NUP98-HOXD13 Gene Fusion in Therapy-Related Acute Myelogenous Leukemia1

(CANCER RESEARCH 58. 4269-4273. October I. 1998] Advances in Brief

NUP98-HOXD13 Gene Fusion in Therapy-related Acute Myelogenous Leukemia1

Samina Z. Raza-Egilmez, Sheila N. Jani-Sait, Mauro Grossi, Michael J. Higgins, Thomas B. Shows, and Peter D. Aplan2

Cancer Genetics /S.Z.R-E., M.J.H., T. B. S., P. D.A.I. Pediatrics Â¡M.G., P.D.AJ. Immunology [S. Z. R-E.Â¡, and Clinical Cylogenelics Â¡S.N.J-S.], Roswell Park Cancer Institute, Buffalo. NY 14263; anil Department af PediatrÃ¬eHematnlogy-Oncnlngy. Children's Hospital of Buffalo. NY 14222 Â¡M.G.. P. D. A.Â¡

Abstract ated with t-AML and t-MDS (5). t-AML and t-MDS arc malignancies that occur following treatment of a primary malignancy with cytotoxic A novel chromosomal translocation, t(2;ll)(q31;pl5), was identified in chemotherapcutic agents or ionizing radiation. As a first approxima a patient with therapy-related acute myelogenous leukemia (I-AMI.). tion, there seem to be two forms of t-AML, which can be distin Fluorescence in \iin hybridization experiments mapped the breakpoint guished by clinical and cytogenetic features. The first form is typified near NUP98; Southern blot analysis demonstrated that the nucleoporin by the therapeutic use of alkylating agents; a long (5-10-year) latency gene NUP98 was disrupted by this translocation. We used rapid amplifi cation of cDNA ends to identify a chimi-rie iiiKN A. An in-frame, chimeric period, often associated with a preceding myelodysplastic phase; and mRNA that fused NVP98 sequences to the homeobox gene HOXD13 was the loss of chromosome 5 or 7 material. The second form is associated cloned; the predicted fusion protein contains both the GLFG repeats from with the use of topoisomerase II inhibitor, a short (<24-month) NUP98 as well as the homeodomain from HOXD13. The NUP98-HOXD13 latency period, and balanced translocations involving either the MLL fusion is structurally similar to the NVP98-HOXA9 fusion previously or AMLl gene (6). The speculation that these t-AMLs are caused by identified in patients with AML, leading to the speculation that NUP98- chromosomal aberrations induced by cytotoxic, DNA-damaging homeobox gene fusions may be oncogenic. Moreover, this report, along chemotherapy is strengthened by the observation that both Eloposide with a recent study that demonstrated NUP98-DDX10 fusions in patients with I-AMI,, raises the possibility that NVP98 may be a previously un (a topoisomerase II inhibitor) and Melphalan (an alkylating agent) can suspected target for chromosomal translocations in patients with t-AMI .. induce frequent gross chromosomal abnormalities, such as transloca tions, inversions, and deletions, in peripheral blood leukocytes (7, 8). Here, we describe the characterization of a novel chromosomal trans- Introduction location, a t(2;l I)(q31:pl5.5), which occurred in a patient with t-MDS that progressed to t-AML. Nonrandom, recurrent, chromosomal aberrations such as transloca tions and inversions are frequently associated with a wide spectrum of hematological malignancies and are generally thought to be causal Materials and Methods events in the process of leukemic transformation ( 1). In general, these FISH. Cytogenetic analysis of bone marrow cells was performed in ac translocations or inversions are thought to be oncogenic either through cordance with standard techniques, as described previously (9). Fixed cells the activation of a latent proto-oncogene [such as activation of c-mvc stored at â€”¿20Â°Cwere used for FISH studies with previously mapped PAC by the t(8:14) translocation] or through the generation of a chimeric clones from 1Ipl5.5 (Fig. IA), as described previously (9, 10). oncoprotein, such as the bcr-abl protein produced by the 1(9:22) Nucleic Acid Isolation. In accordance with institute guidelines, informed consent to participate in research studies was obtained from the patient's translocation (1). The identification of the genes involved in these chromosomal aberrations, as well as characterization of the fusion