., J. E. Tebble, R. F. Smith, and W. R. Ward. 2001. Is stress really all that important? Theriogenology 55:65–73.

Donaldson, L. and W. Hansel. 1965. Histological study of bovine corpora lutea. J. Dairy Sci. 48:905-909.

Donovan, D. C., D. J. Schingoethe, R. J. Baer, J. Ryali, A. R. Hippen, and S. T. Franklin. 2000. Influence of dietary fish oil on conjugated linoleic acid and other fatty acids in milk fat from lactating dairy cows. J. Dairy Sci. 83:2620-2628.

Downer, J. V., D. L. Patterson, D. W. Rock, W. V. Chalupa, R. M. Cleale, J. L. Firkins, G. L. Lynch, J. H. Clark, B. O. Brodie, B. F. Jenny, and R. DeGregorio. 1993. Dose titration of sustained-release recombinant bovine somatotropin in lactating dairy cows. J. Dairy Sci. 75:111-123.

Dransfield, M. B., R. L. Nebel, R. E. Pearson, and L. D. Warnick. 1998. Timing of insemination for dairy cows identified in estrus by a radiotelemetric estrus detection system. J. Dairy Sci. 81:1874-1882.

Drew, B. 1999. Practical nutrition and management of heifers and high yielding dairy cows for optimal fertility. Cattle Practice 7:243-248.

Drost, M., J. D. Ambrose, M. J. Thatcher, C. K. Cantrell, K. E. Wolsdorf, J. F. Hasler, and W. W. Thatcher. 1999. Conception rates after artificial insemination or embryo transfer in lactating dairy cows during summer in Florida. Theriogenology 52:1161–1167.

Dubois, D. H., and F. W. Bazer. 1991. Effect of porcine conceptus secretory proteins on in vitro secretion of prostaglandin-F2α and -E2 from luminal and myometrial surfaces of endometrium from cyclic and pseudopregnant gilts. Prostaglandins 41:283-301.

Dunne, L. D., M. G. Diskin, and J. M. Sreenan. 2000. Embryo and fetal loss in beef heifers between day 14 of gestation and full term. Anim. Reprod. Sci. 58:39-44.

266

Echternkamp, S. E., K. E. Gregory, G. E. Dickerson, L. V. Cundiff, R. M. Koch, and L. D. VanVeleck. 1990. Twinning in cattle: genetic and environmental effects on ovulation rate in pubertal heifers and postpartum cows and the effects of ovulation rate on embryonic survival. J. Anim. Sci. 68:1877-1888.

Eckery, D. C., C. L. Moeller, T. M. Nett, and H. R. Sawyer. 1997. Localization and quantification of binding sites for follicle-stimulating hormone, luteinizing hormone, growth hormone, and insulin-like growth factor I in sheep ovarian follicles. Biol. Reprod. 57:507-513.

Edwards, J. L., A. D. Ealy, V. H. Monterroso, and P. J. Hansen. 1997. Ontogeny of temperature-regulated heat shock protein 70 synthesis in preimplantation bovine embryos. Mol. Reprod. Dev. 48:25-33.

Edwards, J. L., and P. J. Hansen. 1997. Differential responses of bovine oocytes and preimplantation embryos to heat shock. Mol. Reprod. Dev. 46:138-145.

Elsasser, T. H., T. S. Rumsey, and A. C. Hammond. 1989. Influence of diet on basal and growth hormone-stimulated plasma concentrations of IGF-I in beef cattle. J. Anim. Sci. 67:128-141.

Elwood, P. C. 1991. Epidemiological studies of cardiovascular diseases. Progress report VII Llandough Hospital, Penarth, South Glam, Wales CF6 1XX.

Emond V., L. A. MacLaren, S. Kimmins, J. A. Arosh, M. A. Fortier, and R. D. Lambert. 2004. Expression of cyclooxygenase-2 and granulocyte-macrophage colony- stimulating factor in the endometrial epithelium of the cow is up-regulated during early pregnancy and in response to intrauterine infusions of interferon-τ. Biol. Reprod. 70:54-64.

Enser, M., N. D. Scollan, N. J. Choi, E. Kurt, K. Hallet, and J. D. Wood. 1999. Effect of dietary lipid on the content of conjugated linoleic acid (CLA) in beef muscle. J. Anim. Sci. 69:143-146.

Erickson, P. J., M. R. Murphy, and J. H. Clark. 1992. Supplementation of dairy cow diets with calcium salts of long-chain fatty acids and nicotinic acid in early lactation. J. Dairy Sci. 75:1078-1089.

Espey, L. L. 1980. Ovulation as an inflammatory reaction--a hypothesis. Biol. Reprod. 22:73-106.

Esteban, E., P. H. Kass, L. D. Weaver, J. D. Rowe, C. A. Holmberg, C. E. Franti, and H. F. Troutt. 1994. Reproductive performance in high producing dairy cows treated with recombinant bovine somatotropin. J. Dairy Sci. 77:3371-3381.

Etherton, T. D., and D. E. Bauman. 1998. Biology of somatotropin in growth and lactation of domestic animals. Physiol. Rev. 78:745-761.

267

Familletti, P. C., S. Rubinstein, and S. Petska. 1981. A convenient and rapid cytopathic effect inhibition assay for interferon. Methods Enzymol. 78:387-394.

Farin, C. E., K. Imakawa, T. R. Hansen, J. J. McDonell, C. N. Murphy, P. W. Farin, and R. M. Roberts. 1990. Expression of trophoblastic interferon genes in sheep and cattle. Biol. Reprod. 43:210-218.

Feinberg, A. P., and B. Vogelstein. 1983. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 32:6-13.

Ferguson, J. D., D. Sklan, W. V. Chalupa, and D. S. Kronfeld. 1990. Effects of hard fats on in vitro and in vivo rumen fermentation, milk production, and reproduction in dairy cows. J. Dairy Sci. 73:2864-2879.

Filley, S. J., H. A. Turner, and F. Stormshak. 2000. Plasma fatty acids, prostaglandin F2alpha metabolite, and reproductive response in postpartum heifers fed rumen bypass. fat.J. Anim. Sci. 78:139-44.

Firth, S. M., and R. C. Baxter. 2002. Cellular actions of the insulin-like growth factor binding proteins. Endocr. Rev. 23:824-854.

Flint, A.P.F., H. J. Stewart, G .E. Lamming, and J. H. Payne. 1992. Role of the oxytocin receptor in the choice between cyclicity and gestation in ruminants. J. Reprod. Fertil. Suppl. 45:53-58.

Foncea, R., M. Anderson, A. Ketterman, V. Blakesley, M. Sapag-Hagar, P. H. Sugden, D. LeRoith, and S. Lavandero. 1997. Insulin-like growth factor-I rapidly activates multiple signal transduction pathways in cultured rat cardiac myocytes. J. Biol. Chem. 272:19115-19124.

Formigoni, A., and E. Trevisi. 2003. Transition cow: interaction with fertility. Vet. Res. Comm. 27:143-152.

Fouladi-Nashta, A. A., C. G. Gutierrez, H. F. Russell, P. C. Garnsworthy, and R. Webb. 2004. Effects of dietary fatty acids on oocyte quality and development in lactating dairy cows. Biol. Reprod. Special Issue 107. (Abstr.)

French, P., E. G. O’Riordan, F. J. Monahan, P. J. Caffrey, and A. P. Moloney. 2003. Fatty acid composition of intramuscular triacylglycerols of steers fed autumn grass and concentrates. Livest. Prod. Sci. 81:307-317.

Frick, F., D. Linden, C. Ameen, S. Eden, A. Mode, and J. Oscarsson. 2002. Interaction between growth hormone and insulin in the regulation of lipoprotein metabolism in the rat. Am. J. Physiol. Endocrinol. Metab. 283:E1023-E1031.

Fuchs, A. R., O. Behrens, H. Helmer, C-H. Liu, C. M. Barros, and M. J. Fields. 1990. Oxytocin and vasopressin receptors in bovine endometrium and myometrium during the estrous cycle and early pregnancy. Endocrinology 127:629-636.

268

Fuquay, J. W. 1981. Heat stress as it affects animal production. J. Anim. Sci. 52:164- 174.

Gallo, G. F., and E. Block. 1991. Effects of recombinant bovine somatotropin on hypophyseal and ovarian functions of lactating dairy cows. Can. J. Anim. Sci. 71:343-353.

Garbarino, E. J., J. A. Hernandez, J. K. Shearer, C. A. Risco, and W. W. Thatcher. 2004. Effect of lameness on ovarian activity in postpartum Holstein cows. J. Dairy Sci. 87:4123 – 4131.

Garcia-Bojalil, C. M., C. R. Staples, C. A. Risco, J. D. Savio, and W. W. Thatcher. 1998. Protein degradability and calcium salts of long-chain fatty acids in the diets of lactating dairy cows: productive responses. J. Dairy Sci. 81:1374-1384.

Garnsworthy, P. C. and R. Webb. 1999. The influence of nutrition on fertility in dairy cows. In: P.C. Garnsworthy and J. Wiseman (eds), Recent Advances in Animal Nutrition, 1999, (Nottingham University Press, UK), 39-57.

Garret, J. E., R. D. Geisert, M. T. Zavy, and G. L. Morgan. 1998. Evidence for maternal regulation of early conceptus growth and development in beef cattle. J. Reprod. Fertil. 84:437–446.

Geisert, R. D., C.-Y. Lee, F. A. Simmen, T. Zavy, A. E. Fliss, F. W. Bazer, and R. C. M. Simmen. 1991. Expression of messenger RNAs encoding insulin-like growth factor-I, -II, and insulin-like gowth factor binding protein-2 in bovine endometrium during the estrous cycle and early pregnancy. Biol. Reprod. 45:975-983.

Geisert, R. D., G. L. Morgan, E. C. Short, and M. T. Zavy. 1992. Endocrine events associated with endometrial function and conceptus development in cattle. Reprod. Fertil. Dev. 4:301–305.

Gillies, G. 1997. Somatostatin: the neuroendocrine story. Trends Pharmacol. Sci. 18:87-95.

Ginther, O. J., L. Knopf, and J. P. Kastelic. 1989. Temporal associations among ovarian events in cattle during oestrous cycles with two or three follicular waves. J. Reprod. Fertil. 87:223–230.

Giudice, L. C. 1992. Insulin-like growth factors and ovarian follicular development. Endocrine Rev. 13:641-669.

Gluckman, P. D. 1995. The endocrine regulation of fetal growth in late gestation: the role of insulin-like growth factors. J. Clin Endocrinol. Metab. 80:1047-1050.

Gluckman, P. D., B. H. Breier, and S. R. Davis. 1987. Physiology of the somatotropic axis with particular reference to the ruminant. J. Dairy Sci. 70:442-466.

269

Gong, J. G., G. Baxter, T. A. Bramley, and R. Webb. 1997. Enhancement of ovarian follicle development in heifers by treatment with recombinant bovine somatotropin: a dose-response study. J. Reprod. Fertil. 110:91-97.

Gong, J. G., T. Bramley, and R. Webb. 1991. The effect of recombinant bovine somatotropin on ovarian function in heifers: follicular populations and peripheral hormones. Biol. Reprod. 45:941-949.

Gong, J. G., T. A. Bramley, and R. Webb. 1993. The effect of recombinant bovine somatotropin on ovarian follicular growth and development in heifers. J. Reprod. Fertil. 97:247-254.

Goodhand, K. L., R. G. Watt, M. E. Staines, J. S. M. Hutchinson, and P. J. Broadbent. 1999. In vivo oocyte recovery and in vitro embryo production from bovine donors aspirated at different frequencies or following FSH treatment. Theriogenology 51:951–961.

Griinari, J. M., and D. E. Bauman. 1999. Biosynthesis of conjugated linoleic acid and its incorpotation into meat and milk in ruminants. In M. P. Yurawecz, M. M. Mossoba, J. K. G. Kramer, M. W. Pariza and G. J. Nelson (ed) Advances in Conjugated Linoleic Acid Research. Vol. 1., pp: 180-200. AOCS Press, Champaign, IL.

