Biogeography and Population Genetics of the Lake Malawi Cichlid

MEC658.fm Page 1013 Thursday, June 10, 1999 11:48 AM

Molecular Ecology (1999) 8, 1013–1026

Blackwell Science, Ltod geography and population genetics of the Lake Malawi cichlid Melanochromis auratus: habitat transience, philopatry and speciation

JEFFREY A. MARKERT,* MATTHEW E. ARNEGARD,† PATRICK D. DANLEY* and THOMAS D. KOCHER* *Department of Zoology, University of New Hampshire, Durham NH 03824, USA, †Field of Neurobiology and Behavior, Cornell University, Ithaca, NY 14853, USA

Abstract Migration rates among nine populations of the endemic Lake Malawi cichlid Melano- chromis auratus were estimated along a 42-km stretch of habitat in the southern end of the lake. Allele frequencies were surveyed at four simple sequence repeat (SSR) loci. The data suggest migration rates among populations are quite low. Exact tests indicate that statistically detectable allele frequency differences exist between many adjacent popu-

lations in the study. The FST value among all populations was estimated to be 0.151 (P < 0.0002). A biogeographic survey suggests that the highest levels of genetic differentiation exist between populations separated by stretches of deep water. Migration is more common between populations separated by shallower water or with shoreline dispersal routes. Reduced allelic diversity was observed at more recently created habitat patches, suggesting that either bottlenecks are associated with the colonization of new habitat patches or that these shallower sites were all founded by genetically depauperate ances- tral populations. The extreme philopatry of M. auratus, coupled with the patchy distribution and transient nature of its preferred habitat, provides opportunities for both selection and genetic drift to produce genetic differentiation among populations. Both processes may be important to the evolution of taxonomic diversity in the East African cichlid species ﬂocks. Keywords: biogeography, cichlids, Lake Malawi, Mbuna, microsatellites, migration Received 5 August 1998; revision received 22 January 1999; accepted 22 January 1999

Introduction (see Boulenger (1915) for early citations), many explanations for the rapid evolution of taxonomic diversity have The flocks of endemic fish species in the East African been suggested. Proposed explanations include selective Great Lakes are well known examples of ‘explosive’ mating and brood care (Kosswig 1947), adaptation to cladogenesis (Greenwood 1964). The fishes of Lake changes in habitat arising from lake level dynamics Malawi are a dramatic example, with an estimated 500 (Trewavas 1947), adaptation to a postulated diversity of endemic species, virtually all of which are in the Teleost habitats resulting from the sheer size of the lakes (Jackson family Cichlidae (Ribbink et al. 1983). This extraordin- 1955), restricted migration due to predation (Fryer 1965) ary taxonomic diversity has fascinated and challenged and microadaptation to fragmented habitats (Fryer 1959a, evolutionary biologists since the earliest description of b). The most recent synthetic model was proposed by the rift valley lakes by European naturalists and explorers Dominey (1984) who suggested that a combination of in the 19th century (Günther 1864). extremely low gene flow among populations, coupled Since the first formal description of the Rift Valley taxa with sexual selection, could lead to the fixation of distinct mate recognition systems (sensu Patterson (1985)) within Correspondence: J. A. Markert. Fax: +01-603-862 3784; E-mail: local populations. [email protected] Most of these models stress the importance of selection

MEC658.fm Page 1014 Thursday, June 10, 1999 11:48 AM

1014 J . A. MAR KE RT E T A L.

Fig. 1 Habitat distribution along the shores of the Nankumba Peninsula. (a) The peninsula divides the southern end of Lake Malawi into two shallow basins. The shaded area represents parts Mumbo Island of the lake which are > 200 m deep (adapted from Owen et al. 1990). (b) The b distribution of rocky habitats along the shores of the peninsula and the location of sites from which fish were sampled. IIaIa Gap (c) A schematic diagram showing the 5 km typical arrangement of rocky habitat along the shoreline. Rocks and boulders d e (stippled) slope away from the shore, y e v r eventually intersecting the flatter sandy u S 50 km lake bottom (checks) When water levels t Mvunguti SE o Nankumba Peninsula N Tsano Rock are high (solid line) mbuna can use the rocks as habitat. Periodic recessions in Harbour Island lake level can destroy this habitat (dashed line). Increases in water level can completely submerge some rocky Rocky areas, making the site inhospitable to Shore obligate rock-dwelling fishes with shallow depth preferences.

Sandy Beach Mazinzi Reef c

Shallow Reef Scattered Boulders, Cobbles Nkhudzi Hills

Mphande Island

to the evolution of lineage divergence. However, selective feature of the physical environment. The extent and distri- forces must overcome the effects of gene flow between bution of sandy and rocky habitats is influenced by diverging gene pools or local adaptations will not develop. the rapid and dramatic changes in water level which are It is important to assess both the spatial scale of genetic typical in Lake Malawi (Fryer 1959a; McKaye & Gray differentiation and identify the physical features of the 1984; Scholz & Rosendahl 1988; Owen et al. 1990). Fluctu- environment that constrain population differentiation ations in water level occur on both geological and historical if we are to evaluate models proposed to explain the time scales. Owen et al. (1990) document three climatically rapid evolution of taxonomic diversity in the Lake controlled late-Pleistocene decreases in water level, the Malawi cichlid species flock. most recent of which occurred between the years 1500 Many Malawi cichlids have a high level of habitat fidel- and 1850. During this period, water levels were at least ity which, in combination with the patchy distribution of 121 m below their present level, and the two southern habitat types, could contribute to the evolution of lineage basins were mostly dry land. divergence. The shoreline is a mosaic of habitat types Decreased rainfall can lead to the loss of rocky habitats with rocky stretches existing as habitat islands separated when water levels fall below the rock–sand interface by long stretches of sandy or weedy substrate (McKaye (Fig. 1). Increases in water level can open newly flooded & Gray 1984). Rocky habitats also exist along the shores habitat patches for colonization and can alter the nature of several small islands and as completely submerged of existing habitat patches by increasing their depth. offshore rocky outcrops. The configuration of substrate Variation in water levels can unite previously isolated types along the shores of Lake Malawi is not a fixed habitat patches or subdivide continuous stretches of

MEC658.fm Page 1015 Thursday, June 10, 1999 11:48 AM

BI OGE OGR A PHY OF A MA L AWI C IC H LID 1015

habitat, depending on local topography (see McKaye & 1983). Similar to most other mbuna, they are almost never Gray (1984) or Ribbink et al. (1983)). observed over a sandy substrate. The rocky areas are the primary habitat for a well- studied guild of small, brightly coloured fish known Study area collectively as mbuna (Fryer 1959a). The lithophilic nature of most mbuna, combined with the patchy distribution M. auratus were sampled from areas in the proximity of of rocky habitats within Lake Malawi, form a system in the Nankumba Peninsula which divides the southern end which the development of interpopulation genetic hetero- of Lake Malawi into two shallow basins (Fig. 1). Mbuna geneity (a probable precondition for lineage splitting) habitats in this vicinity are probably quite young. Much may be explored. Early genetic data suggested that of the southern end of Lake Malawi was dry land migration rates among mbuna populations might be very between the years 1500 and 1850 when lake levels are low. McKaye et al. (1984) found evidence of genetic differ- estimated to have been 121 m lower than they are now entiation at some allozyme loci among four populations (Owen et al. 1990), providing an upper boundary to the of the widely distributed Pseudotropheus zebra. Bowers et age of populations at most habitats. al. (1994) found differences in mitochondrial DNA haplo- The steeply sloping rocky habitats adjacent to the type frequencies between populations in the southern shores of the Nankumba Peninsula all intersect the flatter, end of the lake for two different species in the mbuna sandy lake bottom (Fig. 1c). The depth of this present-day genus Melanochromis. The recent availability of simple rock–sand interface should determine the order in which sequence repeat (SSR) loci (Tautz 1989) with their high sites became available for colonization as the southern allelic diversity provides a tool with the resolution basins refilled (Table 1). Deeper habitats became avail- needed to detect fine-scale population differentiation able first while the shallower habitats became available among recently established populations. more recently (See Ribbink et al. 1983; McKaye & Gray Recently, van Oppen et al. (1997) have used SSR loci to 1984; and Fig. 1 for details of this process). detect population structure in several mbuna species The study area ranges from Mumbo Island (to the across very small gaps at more stable rocky habitats near north and west of the peninsula) to Mphande Island (to Nkhata Bay on the western shore of Lake Malawi. The the south and east) (Fig. 1b). Fish were sampled from newly flooded rocky habitats in the southern end of the waters adjacent to both these islands, several habitats lake, many of which are less than 200-years old, provide adjacent to the eastern shore of the peninsula itself, and an opportunity to further explore the spatial and tem- two submerged offshore rocky ‘reefs’. Divers assessed the poral scale of population structure in Malawi Cichlids. We depth of the rock–sand interface at each site. The length combine fine-scale population sampling with a detailed of each habitat and the distances between habitats were survey of habitat distribution and an analysis of allele estimated with the aid of a global positioning system frequencies at SSR loci to evaluate the influence of (GPS) receiver and nautical maps (Tripp et al. 1957; biogeographic forces on population structure in the Malawi Government 1977). rock-dwelling Malawi cichlid Melanochromis auratus. Sample collection Materials and methods A total of 368 individual M. auratus was sampled at nine sites in southern Lake Malawi. Sample sizes at each locality Study species are shown in Table 2; the mean number of fish sampled/ Melanochromis auratus (Boulenger 1897) is an easily recog- site is 41. Sample sizes at these sites, many of which are nizable species that is widely distributed in the southern within the boundaries of Lake Malawi National Park, were end of Lake Malawi. It is a small (4−9 cm), sexually restricted under the conditions of our collecting permit. dimorphic fish. Females have a bright yellow ground col- Fish were captured by SCUBA divers using monofila- our with black or dark-brown horizontal stripes. Males ment nets. Divers usually worked within 50 m of each are slightly larger than females and have a dark-brown other to avoid possible complications from the Wahlund or blue/black ground colour with yellow-gold stripes effect. An exception was made at the site designated (Bowers 1993). Unlike many other mbuna species in the Shallow Reef where fish were collected from two exposed vicinity of the Nankumba Peninsula, M. auratus shows rocky ledges ≈ 800 m apart, at either end of a sprawling little systematic variation in colour pattern from locality aggregation of rocky habitats in a sand and gravel matrix to locality, although slight intrapopulation variation in generally 100−300 m from shore. This was necessary due colour intensity is common. They are most common at to the relatively low densities of M. auratus at these sites. depths between 1.5 and 10 m, although their full range Tissue for this study consisted of fin clips (≈ 0.5–1 cm2) extends from the surface to a depth of 40 m (Ribbink et al. obtained from one of the unpaired fins (for fish collected