parents. Leukemic blasts were isolated from the bone marrow of patient 229 by proteins produced, has proven to be a valuable starling point for Ficoll-Hypaque (Sigma Chemical Co.) density centrifugaron. Genomic DNA was isolated using a salting-out technique, as described previously (11). Total understanding the process of leukemic transformation. NUP98 is a Mr 98,000 component of the NPC.3 NUP98 is localized at the nucleo- RNA was isolated using Trizol reagent (Life Technologies, Inc.) and the manufacturer's recommended protocol. Plasmid DNA was isolated using Qia- plasmic side of the NPC and is involved in the transport of RNA and gen reagents and protocols. protein between the cytoplasm and nucleus (2). Recently, NUP98 has Southern Blots and Probes. Ten ^tg of genomic DNA were digested with been reported to be involved in a rare but recurrent chromosomal the indicated restriction en/.yme (Life Technologies. Inc.). si/e-fractionated on translocation, t(7;l I)(pl5pl5.5) (3, 4), as well as a chromosomal 0.8% agarose gels containing I /xg/ml ethidium bromide, photographed, de inversion, inv(l I)(pl5.5;q31) (5). The t(7;ll) fuses NUP98 in-frame natured, neutralized, and transferred to nitrocellulose membranes (Schleicher to a homeobox gene (HOXA9). whereas the inv(l I)(pl5.5:q31) fuses & Schuell) by the Southern technique (12). Southern blots were hybridized to 12P-labeled probes labeled by the random priming technique using Prime-It II NUP98 to DDXÃŒO.a putative RNA helicase gene. Both of these (Stratagene) reagents and protocols. Oligonucleotides were labeled using a chromosomal aberrations involving NUP98 were recognized in pa terminal deoxynucleotidyl transf'erase end-labeling technique, and hybridiza tients with AML. Moreover, the inv(l I)(pl5.5;q31) has been associ- tion was performed as described previously (13). The probes used were a 1.4-kb tfindIII-Â£rÂ»RV NUP98 cDNA fragment (nucleotides 1249-2628 of Received 6/22/98: accepted 8/17/98. GenBank accession no. U41815; a kind gift of Dr. Julian Borrow, Center for The costs of publication of this article were defrayed in part hy the payment of page Cancer Research. MIT. Cambridge. MA), a 0.3-kb Mlul-BamHl ETV6 cDNA charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. probe (nucleotides 813-1142 of GenBank accession no. Ul 1732), and selected 1Supported in part by the Roswell Park Alliance Foundation and NIH Grants synthetic oligonucleotides. CAI6056, CA73773. and CA63333. P. D. A. is a scholar of the Leukemia Society of 3'-RACE. 3' RACE was performed using reagents from Lite Technolo America. 2 To whom requests for reprints should be addressed, at Department of Pediatrics. gies, Inc., and a modified protocol. Briefly, first strand cDNA was synthesized Roswell Park Cancer Institute, Buffalo, NY 14263. Phone: (716)845-5773; Fax: from 1 /Â¿gof total RNA using either an oligo(dT) AP (.V-GGCCACGCGTC- (716)845-4502; E-mail: [email protected]. GACTAGTAcrrrrrrrrrrrrrrriT-3') or a randomAPIS'-GGC- 3 The abbreviations used are: NPC. nuclear pore complex; AML. acute myelogenous CACGCGTCGACTAGTACNNNNNN-3'). An aliquot of the first strand leukemia: t-AML. therapy-related AML; t-MDS. therapy-related myclodysplastic syn cDNA was then amplified using a /VÃ•/TOS-specificforward primer (5'-TG- drome: FISH, fluorescence in situ hybridization: RACE, rapid amplification of cDNA GAGGGCCTCTTGGTACAGG-3': nucleotides 1461-1481 of GenBank ac- ends; AP. adapter primer. 4269

telnmere II 111

Fig. I. A, map of chromosome Ilpl5.5 in the region of the translocation (modified from Ref. 10). Ordered markers and the loca tion of PAC clones used as probes (/I73KI and 47C3) are indicated. Arrow, region of the breakpoint. B. FISH mapping with the l I73K1 probe. Metaphase spreads from cells with the t(2;l 1) were hybridized to the 1173K1 probe. Small arrowhead, the normal chromosome 11; larxe iirriwheatl, the derivative 11. C, FISH mapping with the 47G3 probe. Metaphase spreads from cells with the 1(2;11) were hybridized to the 47G3 probe. Small arrowhead, the normal chromosome 11: large arrowhead, the derivative 2.

