DOCSLIB.ORG

Mutations in the Cardiac Troponin T Gene Show Various Prognoses in Japanese Patients with Hypertrophic Cardiomyopathy

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mutations in the Cardiac Troponin T Gene Show Various Prognoses in Japanese Patients with Hypertrophic Cardiomyopathy View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Crossref Heart Vessels (2013) 28:785–794 DOI 10.1007/s00380-013-0332-3 ORIGINAL ARTICLE Mutations in the cardiac troponin T gene show various prognoses in Japanese patients with hypertrophic cardiomyopathy Etsuko Fujita • Toshio Nakanishi • Tsutomu Nishizawa • Nobuhisa Hagiwara • Rumiko Matsuoka Received: 2 April 2012 / Accepted: 15 February 2013 / Published online: 14 March 2013 Ó The Author(s) 2013. This article is published with open access at Springerlink.com Abstract Hypertrophic cardiomyopathy (HCM) is an Arg92Trp mutation, and one individual of another family autosomal dominant disorder resulting from mutations in had a new mutation, Ile79Thr, of TNNT2. The phenotype genes for at least 15 various sarcomere-related proteins of each family was often different from reported cases, including cardiac b-myosin heavy chain, cardiac myosin- even if they had the same genetic mutation. In addition, binding protein C, and cardiac troponin T. The troponin families with the same genetic mutation showed a similar T gene (TNNT2) mutation has the third incidence of trend in the phenotype, but it was not exactly the same. familial HCM, and the genotype–phenotype correlation However, sudden death in youth was observed in all of of this gene still remains insufficient in Japanese familial these families. Although the type of genetic mutation is HCM. Therefore, in the present study, we focused on not useful for predicting prognosis in HCM, the possi- screening the TNNT2 mutation in 173 unrelated Japanese bility of sudden cardiac death remains. Therefore, the patients with familial HCM, and found three reported prognosis of individuals bearing the TNNT2 mutation mutations and a new mutation of TNNT2 in 11 individ- with familial HCM should be more carefully observed uals from four families. In these families, two individuals from birth. from one family had double mutations, Arg130Cys and Phe110Ile, six individuals from two other families had an Keywords Familial hypertrophic cardiomyopathy Á TNNT2 gene Á Mutation Á Phenotype–genotype E. Fujita Á N. Hagiwara Department of Cardiology, Tokyo Women’s Medical University, Tokyo, Japan Introduction T. Nakanishi Á R. Matsuoka Hypertrophic cardiomyopathy (HCM) is characterized by Department of Pediatric Cardiology, Tokyo Women’s Medical University, Tokyo, Japan left and/or right ventricular hypertrophy, with predominant involvement of the interventricular septum in the absence T. Nishizawa Á R. Matsuoka of other causes of hypertrophy, such as hypertension, val- International Research and Educational Institute for Integrated vular heart disease, or metabolic disease [1–7]. Medical Sciences (IREIMS), Tokyo Women’s Medical University, Tokyo, Japan Familial HCM is an autosomal dominant disorder caused by mutations in genes that encode sarcomere pro- R. Matsuoka teins. It has been reported that at least 15 genes are Division of Genomic Medicine, Institute of Advanced implicated in 55–70 % of HCM, and the major genes Biomedical Engineering and Science, Graduate School of Medicine, Tokyo Women’s Medical University, Tokyo, Japan causing HCM include cardiac b-myosin heavy chain (MYH7), a-tropomyosin, cardiac troponin T (TNNT2), R. Matsuoka (&) cardiac myosin-binding protein C (MYBPC3), cardiac tro- International Center for Molecular, Cellular, and Immunological ponin I (TNNI3), cardiac myosin regulatory light chains Research (IMCIR), Tokyo Women’s Medical University, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666, Japan (MYL2), and cardiac myosin essential light chains (MYL3) e-mail: [email protected] [1, 4, 5, 8–11]. 