MEC658.fm Page 1016 Thursday, June 10, 1999 11:48 AM

1016 J . A. MA R KE R T E T A L.

Table 1 A description of collection localities along the Nakumba Peninsula. Habitat depth is deﬁned as the depth of the rock–sand interface

Depth of Collection site habitat (m) Habitat description

Harbour Island 30 Large boulders with some gravel and cobbles. Continuous with shoreline habitat. Ilala Gap 36 A shoreline habitat composed primarily of large rounded boulders. Fish were collected just south of the channel between the peninsula and Domwe Island. Mazinzi Reef 13 An isolated and submerged rocky outcrop about 3 km from shore. The total habitat area is an estimated 20 000 m2 in area and is composed of all size-classes of rocky substrate. The highest point of this structure is 3 m below the lake surface. Mphande Island 4 An isolated shallow habitat along the lakeward side of Mphande Island consisting of sedimented cobbles, small (< 1 m diameter) boulders and some large (> 3 m) boulders at the rock/sand interface. Mumbo Island 46 An isolated habitat about 6.5 km west of the Nankumba Peninsula. Habitat at this site is primarily large rocks although some sand and gravel patches are present. Mvunguti—SE 36 A heterogeneous habitat composed of all sizes of rocky substrate. Nkhudzi Point 11 A heterogeneous habitat composed of all sizes of rocks in addition to patches of gravel and sand. Shallow Reef 3 The substrate at this sprawling site is a sand/gravel matrix with many small patches of rocky habitat. The gravel ﬁeld extends approximately 0.4 km from shore along at least one transect. Two large rocky ledges are found nearshore. Tsano Rock 32 The substrate in the vicinity is primarily rocky, lightly sedimented in sheltered areas, with small patches of sand and gravel in the shallow areas.

in Lake Malawi National Park) or from pectoral fins. Fish Scoring and binning of alleles collected in Lake Malawi National Park were clipped and released. Fish from other sites were preserved as voucher GeneScan Analysis software (Applied Biosystems, Foster specimens. The fin tissue was preserved in 70−100% City, California, USA) provides highly repeatable estimates EtOH (undenatured), and the samples were then stored of fragment size. Because of differences in base-pair at c. −15 °C pending transport to the USA. composition between ABI’s GeneScan-500 size standard and the PCR products, these estimates were almost never integers. In order to determine fragment homology, frag- Locus isolation and characterization ment size estimates at each locus were sorted by size and Two of the loci used in this work (UNH-001 and UNH- ‘binned’ into allele size estimates that typically differed 002) were used previously by Kellogg et al. (1995) for by 2 bp. Allele size estimates were sorted by size and paternity analysis. These and two additional loci, UNH- ranked. These rank scores were then plotted against allele 050 and UNH-231, were isolated using methods size to provide a visual representation of the bins. If bin described by Lee & Kocher (1996). All four loci are limits were ambiguous, individuals at both extremes of perfect dinucleotide repeats. Locus 231 was cloned from that bin and from neighbouring bins were re-run on a Oreochromis niloticus and the remaining loci were single gel. developed from an M. auratus library. Primer sequences, GenBank accession numbers, and fragment size ranges Detection of null alleles are provided in Table 3. The possibility of ‘null’ alleles (alleles that cannot be visu- alized due to mutations in the PCR primer site) complic- DNA preparation and amplification ates the analysis of SSR data. The frequency of these DNA samples were extracted and amplified using alleles can be quite high (see Lehman et al. (1996) and the methods outlined in Kellogg et al. (1995). Optimal Allen et al. (1995) for recent examples). In their survey of PCR conditions were determined empirically. UNH-001, populations of several Pseudotropheus species from Lake UNH-050 and UNH-231 were usually amplified by 25 Malawi, van Oppen et al. (1997) reported that a true cycles of 94 °C (0:20), 56 °C (0:45), 72 °C (0:45). For breeding null allele is present at locus UNH-002 in some locus UNH-002 an annealing temperature of 54 °C was of the mbuna species they studied. substituted and 30 thermal cycles were used. Fragment To estimate the frequency of null alleles in our data set, size ranges are listed in Table 3. Samples were electro- individuals for which PCR products could be generated phoresed on a 6% denaturing acrylamide gel at 30 W for at only three of the four loci after two or more attempts 8.25 h using an ABI 373A DNA sequencer. were provisionally assumed to be homozygous for a

MEC658.fm Page 1017 Thursday, June 10, 1999 11:48 AM

BI OGE OGR A PHY OF A MAL AWI C I C H LI D 1017 ...... s s s s s s s s s S ...... I F n n n n n n n n n l l 9 9 0 5 0 1 9 0 4 u 0 0 0 0 1 3 1 0 1 ...... N 0 0 0 0 0 0 0 0 0 2 6 6 5 4 1 3 0 6 1 6 3 6 5 5 9 7 3 E 9 8 8 8 7 7 7 5 6 ......

; H 0 0 0 0 0 0 0 0 0 y t i s 5 1 7 2 0 9 7 3 o 1 1 5 9 0 8 4 9 1 7 g O 9 8 8 9 7 8 4 6 5 y ...... z H 0 0 0 0 0 0 0 0 0 o r e t 0 6 2 1 5 9 7 8 7 e 2 9 7 7 9 7 1 2 6 ...... h

e 0 6 5 6 3 3 4 2 2 d n 1 e 1 t 3 c 2

e s - f e p o l

H x . e e l o

N l 0 2 9 2 4 8 7 7 0 = .