Griinari, J. M., D. A. Dwyer, M. A. McGuire, and D. E. Bauman. 1996. Partially hydrogenated fatty acids and milk fat depression. J. Dairy Sci. 79(suppl. 1):177. (Abstr)

Griinari, J. M., D. A. Dwyer, M. A. McGuire, D. E. Bauman, D. L. Palmquist, and K. V. Nurmela. 1998. Transoctadecenoic acids and milk fat depression in lactating dairy cows. J. Dairy Sci. 81:1251-1261.

Grohn, Y. T., and P. J. Rajala-Schultz. 2000. Epidemiology of reproductive performance in dairy cows. Anim. Reprod. Sci. 60-61:605-614.

Gronowski, A. M., and P. Rotwein. 1995. Rapid changes in gene expression after in vivo growth hormone treatment. Endocrinology 136:4741-4748.

Gross, T. S., W. W. Thatcher, P. J. Hansen, and S. D. Helmer. 1988. Presence of an intracellular endometrial inhibitor of prostaglandin synthesis during early pregnancy in the cow. Prostaglandins 35:359-378.

Grummer, R. R. 1993. Etiology of lipid-related metabolic disorders in periparturient dairy cows. J. Dairy Sci. 76:3882-3896.

Grummer, R. R., and D. J. Carroll. 1991. Effects of dietary fat on metabolic disorders and reproductive performance of dairy cattle. J. Anim. Sci. 69:3838-3852.

270

Gustafsson, H., and K. Larsson. 1985. Embryonic mortality in heifers after artificial insemination and embryo transfer: differences between virgin and repeat breeder heifers. Res. Vet. Sci. 39:271-274.

Guzeloglu, A., T. R. Bilby, A. Meikle, S. Kamimura, A. Kowalski, F. Michel, L. A. MacLaren, and W. W. Thatcher. 2004a. Pregnancy and bST in nonlactating dairy cows: II. endometrial gene expression related to maintenance of pregnancy. J. Dairy Sci. 87:3268-3279.

Guzeloglu, A., F. Michel, and W. W. Thatcher. 2004c. Differential effects of interferon- tau on the prostaglandin synthetic pathway in bovine endometrial cells treated with phorbol ester. J. Dairy Sci. 87:2032-2041.

Guzeloglu, A., P. Subramaniam, F. Michel, and W. W. Thatcher. 2004b. Interferon-τ induces degradation of prostaglandin H synthase-2 mRNA in bovine endometrial cells through a transcription dependent mechanism. Biol. Reprod. 71:170-176.

Gwazdauskas, F. C., K. W. Kendrick, A. W. Pryor, and T. L. Bailey. 2000. Impact of follicular aspiration on folliculogenesis as influenced by dietary energy and stage of lactation. J. Dairy Sci. 83:1625-1634.

Hanaire-Broutin, H., B. Sallerin-Caute, M. F. Poncet, M. Tauber, R. Bastide, J. J. Chale, R. Rosenfeld, and J. P. Tauber. 1996. Effect of intraperitoneal insulin delivery on growth hormone binding protein, insulin-like growth factor (IGF)-I, and IGF- binding protein-3 in IDDM. Diabetologia 39:1498-1504.

Hanenberg, E. H. A. T. and A. M. van Wagtendonk-de Leeuw. 1997. Comparison of 3, 4 or 7 day interval between oocyte collections for in vitro embryo production results. Theriogenology 47(Suppl. 1):158. (Abstr.)

Hansen, L. B. 2000. Consequences of selection for milk yield from a geneticist’s viewpoint. J. Dairy Sci. 70:712-715.

Hansen, T. R., K. Imakawa, H. G. Polities, K. R. Marotti, R. V. Anthony, and R. M. Roberts. 1988. Interferon RNA of embryonic origin is expressed transiently during early pregnancy in the ewe. J. Biol. Chem. 263:12801-12804.

Hansen, P. J., P. Soto, and R. P. Natzke. 2004. Mastitis and fertility in cattle – possible involvement of inflammation or immune activation in embryonic mortality. Am. J. Reprod. Immunol. 51:294-301.

Harfoot, C. G., and G. P. Hazlewood. 1988. Lipid metabolism in the rumen. In: P. N. Hobson (Ed.) The Rumen Microbial Ecosystem. pp 285-322. Elsevier Applied Science Publishers, London.

Harrison, J. H., J. P. McNamara, and R. L. Kincaid. 1995. Production responses in lactating dairy cattle fed rations high in fat. J. Dairy Sci. 78:181-193.

271

Hauser, S. D., M. F. McGrath, R. J. Collier, and G. G. Krivi. 1990. Cloning and in vivo expression of bovine growth hormone receptor mRNA. Mol. Cell. Endocrinol. 72:187-200.

Hawkins, D. E., K. D. Niswender, G. M. Oss, C. L. Moeller, K. G. Odde, H. R. Sawyer, and G. D. Niswender. 1995. An increase in serum lipids increases luteal lipid content and alters the disappearance rate of progesterone in cows. J. Anim. Sci. 73:541-545.

Heap, D., R. J. Collier, C. K. Boyd, and M. C. Lucy. 1996. Expression of alternate growth hormone receptor messenger RNA in ovary and uterus of cattle. Domest. Anim. Endocrinol. 13:421-430.

Hendriksen, P. J. M., W. N. M. Steenweg, J. C. Harkema, J. S. Merton, M. M. Bevers, P. L. A. M. Vos, and S. J. Dieleman. 2004. Effect of different stages of the follicular wave on in vitro developmental competence of bovine oocytes. Theriogenology 61:909-920.

Hendriksen, P. J. M., P. L. A. M. Vos, W. N. M. Steenweg, M. M. Bevers, and S. J. Dieleman. 2000. Bovine follicular development and its effect on the in vitro competence of oocytes. Theriogenology 53:11-20.

Hightshoe, R. B., R. C. Cochran, L. R. Corah, G. H. Kiracofe, D. L. Harmon, and R. C. Perry. 1991. Effects of calcium soaps of fatty acids on postpartum reproductive function in beef cows. J. Anim. Sci. 69:4097-4103.

Hochi, S., K. Kimura, and A. Hanada. 1999. Effect of linoleic acid-albumin in the culture medium on freezing sensitivity of in vitro-produced bovine morulae. Theriogenology 52:497-504.

Holmann, F. J., C. R. Shumway, R. W. Blake, R. B. Schwart, and E. M. Sudweeks. 1984. Economic value of days open for Holstein cows of alternative milk yields with varying calving intervals. J. Dairy Sci. 67:636-643.

Homa, S. T. and C. A. Brown. 1992. Changes in linoleic acid during follicular development and inhibition of spontaneous breakdown of germinal vesicles in cumulus-free bovine oocytes. J. Reprod. Fertil. 94:153-160.

Horseman, N. D., and L. Yu-lee. 1994. Transcriptional regulation by the helix bundle peptide hormones: growth hormone, prolactin, and hematopoietic cytokines. Endocrine Rev. 15:627-649.

Housekneckt, K. L., D. L. Campion, D. R. Sartin, J. L. Kiser, J. B. Rampacek, and H. E. Amos. 1988. Effect of dietary energy source and level of serum growth hormone, insulin-like growth factor-I, growth and body composition in beef heifers. J. Anim. Sci. 66:2916-2923.

272

Howard, J. J., R. G. Scott, and J. H. Britt. 1990. Associations among progesterone, estradiol-17β, and prostaglandin in cattle treated with hCG during diestrus to extend corpus luteum function. Prostaglandins 40:51-70.

Huang, J. C., J. S. Goldsby, F. Arbab, Z. Melhem, N. Aleksic, and K. K. Wu. 2004. Oviduct prostacyclin functions as a paracrine factor to augment the development of embryos. Hum. Reprod. 19:2907-2912.

Huber, J. T., S. Willman, K. Marcus, C. B. Theurer, D. L. Hard, and L. Kung. 1988. Effect of sometribove, USAN (recombinant methionyl bovine somatotropin) injected in lactating cows at 14-day intervals on milk yield, milk composition and health. J. Dairy Sci. 71(Suppl.1):207. (Abstr.)

Humbel, R. E. 1990. Insulin-like growth factors I and II. Eur. J. Biochem. 190:445-462.

Ing, N. H., T. E. Spencer, and F. W. Bazer. 1996. Estrogen enhances endometrial estrogen receptor gene expression by a posttranscriptional mechanism in the ovariectomized ewe. Biol. Reprod. 54:591-599.

Inoue, I., K. Shino, and S. Noji. 1998. Expression of peroxisome proliferator-activated receptor alpha (PPARα) in primary cultures of human vascular endothelial cells. Biochem. Biophys. Res. Commun. 246:370-374.

Inskeep, E. K. 2004. Preovulatory, postovulatory, and postmaternal recognition effects of concentrations of progesterone on embryonic survival in the cow. J. Anim. Sci. 82(E. Suppl.):E24-E39.

Ip, C. 1997. Review of the effects of trans fatty acids, oleic acid, n-3 polyunsaturated fatty acids, and conjugated linoleic acid on mammary carcinogenesis in animals. Am. J. Clin. Nutr. 66:15235–15295.

Ip, C., S. Banni, E. Angioni, G. Carta, J. McGinley, H. J. Thompson, D. Barbano, and D. Bauman. 1999. Conjugated linoleic acid-enriched butter fat alters mammary gland morphogenesis and reduces cancer risk in rats. J. Nutr. 129:2135-2142.

Izadyar, F., B. Colenbrander, and M. M. Bevers. 1996. In vitro maturation of bovine oocytes in the presence of growth hormone accelerates nuclear maturation and promotes subsequent embryonic development. Mol. Reprod. Dev. 45:372-377.

Izadyar, F., H. T. A. Van tol, B. Colenbrander, and M. M. Bevers. 1997. Stimulatory effect of growth hormone on in vitro maturation of bovine oocytes is exerted through cumulus cells and not mediated by IGF-I. Mol. Reprod. Dev. 45:175-180.

Izadyar, F., H. T. A. Van tol, W. G. Hage, and M. M. Bevers. 2000. Preimplantation bovine embryos express mRNA of growth hormone receptor and respond to growth hormone addition during in vitro development. Mol. Reprod. Dev. 57:247-255.

Jenkins, T. C. 1993. Lipid metabolism in the rumen. J. Dairy Sci. 76:3851-3863.

273

Jenkins, T. C., and B. F. Jenny. 1989. Effect of hydrogenated fat on feed intake, nutrient digestion, and lactation performance of dairy cows. J. Dairy Sci. 72:2316-2324.

Jimenez-Krassel, F., M. Binelli, H. A. Tucker, and J. J. Ireland. 1999. Effect of long term infusion with recombinant bovine somatotropin on development and function of dominant follicles and corpora lutea in Holstein cows. J. Dairy Sci. 82:1917- 1926.

Johnson, G. A., T. E. Spencer, T. R. Hansen, K. J. Austin, R. C. Burghardt, and F. W. Bazer. 1999. Expression of the interferon-tau inducible ubiquitin cross-reactive protein in the ovine uterus. Biol. Reprod. 61:312-318.

Johnson, G. A., M. D. Steward, C. A. Gray, Y. Choi, R. C. Burghardt, L. Y. Yu-Lee, F. W. Bazer, and T. E. Spencer. 2001. Effects of the estrous cycle, pregnancy, and interferon-tau on 2`, 5`-oligoadenylate synthetase expression in the ovine uterus. Biol. Reprod. 64:1392-1399.

Jones, D. F., W. P. Weiss, and D. L. Palmquist. 2000. Short communication: influence of dietary tallow and fish oil on milk fat composition. J. Dairy Sci. 83:2024-2026.