123 786 Heart Vessels (2013) 28:785–794 Cardiac troponin T is a thin-filament protein that takes this gene still remains insufficient in Japanese familial part in muscle contraction. The troponin complex on the HCM. Therefore, in the present study we focused on actin filament regulates the force and velocity of muscle screening the TNNT2 mutation. contraction. Troponin C functions as a calcium receptor while troponin I inhibits adenosine triphosphatase (ATP- ase) activity when bound to actin. Troponin T fixes the Patients and methods troponin group to tropomyosin. During relaxation, the troponin group is bound to actin and tropomyosin, blocking Subjects the interaction of myosin and actin [12]. TNNT2 was mapped to chromosome 1q32. Mutations of We genetically evaluated 173 patients (101 men and 72 TNNT2 were thought to account for approximately 15 % of women; 0–79 years old, median age 20 years) who were familial HCM, with most missense mutations located in clinically diagnosed with familial HCM. exons 8–16 [3], and were associated with a particularly Pediatric patients with HCM were recruited from Tokyo severe form of the disease characterized by a poor overall Women’s Medical University. Written informed consent prognosis with a high incidence of sudden death despite was obtained from all study subjects in accordance with the only mild left ventricular hypertrophy (LVH) [1–4]. Most Declaration of Helsinki. If patients were younger than 16 TNNT2 mutations of familial HCM alter the contractile years, informed consent was given by their guardians. We properties of cardiac muscle, especially the Ca2? sensi- assessed each patient by taking their history and perform- tivity of force development and ATPase activity in vitro ing a physical examination, and reviewed their medical and in vivo [13–17]. records. All assessments were done with the approval of Previous reports have suggested that there is a more the Ethics Committees of Tokyo Women’s Medical consistent relationship between certain genetic mutations University. and clinical outcome, allowing for the classification of The diagnosis of HCM was determined through clinical ‘‘benign’’ and ‘‘malignant’’ mutations [18–30]. For exam- evaluation, chest radiography, electrocardiography, echo- ple, a favorable prognosis has been reported in patients cardiography, and cardiac catheterization based on current with a Phe110Ile mutation of the TNNT2 mutation (in 16 international consensus criteria. individuals of 6 Japanese families) [19, 20]. From these Diseases of the heart, hypertension, valvular heart dis- data, genetic analysis and determination of genotype were ease, or metabolic disease attributable to HCM were thought to be important for assisting with patient excluded from this study by pediatric cardiologists. management. However, these findings were based on limited experi- Mutation screenings ence; to date, only 30 different mutations have been identified in TNNT2 [9–11, 18]. In addition to this genetic Genomic DNA was prepared from peripheral blood lym- diversity, the phenotypic expression of these mutations phocytes or lymphoblast cell lines transformed by the varies considerably, ranging from asymptomatic individu- Epstein–Barr virus, as described previously [33]. TNNT2 als with a normal life expectancy to those with sudden coding regions and exon–intron boundaries, including cardiac death or the need for an early heart transplant. regions approximately 30–100 bp upstream and down- Clinical parameters such as the degree of LVH, the pres- stream from the exons, were amplified from genomic DNA ence or absence of a left ventricular outflow tract gradient, using primers, as described in previous reports [34, 35]. and electrophysiology testing have not been predictive Genomic DNA (50 ng) was amplified through the use of markers of poor prognosis [1–5]. More recently, it was primers designed from flanking intron sequences (Table 1). reported that late gadolinium enhancement with cardiac Amplified products were purified using a MultiScreen magnetic resonance can be a predictive marker of the polymerase chain reaction (PCR) plate (Millipore, Bille- ventricular arrhythmia and poor prognosis in HCM [31]. rica, MA, USA) and directly sequenced using the ABI- In recent years, mutation-specific risk stratification was PRISM BigDye-terminator cycle sequencing reaction kit considered to be not possible, but genetic test-based risk and ABI 3130xl genetic analyzer (Applied Biosystems, stratification seemed to be clinically informative [32]. Foster City, CA, USA). When a mutation was detected, we The TNNT2 mutation has the third-ranked incidence of confirmed that it was not presenting 363 Japanese normal familial HCM, and the genotype–phenotype correlation of chromosomes by direct sequencing. 123 Heart Vessels (2013) 28:785–794 787 Table 1 Primers used for Exon Forward (50–30) Reverse (50–30) amplification of fragments from TNNT2 2 GAGCTCTTCTGAGGAAGGCA CTACCCAGAATCCGAGGGAC 3 and 4 CAGGGCAGCGTGGACTCCC CCCAGGGCTCCCAGGATTT 5 CCATTCTCTGCTCTGGGTTC GTGCACATGGGAAAGCTGTTCT 6 TAGGGCTTATCTGTGGGGAAGGC CTTCCCTGGAAAGAGCACTG 7 GAAATGGAAATCCACAGGGA TACTGCACCCCGTTCCATCA 8 and 9 CTCTAGGAAGGATCAGGGCCC CTCACAAAAGGGATGGAGGA 10 GCGATGTCACCTTCTCCCTA CACCGCACCCGGCCAATA 11 GGTTTCCAATCCTTTCCCCTAA GCTGCAGTGGACACCTCATTC 12 GCCTTTGTCTTCCTGCCTTCTC CAGCCAGCCCAATCTCTTCACT 13 ACAGGGAGGGGGCAATCTGGCC CCCAGAGCAGATGCGGGCAGTG 14 ACTGGGTGCTGCCGTCTGGTC AAGGGGGCTGTTGGGGAATAGG 15 CACTCAGCCCCCTTCTCC AAGCTTCTCCGCCCCACATTTC 16 GGCACCCCAGTCCTACCC GTCCCCCTCAACAGCACTTTT The PCR conditions of these genes were modified and mother and mother’s family had no symptoms or abnormal fragments were analyzed by electrophoresis, as described findings. The proband and her brother and father (Fig. 1; previously [36, 37]. III-2, III-1, I-2) showed mild LVH (maximum wall thick- Proband patients bearing TNNT2 mutations were addi- ness \20 mm).