U N A 2 1 1 1 1 o E r H e

...... ; z

s s s s s s s s s S y ...... I t F n n n n n n n n n m i s o r o f

g l l e 4 5 7 2 8 7 2 6 y 1 l u 0 1 0 2 0 1 1 0 0 z ...... b o N 0 0 0 0 0 0 0 0 0 a r h e t s i e 6 7 4 1 6 2 7 2 1 u h

6 9 5 3 5 2 7 7 2 g E 8 8 6 4 8 7 3 8 7 d n ...... i e H 0 0 0 0 0 0 0 0 0 t v s r i e d

s 5 6 7 9 5 5 5 3 5 y b 9 9 5 1 8 7 8 3 6 l o t O 8 8 7 4 7 6 3 8 7

...... n = H 0 0 0 0 0 0 0 0 0

a c O ﬁ H i

2 1 2 4 3 8 9 3 6 ; n 0 8 8 7 6 4 5 1 4 s e ...... g e n 7 8 2 1 6 3 1 6 3 i l s 0 e

5 l e l 0 r

s a - f

a e

f o l

H y o . e

l e o r N l 4 3 7 6 0 0 3 9 8 h e t U N A 1 1 1 1

b n m e u 2 4 h ...... 3 7 n

w s s s s s s s S 3 3

...... I . . e y F n n n 0 n 0 n n n v l i t n c o l

e l f 5 0 6 6 5 5 0 8 4 d f u 1 1 1 1 0 1 1 1 1 e e ......

t N 0 0 0 0 0 0 0 0 0 r =

o e p n

e ; 8 9 5 7 6 5 9 7 4 r 7 0 0 3 6 0 0 9 6

n E e 8 9 8 3 7 9 4 3 5 o ...... r i t H 0 0 0 0 0 0 0 0 0 a

a l s e u 9 1 7 2 3 3 9 3 4 u p l 0 2 6 9 1 3 5 0 1 o a O 8 8 7 2 5 8 2 3 5 p ...... v

H 0 0 0 0 0 0 0 0 0 S a I

n F n

i ; o

8 0 2 9 7 8 8 4 5 i n d t 6 0 9 4 0 5 6 6 2 ...... o e a i e 7 0 4 1 4 7 1 1 2 l t v n 1 r a u l 2 e 0 s p u 0 b

o p s - f o o e p

o l

s H p . e

e d l l o a N l

7 3 2 5 6 0 5 8 6 n e l U N A 1 1 1 1 n a l i

a s

y f c u o 2

c n ...... 9 r e o s s s s s s s s S 1 e ...... I l . u

b F n n n 0 n n n n n q h e m c r f u a l

l n e 4 2 3 7 9 8 3 5 e 1

l u l 1 0 1 1 1 0 1 2 2 r ...... e a l N 0 0 0 0 0 0 0 0 0 t o l f o a

l s l c = 1 1 0 2 9 2 1 3 6

u i 9 5 9 5 1 3 4 8 7 s t n E 7 8 7 6 7 8 7 6 5

e s ...... l i e 0 0 0 0 0 0 0 0 0 H t e h l a l t

t f A s

o 2 6 7 8 1 9 7 1 3 f

y 7 5 6 2 8 2 3 9 1 o e

r O t 7 8 7 5 4 8 6 6 3 ...... a a o 0 0 0 0 0 0 0 0 0 H m N m i

t ; s e 0 2 4 1 9 3 1 5 1 m t e 6 3 6 8 3 5 4 0 3 i

e u ...... s s d 4 6 4 2 3 5 3 3 2 n

/ 1 o d 0 d o e 0

n h s l - f i a e l p

o l e

H . e e m k l o i N l z a l 2 5 5 2 0 8 2 9 . 1 i

s t 1 1 1 1 1 1 1 U N A s

n m h e a s l u c 4 5 2 5 6 4 8 7 7 ﬁ p

ﬁ m 5 5 1 3 3 7 3 2 3 N f i i o n m x

g a r a i k

S s i m c

b t e

i t

o r p i a u d z 2 o

m o a

u R z

w g n d

n b u

e o = n o G a d d d n o t

u i

l l n = b l f f l

m h n n n u

z n n l a h . r . b i e e l a a a a = v a p u a a u k s

E l l l e e a a o . . h s s l s s N n M S N P S R T N T H I I M R M I M I

MEC658.fm Page 1018 Thursday, June 10, 1999 11:48 AM

1018 J . A. M AR KE R T E T A L.

Table 3 Information on the four simple sequence loci

GenBank Annealing Fragment size Total no. Average Locus Primer sequences Accession no. temperature range (bp) of alleles heterozygosity

UNH-001 GATTAACTCTGTCCCTGTCT U17044 56 °C 157–243 30 0.650 CTGAAGTGTTAAAAATATTGTT UNH-002 TTATCCCAACTTGCAACTCTATTT U17045 54 °C 175–236 24 0.549 TCCATTTCCTGATCTAACGACAAG UNH-050 GTCATCCCACTCACTAACAT AF036714 56 °C 292–364 21 0.707 AGAACAAACACAGGAAACTAT UNH-231 GCCTATTAGTCAAAGCGT G12382 56 °C 192–253 27 0.777 ATTTCTGCAAAAGTTTTCC

null allele. These frequencies were used to estimate the for generating the global array of alleles present at these frequency of the null allele in each population using the loci (but see Farrall & Weeks 1998), it seems likely that the maximum-likelihood algorithm in genepop 3.1 (Goudet allele frequency distributions observed in the sampled 1995). Heterozygote deﬁciency was estimated using the populations are the result of recent historical sampling score test (Rousset & Raymond 1995) of genepop to esti- processes rather than postdivergence mutation, given the

mate FIS values and their signiﬁcance level. extremely recent origin of the habitats in the area surveyed (Owen et al. 1990). The mutation-based statistic (δµ)2 is therefore included for comparison only and is Estimators of between-population heterogeneity not intended to represent a reliable index of genetic The statistical signiﬁcance of interpopulation allele fre- differentiation. quency differences was determined by using exact tests An analysis of isolation by distance was conducted by

in Raymond & Rousset’s (1995) genepop package which regressing log10M, where M = 1/4((1/FST) − 1) against follows the methods described in Rousset & Raymond log10 distance following Slatkin (1993). The statistical (1995). Estimates of population heterozygosity, allele signiﬁcance of the relationship between distance and

frequencies and F-statistics were estimated with the aid the parameter FST/(1 − FST) was estimated by using the of Goudet’s (1995) program fstat. This package estimates Mantel test in genepop 3.1. F-statistics using the method of Weir & Cockerham (1984) and calculates confidence intervals for these estimates using a resampling algorithm which permits permuta- Linkage disequilibrium and locus correlation tion among loci, alleles, and populations. To determine whether the four loci surveyed represent Two sets of FST calculations were performed. The first independent samples of the M. auratus genome, genepop estimated the overall FST among all populations. The was used to perform Fisher’s exact test under a null second set estimated pairwise FST values for all pairs of hypothesis of no association between genotypes at dif- populations. Confidence intervals were estimated for FST ferent loci. estimates between adjacent populations and between the To test whether there was a concordance in FST estim- two terminal populations by performing 5000 resampl- ates at all four loci, a matrix of Pearson product moment ings for the overall FST estimate and 2000 resamplings for correlations and their significance levels was calculated each of the pairwise comparisons. for all pairwise FST estimates. Barton & Slatkin’s (1985) rare allele based estimate of

Nm was calculated using genepop 3.1 (Raymond & Rousset 1995). This divergence estimator should be less sensitive Results than Weir & Cockerham’s (1984) FST to biases which result from the relative youth of the populations surveyed. 2 Distribution of habitats Pairwise Nei’s Distance (DN) and (δµ) were calculated for all pairs of populations using the program microsat Habitat depth estimates and brief habitat descriptions are [version 1.4d] (Minch et al. 1995–96). Nei’s distance was reported in Table 1. Collection sites and habitat distribu- determined to be a more appropriate measure of diver- tion are shown in Fig. 1b. In general, the deepest habitats gence between these populations than (δµ)2 (Goldstein surveyed are at sites in the north and west of the sam- et al. 1995) which assumes a single step mutation model pled area, whereas the shallower sites are in the south for SSR loci. Although evidence is accumulating which and east. A description of the intervening substrate indicates that stepwise mutation is probably responsible between collection sites is shown in Table 4.

B IOGE OGRA PHY OF A MAL A WI C IC H L I D 1019 3 7 1 6 6 8 2 3 4 2 3 9 2 5 7 5 4 0 7 9 9 1 0 9 1 ) 0 3 6 4 3 7 3 2 3 2 3 0 ...... µ 0 1 0 0 0 1 9 0 6 6 6 1 ∂ . ( — 1 1 0

f 1 o

3 1 1 1 1 1 1 0 4 6 4 . 0 2 t 0 0 0 0 0 0 6 3 6 5 3 i - 0 0 0 0 0 0 5 5 1 4 1 r 0 0 0 0 0 0 1 2 9 1 9 H c 0 0 0 0 0 0 0 8 5 0 0 - ...... N 0 0 0 0 0 0 P 0 0 0 0 0

— U < < < < < < d e 0 t 5 c 1 1 1 1 1 1 1 0 8 0 2 0 e 0 0 0 0 0 0 0 9 2 0 1 - r 0 0 0 0 0 0 0 1 5 3 3 r 0 0 0 0 0 0 0 8 6 0 0 H o 0 0 0 0 0 0 0 3 6 0 0 ...... c N 0 0 0 0 0 0 0 0 0 0 0

i — U < < < < < < < n o 2 r 0 1 1 1 1 1 1 1 r 2 8 4 8 0 0 0 0 0 0 0 0 1 7 0 9 e s - f 0 0 0 0 0 0 0 4 1 0 3 e 0 0 0 0 0 0 0 3 0 0 2 n H u 0 0 0 0 0 0 0 2 7 0 0 l o ...... N a 0 0 0 0 0 0 0 0 0 0 0 B v

— U < < < < < < < - a P

1 t w s 0 1 1 1 1 1 6 6 6 0 4 8 e 0 o 0 0 0 0 0 9 1 6 2 1 8 t l -

0 0 0 0 0 4 5 1 0 3 3 t e 0 0 0 0 0 1 0 6 0 1 3 c H b 0 0 0 0 0 0 0 0 0 0 0 a ......