cession no. U41815) and an abridged universal AP (5'-GGCCACGCGTC- Results GACTAGTAC-.V) as the reverse primer. A "hot start" was used by adding the Taq polymerase after a 3-min incubation at 80Â°C;35 PCR cycles of 94Â°Cfor Case Report. The patient developed B-cell precursor acute lym- 1 min, 60Â°Cfor 45 s, and 72Â°Cfor 2 min were used, followed by a terminal phoblastic leukemia at 4 years of age. Cytogenetic analysis at that 10-min extension at 72Â°C.The PCR products were analyzed by agarose gel time revealed a normal 46, XY karyotype. He did not have central electrophoresis and subcloned into either the pGEMR-T or pGEMR-T Easy nervous system involvement at initial diagnosis, and he received standard induction therapy consisting of vincristine, prednisone, L- vector (Promega). asparaginase, and "triple" intrathecal therapy (hydrocortisone, me- Nucleotide Sequence Analysis. Nucleotide sequencing was performed on a Perkin-Elmer ABI PRISM Model 373A Stretch Automated Sequencer at the thotrexate, and 1-ÃŸ-D-arabinofuranosylcytosine). Consolidation and Roswell Park Cancer Institute Biopolymer facility. Oligonucleotides were maintenance therapies lasted 2.5 years and consisted of intermediate- synthesized on an Applied Biosystems oligonucleotide synthesizer at the above dose methotrexate and methotrexate with 6-mercaptopurine, respec facility. tively. The patient was in continuous complete remission for 3 years, 4270

Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 1998 American Association for Cancer Research. NUPW-HOXÃ›13 IN t-AML until he developed an isolated epidural relapse 6 months after cessa tion of therapy. At that time, he was again treated with vincristine, prednisone, and L-asparaginase, as well as 24 Gy of craniospinal IECUU)co^M^CI^o irradiation. He received continuation therapy, consisting of high-dose 1-ÃŸ-D-arabinofuranosylcytosine,etoposide, vincristine, L-asparagi oLU nase, cyclophosphamide, and doxorubicin. Because of religious be liefs that precluded the transfusion of blood products, he was treated with recombinant erythropoietin and granulocyte colony-stimulating factor following each course of chemotherapy. He completed a 2-year o> O) O) course of therapy and again did well until isolated thrombocytopenia evi evi evi evi O CM Ãœ evi evi Ãœ was noted 9 months after he went off therapy; this progressed, and the o patient was noted to be pancytopenic 13 months after completion of therapy. A bone marrow aspiration and biopsy at that time was 23- consistent with a diagnosis of refractory anemia with excess blasts. Cytogenetic analysis at that time revealed a balanced t(2;l I)(q31;pl5) translocation. The myelodysplastic syndrome progressed to AML (M6 9.6- variant) within 3 months, and a successful remission was induced with 1-ÃŸ-D-arabinofuranosylcytosine,etoposide, and mitoxantrone, fol 6.4- lowed by consolidation with an allogeneic bone marrow transplant. FISH Analysis. We used a set of previously characterizedchro 4.4- mosome 1Ipl5.5 probes (9, 10) to localize the t(2;l 1) breakpoint. Fig. 1 demonstrates that the 1173K1 probe hybridized to the derivative 11 chromosome and the normal 11, whereas the 47G3 probe hybridized to the derivative 2 and the normal 11 (Fig. 1). Additionally, two more telomeric 1Ipl5.5 probes (74K15 and 915F1; Ref. 10) also mapped to the derivative 11 (data not shown). These findings placed the break 2.3_ point between 1173K1 and 47G3. Because the 1173K1 mapped quite 2.0- close to NUP98 and NUP98 was known to be translocated in other AML cases, NUP98 was an obvious candidate gene for this translo cation. NUP98 Rearrangement. To investigate whether NUP98 was dis B rupted by this translocation, we searched for genomic DNA rearrange BamHI BamHI ments within the NUP98 locus by Southern blot hybridization to the 1.4-kb Hindlll-EcoRV NUP98 cDNA probe. As seen in Fig. 2A, non-germ-line-sized fragments are present in genomic DNA digested with multiple different restriction enzymes, suggesting a genomic DNA rearrangement had occurred within the NUP98 gene, most likely due to a chromosomal translocation. To rule out the possibility that the non-germ-line-sized bands were due to a polymorphism, as well as to investigate whether the NUP98 rearrangement was present in the initial leukemia, we searched for NUP98 rearrangements in genomic DNA from the original B-cell precursor leukemia, genomic DNA from the t-AML, and genomic DNA from a remission sample obtained after treatment of the t-AML. In addition, because the initial leukemia had an ETV6-AMLI translo cation, we were able to determine whether the initial leukemia had evolved into an AML, through a lineage shift of the initial leukemic 4.4 â€”¿ clone. Fig. IB shows that the ETV6 rearrangement was present in the initial leukemia but not the t-AML or the remission sample. Similarly, the NUP98 rearrangement was present in the t-AML but not the initial leukemia nor the remission sample, demonstrating that the NUP98 rearrangement was not due to a polymorphism or to a lineage shift of 2.3 â€”¿ the initial leukemia. 2.0 â€”¿ Detection of a Fusion Transcript in the t-AML Sample. We used 3' RACE to search for a NUP98 fusion transcript in RNA Probe: ETV6 Probe: NUP98 from the t-AML sample. Because the previously reported NUP98 fusion transcripts (3-5) join NUP98 exons to HOXA9 or DDX10 Fig. 2. A, Soulhern blot hybridized lo Ihe 1.4-kh NUPW Hind\ll-Eti>RV cDNA probe. exons at either nucleotide 1552 or 1864 of the NUP98 cDNA The restriction enzymes used are indicated above the lanes. 229. patient DNA; C. control DNA from a lymphoblastoid cell line. Size standards are in kb. Rearranged fragments are (GenBank accession no. U41815) in a head-to-tail fashion, we seen in all four lanes containing patient DNA. B, comparison of primary acute lympho- reasoned that the t(2;ll) may produce a NUP98 fusion transcript blastic leukemia and t-AML. Lanes 1-4. Southern blot of fiiimHI-digcsled DNA from with a similar fusion point. We used two complementary 3' RACE indicated patient samples or control lymphoblastoid DNA (O hybridi/ed to the ETV6 Mlu\-BanM\ cDNA probe. Lanes 5-8. the identical Southern blot was stripped and approaches to clone the NUP98 fusion transcript. For one set of rehybridized to the NUP98 H/ndlll-EcoRV cDNA probe. Size standards are in kb. experiments, we used an oligo(dT) tailed AP and a JVWPS-specific Non-germ-line sized fragments are evident in Lane\ 2 and 7. 4271

Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 1998 American Association for Cancer Research. NUP9K-HOXDI.ÃŒIN I-AML primer (5'-TGGAGGGCCTCTTGGTACAGG-3') complementary Table 1 Translocations involving nucleoporin genes to NUP98 nucleotides 1461-1481. However, if the fusion tran Translocation1(2:1 geneNUP9S geneHOXDI3 script encoded a very large RNA, we realized that this approach 1)q3l:pl5.5> may not be successful if the reverse transcriptase had to reverse t(7;ll)(pl5:pl5) NUP98 HOXA9 AML and 4 transcribe a large segment prior to reaching the NUP98 fusion inv(ll(pl5:q22) NUP98 DDX10 De novo and t-AML/MDS 5 point. Therefore, a second set of 3' RACE experiments used a t(6;9)(p23;q34) NUP214 DEK AML 21 t(4;ll(q21:pl5.5p)NPC NUP98PartnerUnknownDiseaset-AMLAMLRefs.3 22 random hexamer AP and the same yVW9Â£-specificprimer. Both approaches were performed with templates from patient RNA, as well as three control cell lines (HEL, K562, and Molt4) that did not have a t(2;l 1) translocation: both approaches yielded PCR prod consensus polyadenylation signal (AATAAA) located 23 nucleotides upstream of the poly(A) tail; the 0.5-kb clones did not have a poly ucts that hybridized to NUP98 probes. adenylation signal and were generated by fortuitous annealing of the PCR products from the oligo(dT) primed experiment were sub- AP to a complementary sequence within the HOXD13 3'-untranslated cloned into the pGEMR-T Easy vector. Twenty-five clones that hy bridized to a nested, internal oligonucleotide 5' of the predicted region. We were unable to amplify a potential reciprocal HOXDI3- breakpoint (5'-GCCACTTTGGGCTTTGGAGC-3'; complementary NUP98 fusion transcript; this result is not surprising in light of the to NUP98 nucleotides 1516-1525) were evaluated. None of these observation that the HOXD13 promoter is not normally active in clones hybridized to a NUP98 probe 3' of the predicted breakpoint hematopoietic cells (14). (5'-AGAAGTTGGTTTrGAAGAACC-3'), suggesting that none of Discussion these clones represented germ-line NUP98 clones. We analyzed six independent subclones; these fell into two classes, with either a 0.5- or This report demonstrates that NUP98 is fused to HOXDI3 in a 1.6-kb insert. We sequenced one clone from each class; both clones novel t(2;11)(q31;p15)seen in a patient with t-AML. Because this was diverged from NUP98 germ-line sequences at nucleotide 1552 of the sole cytogenetic abnormality seen in this t-AML sample, we GenBank accession no. U41815, precisely where the NUP98-HOXA9 suspect that the NUP98-HOXD13 fusion was a causal event in this fusion occurs (Fig. 3A). The sequence 3' of the fusion in each case disease. The fusion transcript is composed of the 5' region of the was a perfect match for the human HOXD13, which maps to human NUP98 gene fused in frame to exon 2 and the 3' untranslated region chromosome 2q31: we did not detect a NUP98-HOXD13 fusion of the HOXD13 gene. The NUP98-HOXD13 fusion transcript is fused among the PCR products from three control cell lines (HEL, K562, at the same NUP98 exon as NUP98-HOXA9 and NUP98-DDX10 and Molt4). Therefore, the t(2;l I)(q31;pl5) generated a specific fu fusions, suggesting the existence of a breakpoint cluster region within sion mRNA between NUP98 and HOXD13. The 1.6-kb clones had a the NUP98 gene (14-16).

CCCCAGGCCCCAGTAGCTTTTGACAGATCC NUP98 PQAPVACDRS

CCCCAQGCCCCAGTAGGGGATGTGGCTCTA NUP98/HOXD13 PQAPVGDVAL

CTTTTGTTTGTATCAGGGGATGTGGCTCTA HOXD13 Fig. 3. A NUP98-HOXDIJ fusion cDNA. The germ-line NUP9X nucleotide sequence is shown (lupi LLFVSGDVAL in holdfiict' rvpt1. The germ-line HOXDI3 sequence (hotlum) and the fusion cDNA (middle) are also shown. The fusion between NUP9X and HOXDI3 occurs be B tween two Gs (nntlrrlineil). The amino acids encoded are shown below the nucleotide sequence. B, schematic diagram of wild-type proteins and deduced chimeric NUP98 protein. Arrm-s. fusion point of NUP98 and HOXD1J. Regions that correspond to structural and functional GLFG GLFG RNA bind domains of the proteins are also shown: GLFG, GLFG repeats: RNA hind. RNA-binding domain (^): HD. homeodomain (B); and HOXDIÃŒexon 1 (H).