Load more

Recommended publications
  • Identification of the Binding Partners for Hspb2 and Cryab Reveals
    Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity.
    [Show full text]
  • Genetic Mutations and Mechanisms in Dilated Cardiomyopathy
    Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, … , Jessica R. Golbus, Megan J. Puckelwartz J Clin Invest. 2013;123(1):19-26. https://doi.org/10.1172/JCI62862. Review Series Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of congestive heart failure. In hypertrophic cardiomyopathy (HCM), cardiac output is limited by the thickened myocardium through impaired filling and outflow. Mutations in the genes encoding the thick filament components myosin heavy chain and myosin binding protein C (MYH7 and MYBPC3) together explain 75% of inherited HCMs, leading to the observation that HCM is a disease of the sarcomere. Many mutations are “private” or rare variants, often unique to families. In contrast, dilated cardiomyopathy (DCM) is far more genetically heterogeneous, with mutations in genes encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. DCM is characterized by enlarged ventricular dimensions and impaired systolic and diastolic function. Private mutations account for most DCMs, with few hotspots or recurring mutations. More than 50 single genes are linked to inherited DCM, including many genes that also link to HCM. Relatively few clinical clues guide the diagnosis of inherited DCM, but emerging evidence supports the use of genetic testing to identify those patients at risk for faster disease progression, congestive heart failure, and arrhythmia. Find the latest version: https://jci.me/62862/pdf Review series Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, Jessica R. Golbus, and Megan J. Puckelwartz Department of Human Genetics, University of Chicago, Chicago, Illinois, USA. Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of conges- tive heart failure.
    [Show full text]
  • Inhibition of Β-Catenin Signaling Respecifies Anterior-Like Endothelium Into Beating Human Cardiomyocytes Nathan J
    © 2015. Published by The Company of Biologists Ltd | Development (2015) 142, 3198-3209 doi:10.1242/dev.117010 RESEARCH ARTICLE STEM CELLS AND REGENERATION Inhibition of β-catenin signaling respecifies anterior-like endothelium into beating human cardiomyocytes Nathan J. Palpant1,2,3,*, Lil Pabon1,2,3,*, Meredith Roberts2,3,4, Brandon Hadland5,6, Daniel Jones7, Christina Jones3,8,9, Randall T. Moon3,8,9, Walter L. Ruzzo7, Irwin Bernstein5,6, Ying Zheng2,3,4 and Charles E. Murry1,2,3,4,10,‡ ABSTRACT lineages. Anterior mesoderm (mid-streak) gives rise to cardiac and endocardial endothelium, whereas posterior mesoderm (posterior During vertebrate development, mesodermal fate choices are regulated streak) gives rise to the blood-forming endothelium and vasculature by interactions between morphogens such as activin/nodal, BMPs and (Murry and Keller, 2008). Wnt/β-catenin that define anterior-posterior patterning and specify Well-described anterior-posterior morphogen gradients, downstream derivatives including cardiomyocyte, endothelial and including those of activin A/nodal and BMP4, are thought to hematopoietic cells. We used human embryonic stem cells to explore pattern mesoderm subtypes (Nostro et al., 2008; Sumi et al., 2008; how these pathways control mesodermal fate choices in vitro. Varying Kattman et al., 2011). Such gradients are proposed to specify doses of activin A and BMP4 to mimic cytokine gradient polarization anterior mesodermal fates like cardiomyocytes versus posterior in the anterior-posterior axis of the embryo led to differential activity mesodermal fates like blood. Remarkably, a recent study showed of Wnt/β-catenin signaling and specified distinct anterior-like (high activin/ that ectopic induction of a nodal/BMP gradient in zebrafish embryos low BMP) and posterior-like (low activin/high BMP) mesodermal was sufficient to create an entirely new embryonic axis that could populations.