N x 0 0 0 0 0 s 0 0 0 0 0 0 — U < < < < < E e u l . a 7 6 2 3 0 4 0 1 2 1 9 a m 6 4 5 8 1 8 5 8 3 7 1 v ......

3 4 n 4 5 4 1 2 1 0 1 5 N e c n 0

a ≤ 2 5 5 5 5 5 5 5 0 c

T 0 0 0 0 0 0 0 0 1 ﬁ S . . . 0 0 0 0 0 0 0 0 0 i F s s s 0 0 0 0 0 0 0 0 0

...... n 0 0 0 n n 0 0 0 n 0 0 0 P g i s ) ) ) ) ) ) ) ) ) )

) ) t

7 3 1 4 3 2 4 1 3 9 1 1

s s ) 1 1 6 1 1 0 3 1 8 7 1 3 d e u n 0 0 0 0 0 0 0 0 0 0 0 0 ...... t r . c o

0 0 0 0 0 0 0 0 0 0 0 a 0 i o t ( ( ( ( ( ( ( ( ( ( ( t ( l

c a 1 8 0 5 3 9 5 6 8 8 4 r 3 i n a

5 5 4 1 1 2 9 1 5 0 0 1 u v a T x t 1 0 1 0 0 0 0 1 0 1 3 1 e S o ...... s E 0 0 0 0 0 0 0 0 0 0 0 0 ( d F F

. s 1 n 3 o i 2 t - a 7 0 3 4 2 8 0 0 2 3 0 0 l H 4 8 3 0 3 0 2 0 5 7 6 1 u N 1 0 1 0 0 0 0 0 0 1 1 0 ...... p 0 0 0 0 0 0 0 0 0 0 0 0 U o p

0 l 5 a 0 - n i 0 4 5 0 0 0 7 8 7 5 3 6 H 6 3 0 0 0 2 5 4 4 3 7 4 m N 1 0 2 0 0 0 4 1 1 1 0 3 r ...... s e 0 0 0 0 0 0 0 0 0 0 0 0 U e t t

a d 2 m 0 n i 0 t a - s

, e 1 7 8 0 0 8 5 1 2 4 7 t

2 H

9 5 1 0 0 2 0 2 7 1 2 1 T n N 1 0 0 0 0 0 4 1 1 1 0 0 S e ...... F c 0 0 0 0 0 0 0 0 0 0 0 0 U

s a j u 1 d c 0 o a l 0

- y e l l 1 5 3 5 5 7 9 4 8 9 0 3 H r g 4 9 4 6 5 3 0 7 6 8 0 0 a n N 1 0 0 0 0 0 2 0 0 0 0 0 i ...... e 0 0 S 0 0 0 0 0 0 0 0 0 0 U n

, t ) ) ) ) 9 ) ) ) ) ) 2 ) ) n

9 9 7 4 3 2 5 1 3 5 1 e d 1 1 0 0 9 1 1 2 2 0 3 c

...... r a 0 0 0 0 0 0 0 0 0 0 0 a j D ( ( ( ( ( ( ( ( ( ( (

) d d s r 5 6 4 6 8 1 4 5 7 3 5 ’ n a i 5 1 0 2 7 9 6 3 0 2 3 o a

r e t 2 0 0 2 7 7 3 3 3 0 4 ...... r n s — 0 0 0 N 0 2 0 0 0 0 0 0 ( e e e

e e w t ) t d

k k k u e p e a a a n t

g l l l e m

a b

n e

y r y y y 0 k t y u d y d n 5 d a

d d s d l v d 3 e e n

o n y b n n e

e n i m y n a n n a y a a k

u n t M ~ i i n a s a a s

i s s

c l l i s

s l t a

, s l , , ,

B e e t o n

2 i r r

n a r r e

g r r r t s

g a a e e

r a e e y

, > t n o o a t y t t n n s i o e ( i

e e d d a a o

h h a a a e t l n k h s s c n n n n b r

a w s w i i e e

w e n w w

a a

l l

e m m m m y y

y o y v n g o f e e y l m n n o o o o p p r k k k l d d f r r a n d t t t t e e e k e e i l e c c c a t t t t M t a n n o o l n c t

p p l e e o o o i o o o o d h a a t h a h h o n

O D — R R R D A S S O S s V s s b c a b r b b I c i t ) e

m n

n k e e n o ( c i g

e t

s n e f c t a e t o n w l 4 4 1 9 7 6 7 8 8 0 6 i

s t ...... l i s o e 2 0 8 0 3 7 7 2 6 5 5 o r 4 1 — D b c p o t

a o — — d d d — — — n t t d s t m e d d n n d d i — a — — e n n n a a n n n f n t f f f t i i f f s l l — i n n i a i a a — e s e e e s s e e T l o o s l a a l l o s E

I I e e k l l e e

s e e k r s s l

E P P n P S I s s c l — I I

P R

n e e

R e R

R R I I i i o

a o

r p o i r r p i i o

i t d d z z 4 z d t i a o o u a R z z

u u R z w g t w w n n u d d

a d

n b b o l n n c e o o o G n a a n o o G n o u u i i o

l u i

l l l e u b u b b l o k h h l l m m

l z z n u a h n z n r a h r r l c b l a p l a a a p p a a e a v u u a a k k a a k m o a o a a h s o r h h s l l S M N N M M I T H M A p I M N M H R M T a S M T H S C

1020 J . A . M AR KE R T E T A L. 3 0 . 9 0 6 5 0 . 9 0 4 6 2 0 0 . 7 . 0 4 0 2 5 2 4 3 0 0 0 0 0 . . . 5 . . 0 0 0 4 0 0 2 4 4 2 3 0 0 0 0 0 . . . 0 4 . . 0 0 0 8 4 0 0 2 1 0 0 9 . 2 . 7 0 4 0 1 1 0 1 6 2 0 0 2 0 3 0 6 . 1 . . . . . 7 0 4 0 0 0 0 0 2 3 5 1 1 3 0 0 0 0 0 0 . . . 5 0 . . . 0 0 0 7 4 0 0 0 4 1 9 0 1 1 2 5 8 1 0 0 1 1 0 0 1 0 0 0 . . . . . 4 9 . 3 . . . . 0 0 0 0 0 7 3 0 4 0 0 0 0 2 3 1 1 3 4 3 0 0 0 0 0 0 0 . . 3 8 0 . . . . . 0 0 7 3 4 0 0 0 0 0 8 4 1 7 1 3 1 1 2 0 0 0 0 0 0 0 0 . . . . 0 2 7 9 . . . . 0 0 0 0 1 7 3 3 0 0 0 0 2 1 3 9 1 2 1 3 1 6 3 1 0 0 1 0 0 0 0 0 0 0 0 0 ...... 9 1 . 6 7 . . . 0 0 0 0 0 0 0 0 9 7 0 3 3 0 0 0 7 3 5 3 1 3 2 0 5 5 4 6 2 1 1 0 3 1 1 1 0 1 0 1 1 0 0 0 0 1 0 1 0 0 0 0 0 0 3 1 ...... 8 0 . 5 . . 6 ...... 0 0 0 0 0 0 0 0 0 0 9 7 0 3 0 0 3 0 0 0 0 0 0 0 2 3 1 4 2 2 1 3 4 1 2 6 2 0 0 0 0 0 0 0 0 0 0 0 0 0 . . . . . 7 . . 9 . . 4 . 5 . . . 0 0 0 0 0 9 0 0 6 0 0 3 0 3 0 0 0 6 3 8 7 2 2 2 2 2 3 1 4 6 4 6 3 8 7 1 3 1 1 2 5 2 0 0 0 0 0 0 0 0 0 0 2 1 1 0 0 1 0 1 0 2 0 0 0 0 0 ...... 6 . . . 8 . . . 3 . 4 ...... 0 0 0 0 0 0 0 0 0 0 0 0 9 0 0 0 6 0 0 0 3 0 3 0 0 0 0 0 0 3 4 1 3 3 5 4 4 1 3 8 8 8 4 6 4 4 6 7 1 5 3 0 0 0 0 0 0 1 0 0 1 0 1 0 1 0 0 ...... 5 . . . . 7 . . 2 . 3 . 0 0 0 0 0 0 0 0 0 0 0 9 0 0 0 0 6 0 0 3 0 3 0 0 4 0 7 7 4 3 2 4 7 7 4 9 8 2 1 0 1 1 7 5 9 2 3 7 7 1 5 4 5 6 0 2 0 0 1 5 0 0 1 0 0 3 0 3 5 0 0 1 2 0 1 1 0 0 1 0 0 ...... 6 . . 1 . 2 . . 4 . 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 0 0 3 0 3 0 0 9 0 9 4 3 1 2 4 1 6 7 1 4 7 6 4 5 0 3 2 9 1 4 1 0 0 0 0 0 6 8 7 7 0 0 0 2 1 2 3 0 0 0 0 0 0 ...... 5 . . 0 . 1 . . 3 . 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 0 0 3 0 3 0 0 9 0 4 2 4 2 2 3 8 1 8 1 4 1 2 3 2 9 8 4 6 3 1 1 1 5 6 2 0 0 4 0 2 1 0 0 1 0 0 1 0 0 0 0 0 0 ...... 4 . 9 0 . . 2 . 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 0 2 3 0 0 9 0 i c 1 7 6 2 2 5 0 5 4 4 1 0 9 1 5 1 8 3 7 3 2 0 0 0 0 0 1 1 0 0 0 0 5 1 0 0 0 0 0 1 0 0 o ...... 3 . 8 . 9 . 1 . l