NUP98/HOXD13

HOXD13

HD 4272

BOX genes encode a large family of transcription factors contain 2. Radu. A.. Moore. M. S., and Blobel, G. The peptide repeat domain of nucleoporin ing a conserved DNA-binding homeobox domain (14, 15). HOX NUP98 functions as a docking sile in transport across the nuclear pore complex. Cell. 81: 215-222. 1995. genes are important for a wide spectrum of developmental events, 3. Borrow. J., Shearman, A. M.. Stanton. V. P.. Jr.. Becher. R.. Collins. T.. Williams, including axial patterning and hematopoiesis (14, 16). Most of the A. J.. Dube, I.. Katz. F.. Kwong. Y. L.. Morris. C.. Ohyashiki, K.. Toyama, K., mammalian HOX genes are found in four conserved clusters (HOX A, Rowley. J.. and Houseman. D. E. The 1(7:11)(pl5;pl 5) translocation in acute myeloid B, C, and D); a minority of mammalian HOX genes (such as HOX 11) leukemia fuses the genes for nucleoporin NUP98 and class 1 homeoprotein HOXA9. are "orphans" that are located outside of one of the principal clusters Nat. Genet.. 12: 159-167, 1996. 4. Nakamura. T.. Largaespada. D. A.. Lee, M. P.. Johnson. L. A.. Ohyashiki. K.. (14). Members of the HOX A, B, and C clusters are normally ex Toyama. K.. Chen. S. J.. Willman. C. L.. Chen. 1. M.. Feinberg. A. P.. Jenkins, N. A., pressed during distinct stages of hematopoietic differentiation. In Copeland. N. G.. and Shaughnessy. J. D. Fusion of the nucieoporin gene NUP9K to HOXA9 by the chromosomal translocation 1(7:11Hpl5:pl5l in human myeloid leu contrast, with the exception of HOXD3 expression in the erythroleukemia. Nat. Genet.. 12: 154-158, 1996. kemia cell line HEL (17), HOX D cluster genes are not normally 5. Yasuhito. A.. Hosoda, F., Kohayashi. H.. Kyoko. A.. Hayashi. Y.. Nanao. K.. Kaneko. expressed during hematopoietic development (16). Several homeobox Y.. and Ohki. M. The inv(l I)(pl5.5:q31 )(pl5.5:q31 Xpl5;cj22). chromosome translocation of de novo and therapy-related myeloid malignancies results in fusion of the genes, including HOXA9, HOX11, and PBXl, are known to be in nucleoporin gene. NUP98. with the putative RNA helicase. DDX10. Blood, 89: volved in recurrent, nonrandom chromosomal translocations associ 3936-3944. 1997. ated with lymphoid and myeloid malignancies (3, 4, 18, 19). 6. Smith. M. A.. Rubinstein. L., and Ungerleider, R. S. Therapy-related acute myeloid The predicted NUP98-HOXD13 fusion protein (illustrated in Fig. leukemia following treatment with epipodophyllotoxins: estimating the risks. Med. Pediatr. Oncol., 23: 86-98. 1994. 3ÃŸ)retains the conserved GLFG repeats OÃ•NUP98,which are thought 7. Maraschin. J., Dutrillaux, B., and Aurias. A. Chromosome aberrations induced by to function as docking sites for karyopherin b at the nuclear pore (20). etoposide are not random. Int. J. Cancer. 46: 808-812. 1990. The HOXD13 portion of the predicted fusion protein retains the 8. Mamuris. Z.. Prieur, M.. Dutrillaux. B.. and Aurias. A. The chemotherapcutic drug Melphalan induces breakage of chromosome regions rearranged in secondary leuke homeobox domain, which is a helix-turn-helix DNA-binding domain. mia. Cancer Genet. Cytogenet., 37: 65-77, 1989. Therefore, the putative fusion protein retains the ability to bind both 9. Sait, S. N. J., Nowak, N. J.. Singh-Kahlon. P.. Weksberg. R.. Squire. J.. Shows. T. B.. DNA as well as any transcription factors that bind to the homeodo- and Higgins. M. J. Localization of Beckwith-Wiedemann and rhabdoid tumor chro mosome rearrangements to a defined interval in chromosome band 1Ipl5.5. Genes main. Chromosomes Cancer, //: 97-105, 1994. It is not clear how a NUP98-HOXDÃŒ3fusion protein might con 10. Reid, L. H., Davies. C.. Cooper. P. R.. Cridermiller. S. J.. Sait. S. N. J.. Nowak, N. J. tribute to leukemogenesis. The NUP98 portion of the fusion protein Evans. G., Stanbridge. E. J.. DeJong. P.. Shows. T. B.. Weissman. B. E.. and Higgins, does not retain the RNA-binding domain OÃ•NUP98,which is replaced M. J. A I-Mb physical map and pac contig of the imprinted domain in I Ipl5.5 that contains tapal and the bwscrl/wt2 region. Genomics. 