    [Show full text]
  • Transcriptomic Uniqueness and Commonality of the Ion Channels and Transporters in the Four Heart Chambers Sanda Iacobas1, Bogdan Amuzescu2 & Dumitru A
    www.nature.com/scientificreports OPEN Transcriptomic uniqueness and commonality of the ion channels and transporters in the four heart chambers Sanda Iacobas1, Bogdan Amuzescu2 & Dumitru A. Iacobas3,4* Myocardium transcriptomes of left and right atria and ventricles from four adult male C57Bl/6j mice were profled with Agilent microarrays to identify the diferences responsible for the distinct functional roles of the four heart chambers. Female mice were not investigated owing to their transcriptome dependence on the estrous cycle phase. Out of the quantifed 16,886 unigenes, 15.76% on the left side and 16.5% on the right side exhibited diferential expression between the atrium and the ventricle, while 5.8% of genes were diferently expressed between the two atria and only 1.2% between the two ventricles. The study revealed also chamber diferences in gene expression control and coordination. We analyzed ion channels and transporters, and genes within the cardiac muscle contraction, oxidative phosphorylation, glycolysis/gluconeogenesis, calcium and adrenergic signaling pathways. Interestingly, while expression of Ank2 oscillates in phase with all 27 quantifed binding partners in the left ventricle, the percentage of in-phase oscillating partners of Ank2 is 15% and 37% in the left and right atria and 74% in the right ventricle. The analysis indicated high interventricular synchrony of the ion channels expressions and the substantially lower synchrony between the two atria and between the atrium and the ventricle from the same side. Starting with crocodilians, the heart pumps the blood through the pulmonary circulation and the systemic cir- culation by the coordinated rhythmic contractions of its upper lef and right atria (LA, RA) and lower lef and right ventricles (LV, RV).
    [Show full text]
  • The Role of Wnt/Β-Catenin Antagonists - Sclerostin and DKK1 - in Bone Homeostasis and Mechanotransduction
    The role of Wnt/β-catenin antagonists - sclerostin and DKK1 - in bone homeostasis and mechanotransduction Alyson Ruth Morse B Biotech (Hons) A thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy Supervisor: Prof David G Little Co-supervisors: A/Prof Aaron Schindeler Dr Michelle M McDonald 2017 The University of Sydney Sydney Medical School Statement of Originality This is to certify that to the best of my knowledge, the content of this thesis is my own work. This thesis has not been submitted for any degree or other purposes. I certify that the intellectual content of this thesis is the product of my own work and that all the assistance received in preparing this thesis and sources have been acknowledged. Alyson Morse ii Acknowledgments It has been a long, long journey with many people to thank. My husband, James: he is my number one supporter and inspiration. He has a drive and desire for achievement that I see unmatched. My little girl, Lyndsey: who has been the motivating force every day over the past two years to get this thesis finished! My parents and family: they have always believed in my abilities and maintained interest in my achievements - thank you for all that you have given for me. My supervisor, David: he has shown more confidence in me than I ever did in myself. I’m sure he is unaware of the full influence and ambition that he has instilled. My associate supervisors, Michelle and Aaron: each have provided invaluable guidance, experience and knowledge during different stages of my candidature - thank you! The additional experts that have helped me along the way: Prof Marjolein van der Meulen, Dr Wendy Gold, and Dr Ciara Murphy - you have been invaluable.