Jones, J. I., and D. R. Clemmons. 1995. Insulin-like growth factors and their binding proteins: biological actions. Endocrine Rev. 16:3-34.

Jousan, F. D., and P. J. Hansen. 2004. Insulin-like growth factor-I as a survival factor for the bovine preimplantation embryo exposed to heat shock. Biol. Reprod. 71:1665-70.

Ju, J-C., J. E. Parks, and X. Yang. 1999. Thermotolerance of IVM-derived bovine oocytes and embryos after short-term heat shock. Mol. Reprod. Dev. 53:336-340.

Juchem, S. O., R. L. A. Cerri, R. Bruno, K. N. Galvao, E. W. Lemos, M. Villasenor, A. C. Coscioni, H. M. Rutgliano, W. W. Thatcher, D. Luchini, and J. E. P. Santos. 2004. Effect of feeding Ca salts of palm oil (PO) or a blend of linoleic and monoenoic trans fatty acids (LTFA) on uterine involution and reproductive performance in Holstein cows. J. Dairy Sci. 87(Suppl.1):310. (Abstr.)

Juengel, J. L., and G. D. Niswender. 1999. Molecular regulation of luteal progesterone synthesis in domestic ruminants. J. Reprod. Fertil. Suppl. 54:193-205.

Jump, D. B., and S. D. Clarke. 1999. Regulation of gene expression by dietary fat. Annu. Rev. Nutr. 19:63-90.

Kaneda, T. 1991. Iso- and anteiso-fatty acids in bacteria: biosynthesis, function, and taxonomic significance. Microbiol. Rev. 55:288-302.

274

Kamegai, J., H. Tamura, T. Shimizu, S. Ishii, H. Sugihara, and I. Wakabayashi. 2001. Chronic central infusion of ghrelin increases hypothalamic neuropeptide Y and Agouti-related protein mRNA levels and body weight in rats. Diabetes 50: 2438– 2443.

Kassa, T., J. D. Ambrose, A. L. Adams, C. Risco, C. R. Staples, M. J. Thatcher, H. H. Van Horn, A. Garcia, H. H. Head, and W. W. Thatcher. 2002. Effects of whole cottonseed diet and recombinant bovine somatotropin on ovarian follicles in lactating dairy cows. J. Dairy Sci. 85:2823-2830.

Katagiri, S., Y. S. Moon, and B. H. Yuen. 1996. The role for the uterine insulin-like growth factor I in early embryonic loss after superovulation in the rat. Fertil. Steril. 65:426:436.

Katagiri, S., Y. S. Moon, and B. H. Yuen. 1997. A somatostatin analogue decreases embryonic loss following superovulation in rats by normalizing insulin-like growth factor-I action in the uterus. Hum. Reprod. 12:671-676.

Kaye, P. L. 1997. Preimplantation growth factor physiology. Rev. Reprod. 2:121-127.

Kaye, P. L., K. L. Bell, L. F. S. Beebe, G. F. Dunglison, H. G. Gardner, and M. B. Harvey. 1992. Insulin and insulin-like growth factors (IGFs) in preimplantation development. Reprod. Fertil. Dev. 4:373-386.

Keady, T. W., C. S. Mayne, and D. A. Fitzpatrick. 2000. Effects of supplementation of dairy cattle with fish oil on silage intake, milk yield and milk composition. J. Dairy Res. 67:137-153.

Keeney, M. 1970. Lipid metabolism in the rumen. In: A. T. Phillipson (Ed.) Physiology of Digestion and Metabolism in the Ruminant. Pp 489-503. Oriel Press, Newcastle upon Tyne, U. K.

Keeney, M., I. Katz, and M. J. Allison. 1962. On the probable origin of some milk fat acids in rumen microbial lipids. J. Am. Oil Chem. Soc. 39:198-201.

Kelly, M. L., J. R. Berry, D. A. Dwyer, J. M. Griinari, P. Y. Chouinard, M. E. Van Amburgh, and D. E. Bauman. 1988. Dietary fatty acid sources affect conjugated linoleic acid concentrations in milk from lactating dairy cows. J. Nutr. 128:881- 885.

Kelly, M. L., E. S. Kolver, D. E. Bauman, M. E. VanAmburgh, and L. D. Muller. 1998. Effect of dietary intake of pasture on conjugated linoleic acid (CLA) concentrations in milk from lactating dairy cows. J. Dairy Sci. 81:1630-1636.

Kelsey, J. A., B. A. Corl, R. J. Collier, and D. E. Bauman. 2003. The effect of breed, parity, and stage of lactation on conjugated linoleic acid (CLA) in milk fat from dairy cows. J. Dairy Sci. 86:2588-2597.

275

Khan, A. S., and J. P. Vanden Heuvel. 2003. Role of nuclear receptors in the regulation of gene expression by dietary fatty acids. J. Nut. Biochem. 14:554-567.

Khanal, R. C., and T. R. Dhiman. 2004. Biosynthesis of conjugated linoleic acid (CLA): a review. Pak. J. Nutr. 3:72-81.

Kiess, W., G. D. Blickenstaff, M. M. Sklar, C. L. Thomas, S. P. Nissley, and G. G. Sahagian. 1988. Biochemical evidence that the type II insulin-like growth factor II receptor: distinct binding sites for mannose 6-phosphate and insulin-like growth factor II. Biochem. Biophys. Res. Commun. 150:1287-1293.

Kim, B., C. M. van Golen, and E. L. Feldman. 2004. Insulin-like growth factor-I signaling in human neuroblastoma cells. Oncogene 23:130-141.

Kim, J. Y., M. Kinoshita, M. Ohnishi, and Y. Fukui. 2001. Lipid and fatty acid analysis of fresh and frozen-thawed immature and in vitro matured bovine oocytes. Reproduction 122:131-138.

Kim, S., Y. Choi, F. W. Bazer, and T. E. Spencer. 2003. Effects of the estrous cycle, pregnancy and interferon-tau on cyclooxygenase 2 (COX-2) expression in ovine endometrium. Reprod. Biol. Endocrinol. 1:58-67.

Kimmins, S., and L. A. MacLaren. 2001. Oestrous cycle and pregnancy effects on the distribution of oestrogen and progesterone receptors in bovine endometrium. Placenta 22:742-748.

Kirby, C. J., M. F. Smith, D. H. Keisler, and M. C. Lucy. 1997a. Follicular function in lactating dairy cows treated with sustained release bovine somatotropin. J. Dairy Sci. 80:273–285.

Kirby, C. J., W. W. Thatcher, R. J. Collier, F. A. Simmen, and M. C. Lucy. 1996. Effects of growth hormone and pregnancy on expression of growth hormone receptor, insulin-like growth factor-I, and insulin-like growth factor binding protein-2 and -3 genes in bovine uterus, ovary, and oviduct. Biol. Reprod. 55:996- 1002.

Kirby, C. J., S. J. Wilson, and M. C. Lucy. 1997b. Response of dairy cows treated with bovine somatotropin to a luteolytic dose of prostaglandin F2α. J. Dairy Sci. 80:273- 282.

Klotz, D. M., S. C. Hewitt, P. Ciana, M. Raviscioni, J. K. Lindzey, J. Foley, A. Maggi, R. P. DiAugustine, and K. S. Korach. 2002. Requirement of estrogen receptor-alpha in insulin-like growth factor-1 (IGF-1)-induced uterine responses and in vivo evidence for IGF-1/estrogen receptor cross-talk. J. Biol. Chem. 277:8531-8537.

Knickerbocker, J. J., W. W. Thatcher, D. B. Foster, D. Wolfenson, F. F. Bartol, and D. Caton. 1986. Uterine prostaglandin and blood flow responses to estradiol-17β in cyclic cattle. Prostaglandins 31:757-776.

276

Knight, C. H. 1992. Milk yield responses to sequential treatments with recombinant bovine somatotropin and frequent milking in lactating goats. J. Dairy Res. 59:115- 122.

Ko, Y., C. J. Lee, T. L. Ott, M. A. Davis, R. C. M. Simmen, F. W. Bazer, and F. A. Simmen. 1991. Insulin-like growth factors in sheep uterine fluids: concentrations and relationship to ovine trophoblastic protein-1 production during early pregnancy. Biol. Reprod. 45:135-142.

Kobayashi, Y., C. K. Boyd, C. J. Bracken, W. R. Lamberson, D. H. Keisler, and M. C. Lucy. 1999. Growth hormone receptor (GHR) messenger ribonucleic acid in liver of periparturient cattle is caused by a specific down-regulation of GHR 1A that is associated with decreased insulin-like growth factor. Endocrinology 140:3947- 3954.

Kojima, M., H. Hosoda, Y. Date, M. Nakazato, H. Matsuo, and K. Kangawa. 1999. Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 402: 656-660.

Kojima, M., and K. Kangawa. 2005. Ghrelin: structure and function. Physiol. Rev. 85:495-522.

Kolle, S., F. Sinowatz, G. Boie, D. Lincoln, and G. A. Palma. 1997. Expression of growth hormone receptor and its transcript during bovine early embryonic development. Reprod. Dom. Anim. 32:51. (Abstr.)

Korbonits, M., and A. B. Grossman. 2004. Ghrelin: update on a novel hormonal system. Eur. J. Endocrinol. 151 (Suppl.)2: S67-S70.

Kramer, J. K., V. Fellner, M. E. Dugan, F. D. Sauer, M. M. Mossoba, and M. P. Yurawecz. 1997. Evaluating acid and base catalysts in the methylation of milk and rumen fatty acids with special emphasis on conjugated dienes and total trans fatty acids. Lipids 11:1219-1228.

Kris-Etherton, P. M., S. W. Harris, and L. J. Appel. 2003. Fish consumption, fish oil, omega-3 fatty acids, and cardiovascular disease. Arterioscler. Thromb. Vasc. Biol. 23:e20-e30.

Kris-Etherton, P. M., D. S. Taylor, S. Yu-Poth, P. Huth, K. Moriarty, V. Fishell, R. L. Hargrove, G. Zhao, and T. D. Etherton. 2000. Polyunsaturated fatty acids in the food chain in the United States. Am. J. Clin. Nutr. 71:179S-188S.

Kritchevsky, D. 2003. Conjugated linoleic acid in experimental atherosclerosis. J. Sebedio, W. W. Christie and R. Adolf (ed) Advances in Conjugated Linoleic Acid Research, Vol. 2. pp:292-301. AOCS Press, Champaign, IL.

277

Labernia, J., F. Lopez-Gautius, P. Santolaria, C. Hanzen, Y. Laurent, and J. Y. Houtain. 1999. Influence of calving season on the interactions among reproductive disorders of dairy cows. J. Anim. Sci. 67:387–393.

Lambert, M. R., N. L. Jacobson, R. S. Allen, and J. H. Zaletel. 1954. Lipid deficiency in the calf. J. Nutr. 52:259-272.

Lamming, G. E., and A. O. Darwash. 1995. Effect of inter-luteal interval on subsequent luteal phase length and fertility in postpartum dairy cows. Biol. Reprod. 53(Suppl.1):63. (Abstr.)

Lamming, G. E., and G. E. Mann. 1995. Control of endometrial oxytocin receptors and prostaglandin F2α production in cows by progesterone and oestradiol. J. Reprod. Fertil. 103:69-73.

Lanna, P. D., K. L. Houseknecht, D. M. Harris, and D. E. Bauman. 1995. Effect of somatotropin treatment on lipogensis, lipolysis, and related cellular mechanisms in adipose tissue of lactating cows. J. Dairy Sci. 78:1703-1712.

Lawson, R. A. S., R. A. Parr, and L. P. Cahill. 1983. Evidence for maternal control of blastocyst growth after asynchronous transfer of embryos to the uterus of the ewe. J. Reprod. Fertil. 67:477-483.

Lee, A. V., C. N. Weng, J. G. Jackson, and D. Yee. 1997. Activation of estrogen receptor-mediated gene transcription by IGF-I in human breast cancer cells. J. Endcorinol. 152:39-47.