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 0 2 0 2 0 9 0 t a e 7 2 9 2 6 3 3 4 4 5 7 0 4 1 6 9 9 5 1 5 1 0 1 4 3 p 2 2 0 0 0 0 2 3 0 3 1 2 0 0 1 0 1 1 2 0 0 4 0 0 0 ...... 2 . 7 . 8 . . 0 . e 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 0 2 0 2 0 0 9 0 r

e c 8 3 1 2 4 3 8 6 4 7 0 3 9 4 5 1 1 9 6 8 0 0 0 0 0 0 0 0 1 1 2 1 1 0 1 0 0 0 0 1 n ...... 1 . 6 . 7 . . 9 . e 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 0 2 0 2 0 0 8 0 u q 1 4 7 1 9 1 1 3 9 4 2 0 1 4 2 2 e 0 0 0 0 0 0 0 1 0 0 0 1 0 2 1 0 s ...... 9 . 5 . 6 . . 8 .

0 0 0 0 0 0 0 0 0 0 0 5 0 2 0 2 0 0 8 0 e l p ) 5 5 5 2 1 1 6 4 5 3 7 5 4 1 2 1 6 s 0 3 1 0 0 0 2 0 1 1 7 2 7 0 0 0 0 m t ...... 8 . 4 . 5 . 7 . i a 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 2 0 2 0 8 0 s e

r p e u 6 1 8 4 1 1 6 4 6 2 9 4 3 2 3 9 2 0 r

2 0 3 1 0 0 0 0 0 0 4 0 1 0 0 1 1 2 o ...... 6 . 3 4 . . 6 . f A

0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 2 2 0 0 8 0 t C

f 1 1 4 5 1 2 3 4 2 1 4 2 5 s o

0 0 0 0 0 0 0 0 0 0 0 0 0 e ...... 4 . 2 . 3 . . 4 . i o 0 0 0 0 0 0 0 0 5 0 2 0 2 0 0 8 0 c n

n d e 1 7 3 8 1 2 5 9 7 1 e u 0 1 1 0 0 0 0 0 1 0 t . . . . 3 . 1 . 2 . . . 2 . a q 0 0 0 0 5 0 2 0 2 0 0 0 8 0 e m r i f t

3 3 2 2 2 1 s e 1 0 0 0 0 0 e l . . 2 . 8 . 1 . . 9 (

0 0 5 0 1 0 2 0 0 7 e s l l e l a

e 9 8 4 1 3 1 1 2 l l 0 1 0 0 0 2 0 1 n 1 . . 4 9 . . 7 . . . . o 5 0 0 1 1 0 0 6 0 0 A 0 0 i t a l d d d d . u t t t t d d d d . . . n n n n d d d d E n n n n n n n n a a a a p . E E E f f f f f f f f i i i i n n n n l l l l . . . a a a a e e e e o S e e e e s s s s a a a a l l l l o o o o

S S S

I I I I l l l l e e e e e e e e k k k k

s s s s

n P P P P P i i i i s s s s I I I I c c c c

d 5 1 2 t t t t R R R R e e e e

R R R R I I I I 1 o i i i i

o o o o i r r r r p p p p 0 3 0 n i i i i 0 u u u u d d d d z z z z t 5 o o o o a a a a 0 2 0 a

u u u u R R R R z z z z 0 w w w w g g g g a n n n n

d d d d

- - - - b b b b l e o o o o n n n n s o o o o G G G G a a a a n n n n o o o o u u u u i i i i

l l l l l u b b b b H H H H l l l l u m m m m h h h h u u u u z z z z n n n n a a a a h h h h r r r r b c p l l l l a a a a a p u v a p u v u v a p u v a p a a a a a a a a k k k k N N N N a a a a a o o h h h h s s s s l l l l M M M M N S T U H I M M M M N S T U H I M M N S T U H I M M M M N S T T L P U H I M M

B IOGE OGRA PHY OF A MAL A WI C IC H L I D 1021

Barton & Slatkin’s (1986) rare alleles method estimates Allelic diversity and heterozygosity the genetic equivalent of 0.32 migrants/generation. The

A total of 29, 21, 19, and 25 alleles was observed at loci FST-based estimate is slightly higher at 0.56 migrants/ UNH-001, UNH-002, UNH-050 and UNH-231, respect- generation. Both methods produce concordant estimates of ively. The average population heterozygosity at all four relative levels of migration (Kendall’s tau = 0.722, P = 0.01) loci is 0.671. These results and other estimates of within- in adjacent populations. The only disagreement in rank population genetic diversity are shown in Table 2. Allele scores occurred in population comparisons in which the

frequencies for all loci in all populations are shown in FST value was statistically indistinguishable from zero, Table 5. leading us to conclude that either estimator is a good relat- A strong positive correlation was observed between ive index of gene ﬂow between habitat patches despite the maximum depth of rocky substrate at a site and the the recent establishment of these populations. 2 observed heterozygosity at that site (r = 0.803, P = 0.003). All pairwise DN and FST estimates are shown in Table 6. However, this pattern may be a result of population The highest level of differentiation was observed between ancestry rather than habitat age because all the shallow the two terminal sites, Mumbo and Mphande Islands.

sites are located in the southern end of our survey area. Nei’s D value between these two sites is 2.778 and FST is 2 The maximum likelihood estimate of null allele fre- 0.308 (P = 0.0005). The lowest Nm and highest (δµ) estim- quencies within each population ranged from 0.0 to 0.31 ates were also observed between the two terminal sites. (Table 2). These estimates will probably overstate the With a Bonferroni-corrected P (critical) of 0.0013, sig- frequency of null alleles because PCR reactions can fail nificant differences in allele frequency were detected at for a variety of reasons other than primer incompatibility all four loci in the following adjacent population pairs: (Brookfield 1996); however, at least one additional ampli- Mumbo Island/Ilala Gap and Tsano Rock/Harbour fication attempt was made on individuals that did not Island. Differentiation was detected at three of the four amplify initially. We expect that true null alleles should be loci between Ilala Gap/Tsano Rock, Harbour Island/ associated with an excess of homozygosity. Populations Mazinzi Reef, Harbour Island/Shallow Reef, Shallow

with FIS values which are signiﬁcantly different from zero Reef/Nkhudzi Hills, and Mazinzi Reef/Nkhudzi Hills. are indicated in Table 2. Populations with high null allele No evidence of differentiation was detected between

frequency estimates did not necessarily have FIS values Mvunguti SE/Tsano Rock, Mazinzi Reef/Shallow Reef or signiﬁcantly different from zero. Nkhudzi Hills/Mphande Island (Table 4).