    [Show full text]
  • A Concise Review of Human Brain Methylome During Aging and Neurodegenerative Diseases
    BMB Rep. 2019; 52(10): 577-588 BMB www.bmbreports.org Reports Invited Mini Review A concise review of human brain methylome during aging and neurodegenerative diseases Renuka Prasad G & Eek-hoon Jho* Department of Life Science, University of Seoul, Seoul 02504, Korea DNA methylation at CpG sites is an essential epigenetic mark position of carbon in the cytosine within CG dinucleotides that regulates gene expression during mammalian development with resultant formation of 5mC. The symmetrical CG and diseases. Methylome refers to the entire set of methylation dinucleotides are also called as CpG, due to the presence of modifications present in the whole genome. Over the last phosphodiester bond between cytosine and guanine. The several years, an increasing number of reports on brain DNA human genome contains short lengths of DNA (∼1,000 bp) in methylome reported the association between aberrant which CpG is commonly located (∼1 per 10 bp) in methylation and the abnormalities in the expression of critical unmethylated form and referred as CpG islands; they genes known to have critical roles during aging and neuro- commonly overlap with the transcription start sites (TSSs) of degenerative diseases. Consequently, the role of methylation genes. In human DNA, 5mC is present in approximately 1.5% in understanding neurodegenerative diseases has been under of the whole genome and CpG base pairs are 5-fold enriched focus. This review outlines the current knowledge of the human in CpG islands than other regions of the genome (3, 4). CpG brain DNA methylomes during aging and neurodegenerative islands have the following salient features. In the human diseases.
    [Show full text]
  • Understanding Lamin A/C and Its Roles in Disease
    UNDERSTANDING LAMIN A/C AND ITS ROLES IN DISEASE PATHOLOGIES AUDREY WANG SHIMEI BSC (HONS.), NANYANG TECHNOLOGICAL UNIVERSITY A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE 2014 i ii ACKNOWLEDGEMENTS I would like to express my sincere gratitude to Professor Colin L. Stewart (THE BOSS) for his continuous support of my PhD study. His guidance, motivation and most importantly, his quirky sense of humour have made these six years a great learning journey. His unsurpassed knowledge of lamins has opened my eyes to the world of nuclear dynamics. His exquisite taste in excellent wines, good food and foresight in choosing awesome people for the group made everything better. I would like to thank my mentor Dr. Henning Horn, who has been a great teacher to me on both academic and personal level. I’m extremely grateful to him for all his advice at work and personal matters, through good and difficult times. I also thank each and everyone in the BS lab for their great advice, support and friendship. I am very blessed to be in this lab and could not have asked for better folks to work with. In particular, Alex, Hen, Rafidah, Xiaoqian, Esther and Gracy who have helped in more ways than one, and Tinka, Dave, Anna for helping to read through bits and pieces of this thesis. I also must thank my collaborators from Ludwig-Maximilians University Munich: the late Prof Boris Joffe whom, sadly, I never met in person, and a very kind and brilliant scientist, Dr Irina Solovei.
    [Show full text]
  • Coverage and Diagnostic Yield of Whole Exome Sequencing for the Evaluation of Cases with Dilated and Hypertrophic Cardiomyopathy
    www.nature.com/scientificreports OPEN Coverage and diagnostic yield of Whole Exome Sequencing for the Evaluation of Cases with Dilated Received: 21 November 2017 Accepted: 4 July 2018 and Hypertrophic Cardiomyopathy Published: xx xx xxxx Timothy Shin Heng Mak 1, Yee-Ki Lee2, Clara S. Tang 3,4, JoJo S. H. Hai2, Xinru Ran2, Pak-Chung Sham 1,5,6 & Hung-Fat Tse2,7,8,9 Targeted next generation sequencing of gene panels has become a popular tool for the genetic diagnosis of hypertrophic (HCM) and dilated cardiomyopathy (DCM). However, it is uncertain whether the use of Whole Exome Sequencing (WES) represents a more efective approach for diagnosis of cases with HCM and DCM. In this study, we performed indirect comparisons of the coverage and diagnostic yield of WES on genes and variants related to HCM and DCM versus 4 diferent commercial gene panels using 40 HCM and DCM patients, assuming perfect coverage in those panels. We identifed 6 pathogenic or likely pathogenic among 14 HCM patients (diagnostic yield 43%). 3 pathogenic or likely pathogenic were found among the 26 DCM patients (diagnostic yield 12%). The coverage was similar to that of four existing commercial gene panels due to the clustering of mutation within MYH7, MYBPC3, TPM1, TNT2, and TTN. Moreover, the coverage of WES appeared inadequate for TNNI3 and PLN. We conclude that most of the pathogenic variants for HCM and DCM can be found within a small number of genes which were covered by all the commercial gene panels, and the application of WES did not increase diagnostic yield.