Lee, C. Y., M. L. Green, R. C. M. Simmen, and F. A. Simmen. 1998. Proteolysis of insulin-like growth factor-binding proteins (IGFBPs) within the pig uterine lumen associated with peri-implantation conceptus development. J. Reprod. Fertil. 112:369-377.

Lefebvre, D. M., and E. Block. 1992. Effect of recombinant bovine somatotropin on estradiol-induced estrous behavior in ovariectomized heifers. J. Dairy Sci. 75:1461-1478.

Lessard, M., N. Gagnon, D. L. Godson, and H. V. Petit. 2004. Influence of parturition and diets enriched in n-3 or n-6 polyunsaturated fatty acids on immune response of dairy cows during the transition period. J. Dairy Sci. 87:2197-2210.

Lessard, M., N. Gagnon, and H. V. Petit. 2003. Immune response of postpartum dairy cows fed flaxseed. J. Dairy Sci. 86:2647-2657.

Lewis, G. S., W. W. Thatcher, F. W. Bazer, and J. S. Curl. 1982. Metabolism of arachidonic acid in vitro by bovine blastocysts and endometrium. Biol. Reprod. 27:431-439.

278

Lewis, U. J. 1992. Growth hormone: what is it and what does it do. Trends Endocr. Metab. 3:117-121.

Lim, H., R. A. Gupta, W. G. Ma, B. C. Paria, D. E. Moller, J. D. Morrow, R. N. BuBois, J. M. Trzaskos, and S. K. Dey. 1999. Cyclo-oxygenase-2-derived prostacyclin mediates embryo implantation in the mouse via PPARδ. Gene Dev. 13:1561-1574.

Lim, H., B. C. Paria, S. K. Das, K. E. Dinchuk, R. Langenbach, J. M. Trzaskos, and S. K. Dey. 1997. Multiple female reproductive failure in cyclooxygenase 2-deficient mice. Cell 91:197-208.

Littell, R. C., G. A. Milliken, W. W. Stroup, and R. D. Wolfinger. 1996. SAS for Mixed Models. SAS Institute Inc., Cary, NC. pp.633.

Liu, J., M. Antaya, A. K. Goff, D. Boerboom, D. W. Silversides, J. G. Lussier, and J. Sirois. 2001. Molecular characterization of bovine prostaglandin G/H Synthase-2 and regulation on uterine stromal cells. Biol. Reprod. 64:983-991.

Lonergan, P., P. Monaghan, D. Rizos, M. P. Boland, and I. Gordon. 1994. Effect of follicle size on bovine oocyte quality and developmental competence following maturation, fertilization, and culture in vitro. Mol. Reprod. Dev. 37:48-53.

Lopez-Gatius, F., I. Garcia-Ispierto, P. Santolaria, J. Yaniz, C. Nogareda, and M. Lopez- Bejar. 2005. Screening for high fertility in high-producing dairy cows. Theriogenology (in press).

Louca, A., and J. E. Legates. 1968. Production losses in dairy cattle due to days open. J. Dairy Sci. 51:573-583.

Lozano, J. M., P. Lonergan, M. P. Boland, and D. O’Callaghan. 2003. Influence of nutrition on the effectiveness of superovulation programs in ewes: effect on oocyte quality and post-fertilization development. Reproduction 125:543-553.

Lucy, M. C. 2000. Regulation of ovarian follicular growth by somatotropin and insulin- like growth factors in cattle. J. Dairy Sci. 83:1635-47.

Lucy, M. C. 2001. Reproductive loss in high-producing dairy cattle: where will it end? J. Dairy Sci. 84:1277-1293.

Lucy, M. C., C. K. Boyd, A. T. Koenigfeld, and C. S. Okamura. 1998b. Expression of somatotropin receptor messenger ribonucleic acid in bovine tissues. J. Dairy Sci. 81:1889–1895.

Lucy, M. C., J. C. Byatt, T. L. Curran, and R. J. Collier. 1994. Placental lactogen and somatotropin: hormone binding to the corpus luteum and effects on the growth and functions of the ovary in heifers. Biol. Reprod. 50:136-44.

279

Lucy, M. C., R. J. Collier, M. L. Kitchel, J. J. Dibner, S. D. Hauser, and G. G. Krivi. 1993a. Immunohistochemical and nucleic acid analysis of growth hormone receptor populations in the bovine ovary. Biol. Reprod. 48:1219-1227.

Lucy, M. C., and B. A. Crooker. 2001. Physiological and genetic differences between low and high index dairy cows. Brit. Soc. Anim. Sci. Occasional Publ. 26:223-234.

Lucy, M. C., R. L. De La Sota, C. R. Staples, and W. W. Thatcher. 1993b. Ovarian follicular populations in lactating dairy cows treated with recombinant bovine somatotropin (sometribove) or saline and fed diets differing in fat content and energy. J. Dairy Sci. 76:1014-1027.

Lucy, M. C., C. R. Staples, F. M. Michel, W. W. Thatcher, and D. J. Bolt. 1991a. Effect of feeding calcium soaps to early postpartum dairy cows on plasma prostaglandin F2α, luteinizing hormone, and follicular growth. J. Dairy Sci. 74:483-489.

Lucy, M. C., C. R. Staples, F. M. Michel, and W. W. Thatcher. 1991b. Energy balance and size and number of ovarian follicles detected by ultrasonography in early postpartum dairy cows. J. Dairy Sci. 74:473-482.

Lucy, M. C., C. R. Staples, W. W. Thatcher, P. S. Erickson, R. M. Cleale, J. L. Firkins, J. H. Clark, M. R. Murphy, and B. O. Brodie. 1992. Influence of diet composition, dry matter intake, milk production, and energy balance on time of post-partum ovulation and fertility in dairy cows. Anim. Reprod. 54:323-331.

Lucy, M. C., W. W. Thatcher, R. J. Collier, F. A. Simmen, Y. Ko, J. D. Savio, and L. Badinga. 1995. Effects of somatotropin on the conceptus, uterus, and ovary during maternal recognition of pregnancy in cattle. Domest. Anim. Endocrinol. 12:73-82.

Lucy, M. C., W. J. Weber, L. H. Baumgard, B. S. Seguin, A. T. Koenigsfeld, L. B. Hansen, H. Chester-Jones, and B. A. Crooker. 1998a. Reproductive endocrinology of lactating dairy cows selected for increased milk production. J. Anim. Sci. 76(Suppl.1):296. (Abstr.)

MacLaren, L. A., A. Guzeloglu, T. R. Bilby, F. Michel, and W. W. Thatcher. 2003. Expression of peroxisome proliferator-activated receptors (PPARs) in bovine endometrium. Biol. Reprod. 68(Suppl.1):264. (Abstr.)

MacLaren, L. A., A. Guzeloglu, F. Michel, and W. W. Thatcher. 2005. Peroxisome proliferator-activated receptor (PPAR) expression in cultured bovine endometrial cells and response to omega-3 fatty acid, growth hormone and agonist stimulation in relation to series 2 prostaglandin production. Dom. Anim. Endocr. (in press).

Madron, M. S., D. G. Peterson, D. A. Dwyer, B. A. Corl, L. H. Baumgard, D. H. Beerman, and D. E. Bauman. 2002. Effect of extruded full-fat soybeans on conjugated linoleic acid content of intramuscular, intermuscular, and subcutaneous fat in beef steers. J. Anim. Sci. 80:1135-1143.

280

Malau-Aduli, A. E. O., B. D. Siebert, C. D. K. Bottema, and W. S. Pitchford. 1997. A comparison of the fatty acid composition of triacylglycerols in adipose tissue from Limousin and Jersey cattle. Aust. J. Agric. Res. 48:715-722.

Malven, P. V., H. H. Head, R. J. Collier, and F. C. Buonomo. 1987. Periparturient changes in secretion and mammary uptake of insulin and in concentrations of insulin and insulin-like growth factors in milk of dairy cows. J. Dairy Sci. 70:2254-65.

Mann, G. E., and G. E. Lamming. 1994. Use of repeated biopsies to monitor endometrial oxytocin receptors in the cow. Vet. Rec. 135:403-405.

Mann, G. E., and G. E. Lamming. 1999. The influence of progesterone during early pregnancy in cattle. Reprod. Domest. Anim. 34:269–274.

Mann, G. E., and G. E. Lamming. 2001. Relationship between maternal endocrine environment, early embryo development and inhibition of the luteolytic mechanism in cows. Reproduction 121:175-180.

Mann, G. E., G. E. Lamming, and P. A. Fisher. 1998. Progesterone control of embryonic interferon-tau production during early pregnancy in the cow. J. Reprod. Fertil. 21(Suppl.1):37 (Abstr.)

Mann, G. E., G. E. Lamming, R. S. Robinson, and D. C. Wathes. 1999. The regulation of interferon-tau production and uterine hormone receptors during early pregnancy. J. Reprod. Fertil. 54:317-328.

Mann, G. E., S. H. Mann, and G. E. Lamming. 1996. The inter-relationship between the maternal hormone environment and the embryo during the early stages of pregnancy. J. Reprod. Fertil. 17(Suppl.1):55. (Abstr.)

Mapletoft, R. J., C. E. Lindsell, and V. Pawlshyn. 1986. Effects of clenbuterol, body condition, and nonsurgical embryo transfer equipment on pregnancy rates in bovine recipients. Theriogenology 25:172. (Abstr.)

Marions, L., and K. G. Danielsson. 1999. Expression of cyclo-oxygenase in human endometrium during the implantation period. Mol. Human Reprod. 5:961-965.

Markusfeld, O., N. Galon, and E. Ezra. 1997. Body condition score, health, yield and fertility in dairy cows. Vet. Rec. 141:67–72.

Matsumoto, H., M. Wen-Ge, T. Daikoku, X. Zhao, B. C. Paria, S. K. Das, J. M. Trzaskos, and S. K. Dey. 2002. Cyclooxygenase-2 differentially directs uterine angiogenesis during implantation in mice. J. Biol. Chem. 277:29260-29267.

Matsumoto, H., M. Wen-Ge, W. Smalley, J. Trzaskos, R. M. Breyer, and S. K. Dey. 2001. Diversification of cyclooxygenase-2-derived prostaglandins in ovulation and implantation. Biol. Reprod. 64:557-1565.

281

Mayo, K. E., P. A. Godfrey, S. T. Suhr, D. J. Kulik, and J. O. Rahal. 1995. Growth hormone-releasing hormone: synthesis and signaling. Recent Progress Horm. Res. 50:35-73.

Mattos, R., A. Guzeloglu, L. Badinga, C. R. Staples, and W. W. Thatcher. 2003. Polyunsaturated fatty acids and bovine interferon-τ modify phorbol ester-induced secretion of prostaglandinF2α and expression of prostaglandin endoperoxide synthase-2 and phospholipase-A2 in bovine endometrial cells. Biol. Reprod. 69: 780-787.

Mattos, R., C. R. Staples, A. Arteche, M. C. Wiltbank, F. J. Diaz, T. C. Jenkins, and W. W. Thatcher. 2004. The effects of feeding fish oil on uterine secretion of PGF2α, milk composition, and metabolic status of periparturient Holstein cows. J. Dairy Sci. 87:921-932.

Mattos, R., C. R. Staples, and W. W. Thatcher. 2000. Effects of dietary fatty acids on reproduction in ruminants. Rev. Reprod. 5:38–45.

Mattos, R., C. R. Staples, J. Williams, A. Amorocho, M. A. McGuire, and W. W. Thatcher. 2002. Uterine, ovarian, and production responses of lactating dairy cows to increasing dietary concentrations of menhaden fish meal. J. Dairy Sci. 85:755-764.

McAtee, J. W., and A. Trenkle. 1971. Effect of feeding, fasting and infusion of energy substrates on plasma growth hormone levels in cattle. J. Anim. Sci. 33:612-616.