Population differentiation Linkage disequilibrium and locus correlation A high level of population structure was observed. The No evidence of linkage between loci was found, suggesting

overall FST estimate is 0.151 (95% CI = 0.121 − 0.186, boot- that each locus is an independent estimate of population strapping over loci). Pairwise population statistics and structure.

distance estimates between adjacent collection sites are Pearson product moment correlations between FST estim- summarized in Table 4. Pairwise FST values between adja- ates at different loci range from 0.4162 [UNH-002 and cent populations range from 0 to 0.158. Pairwise estim- UNH-050] to 0.8750 [UNH-002 and UNH-231], with an

ates of Nm (based on the rare alleles method) between average of 0.6321. The correlation matrix is statistically adjacent sites range from 1.71 to 5.83. signiﬁcant (P < 0.001), suggesting different loci generally Gene ﬂow between the two terminal sites is very low. yield concordant estimates of genetic differentiation.

Table 6 A matrix of four locus average FST values (below diagonal) and DN values (above diagonal)

Harbour Shallow Mphande Mazinzi Mumbo Mvunguti Nkhudzi Tsano Island Reef Ilala Gap Island Reef Island S. E. Point Rock

Harbour Island — 0.307 0.939 0.522 0.335 1.348 0.471 0.490 0.364 Shallow Reef 0.113 — 1.372 0.286 0.023 2.370 0.897 0.255 0.734 Ilala Gap 0.111 0.229 — 1.684 1.287 0.700 0.262 1.490 0.226 Mphande Island 0.168 0.150 0.246 — 0.416 2.778 1.414 0.016 1.106 Mazinzi Reef 0.095 0.016 0.184 0.171 — 2.138 0.996 0.435 0.753 Mumbo Island 0.163 0.305 0.104 0.308 0.264 — 1.034 2.465 0.653 Mvunguti SE 0.092 0.251 0.057 0.279 0.212 0.158 — 1.270 0.004 Nkhudzi Hills 0.141 0.140 0.217 0.015 0.158 0.286 0.245 — 1.000 Tsano Rock 0.058 0.179 0.029 0.213 0.144 0.095 0.013 0.186 —

1022 J . A. M AR KE R T E T A L.

levels of differentiation. These observations are consist- Isolation by distance ent with Ribbink’s (1986) hypothesis that deep water can

Although geological evidence suggests that the popula- serve as a strong barrier to gene ﬂow. The lowest Nm estim- tions in the southern end of Lake Malawi were founded ates between adjacent sites are found between Mumbo very recently, a strong pattern of isolation by distance Island and Ilala Gap which are separated by approxim- is observed, with the slope of the regression line being ately 10 km of deep, open water. The rock–sand inter- −0.996, r2 = 0.694. This relationship between distance face occurs at a depth of 45 m at Mumbo Island and 36 m and genetic differentiation is statistically signiﬁcant at Ilala Gap. The intervening trough is about 100 m deep

(P < 0.00001). This pattern is consistent with a one- (Tripp et al. 1957). Similarly low Nm estimates were calcu- dimensional stepping-stone model at equilibrium (Hellberg lated between the Mazinzi Reef, a submerged offshore 1995). rocky outcrop, and two nearby shoreline sites; Harbour Island and Nkhudzi Hills. Although the lake bottom between these two pairs of sites is not nearly as deep as it Discussion is between Mumbo Island and the peninsula, depth may SSR loci reveal evidence of genetic substructuring in Lake still be a formidable barrier for M. auratus which are most Malawi cichlids on very fine geographical scales. The first common < 10 m below the surface at all the sites we sur- published study on this subject (van Oppen et al. 1997) veyed. Marsh & Ribbink (1981) and Hill & Ribbink (1978) found evidence of kilometre-scale structuring in four have demonstrated experimentally that some mbuna taxa mbuna species (genus Metriaclima and genus Pseudo- are unable to control their buoyancy in waters greater tropheus) from four habitat patches along the western than 40 m deep and that the maximum rate of depth shore of the lake. We observe an even higher level of genetic acclimation for fish in the mbuna genus Petrotilapia is differentiation among M. auratus populations from the < 4 m/day, leading the authors to suggest that substrate-

Nankumba Peninsula with an overall FST value an order hugging mbuna are physiologically incapable of crossing of magnitude higher than the average FST estimated by long stretches of deep water. Our data are consistent with van Oppen et al. (1997). Evidence of ﬁne-scale genetic Ribbink et al.’s (1986) hypothesis and the Ribbink et al. substructuring exists for other mbuna species including (1983) hypothesis that deep water is a barrier to migra- Labeotropheus fuelleborni (Arnegard et al. 1999), and tion due to the physiological limits of mbuna swim additional Metriaclima species complex taxa (P. Danley bladders. et al., in preparation). These data suggest that van Oppen The highest levels of gene ﬂow were inferred for et al.’s (1997) assertion that mbuna populations may samples collected from either end of continuous stretches of represent thousands of genetically divergent subunits has rocky habitat or from rocky patches separated by shallow strong empirical support. By systematically surveying sandy shoreline. Ilala Gap and Tsano Rock lie at opposite habitats in a small area in southern Lake Malawi and ends of a nearly continuous stretch of rocky coastline sampling M. auratus from these habitats we are able to which is interrupted only by an approximately 350 m determine which components of the physical environ- stretch of sandy shoreline at Mvunguti Village. These two ment constrain migration and further explore the spatial sites are 8.2 km apart yet show considerably less differ- and temporal scales of genetic differentiation in Malawi entiation than the sites separated by similar stretches of

cichlids. open water. The estimated FST value of 0.029 between M. auratus in southern Lake Malawi show a high level these two sites was signiﬁcantly different from zero (at of population differentiation, even relative to the other a Bonferroni-corrected P < 0.0038), but this is low relative

mbuna species surveyed to date. An overall FST value of to the other signiﬁcant FST values. The Nm estimate of 4.10 0.151 (P < 0.0002) was observed among all sites along suggests that migration is common between these two a 42-km transect. Migration between the two terminal sites. sites is estimated to be the genetic equivalent of one Shallow sandy shoreline also appears to facilitate dis- migrant every second generation or less. High pairwise persal. Mphande Island is located in a shallow bay about

FST and low Nm values were observed between several 5.6 km southeast of Nkhudzi Hills. The shoreline between adjacent populations, suggesting that philopatry is a the two sites is apparently free of classical mbuna habitat

general feature of M. auratus biology rather than an yet the estimated Nm value of 4.52, absence of detectable artefact of a single major barrier to gene ﬂow within the allele frequency differences at any of the four loci and an

area surveyed. FST value statistically indistinguishable from zero suggest The highest level of differentiation was observed that migration occurs between these two sites. A similar between populations separated by long stretches of deep pattern is observed between Mazinzi Reef and Shallow water. Conversely, collection sites separated by long Reef which have the second-highest pairwise estimate of stretches of rocky or sandy shoreline show much lower migration observed between adjacent sites in this study