    [Show full text]
  • PKM2 Phosphorylates MLC2 and Regulates Cytokinesis of Tumour Cells
    ARTICLE Received 17 Jun 2014 | Accepted 14 Oct 2014 | Published 21 Nov 2014 DOI: 10.1038/ncomms6566 PKM2 phosphorylates MLC2 and regulates cytokinesis of tumour cells Yuhui Jiang1, Yugang Wang1, Ting Wang2, David H. Hawke3, Yanhua Zheng1, Xinjian Li1, Qin Zhou4, Sadhan Majumder5, Erfei Bi2, David X. Liu6, Suyun Huang7 & Zhimin Lu1,8,9 Pyruvate kinase M2 (PKM2) is expressed at high levels during embryonic development and tumour progression and is important for cell growth. However, it is not known whether it directly controls cell division. Here, we found that Aurora B phosphorylates PKM2, but not PKM1, at T45; this phosphorylation is required for PKM2’s localization and interaction with myosin light chain 2 (MLC2) in the contractile ring region of mitotic cells during cytokinesis. PKM2 phosphorylates MLC2 at Y118, which primes the binding of ROCK2 to MLC2 and subsequent ROCK2-dependent MLC2 S15 phosphorylation. PKM2-regulated MLC2 phosphorylation, which is greatly enhanced by EGF stimulation or EGFRvIII, K-Ras G12V and B-Raf V600E mutant expression, plays a pivotal role in cytokinesis, cell proliferation and brain tumour development. These findings underscore the instrumental function of PKM2 in oncogenic EGFR-, K-Ras- and B-Raf-regulated cytokinesis and tumorigenesis. 1 Brain Tumor Center and Department of Neuro-Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas 77030, USA. 2 Department of Cell and Developmental Biology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104, USA. 3 Department of Systems Biology, The University of Texas MD Anderson Cancer Center, Houston, Texas 77030, USA. 4 The M.O.E.
    [Show full text]
  • Genetic Testing for Inherited Cardiomyopathies and Channelopathies AHS – M2025
    Corporate Medical Policy Genetic Testing for Inherited Cardiomyopathies and Channelopathies AHS – M2025 File Name: genetic_testing_for_inherited_cardiomyopathies_and_channelopathies Origination: 01/2019 Last CAP Review: 04/2021 Next CAP Review: 04/2022 Last Review: 04/2021 Description of Procedure or Service Cardiomyopathies are diseases of the heart muscle. These conditions are frequently genetic and do not include muscle abnormalities caused by coronary artery disease, hypertension, valvular disease, and congenital heart disease. Symptoms include arrhythmia, cardiac dysfunction, and heart failure (Cooper, 2019). Channelopathies, also known as primary electrical disease, are a group of cardiac diseases caused by genetic defects in ion channels of the heart leading to arrhythmias, syncope, and the risk of sudden cardiac death (SCD) (Campuzano, Sarquella-Brugada, Brugada, & Brugada, 2015). Rela ted Policies Cardiovascular Disease Risk Assessment AHS – G2050 ***Note: This Medical Policy is complex and technical. For questions concerning the technical language and/or specific clinical indications for its use, please consult your physician. Policy BCBSNC will provide coverage for genetic testing for cardiomyopathies and channelopathies when it is determined the medical criteria or reimbursement guidelines below are met. Benefits Application This medical policy relates only to the services or supplies described herein. Please refer to the Member's Benefit Booklet for availability of benefits. Member's benefits may vary according to benefit design; therefore member benefit language should be reviewed before applying the terms of this medical policy. When Genetic Testing for Cardiac Ion Channelopathies is covered 1. Reimbursement for genetic counseling for genetic testing for inherited cardiomyopathies and channelopathies is allowed. Genetic counseling is required for individuals prior to and after undergoing genetic testing for inherited cardiomyopathies and channelopathies for diagnostic, carrier, and/or risk assessment purposes.