McCracken, J. A., E. E. Custer, and J. C. Lamsa. 1999. Luteolysis: a neuroendocrine- mediated event. Physiol. Rev. 79:263-324.

McDowell, G. H. 1991. Somatotropin and endocrine regulation of metabolism during lactation. J. Dairy Sci. 74(Suppl.2):44. (Abstr.)

McDowell, G. H., I. C. Hart, and A. C. Kirby. 1987. Local intra-arterial infusion of growth hormone into the mammary glands of sheep and goats: effects on milk yield and composition, plasma hormones and metabolites. Aust. J. Biol. Sci. 40:181- 189.

McEvoy, T. G., G. D. Coull, P. J. Broadbent, J. S. M. Hutchinson, and B. K. Speake. 2000. Fatty acid composition of lipids in immature cattle, pig and sheep oocytes with intact zona pellucida. J. Reprod. Fertil. 118:163-170.

McGaughey, R. W. 1983. Regulation of oocyte maturation. Oxford Rev. Reprod. Biol. 5:106-130.

282

McGuire, M. A., M. K. McGuire, M. A. Guy, W. K. Sanchez, T. D. Schultz, L. Y. Harison, D. E. Bauman, and J. M. Griinari. 1996. Effect of dietary lipid concentration on content of conjugated linoleic acid (CLA) in milk from dairy cattle. J. Anim. Sci. 74(Suppl.1):266. (Abstr)

McGuire, M. A., J. L. Vicini, D. E. Bauman, and J. J. Veenhuizen. 1992. Insulin-like growth factors and binding proteins in ruminants and their nutritional regulation. J. Anim. Sci. 70:2901-2910.

Meikle, A., L. Sahlin, A. Ferraris, B. Masironi, J. E. Blanc, M. Rodriguez-Irazqui, M. Rodriguez-Pinon, H. Kindahl, and M. Forsberg. 2001. Endometrial mRNA expression of oestrogen receptor α, progesterone receptor and insulin-like growth factor-I (IGF-I) throughout the bovine oestrous cycle. Anim. Reprod. Sci. 68:45- 56.

Menotti, A. 1999. Diet cholesterol and coronary heart disease: a perspective. Acta. Cardinol. 54:169-172.

Mermillod, P., B. Oussaid, and Y. Cognie. 1999. Aspects of follicular and oocyte maturation that affect the developmental potential of embryos. J. Reprod. Fertil. 54:449-460.

Merton, J. S., A. P. W. de Roos, E. Mullaart, L. de Ruigh, L. Kaal, P. L. A. M. Vos, and S. J. Dieleman. 2003. Factors affecting oocyte quality and quantity in commercial application of embryo technologies in the cattle breeding industry. Theriogenology 59:651-674.

Mihm, M., A. Bagnisi, M. P. Boland, and J. F. Roche. 1994. Association between the duration of dominance of the ovulatory follicle and pregnancy rate in beef heifers. J. Reprod. Fertil. 102:123–130.

Mihm, M., M. A. Crowe, P. G. Knight, and E. J. Austin. 2002. Follicle wave growth in cattle. Reprod. Domest. Anim. 37:191–200.

Mishra, D. P., H. H. D. Meyer, and B. S. Prakash. 2003. Validation of a sensitive enzyme immunoassay for 13,14-dihydro-15-keto-PGF2α in buffalo plasma and its application for reproductive health status monitoring. Anim. Reprod. Sci. 78:33- 46.

Moallem, U., Y. Folman, A. Bor, A. Arav, and D. Sklan. 1999. Effect of calcium soaps of fatty acids and administration of somatotropin on milk production, preovulatory follicular development, and plasma and follicular fluid lipid composition in high yielding dairy cows. J. Dairy Sci. 82:2358-2368.

Monty, D. E., and C. Racowsky. 1987. In vitro evaluation of early embryo viability and development in summer heat-stressed, superovulated dairy cows. Theriogenology 28:451–465.

283

Moore, N. W., and J. N. Shelton. 1964. Egg transfer in sheep: effect of degree of synchronization between donor and recipient, age of egg and site of transfer on the survival of the transferred eggs. J. Reprod. Fertil. 7:45-152.

Morales-Roura, J. S., L. Zarco, J. Hernandez-Ceron, and G. Rodríguez. 2001. Effect of short-term treatment with bovine somatotropin at estrus on conception rate and luteal function of repeat-breeding dairy cows. Theriogenology 55:1831-1841.

Morbeck, D. E., J. H. Britt, and B. T. McDaniel. 1991. Relationships among milk yield, metabolism, and reproductive performance of primiparous Holstein cows treated with somatotropin. J. Dairy Sci. 74:2153-2164.

Moreira, F., L. Badinga, C. Burnley, and W. W. Thatcher. 2002a. Bovine somatotropin increases embryonic development in superovulated cows and improves post- transfer pregnancy rates when given to lactating recipient cows. Theriogenology 57:1371-1387

Moreira, F., R. L. De La Sota, T. Diaz, and W. W. Thatcher. 2000a. Effect of day of the estrous cycle at the initiation of a timed artificial insemination protocol on reproductive responses in dairy heifers. J. Anim. Sci. 78:1568-1576.

Moreira, F., C. Orlandi, C. A. Risco, R. Mattos, F. Lopes, and W. W. Thatcher. 2001. Effects of presynchronization and bovine somatotropin on pregnancy rates to a timed artificial insemination protocol in lactating dairy cows. J. Dairy Sci. 84:1646-1659.

Moreira, F., F. F. Paula-Lopes, P. J. Hansen, L. Badinga, and W. W. Thatcher. 2002b. Effects of growth hormone and insulin-like growth factor-I on development of in vitro derived bovine embryos. Theriogenology 57:895-907.

Moreira, F., C. Risco, M. F. A. Pires, J. D. Ambrose, M. Drost, and W. W. Thatcher. 2000b. Use of bovine somatotropin in lactating dairy cows receiving timed artificial insemination. J. Dairy Sci. 83:1237-1247.

Morrison, S. R. 1983. Ruminant heat stress: effect on production and means of alleviation. J. Anim. Sci. 57:1594-1600.

Myers Jr., M. G., and M. F. White. 1993. The new elements of insulin signaling: insulin receptor substrate-1 and proteins with SH2 domains. Diabetes 42:643-650.

Nakamura, M. T., and T. Y. Nara. 2004. Structure, function, and dietary regulation of ∆- 6, ∆-5, and ∆-9 desaturases. Annu. Rev. Nutr. 24:345-376.

Needleman, P., A. Raz, M. S. Minkes, J. A. Ferrendeli, and H. Sprecher. 1979. Triene prostaglandins: prostacyclin and thromboxane biosynthesis and unique biological properties. Proc. Natl. Acad. Sci. USA 76:944-948.

284

Nestel, P. J. 1995. Controlling coronary risk through nutrition. Can. J. Cardiol. 11:9G- 14G.

Newton, C. J., R. Buric, T. Trapp, S. Brockmeier, U. Pagotto, and G. K. Stalla. 1994. The unliganded estrogen receptor (ER) transduces growth factor signals. J. Steroid Biochem. Mol. Biol. 48:481-486.

Nicolosi, R., E. Rogers, D. Kritchevsky, J. A. Scimeca, and P. Huth. 1997. Dietary conjugated linoleic acid reduces plasma lipoproteins and early aortic atherosclerosis in hypercholesterolemic hamsters. Artery 22:266–277.

Nonogaki, T., Y. Noda, Y. Goto, J. Kishi, and T. Mori. 1994. Developmental blockage of mouse embryos caused by fatty acids. J. Assit. Reprod. Genet. 11:482-488.

Norstedt, G., B. Enberg, C. Moller, and L. S. Mathews. 1990. Growth hormone regulation of gene expression. Acta Paediatrica Scandinavica Suppl. 366:79-83.

Ntambi, J. M., A. M. Sessler, and T. Takova. 1996. A model cell line to study regulation of stearoyl-CoA desaturase gene 1 expression by insulin and polyunsaturated fatty acids. Biochem. Biophys. Res. Commun. 220:990-995.

Nugent, R. A., T. G. Jenkins, A .J. Roberts, and J. Klindt. 1993. Relationship of postpartum interval in mature beef cows with nutritional environment biological type and serum IGF-I concentrations. Anim. Prod. 56:193-200.

Nunez, S. B., J. A. Medin, O. Braissant, L. Kemp, W. Wahli, and K. Ozato. 1997. Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor. Mol. Cell Endocr. 127:27–40.

O’Callaghan, D., J. M. Lozano, J. Fahey, V. Gath, S. Snijders, and M. P. Boland. 2001. Relationships between nutrition and fertility in dairy cattle. Brit. Soc. Anim. Sci. Occasional Publ. 26:147-160.

Oka, Y., L. M. Rozek, and M. P. Czech. 1985. Direct demonstration of rapid insulin-like growth factor II receptor internalization and recycling in rat adipocytes. Insulin stimulates 125I insulin-like growth factor II degradation by modulating the IGF-II receptor recycling process. J. Biol. Chem. 260:9435-9442.

Okamoto, T., T. Katada, Y. Murayama, M. Ui, E. Ogata, and I. Nishimoto. 1990. A simple structure encodes G protein-activating function of the IGF-II/mannose 6- phosphate receptor. Cell 62:709-717.

Oldick, B. S., C. R. Staples, W. W. Thatcher, and P. Gyawu. 1997. Abomasal infusion of glucose and fat-effect on digestion, production, and ovarian and uterine function of cows. J. Dairy Sci. 80:1315-1328.

285

Ott, T. L., T. E. Spencer, J. Y. Lin, H-T. Kim, B. Gerami, F. F. Bartol, A. A. Wiley, and F. W. Bazer. 1998. Effects of the estrous cycle and early pregnancy on uterine expression of Mx protein in sheep (Ovis aries). Biol. Reprod. 59:784-794.

Pantoja, J., J. L. Firkins, and M. L. Eastridge. 1996. Fatty acid digestibility and lactation performance by dairy cows fed fats varying in degree of saturation. J. Dairy Sci. 79:429-437.

Pantoja, J., J. L. Firkins, M. L. Eastridge, and B. L. Hull. 1994. Effects of fat saturation and source of fiber on site of nutrient digestion and milk production by lactating dairy cows. J. Dairy Sci. 77:2341-2356.

Parent, J., C. Villeneuve, A. P. Alexenko, A. D. Ealy, and M. A. Fortier. 2003. Influence of different isoforms of recombinant trophoblast interferons on prostaglandin production in cultured bovine endometrial cells. Biol. Reprod. 68:1035-1043.

Pariza, M. W. 1999. The biological activities of conjugated linoleic acid. In M. P. Yurawecz, M. M. Mossoba, J. K. G. Kramer, M. W. Pariza and G. J. Nelson (ed) Advances in Conjugated Linoleic Acid Research, Vol. 1., pp: 12-20. AOCS Press, Champaign, IL.

Parker, K. I., D. M. Robertson, N. P. Groome, and K. L. Macmillan. 2003. Plasma concentrations of inhibin A and follicle-stimulating hormone differ between cows with two or three waves of ovarian follicular development in a single estrous cycle. Biol. Reprod. 68:822–828.

Parodi, P. 2003. Conjugated linoleic acid in food. In. J. Sebedio, W. W. Christie and R. Adolf (ed) Advances in Conjugated Linoleic Acid Research, Vol. 2, pp: 101-121. AOCS Press, Champaign, IL.

Parr, R. A. 1992. Nutrition-progesterone interactions during early pregnancy in sheep. Reprod. Fertil. Dev. 4:297-300.

Parrish, J. J., J. L. Susko-Parrish, E. S. Critser, W. H. Eyestone, and N. L. First. 1986. Bovine in vitro fertilization with frozen-thawed semen. Theriogenology 25:591- 600.