B IOGE OGRA PHY OF A MAL A WI C IC H L I D 1023

(Nm = 5.19), second only to the rate between Tsano Rock and serve as a source of colonists as new rocky outcrops and Mvunguti S.E. which are separated by < 1 km of are inundated. There are at least two potential refugia in rocky habitat. In contrast, low migration rates are estim- the area that could serve as M. auratus habitat during ated between Mazinzi Reef and other neighbouring moderate recessions in lake level. The waters adjacent to populations. Although this difference in migration rates Boadzulu Island, some 13 km south of Mphande Island, might be partly explained by the fact that Shallow Reef is contain rocky habitat down to at least 40 m (Ribbink et al. much closer to Mazinzi Reef than either Harbour Island 1983). Jerusalem Reef, 7 km east of Mazinzi Reef, is an or Nkhudzi Hills (2.8 km vs. 7.6 or 5.0 km, respectively), isolated rocky outcrop, the top of which is ≈ 40 m below it seems likely that other geographical features influence the lake surface at its shallowest point. M. auratus is not the dispersal of fish from Mazinzi Reef to Shallow Reef. known to exist at either of these sites currently, but it Unlike the other more compact habitats we surveyed, is known to exist at sites south of Boadzulu Island. The Shallow Reef is a sprawling complex of small rocky habitats habitat in these areas appears similar to that at sites where in a sand/gravel matrix. This complex extends 0.4 km M. auratus are abundant, except for the greater depth of from shore along at least one transect. It is possible habitat at Jerusalem Reef. Several other deep reefs in that undetected habitat patches similar to the habitat at the southeast arm of Lake Malawi are known to fishermen Shallow Reef form a series of stepping stones between or are shown on navigational maps (Tripp et al. 1957). Mazinzi Reef and Shallow Reef. Alternatively, the similar- Jerusalem Reef and other similar structures could rep- ity between these two pairs of sites might be a result of resent former habitats which became progressively less recent founding of the two shallower sites (Shallow Reef suitable for M. auratus as water levels increased. The and Mphande Island) by populations with only modest observed pattern of genetic divergence suggests that while levels of genetic diversity. Mazinzi Reef could have been colonized by migrants An alternative explanation for the distribution of geno- from Harbour Island, Nkhudzi Hills may have been types at current habitats might be that they reflect older colonized from now submerged habitats to the east or south. patterns of differentiation rather than current patterns of The four shallow southern sites show lower levels of migration. We see an example of this process among the heterozygosity compared to the five deeper northern southern populations. Allele frequencies at Shallow Reef sites. This reduction in heterozygosity may suggest a are most similar to those at Mazinzi Reef, and are distinct series of bottlenecks associated with the colonization of from Harbour Island, suggesting that gene flow has not newly available habitats. Alternatively, the reduced allelic occurred along the shoreline between Harbour Island diversity may simply reflect smaller populations at these and Shallow Reef. These sites are separated by a series of shallower sites because both habitat area and population shallow sandy bays punctuated with a number of rocky density are reduced relative to the adjacent deeper sites. habitats which might be expected to serve as stepping A third possibility is that the southern populations were stones. The fact that migration is not detected along these founded by a genetically depauperate population from stepping stones may be a result of the recent availability deep water sites to the south and east of the study area of these very shallow (mostly < 2.5 m) habitats which and that the pattern of differentiation is more a result of have become stepping stones too recently for migration the historical distribution of genotypes than of the topo- along this route to homogenize allele frequencies between graphy of individual habitat patches. Harbour Island and Shallow Reef. How likely is it that observed migration estimates are In a similar fashion, the high level of genetic diver- merely an artefact of small sample sizes relative to the gence between the two apparent genetic units (1) Mazinzi total number of alleles, or that they are a result of survey- Reef-Shallow Reef and (2) Nkhudzi Hills-Mphande Island ing a small number of loci? Resampling from a simulated suggests that these two population pairs are more diverged population with an allele distribution similar to locus than we might expect if Nkhudzi Hills were colonized UNH-001 for all populations combined suggests that

by migrants from Mazinzi Reef as water levels rose. Based FST estimates between small samples drawn from a solely on the distance between sites, the expectation is single panmictic population are almost two orders of that Nkhudzi Hills would be only slightly more diverged magnitude smaller than those observed between the most from Mazinzi Reef than Shallow Reef. The observed isolated M. auratus populations (Markert 1998). For samples

pattern could result if genetic divergence evolved before of only 25 individuals, 95% of pairwise FST estimates are the current habitats were colonized. Several isolated sites < 0.007 and only the highest 5% of pairwise FST estimates in the lake could have served as refugia when lake levels were found to be statistically distinguishable from zero were lower (see Arnegard et al. 1999). If these refugia using either the resampling algorithms of fstat or the were as isolated as Mazinzi Reef or Mumbo Island are exact tests for allele frequency distribution in genepop. today, then populations at these sites might become evo- Recently, Ruzzante (1998) has demonstrated that sample

lutionarily detached from other populations in the lake, variances in Weir & Cockerham’s (1984) FST estimator are

1024 J . A. M AR KE R T E T A L.

low relative to other estimators, that FST is unbiased even substructuring may be a general feature of mbuna bio- at small sample sizes, and that the sampling variance in logy. van Oppen et al. (1997) and Arnegard et al. (1999)

FST actually decreases with an increasing number of alleles have demonstrated high levels of population structure for a given sample size. The main advantage of increasing in five additional species using SSR loci. When com- sample sizes would be to enhance our statistfical power, bined with data from allozyme and mitochondrial DNA enabling the detection of smaller levels of genetic differenti- sequences (McKaye et al. 1984; Bowers et al. 1994), a wide- ation and finer discrimination among migration barriers. spread pattern of philopatry emerges. Although adding loci would be expected to enhance Speciation is also likely to be influenced by the the accuracy of the distance estimates, the Pearson cor- dynamic nature of Lake Malawi itself (sensu. Vrba 1985). relation matrix indicates that the four loci surveyed in In mbuna the speciation process is perhaps enhanced by this study are generally concordant with respect to estim- the chronic instability of the rocky habitats along the

ates of interpopulation differentiation. Single-locus FST shores of the lake. While rapid and frequent changes in estimates and the statistical significance of allele frequency lake level alter components of the physical environment, differences for adjacent pairs of populations are shown genetic and environmental differences between popula- in Table 4. In the instances where interpopulation hetero- tions also develop. Colonization of a newly flooded habitat geneity is detectable at only three of the four loci in patch would be expected to be accompanied by stochastic adjacent populations, a single allele is present at a high changes in both allele frequencies (due to founder effects) frequency in both populations being compared. and community structure. This may differentiate popu- The rapid evolution of the Lake Malawi cichlid flock lations with respect to both the potential response to may be driven by the fragmented and chronically unstable selection (as a result of allele frequency differences), and rocky habitats. The importance of habitat fragmenta- the selective environment itself (as a result of differences tion and transience in the evolution of the Lake Malawi in community structure or the physical environment). cichlid species was first emphasized by Trewavas (1947) The other African Rift Valley Lakes have also experi- and later elaborated by Fryer (1959b). For the mbuna, enced dramatic climatically driven changes in water level Fryer suggested that populations on isolated rocky outcrops during the Pleistocene (cf. Scholz & Rosendahl (1988); are free to pursue independent evolutionary trajectories. Johnson et al. (1996)). If habitat fidelity is a general fea- The course of these trajectories may be set either by drift ture of the biology of the East African cichlids then philo- or by adaptation to local physical, social, or ecological patry and habitat instability may help explain the rapid conditions. These local conditions are modified continu- evolution of biodiversity observed in the African cichlid ously as a result of the frequent changes in water level. species flocks. Ribbink et al. (1983) have suggested that fluctuations in water level may play a generative role in speciation by altering the size of rocky zones, exposing or drowning Acknowledgements inhabited areas, and fragmenting or uniting habitat We wish to express our appreciation to Julie Baldizar, Karen patches. Although this process may lead to local extinc- Kellogg, and Jay R. Stauffer, Jr. (who provided underwater field tions, a perpetually shifting evolutionary landscape could support for our research), Aggrey Ambali and Harvey Kabwazi drive speciation with each newly available habitat patch (for their advice and support in Malawi), and Janet Conroy and possessing unique physical conditions, collections of Woo-Jai Lee (who isolated the microsatellite loci used in this fauna, and evolutionary challenges which may lead to study). Christopher Bvalani, Wykliff Louis, and Timoth Mponda endured long hours of outfitting and transporting SCUBA divers evolutionary divergence among mbuna populations in during the field portion of this study. We also gratefully the absence of substantial interhabitat gene flow. acknowledge the Malawi Parks Department for providing permission to work in Lake Malawi National Park (Permit no. 684658). This work was supported by grants from the Conclusions National Geographic Society (J.A.M., T.D.K.), the National Science Foundation (J.A.M., T.D.K.), the Fulbright Commission The low level of migration in mbuna species combined (P.D.D.) and the Rotary Foundation (M.E.A.). Additional insights with the isolated nature of many of the rocky habitat were provided by Ann C. Bucklin, C. Sarah Cohen, Irving patches within Lake Malawi provide many opportunities Kornfield, Michelle Scott, Monica Stevens-Sommer and Lizhao for evolutionary divergence. van Oppen et al. (1997) have Wu. Three anonymous reviewers and Louis Bernatchez pro- suggested that mbuna species are divided into thousands vided useful comments on an earlier version of this manuscript. of genetically isolated units and that this division provides numerous opportunities for allopatric speciation. The docu- References mentation of fine-scale population differentiation in M. auratus presented here is consistent with this suggestion. Allen PJ, Amos W, Pomeroy PP, Twiss SD (1995) Microsatellite Data are emerging which suggest that fine-scale genetic variation in grey seals (Halichoerus grypus) shows evidence of