    [Show full text]
  • Proteomics Study on the Effect of Silybin on Cardiomyopathy in Obese
    www.nature.com/scientificreports OPEN Proteomics study on the efect of silybin on cardiomyopathy in obese mice Fei Wang1, Zelin Li1, Tiantian Song1, Yujiao Jia1, Licui Qi2, Luping Ren3 & Shuchun Chen4* Due to the increase in the number of obese individuals, the incidence of obesity-related complications such as cardiovascular disease and type 2 diabetes is higher. The aim of the present study was to explore the efects of silybin on protein expression in obese mice. Firstly, serum was collected, and it was used to detect serum lipids and other serological indicators. Secondly, total protein from epididymal adipose tissue was extracted for diferential expression analysis by quantitative tandem mass tag (TMT) combined with liquid chromatography-tandem mass spectrometry (LC–MS/MS), followed by bioinformatics and protein–protein interaction (PPI) network analyses of these proteins. Lastly, real-time polymerase chain reaction (RT-PCR) and parallel reaction monitoring (PRM) were used to further validate the expression of identifed diferentially expressed proteins (DEPs) at the mRNA and protein level, respectively. The results revealed that silybin could improve abnormal lipid metabolism caused by the high fat diet in obese mice. A total of 341, 538 and 243 DEPs were found in the high fat/control (WF/WC), silybin/high fat (WS/WF) and WS/WC groups, respectively. These DEPs mainly participated in lipid metabolism and energy metabolism. Notably, tropomyosin 1 (TPM1), myosin light chain 2 (MYL2), myosin heavy chain 11 (MYH11) and other DEPs were involved in hypertrophic cardiomyopathy, dilated cardiomyopathy and other pathways. Silybin could protect cardiac function by inducing the protein expression of TPM1, MYL2 and MYH11 in the adipose tissue of obese mice.
    [Show full text]
  • Prevalence and Distribution of Sarcomeric Gene Mutations in Japanese Patients with Familial Hypertrophic Cardiomyopathy
    Advance Publication by J-STAGE Circulation Journal Official Journal of the Japanese Circulation Society http://www.j-circ.or.jp Prevalence and Distribution of Sarcomeric Gene Mutations in Japanese Patients With Familial Hypertrophic Cardiomyopathy Haruna Otsuka, BSc; Takuro Arimura, PhD; Tadaaki Abe, MD; Hiroya Kawai, MD; Yoshiyasu Aizawa, MD; Toru Kubo, MD; Hiroaki Kitaoka, MD; Hiroshi Nakamura, MD; Kazufumi Nakamura, MD; Hiroshi Okamoto, MD; Fukiko Ichida, MD; Mamoru Ayusawa, MD; Shinichi Nunoda, MD; Mitsuaki Isobe, MD; Masunori Matsuzaki, MD; Yoshinori L. Doi, MD; Keiichi Fukuda, MD; Taishi Sasaoka, MD; Toru Izumi, MD; Naoto Ashizawa, MD; Akinori Kimura, MD Background: Hypertrophic cardiomyopathy (HCM), which is inherited as an autosomal dominant trait, is the most prevalent hereditary cardiac disease. Although there are several reports on the systematic screening of mutations in the disease-causing genes in European and American populations, only limited information is available for Asian populations, including Japanese. Methods and Results: Genetic screening of disease-associated mutations in 8 genes for sarcomeric proteins, MYH7, MYBPC3, MYL2, MYL3, TNNT2, TNNI3, TPM1, and ACTC, was performed by direct sequencing in 112 unre- lated Japanese proband patients with familial HCM; 37 different mutations, including 13 novel ones in 5 genes, MYH7, MYBPC3, TNNT2, TNNI3, and TPM1, were identified in 49 (43.8%) patients. Among them, 3 carried compound het- erozygous mutations in MYBPC3 or TNNT2. The frequency of patients carrying the MYBPC3, MYH7, and TNNT2 mutations were 19.6%, 10.7%, and 8.9%, respectively, and the most frequently affected genes in the northeastern and southwestern parts of Japan were MYBPC3 and MYH7, respectively.
    [Show full text]