Paula-Lopes, F. F., and P. J. Hansen. 2002. Heat-shock induced apoptosis in bovine preimplantation embryos is a developmentally-regulated phenomenon. Biol. Reprod. 66:1169-1177.

Pavlok, A., A. Lucas-Hahn, and H. Niemann. 1992. Fertilization and developmental competence of bovine oocytes derived from different categories of antral follicles. Mol. Reprod. Dev. 31:63-67.

Payne, J. H., and G. E. Lamming. 1994. The direct influence of the embryo on uterine PGF2α and PGE2 production in sheep. J. Reprod. Fertil. 101:737-741.

286

Peel, C. J., and D. E Bauman. 1987. Somatotropin and lactation. J. Dairy Sci. 70:474- 486.

Peel, C. J., T. J. Fronk, D. E. Bauman, and R. C. Gorewit. 1983. Effect of exogenous growth hormone in early and late lactation on lactational performance of dairy cows. J. Dairy Sci. 66:776-782.

Pershing, R. A., A. C. Dinges, W. W. Thatcher, and L. Badinga. 2003. Plasma and uterine insulin-like growth factor-I (IGF-I) and IGF-binding proteins in lactating dairy cows treated with bovine somatotropin. J. Anim. Vet. Adv. 2:67-73.

Pershing, R. A., M. C. Lucy, W. W. Thatcher, and L. Badinga. 2002. Effects of bST on oviductal and uterine genes encoding components of the IGF system in lactating dairy cows. J. Dairy Sci. 85:3260-3267.

Peruzzi, F., M. Prisco, M. Dews, P. Salomoni, E. Grassilli, G. Romano, B. Calabretta, and R. Baserga. 1999. Multiple signaling pathways of the insulin-like growth factor 1 receptor in protection from apoptosis. Mol. Cell Biol. 19:7203-7215.

Petit, H. V., R. J. Dewhurst, J. G. Proulx, M. Khalid, W. Haresign, and H. Twagiramungu. 2001. Milk production, milk composition, and reproductive function of dairy cows fed different fats. Can. J. Dairy Sci. 81:263-271.

Petit, H. V., R. J. Dewhurst, N. D. Scollan, J. G. Proulx, M. Khalid, W. Haresign, H. Twagiramungu, and G. E. Mann. 2002. Milk production and composition, ovarian function, and prostaglandin secretion of dairy cows fed omega-3 fats. J. Dairy Sci. 85:889-899.

Petit, H. V., C. Germiquet, and D. Lebel. 2004. Effect of feeding whole, unprocessed sunflower seeds and flaxseed on milk production, milk composition, and prostaglandin secretion in dairy cows. J. Dairy Sci. 87:3889-3898.

Petyim, S., R. Bage, T. Hallap, A. S. Bergqvist, H. Rodriguez-Martinez, and B. Larsson. 2003. Two different schemes of twice-weekly ovum pick-up in dairy heifers: effect on oocyte recovery and ovarian function. Theriogenology 60:175-188.

Pinto Andrade, L. P., S. M. Rhind, I. A. Wright, S. R. McMilen, P. J. Goddard, and T. A. Bramley. 1996. Effects of bovine somatotropin (bST) on ovarian function in postpartum beef cows. Reprod. Fertil. Dev. 8:951-960.

Postel-Vinay, M-C., and J. Finidori. 1995. Growth hormone receptor: structure and signal transduction. European J. Endocrinol. 133:654-659.

Poulson, C. S., T. R.Dhiman, D. Cornforth, K. C. Olson, and J. Walters. 2001. Influence of diet on conjugated linoleic acid content in beef. J. Anim. Sci. 79(Suppl.1):159. (Abstr.)

287

Prosser, C. G., and S. R. Davis. 1992. Milking frequency alters the milk yield and mammary blood flow response to intra-mammary infusion of insulin-like growth factor-I in the goat. J. Endocrinol. 135:311-316.

Prosser, C. G., S. R. Davis, V. C. Farr, L. G. Moore, and P. D. Gluckman. 1994. Effects of close-arterial (external pudic) infusion of insulin-like growth factor-II on milk yield and mammary blood flow in lactating goats. J. Endocrinol. 142:93-99.

Prosser, C. G., S. R. Davis, S. C. Hodgkinson, and M. A. Mohler. 1995. Pharmacokinetics and bioactivity of intact versus truncated IGF-I during a 24-h infusion into lactating goats. J. Endocrinol. 144:99-107.

Pursley, J. R., M. R. Kosorok, and M. C. Wiltbank. 1997a. Reproductive management of lactating dairy cows using synchronization of ovulation. J. Dairy Sci. 80:301- 306.

Pursley, J. R., R. W. Silcox, and M. C. Wiltbank. 1998. Effect of time of artificial insemination on pregnancy rates, calving rates, pregnancy loss, and gender ratio after synchronization of ovulation in lactating dairy cows. J. Dairy Sci. 81:2139- 2144.

Pursley, J. R., M. C. Wiltbank, J. S. Stevenson, J. S. Ottobre, H. A. Garverick, and L. L. Anderson. 1997b. Pregnancy rates per artificial insemination for cows and heifers inseminated at a synchronized ovulation. J. Dairy Sci. 80:295-300.

Putney, D. J., M. Drost, and W. W. Thatcher. 1988a. Embryonic development in superovulated dairy cattle exposed to elevated ambient temperature between days 1 to 7 post insemination. Theriogenology 30:195–209.

Putney, D. J., M. Drost, and W. W. Thatcher. 1989. Influence of summer heat stress on pregnancy rates of lactating dairy cattle following embryo transfer or artificial insemination. Theriogenology 31:765–778.

Putney, D. J., J. R. Malayer, T. S. Gross, W. W. Thatcher, P. J. Hansen, and M. Drost. 1988b. Heat stress-induced alterations in the synthesis and secretion of proteins and prostaglandins by cultured bovine conceptuses and uterine endometrium. Biol. Reprod. 39:717-728.

Quin, J. D. 1992. The insulin-like growth factors. Quarterly J. Med. 298:81-90.

Quinn, P. J. 1985. A lipid-phase separation model of low-temperature damage to biological membranes. Cryobiology 29:255-266.

Rabiee, A. R., K. L. Macmillan, and F. Schwarzenberger. 2000. Effect of level of feed intake on plasma progesterone concentrations in desorelin-implanted dairy cows treated with a CIDR device. J. Anim. Sci. 78(Suppl.1):221. (Abstr.)

288

Rajaram, S., D. J. Baylink, and S. Mohan. 1997. Insulin-like growth factor-binding proteins in serum and other biological fluids: regulation and functions. Endocr. Rev. 18:801-831.

Ray, D. E., T. J. Halbach, and D. V. Armstrong. 1992. Season and lactation number effects on milk production and reproduction in dairy cattle in Arizona. J. Dairy Sci. 75:2976–2983.

Rechler, M. M., and S. P. Nissley. 1990. Insulin-like growth factors. Handbook Exp. Pharmacol. 95:263–281.

Reynaert, R., S. Marcus, M. De Paepe, and G. Peeters. 1976. Influences of stress, age, sex on serum growth hormone and free fatty acid levels in cattle. Horm. Metab. Res. 8:109-114.

Rhoads, R. P., J. W. Kim, B. J. Leury, L. H. Baumgard, N. Segoale, S. J. Frank, D. E. Bauman, and Y. R. Boisclair. 2004. Insulin increases the abundance of the growth hormone receptor in liver and adipose tissue of periparturient dairy cows. J. Nutr. 134:1020-1027.

Rinderknecht, E., and R. E. Humbel. 1978. The amino acid sequence of human insulin- like growth factor I and its structural homology with proinsulin. J. Biol. Chem. 253:2769-2776.

Roberts, A. J., R. A. Nugent, J. Klindt, and T. G. Jenkins. 1997. Circulating insulin-like growth factor I, insulin-like growth factor binding proteins, growth hormone, and resumption of oestrus in post-partum cows subjected to dietary energy restriction. J. Anim. Sci. 75:1909-1917.

Robinson, R. S., G. E. Mann, G. E. Lamming, and D. C. Wathes. 1999. The effect of pregnancy on the expression of uterine oxytocin, oestrogen and progesterone receptors during early pregnancy in the cow. J. Endocrinol. 160:21-33.

Robinson, R. S., G. E. Mann, G. E. Lamming, and D. C. Wathes. 2001. Expression of oxytocin, oestrogen and progesterone receptors in uterine biopsy samples throughout the oestrous cycle and early pregnancy in cows. Reproduction 122:965- 979.

Robinson, R. S., P. G. A. Pushpakumara, Z. Cheng, A. R. Peters, D. E. E. Abayasekara, and D. C. Wathes. 2002. Effects of dietary polyunsaturated fatty acids on ovarian and uterine function in lactating dairy cows. Reproduction 124:119-131.

Rocha, A., R. D. Randel, J. R. Broussard, J. M. Lim, R. M. Blair, J. D. Roussel, R. A. Godke, and W. Hansel. 1998. High environmental temperature and humidity decrease oocyte quality in Bos Taurus but not in Bos indicus cows. Theriogenology 49:657-665.

289

Roche, J. F., and M. D. Diskin. 2000. Resumption of reproductive activity in the early postpartum period of cows. In: Proceedings of Conference on ‘Fertility in the High Producing Dairy Cow’, Galway, Ireland.

Roche, F., and M. G. Diskin. 2001. Resumption of reproductive activity in the early postpartum period of cows. Brit. Soc. Anim. Sci. Occasional Publ. 26:31-42.

Roenfeldt, S. 1996. BST – extended calving intervals pay. Dairy Herd Management 33:36-40.

Rorie, R. W., T. R. Bilby, and T. D. Lester. 2002. Application of electronic estrus detection technologies to reproductive management of cattle. Theriogenology. 57: 137-148.

Rorie, R. W., C. F. Rosenkrans, and A. J. Aishman. 2004. Effects of bovine somatotropin treatment on A.I. pregnancy rate in dairy heifers. Reprod. Fertil. Dev. 16:132. (Abstr.)

Roth, Z., R. Meweidan, A. Shaham-Albalancy, R. Braw-Tal, and D. Wolfenson. 2001. Delayed effect of heat stress on steroid production in medium-size and preovulatory bovine follicles. Reproduction 121:745–751.

Rotwein, P., A. M. Gronowski, and M. J. Thomas. 1994. Rapid nuclear actions of growth hormone. Horm. Res. 42:170-175.

Russo, V. C., G. Rekaris, N. L. Baker, L. A. Bach, and G. A. Werther. 1999. Basic fibroblast growth factor induces proteolysis of secreted and cell membrane- associated insulin-like growth factor binding protein-2 in human neuroblastoma cells. Endocrinology 140:3082-3090.

Rutanen, E-M., and F. Pekonen. 1990. Insulin-like growth factors and their binding proteins. Acta Endocrinol. 123:7-13.

Rutledge, J. J., R. L. Monson, and D. L. Northey, M. L. Leibfried-Rutledge. 1999. Seasonality of cattle embryo production in a temperate region. Theriogenology 51(Suppl.1):330. (Abstr.)

Rutter, L. M., R. Snopek, and J. G. Manns. 1989. Serum concentrations of IGF-I in post-partum beef cows. J. Anim. Sci. 67:2060-2066.

Ryan, D. P., J. F. Prochard, E. Kopel, and R.A. Godke. 1993. Comparing early embryo mortality in dairy cows during hot and cold season of the year. Theriogenology 39:719–737.

Ryan, D. P., R. A. Spoon, and G. L. Williams. 1992. Ovarian follicular characteristics, embryo recovery, and embryo viability in heifers fed high fat diets and treated with follicle-stimulating hormone. J. Anim. Sci. 70:3505-3513.

290

Sagle, M., K. Bishop, N. Ridley, F. M. Alexander, M. Michel, R. C. Bonney, R. W. Beard, and S. Franks. 1988. Recurrent early miscarriage and polycystic ovaries. Brit. Med. J. 297:1027-1028.