B IOGE OGRA PHY OF A MAL A WI C IC H L I D 1025

genetic differentiation between two British breeding colonies. Johnson TC, Scholz CA, Talbot MR et al. (1996) Late Pleistocene Molecular Ecology, 4, 653–662. dessication of Lake Victoria and rapid evolution of cichlid Arnegard ME, Markert JA, Danley PD, Stauffer Jr JR, Ambali fishes. Science, 273, 1091–1093. AJD, Kocher TD (1999) Population structure and color vari- Kellogg KA, Markert JA, Stauffer Jr JR, Kocher TD (1995) Micro- ation in the lithophilous cichlid Labeotropheus fuelleborni Ahl satellite variation demonstrates multiple paternity in lekking along a recently formed archipelago of rocky habitat patches in cichlid fishes from Lake Malawi, Africa. Proceedings of the Royal southern Lake Malawi. Proceedings of the Royal Society of London, Society of London, 260, 79–84. Series B, 266, 119–130. Kosswig C (1947) Selective mating as a factor for speciation in Barton NH, Slatkin M (1986) A quasi-equilibrium theory of the cichlid fish of east African lakes. Nature, 159, 604. distribution of rare alleles in a subdivided population. Heredity, Lee W-J, Kocher TD (1996) Microsatellite DNA markers for genetic 56, 409–415. mapping in Oreochromis niloticus. Journal of Fish Biology, 49, Boulenger GA (1897) Description of a new fish from Lake 169–171. Nyassa. Annals and Magazine of Natural History, 6, 155. Lehman T, Hawley WA, Collins FH (1996) An evaluation of evo- Boulenger GA (1915) Catalogue of the Fresh-Water Fishes of Africa lutionary constraints on microsatellite loci using null alleles. in the British Museum (Natural History). British Museum Genetics, 144, 1155–1163. (Natural History), London, UK. Malawi Government (1977) Nankumba Peninsula Sheet 1434B2 Bowers NJ (1993) A revision of the Genus Melanochromis (Teleostei: & Part of 1334D4. Dept of Surveys, Blantyre, Malawi. Cichlidae) from Lake Malawi, Africa, using morphological and Markert JA (1998) Population structure and phylogenetic history of molecular techniques. PhD Thesis, The Pennsylvania State the Lake Malawi cichlid species flock. PhD Thesis, University of University. New Hampshire. Bowers N, Stauffer Jr JR, Kocher TD (1994) Intra- and inter- Marsh AC, Ribbink AJ (1981) A comparison of the abilities of specific mitcochondrial DNA sequence variation within two three sympatric species of Petrotilapia (Cichlidae, Lake Malawi) species of rock-dwelling cichlids (Teleostei: Cichlidae) from to penetrate deep water. Environmental Biology of Fishes, 6, 367–369. Lake Malawi, Africa. Molecular Phylogenetics and Evolution, 3, McKaye KR, Gray WN (1984) Extrinsic barriers to gene flow in 75–82. rock-dwelling cichlids of Lake Malawi: Macrohabitat hetero- Brookfield JFY (1996) A simple new method for estimating null geneity and reef colonization. In: Evolution of Fish Species Flocks allele frequency from heterozygote deficiency. Molecular Eco- (eds Echelle AA, Kornfield I), pp. 169–181. University of Maine logy, 5, 453–455. at Orono Press, Orono, USA. Dominey WJ (1984) Effects of sexual selection and life history on McKaye KR, Kocher T, Reinthal P, Harrison R, Kornfield I (1984) speciation: species flocks in African cichlids and Hawaiian Genetic evidence of allopatric and sympatric differentiation Drosophilia. In: Evolution of Species Flocks (eds Echelle AA, among color morphs of a Lake Malawi cichlid fish. Evolution, Kornfield I), pp. 231–249. University of Orono Press, Orono, USA. 38, 215–219. Farrall M, Weeks DE (1998) Mutational mechanisms for generat- Minch E, Ruiz-Linares A, Goldstein D, Feldman M, Cavalli- ing microsatellite allele-frequency distributions: an analysis of Sforza LL (1995–96) MICROSAT (Version 1.4d): a computer 4,558 markers. American Journal of Human Genetics, 62, 1260–1262. program for calculating various statistics on microsatellite Fryer G (1959a) The ecology and evolution of a group of rock- allele data WWW: http://lotka.stanford.edu/microsat.html. frequenting Nyasan cichlid fishes known as the ‘Mbuna’. van Oppen MJH, Deutsch JC, Turner GF et al. (1997) Unusually Proceedings of the Zoological Society of London, 132, 237–279. fine-scale genetic structuring found in rapidly speciating Fryer G (1959b) Some aspects of evolution in Lake Nyasa. Evolu- Malawi cichlid fishes Proceedings of the Royal Society of London, tion, 13, 440–451. Series B, 264, 1803–1812. Fryer G (1965) Predation and its effects on migration and speci- Owen RB, Crossley R, Johnson TC et al. (1990) Major low lake ation in African fishes: a comment. Proceedings of the Zoological levels of Lake Malawi and their implications for speciation Society of London, 144, 301–322. rates in cichlid fishes. Proceedings of the Royal Society of London, Goldstein DB, Linares AR, Cavalli-Sforza LL, Feldman MW (1995) 240, 519–553. An evaluation of genetic distances for use within microsatellite Patterson HEH (1985) The recognition concept of species. In: loci. Genetics, 139, 463–471. Species and Speciation (ed. Vrba ES) Pretoria, S.A., Transvaal Goudet J (1995) fstat (Version 1.2): a computer program to cal- Museum, 4, 21–34. culate F-statistics. Journal of Heredity, 86, 485–486. Raymond M, Rousset F (1995) genepop (Version 1.2): Popula- Greenwood PH (1964) Explosive speciation in African lakes. tion genetics software for exact tests and ecumenicism. Proceedings of the Royal Institute of Great Britain, 40, 256–269. Journal of Heredity, 86, 248–249. Günther A (1864) Report on a collection of reptiles and fishes Ribbink AJ (1986) The species concept, sibling species and made by Dr Kirk in the Zambezi and Nyasa regions. Proceed- speciation. Proceedings of the 3rd European Workshop on Cichlid ings of the Zoological Society of London, 1864, 303–314. Biology. Musee Royal de L’Afrique Centrale, Tevuren, Belgium. Hellberg ME (1995) Stepping-stone gene flow in the solitary Ribbink AJ, Marsh AC, Marsh BA, Sharp BJ (1983) A prelimin- coral Balanophyllia elegans: equilibrium and nonequilibrium at ary survey of the cichlid fishes of the rocky habitats in Lake different spatial scales. Marine Biology, 123, 573–581. Malawi. South African Journal of Zoology, 18, 149–310. Hill BJ, Ribbink AJ (1978) Depth equilibration of a shallow-water Rousset F, Raymond M (1995) Testing heterozygote excess and cichlid fish. Journal of Fish Biology, 13, 741–745. deficiency. Genetics, 140, 1413–1419. Jackson PBN (1955) A new fish of the genus Clarias Gronov. from Ruzzante DE (1998) A comparison of several measures of genetic Lake Nyasa, with notes on the distribution of the Clariidae and distance and population structure with microsatellite data: other catfishes in the lake. Proceedings of the Zoological Society of bias and sampling variance. Canadian Journal of Fisheries and London, 125, 681–684. Aquatic Sciences, 55, 1–14.

1026 J . A. M AR KE R T E T A L.

Scholz CA, Rosendahl BR (1988) Low lake stands in Lake Malawi and Tanganyika, East Africa, delineated with multi- This work is one of a series of papers which explore population fold seismic data. Science, 240, 1645–1648. structure and phylogeographic history in mbuna species along Slatkin M (1993) Isolation by distance in equilibrium and non- the shores of Lake Malawi’s Nankumba Peninsula. Jeffrey equilibrium populations. Evolution, 47, 264–279. Markert is a postdoctoral research associate who uses molecular Tautz D (1989) Hypervariability of simple sequences as a general population genetics to understand the processes which have led source for polymorphic DNA markers. Nucleic Acids Research, to the evolution of the taxonomic richness which characterizes 17, 6463–6471. the cichlids of the African Rift Valley lakes. This publication Trewavas E (1947) Speciation in cichlid ﬁshes of East African represents a portion of his doctoral dissertation at the University Lakes. Nature, 160, 96–97. of New Hampshire. Matthew Arnegard is a PhD student whose Tripp RT, Bailey RT, Crosby A, Farrer R (1957) Chipoka to interests include animal communication, species recognition, Monkey Bay. and the evolution of genetic structure in populations. Patrick Vrba ES (1985) Environment and evolution: alternative causes of Danley is a PhD student studying the genetic basis of repro- the temporal distribution of evolutionary events. South African ductive isolation in cichlids. Thomas Kocher is Professor of Journal of Science, 81, 229–236. Zoology at the University of New Hampshire, and is interested Weir BS, Cockerham CC (1984) Estimating F-statistics for the in genomic approaches to understanding the genetic basis of analysis of population structure. Evolution, 38, 1358–1370. speciation and the evolution of species differences.