43: 366-375. 1997. by HOXDI3. Therefore, aberrant RNA transport could be responsible 11. Miller. S. A., Dykes, D. O.. and Polesky, H. F. A simple salting out procedure for for oncogenesis. Alternatively, the localization of HOXD13 as part of extracting DNA from human nucleated cells. Nucleic Acids Res.. 16: 1215, a NUP98-HOXDÃŒ3fusion protein at the nuclear pore might act as a 1988. trap for homeobox-binding transcription factors that normally bind 12. Davis, L. G.. Dibner, M. D.. and Battey. J. F. Basic methods in molecular biology. New York: Elsevier. 1986. HOXDI3, resulting in their sequestration at the nuclear membrane. Of 13. Ausubel. F. M.. Brent. R.. Kingston, R. E.. Moore. D. D.. Seudman, J. G., Smith. note, the erythroleukemia cell line HEL (17) demonstrates overex- J. A., and Sir uhi. K. Current Protocols in Molecular Biology. Vol. 1. New York: John Wiley & Sons. 1995. pression of HOXD3, raising the possibility that dysregulation of 14. Scott. M. P. Vertebrate homeobox gene nomenclature. Cell. 71: 551-553. 1992. HOXD family members may be generally associated with a subset of 15. Carroll. S. B. Homeotic genes and the evolution of arthropods and ehordates. Nature erythroleukemias. (Lond.), 376: 479-485, 1995. A number of themes regarding NUP98 translocations are under 16. Thorsleindottir, U., Sauvageau. G.. and Humphries. R. K. HOX homeobox genes as regulators of normal and leukemic hematopoiesis. Hematol. Oncol. Clin. North Am.. scored by this report. First, this is now the second form of NUP98 //.â€¢1221-1237, 1997. translocation associated with t-MDS or t-AML, suggesting that the 17. Taniguchi. Y.. Komatsu. N.. and Moriuchi. T. Overexpression of HOX4A (HOXD3) NUP98 locus, like MLL and AMLI, may be a target for nonrandom homeobox gene in human erythroleukemia HEL cells results in altered adhesive properties. Blood. 85: 2786-2794. 1995. chromosomal translocations or inversions occurring as a result of 18. Hatano. M., Roberts. C. W., Minden, M.. Crist. W. M., and Korsmeyer. S. J. cytotoxic chemotherapy. Second, there are now at least five examples Deregulation of a homeobox gene, by the 1(10:14) in T cell leukemia. Science (Table 1) of translocations involving NPC genes in association with (Washington DC), 253: 79-82, 1991. 19. Kamps. M. P.. Murre. C.. Sun. X. H., and Baltimore. D. A new homeobox gÃ¨ne acute leukemia. Last, this is the second example of a translocation contributes the DNA binding domain of the t(l;19) translocation protein in prc-B fusing NUP98 to a HOX gene, suggesting that both NUP98 and the ALL. Cell, 60: 547-555. 1990. homeobox domains are important for malignant transformation. 20. Moroiannu. J.. Hijikala. M.. Blobel. G.. and Radu. A. Mammalian karyopherin alb and a2b heterodimers: a! or a2 subunil binds nuclear localization signal and b subunit Acknowledgments interacts with peptide repeat-containing nucleoporins. Proc. Nati. Acad. Sci. USA. 92: 6332-6536. 1995. We thank Drs. Carolyn Felix, Harish Ahuja. and Alex Dobrovic for helpful 21. von Lindern. M., Poustka. A.. Lerach. H.. and Grosveld. G. The translocation (6:91. associated with a specific subtype of acule myeloid leukemia, results in the fusion of discussions and Elaina Greco for artwork. a chimaeric. leukemia-specific deli-can mRNA. Mol. Cell. Biol.. 12: 1687-1697. References 1992. 22. Dobrovic. A., Hussey. D.. and Sage. R. E. NUP9H is the gene at the chromosome 11 1. Rabbilt, T. H. Chromosomal translocations in human cancer. Nature (Lond.), 372: breakpoint of the translocation t(4; 11)(q2l ;pl5.5) in a patient with acute lymphocylic 143-149. 1994. leukemia. Blood. 90 (Suppl.): 3l8a. 1997.

4273

Samina Z. Raza-Egilmez, Sheila N. Jani-Sait, Mauro Grossi, et al.

Cancer Res 1998;58:4269-4273.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/58/19/4269

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/58/19/4269. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.