Salamonsen, L. A., and J. K. Findlay. 1990. Immunocytochemical localization of prostaglandin synthase in the ovine uterus during the oestrous cycle and in early pregnancy. Reprod. Fertil. Dev. 2:311-319.

Sampath, H., and J. M. Ntambi. 2005. Polyunsaturated fatty acid regulation of genes of lipid metabolism. Annu. Rev. Nutr. 25:317-340.

Sangsritavong, S., D. K. Combs, R. Sartori, L. E. Armentano, and M. C. Wiltbank. 2002. High feed intake increases liver blood flow and metabolism of progesterone and estradiol-17 beta in dairy cattle. J. Dairy Sci. 85:2831-2842.

Sangsritavong, S., D. K. Combs, R. F. Sartori, and M. C. Wiltbank. 2000. Liver blood flow and steroid metabolism are increased by both acute feeding and hypertrophy of the digestive tract. J. Anim. Sci. 78(Suppl.1):221. (Abstr.)

Santos, J. E. P., S. O. Juchem, R. L. A. Cerri, K. N. Galvão, R. C. Chebel, W. W. Thatcher, C. S. Dei, and C. R. Bilby. 2004b. Effect of bST and reproductive management on reproductive performance of Holstein dairy cows. J. Dairy Sci. 87:868-881.

Santos, J. E. P., W. W. Thatcher, R. C. Chebel, R. L. A. Cerri, and K. N. Galvao. 2004a. The effect of embryonic death rates in cattle on the efficacy of estrus synchronization programs. Anim. Reprod. Sci. 82-83:513-535.

Santos, J. E. P., W. W. Thatcher, L. Pool, and M. W. Overton. 2001. Effect of human chorionic gonadotropin on luteal function and reproductive performance of high- producing lactating Holstein dairy cows. J. Anim. Sci. 79:2881-2894.

Sartori, R., G. J. Rosa, and M. C. Wiltbank. 2002a. Ovarian structures and circulating steroids in heifers and lactating cows in summer and lactating and dry cows in winter. J. Dairy Sci. 85:2813-22.

Sartori, R., R. Sartor-Bergfelt, S. A. Mertens, J. N. Guenther, J. J. Parish, and M. C. Wiltbank. 2002b. Fertilization and early embryonic development in heifers and lactating cows in summer and lactating and dry cows in winter. J. Dairy Sci. 85:2803-2812.

Scenna, F. N., J. L. Edwards, N. R. Rohrbach, M. E. Hockett, A. M. Saxton, and F. N. Schrick. 2004. Detrimental effects of prostaglandin F2alpha on preimplantation bovine embryos. Prostaglandins Other Lipid Mediat. 73:215-226.

Schedlich, L. J., T. F. Young, S. M. Firth, and R. C. Baxter. 1998. Insulin-like growth factor-binding protein (IGFBP)-3 and IGFBP-5 share a common nuclear transport pathway in T47D human breast carcinoma cells. J. Biol. Chem. 273:18347-18352.

291

Schillo, K. K. 1992. Effects of dietary energy on control of luteinizing hormone secretion in cattle and sheep. J. Anim. Sci. 70:1271-1282.

Schrick, F. N., M. E. Hockett, A. M. Saxton, M. J. Lewis, H. H. Dowlen, and S. P. Oliver. 2001. Influence of subclinical mastitis during early lactation on reproductive parameters. J. Dairy Sci. 84:1407–1412.

Scollan, N. D., M. Enser, S. K. Gulati, I. Richardson, and J. D. Wood. 2003. Effects of including a ruminally protected lipid supplement in the diet of fatty acid composition of beef muscle. Br. J. Nutr. 90:709-716.

Scott, T. A., R. D. Shaver, L. Zepeda, B. Yandell, and T. R. Smith. 1995. Effects of rumen-inert fat on lactation, reproduction, and health of high producing Holstein herds. J. Dairy Sci. 78:2435-2451.

Secchi, C., and V. Borromeo. 1997. Structure and function of bovine growth hormone: bovine growth hormone as an experimental model for studies of protein-protein interactions. J. Chromatogr. B 688:161-177.

Sepp-Lorenzino, L. 1998. Structure and function of the insulin-like growth factor I receptor. Breast Cancer Res. and Treatment 47:235-253.

Sessler, A. M., and J. M. Ntambi. 1998. Polyunsaturated fatty acid regulation of gene expression. J. Nutr. 128:923-926.

Shinitzky, M. 1984. Membrane fluidity and cellular functions. In: Shintzky M, editor. Physiology of membrane fluidity. Florida: CRC Press Inc. p 1-45.

Shipley, J. M., and D. J. Waxman. 2003. Down-regulation of STAT5b transcriptional activity by ligand-activated peroxisome proliferator-activated receptor (PPAR) α and PPAR γ. Mol. Pharmacol. 64:355-364.

Simopoulos, A. P. 1999. Essential fatty acids in health and chronic disease. Am. J. Clin. Nutr. 70:560-569.

Singh, K., D. G. Hartley, T. B. McFadden, and D. D. S. Mackenzie. 2004. Dietary fat regulates mammary stearoyl CoA desaturase expression and activity in lactating mice. J. Dairy Res. 71:1-6.

Skaar, T. C., R. R. Grummer, M. R. Dentine, and R. H. Stauffacher. 1989. Seasonal effects of prepartum and postpartum fat and niacin feeding on lactation performance and lipid metabolism. J. Dairy Sci. 72:2028-2038.

Sklan, D., M. Kaim, U. Moallem, and Y. Folman. 1994. Effect of dietary calcium soaps on milk yield, body weight, reproductive hormones, and fertility in first parity and older cows. J. Dairy Sci. 77:1652-1660.

292

Sklan, D., U. Moallem, and Y. Folman. 1991. Effect of feeding calcium soaps of fatty acids on production and reproductive responses in high producing lactating cows. J. Dairy Sci. 74:510-517.

Snijders, S. E., P. Dillon, D. O’Callaghan, and M. P. Boland. 2000. Effect of genetic merit, milk yield, body condition and lactation number on in vitro oocyte development in dairy cows. Theriogenology 53:981-989.

Son, J., J. Grant, and L. L. Larson. 1996. Effects of tallow and escape protein on lactational and reproductive performance of dairy cows. J. Dairy Sci. 79:822-830.

Soto, P., R. P. Natzke, and P. J. Hansen. 2003. Identification of possible mediators of embryonic mortality caused by mastitis: actions of lipopolysaccharide, prostaglandin F2α, and the nitric oxide generator, sodium nitroprusside dehydrate, on oocyte maturation and embryonic development in cattle. Am. J. Reprod. Immunol. 50:263-272.

Spencer, T. E., G. Allison, G. A. Johnson, K. M. Taylor, A. Gertler, E. Gootwine, T. L. Ott, and F. W. Bazer. 1999. Effects of recombinant ovine interferon tau, placental lactogen, and growth hormone on the ovine uterus. Biol. Reprod. 61:1409-1418.

Spencer, T. E., and F. W. Bazer. 1995. Temporal and spatial alterations in uterine estrogen receptor and progesterone receptor gene expression during the estrous cycle and early pregnancy in the ewe. Biol. Reprod. 53:1527-1543.

Spencer, T. E., W. C. Becker, P. George, M. A. Mirando, T. F. Ogle, and F. W. Bazer. 1995. Ovine interferon-tau regulates expression of endometrial receptors for estrogen and oxytocin, but not progesterone. Biol. Reprod. 53:732-745.

Spencer, T. E., T. L. Ott, and F. W. Bazer. 1998. Expression of interferon regulatory factors one and two in the ovine endometrium: effects of pregnancy and ovine interferon tau. Biol. Reprod. 58:1154-1162.

Spicer, L. J., E. Alpizar, and S. E. Echternkamp. 1993. Effects of insulin, insulin-like growth factor I, and gonadotropins on bovine granulosa cell proliferation, progesterone production, estradiol production, and (or) insulin-like growth factor I production in vitro. J. Anim. Sci. 71:1232-1241.

Spicer, L. J., and S. E. Echternkamp. 1995. The ovarian insulin and insulin-like growth factor system with an emphasis on domestic animals. Domest. Anim. Endocrinol. 12:223-45

Spicer, L. J., W. B. Tucker, and G. D. Adams. 1990. Insulin-like growth factor-I in dairy cows: relationships among energy balance, body condition, ovarian activity, and estrous behavior. J. Dairy Sci. 73:929-937.

293

Sreenan, J. M., M. G. Diskin, and D. G. Morris. 2001. Embryo survival rate in cattle: a major limitation to the achievement of high fertility. Brit. Soc. Anim. Sci. Occasional Publ. 26:93-104.

Staels, B., W. Koenig, and A. Habib. 1998. Activation of human aortic smooth-muscle cells is inhibited by PPARα but not by PPARγ activators. Nature 393:790-793.

Stanisiewski, E. P., L. F. Krabill, and J. W. Lauderdale. 1992. Milk yield, health, and reproduction of dairy cows given somatotropin (Somavubove) beginning early postpartum. J. Dairy Sci. 75:2149-2164.

Staples, C. R., J. M. Burke, and W. W. Thatcher. 1998. Influence of supplemental fats on reproductive tissues and performance of lactating cows. J. Dairy Sci. 81:856- 871.

Staples, C. R., W. W. Thatcher, and J. H. Clark. 1990. Relationship between ovarian activity and energy status during the early postpartum period of high producing dairy cows. J Dairy Sci. 1990 73:938-47.

Staples, C. R., M. C. Wiltbank, R. R. Grummer, J. Guenther, R. Sartori, F. J. Diaz, S. Bertics, R. Mattos, and W. W. Thatcher. 2000. Effect of long chain fatty acids on lactation performance and reproductive tissues of Holstein cows. J. Dairy Sci. 83(Suppl.1):278. (Abstr.)

Starbuck, G. R., A. O. Darwash, G. E. Mann, and G. E. Lamming. 2001. The detection and treatment of post insemination progesterone insufficiency in dairy cows. Brit. Soc. Anim. Sci. Occasional Publ. 26:447-450.

Stewart, D. M., G. A. Johnson, C. A. Vyhlidal, R. C. Burghardt, S. H. Safe, L. Y. Yu- Lee, F. W. Bazer, and T. E. Spencer. 2001. Interferon-tau activates multiple signal transducer and activator of transcription proteins and has complex effects on interferon responsive gene transcription in ovine endometrial epithelial cells. Endocrinology 142:98-107.

Stubbs, C. D., and A. D. Smith. 1984. The modification of mammalian membrane polyunsaturated fatty acid composition in relation to membrane fluidity and function. Biochem. Biophys. Acta. 779:89-137.

Sun, X. J., P. Rothenberg, and C. R. Kahn. 1991. Structure of the insulin receptor substrate IRS-1 defines a unique signal transduction protein. Nature 352:73-77.

Tamminga, S., P. A. Luteijn, and R. G. M. Meijer. 1997. Changes in composition and energy content of live weight loss in dairy cows with time after parturition. Livest. Prod. Sci. 52:31-38.

Teixeira, M. G., K. J. Austin, D. J. Perry, V. D. Dooley, G. A. Johnson, B. R. Francis, and T. R. Hansen. 1997. Bovine granulocyte chemotactic protein-2 is secreted by the endometrium in response to interferon-tau (IFN-tau). Endocrine 6:31-37.

294

Thatcher, W. W., F. W. Bazer, D. C. Sharp, and R. M. Roberts. 1986. Interrelationships between uterus and conceptus to maintain corpus luteum function in early pregnancy: sheep, cattle, pig and horses. J. Anim. Sci. 62:25-46.

Thatcher, W. W., A. Guzeloglu, R. Mattos, M. Binelli, T. R. Hansen, and J. K. Pru. 2001. Uterine-conceptus interactions and reproductive failure in cattle. Theriogenology 56:1435-50.

Thatcher, W. W., M. D. Meyer, and G. Danet-Desnoyers. 1995. Maternal recognition of pregnancy. J. Reprod. Fertil. Suppl. 49:15-28.

Thatcher, W. W., C. R. Staples, G. Danet-Desnoyers, B. Oldick, and E. P. Schmitt. 1994. Embryo health and mortality in sheep and cattle. J. Anim. Sci. 72(Suppl. 3):16-30.

Thatcher, W. W., D. Wolfenson, J. S. Curl, L. E. Rico, J. J. Knickerbocker, F. W. Bazer, and M. Drost. 1984. Prostaglandin dynamics associated with development of the bovine conceptus. Anim. Reprod. Sci. 7:149-176.

Thissen, J.-P., J.-M. Ketelslegers, and L. E. Underwood. 1994. Nutritional regulation of the insulin-like growth factors. Endocr. Rev. 15:80-101.

Thompson, J. A., D. D. Magee, M. A. Tomaszewski, D. L. Wilks, and R. H. Fourdraine. 1996. Management of summer infertility in Texas Holstein dairy cattle. Theriogenology 46:547–558.

Thurmond, M. C., J. P. Picanso, and C. M. Jameson. 1990. Considerations for use of descriptive epidemiology to investigate fetal loss in dairy cows. J. Am. Vet. Med. Assoc. 197:1305-1312.

Tocher, D. R., M. J. Leaver, and P. A. Hodgson. 1998. Recent developments in the molecular biology and biochemistry of fatty acyl desaturases. Prog. Lipid Res. 37:73-117.

Townson, D. H., P. C. W. Tsang, W. R. Butler, M. Frajblat, L. C. Griel, C. J. Johnson, R. A. Milvae, G. M. Niksic, and J. L. Pate. 2002. Relationship of fertility to ovarian follicular waves before breeding in dairy cows. J. Anim. Sci. 80:1053–1058.

Tuggle, C. K., and A. Trenkle. 1996. Control of growth hormone synthesis. Domest. Anim. Endocrinol. 13:1-33.

Tulppala, M., U. H. Stenman, B. Cacciatore, and O. Ylikorkala. 1993. Polycystic ovaries and levels of gonadotrophins and androgens in recurrent miscarriage: prospective study in 50 women. Brit. J. Obstet. Gynaecol. 100:348-352.

Vallet, J. L., P. J. Barker, G. E. Lamming, N. Skinner, and N. S. Huskisson. 1991. A low molecular weight endometrial secretory protein which is increased by ovine trophoblast protein-1 is a beta 2-microglofulin-like protein. J. Endcrinol. 130:R1- R4.

295

Van der Walt, J. G. 1994. Somatotropin physiology: a review. 1994. S. Afr. J. Anim. Sci. 24:1-9.

Vandehaar, M. J., B. K. Sharma, and R. L. Fogwell. 1995. Effect of dietary energy restriction on the expression of insulin-like growth factor-I in liver and corpus luteum of heifers. J. Dairy Sci. 78:832-841.

Vasconcelos, J. L. M., R. W. Silcox, J. A. Lacerda, J. R. Pursley, and M. C. Wiltbank. 1997. Pregnancy rate, pregnancy loss, and response to heat stress after AI at 2 different times from ovulation in dairy cows. Biol. Reprod. 56(Suppl.1):140. (Abstr.)

Vega, J. R., C. A. Gibson, T. C. Skaar, D. L. Hadsell, and C. R. Baumrucker. 1991. Insulin-like growth factor (IGF)-I and II and IGF binding proteins in serum and mammary secretions during the dry period and early lactation in dairy cows. J. Anim. Sci. 69:2538-2547.

Vicini, J. L., F. C. Buonomo, J. J. Veenhuizen, M. A. Miller, D. R. Clemmons, and R. J. Collier. 1991. Nutrient balance and stage of lactation affect responses of insulin, insulin-like growth factors I and II, and insulin-like growth factor-binding protein 2 to somatotropin administration in dairy cows. J. Nutr. 121:1656-1664.

Waterman, D. F., W. J. Silvia, R. W. Hemken, G. Heersche, Jr., T. S. Swenson, and R. G. Eggert. 1993. Effect of bovine somatotropin on reproductive function in lactating dairy cows. Theriogenology 40:1015-1028.

Waters, M. J., S. W. Rowlinson, R. W. Clarkson, C. Chen, P. E. Lobie, G. Norstedt, H. Mertani, G. Morel, R. Brinkworth, C. A. Wells, S. Bastiras, A. R. Robins, G. E. Muscat, and R. T. Barnard. 1994. Signal transduction by the growth hormone receptor. Proc. Soc. Exp. Biol. Med. 206:216-220.

Wathes, D. C., and M. Hamon. 1993. Localization of estradiol, progesterone and oxytocin receptors in the uterus during the estrous cycle and early pregnancy of the ewe. J. Endocrinol. 138:479-491.

Wathes, D. C., and G. E. Lamming. 1995. The oxytocin receptor, luteolysis and the maintenance of pregnancy. J. Reprod. Fertil. Suppl. 49:53-67.

Wathes, D.C., T. S. Reynolds, R. S. Robinson, and K. R. Stevenson. 1998. Role of the insulin-like growth factor system in uterine function and placental development in ruminants. J. Dairy Sci. 81:1778-1789.

White, M. F., and C. R. Kahn. 1994. The insulin signaling system. J. Biol. Chem. 269:1-4.

296

Wilcox, C. J., W. W. Thatcher, and F. G. Martin. 1990. Statistical analysis of repeated measurements in physiological experiments. In: Proceedings of the Final Research Co-ordination Meeting of the FAO/IAEA/ARACAL III Regional Network for Improving the Reproductive Management of Meat- and Milk-Producing Livestock in Latin America with the Aid of Radioimmunoassay. International Atomic Agency, Vienna 1990; 141 -145.

Wildman, E. E., G. M. Jones, P. E. Wagner, H. F. Troutt, and T. N. Lesch. 1982. A dairy cow body condition scoring system and its relationship to selected production characteristics. J. Dairy Sci. 65:495-501.

Wilkins, J. F., W. D. Hoffman, S. K. Larsson, B. A. Hamilton, D. W. Hennessy, and M. A. Hilard. 1996. Protected lipid/protein supplement improves synchrony of oestrous and conception rate in beef cows. Page 19-2 in Congress Programme of the 13th Int. Congr. Anim. Reprod., Sidney, New South Wales, Australia.

Wilkinson, J. I. D., and M. E. Tarrant. 1991. Fertility of cows receiving somidobove in European studies. J. Dairy Sci. 74(Suppl.1):P151. (Abstr.)

Williams, G. L. 1989. Modulation of luteal activity in postpartum beef cows through changes in dietary lipid. J. Anim. Sci. 67:785-793.

Williams, W. F., G. S. Lewis, W. W. Thatcher, and C. S. Underwood. 1983. Plasma 13,14-dihydro-15 keto PGF2α (PGFM) in pregnant and nonpregnant heifers prior to and during surgery and following intrauterine injection of PGF2α. Prostaglandins 25:891-899.

Willson, T. M., P. J. Brown, D. D. Sternbach, and B. R. Henke. 2000. The PPARs: from orphan receptors to drug discovery. J. Med. Chem. 43:527-550.

Wolfenson, D., F. F. Bartol, L. Badinga, C. M. Barros, D. N. Marple, K. Cummins, D. Wolfe, M. C. Lucy, T. E. Spencer, and W. W. Thatcher. 1993. Secretion of PGF2α and oxytocin during hyperthermia in cyclic and pregnant heifers. Theriogenology 39:1129-1141.

Wolfenson, D., B. J. Lew, W. W. Thatcher, Y. Graber, and R. Meidan. 1997. Seasonal and acute heat stress effects on steroid production by dominant follicles in cow. Anim. Reprod. Sci. 47:9–19.

Wolfenson, D., Z. Roth, and R. Meidan. 2000. Impaired reproduction in heat-stressed cattle: basic and applied aspects. Anim. Reprod. Sci. 60-61:535-47.

Xiao, C. W., J. M. Liu, J. Sirois, and A. K. Goff. 1998. Regulation of cycloxygenase and prostaglandin F synthase gene expression by steroid hormones and interferon- tau in bovine endometrial cells. Endocrinology 139:2293-2299.

Yaqoob, P., and P. C. Calder. 1995. The effect of dietary lipid manipulation on the production of murine T-cell derived cytokines. Cytokine 7:548-553.

297

Yaseen, M. A., C. Wrenzycki, D. Herrmann, J. W. Carnwath, and H. Niemann. 2001. Changes in the relative abundance of mRNA transcripts for insulin-like growth factor (IGF-I and IGF-II) ligands and their receptors (IGF-IR/IGF-IIR) in preimplantation bovine embryos derived from different in vitro systems. Reproduction 122:601-610.

Yelich, J. V., R. P. Wettemann, T. T. Marston, and L. J. Spicer. 1996. Luteinizing hormone, growth hormone, insulin-like growth factor-I, insulin and metabolites before puberty in heifers fed to gain at two rates. Domest. Anim. Endocrinol. 13:325-338.

Yung, M. C., M. J. VandeHaar, R. L. Fogwell, and B. K. Sharma. 1996. Effect of energy balance and somatotropin on insulin-like growth factor-I in serum and on weight and progesterone of corpus luteum in heifers. J. Anim. Sci. 74:2239-2244.

Zapf, J., and E. R. Froesch. 1986. Insulin-like growth factors/somatomedins: structure, secretion, biological actions and physiological role. Horm. Res. 24:121-130.

Zarco, L., G. H. Stabenfeldt, S. Basu, G. E. Bradford, and H. Kindahl. 1988. Modification of prostaglandin F-2α synthesis and release in the ewe during the initial establishment of pregnancy. J. Reprod. Fertil. 83:527-536.

Zeron, Y., A. Ocheretny, O. Kedar, A. Borochov, D. Sklan, and A. Arav. 2001. Seasonal changes in bovine fertility: relation to developmental competence of oocytes, membrane properties and fatty acid composition of follicles. Reproduction 121:447-454.

Zeron, Y., D. Sklan, and A. Arav. 2002. Effect of polyunsaturated fatty acid supplementation on biophysical parameters and chilling sensitivity of ewe oocytes. Mol. Reprod. Dev. 61:271-278.

Zhao, X., J. H. Burton, and B. W. McBride. 1992. Health and reproduction of dairy cows receiving daily injectable or sustained-release somatotropin. J. Dairy Sci. 75:3122-3130.

Zhou, Y., and D. J. Waxman. 1999. Cross-talk between janus kinase-signal transducer and activator of transcription (JAK-STAT) and peroxisome proliferator-activated recepetor-α (PPARα) signaling pathways. J. Biol. Chem. 274:2672-2681.

Zulu, V. C., T. Nakao, and Y. Sawamukai. 2002. Insulin-like growth factor-I as a possible hormonal mediator of nutritional regulation of reproduction in cattle. J. Vet. Med. Sci. 64:657-665.

BIOGRAPHICAL SKETCH

th Todd Bilby was born on April 15 , 1976. He is the younger of two children. He attended elementary and high school at North Andrew in Rosendale, Missouri. Todd went on to Northeastern Oklahoma A & M Junior College in Miami, Oklahoma and earned his associate’s degree in animal science in May 1996. He then transferred to

Oklahoma State University, where he received his bachelor’s degree in animal science

(with a minor in agricultural economics) in May 1999. Todd then received a teaching and research assistantship from the University of Arkansas (in Fayetteville) to study bovine and porcine embryology. In May 2001, Todd received his master’s degree in animal science, with an emphasis in reproductive physiology. Todd received a research assistantship from the University of Florida (in Gainesville) to pursue his doctoral degree with Dr. William W. Thatcher. After completing the requirements for a Doctor of

Philosophy degree, he will be working for Monsanto as an Area Market Manager in

Fresno, California.

298