View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Crossref Heart Vessels (2013) 28:785–794 DOI 10.1007/s00380-013-0332-3 ORIGINAL ARTICLE Mutations in the cardiac troponin T gene show various prognoses in Japanese patients with hypertrophic cardiomyopathy Etsuko Fujita • Toshio Nakanishi • Tsutomu Nishizawa • Nobuhisa Hagiwara • Rumiko Matsuoka Received: 2 April 2012 / Accepted: 15 February 2013 / Published online: 14 March 2013 Ó The Author(s) 2013. This article is published with open access at Springerlink.com Abstract Hypertrophic cardiomyopathy (HCM) is an Arg92Trp mutation, and one individual of another family autosomal dominant disorder resulting from mutations in had a new mutation, Ile79Thr, of TNNT2. The phenotype genes for at least 15 various sarcomere-related proteins of each family was often different from reported cases, including cardiac b-myosin heavy chain, cardiac myosin- even if they had the same genetic mutation. In addition, binding protein C, and cardiac troponin T. The troponin families with the same genetic mutation showed a similar T gene (TNNT2) mutation has the third incidence of trend in the phenotype, but it was not exactly the same. familial HCM, and the genotype–phenotype correlation However, sudden death in youth was observed in all of of this gene still remains insufficient in Japanese familial these families. Although the type of genetic mutation is HCM. Therefore, in the present study, we focused on not useful for predicting prognosis in HCM, the possi- screening the TNNT2 mutation in 173 unrelated Japanese bility of sudden cardiac death remains. Therefore, the patients with familial HCM, and found three reported prognosis of individuals bearing the TNNT2 mutation mutations and a new mutation of TNNT2 in 11 individ- with familial HCM should be more carefully observed uals from four families. In these families, two individuals from birth. from one family had double mutations, Arg130Cys and Phe110Ile, six individuals from two other families had an Keywords Familial hypertrophic cardiomyopathy Á TNNT2 gene Á Mutation Á Phenotype–genotype E. Fujita Á N. Hagiwara Department of Cardiology, Tokyo Women’s Medical University, Tokyo, Japan Introduction T. Nakanishi Á R. Matsuoka Hypertrophic cardiomyopathy (HCM) is characterized by Department of Pediatric Cardiology, Tokyo Women’s Medical University, Tokyo, Japan left and/or right ventricular hypertrophy, with predominant involvement of the interventricular septum in the absence T. Nishizawa Á R. Matsuoka of other causes of hypertrophy, such as hypertension, val- International Research and Educational Institute for Integrated vular heart disease, or metabolic disease [1–7]. Medical Sciences (IREIMS), Tokyo Women’s Medical University, Tokyo, Japan Familial HCM is an autosomal dominant disorder caused by mutations in genes that encode sarcomere pro- R. Matsuoka teins. It has been reported that at least 15 genes are Division of Genomic Medicine, Institute of Advanced implicated in 55–70 % of HCM, and the major genes Biomedical Engineering and Science, Graduate School of Medicine, Tokyo Women’s Medical University, Tokyo, Japan causing HCM include cardiac b-myosin heavy chain (MYH7), a-tropomyosin, cardiac troponin T (TNNT2), R. Matsuoka (&) cardiac myosin-binding protein C (MYBPC3), cardiac tro- International Center for Molecular, Cellular, and Immunological ponin I (TNNI3), cardiac myosin regulatory light chains Research (IMCIR), Tokyo Women’s Medical University, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666, Japan (MYL2), and cardiac myosin essential light chains (MYL3) e-mail: [email protected] [1, 4, 5, 8–11]. 123 786 Heart Vessels (2013) 28:785–794 Cardiac troponin T is a thin-filament protein that takes this gene still remains insufficient in Japanese familial part in muscle contraction. The troponin complex on the HCM. Therefore, in the present study we focused on actin filament regulates the force and velocity of muscle screening the TNNT2 mutation. contraction. Troponin C functions as a calcium receptor while troponin I inhibits adenosine triphosphatase (ATP- ase) activity when bound to actin. Troponin T fixes the Patients and methods troponin group to tropomyosin. During relaxation, the troponin group is bound to actin and tropomyosin, blocking Subjects the interaction of myosin and actin [12]. TNNT2 was mapped to chromosome 1q32. Mutations of We genetically evaluated 173 patients (101 men and 72 TNNT2 were thought to account for approximately 15 % of women; 0–79 years old, median age 20 years) who were familial HCM, with most missense mutations located in clinically diagnosed with familial HCM. exons 8–16 [3], and were associated with a particularly Pediatric patients with HCM were recruited from Tokyo severe form of the disease characterized by a poor overall Women’s Medical University. Written informed consent prognosis with a high incidence of sudden death despite was obtained from all study subjects in accordance with the only mild left ventricular hypertrophy (LVH) [1–4]. Most Declaration of Helsinki. If patients were younger than 16 TNNT2 mutations of familial HCM alter the contractile years, informed consent was given by their guardians. We properties of cardiac muscle, especially the Ca2? sensi- assessed each patient by taking their history and perform- tivity of force development and ATPase activity in vitro ing a physical examination, and reviewed their medical and in vivo [13–17]. records. All assessments were done with the approval of Previous reports have suggested that there is a more the Ethics Committees of Tokyo Women’s Medical consistent relationship between certain genetic mutations University. and clinical outcome, allowing for the classification of The diagnosis of HCM was determined through clinical ‘‘benign’’ and ‘‘malignant’’ mutations [18–30]. For exam- evaluation, chest radiography, electrocardiography, echo- ple, a favorable prognosis has been reported in patients cardiography, and cardiac catheterization based on current with a Phe110Ile mutation of the TNNT2 mutation (in 16 international consensus criteria. individuals of 6 Japanese families) [19, 20]. From these Diseases of the heart, hypertension, valvular heart dis- data, genetic analysis and determination of genotype were ease, or metabolic disease attributable to HCM were thought to be important for assisting with patient excluded from this study by pediatric cardiologists. management. However, these findings were based on limited experi- Mutation screenings ence; to date, only 30 different mutations have been identified in TNNT2 [9–11, 18]. In addition to this genetic Genomic DNA was prepared from peripheral blood lym- diversity, the phenotypic expression of these mutations phocytes or lymphoblast cell lines transformed by the varies considerably, ranging from asymptomatic individu- Epstein–Barr virus, as described previously [33]. TNNT2 als with a normal life expectancy to those with sudden coding regions and exon–intron boundaries, including cardiac death or the need for an early heart transplant. regions approximately 30–100 bp upstream and down- Clinical parameters such as the degree of LVH, the pres- stream from the exons, were amplified from genomic DNA ence or absence of a left ventricular outflow tract gradient, using primers, as described in previous reports [34, 35]. and electrophysiology testing have not been predictive Genomic DNA (50 ng) was amplified through the use of markers of poor prognosis [1–5]. More recently, it was primers designed from flanking intron sequences (Table 1). reported that late gadolinium enhancement with cardiac Amplified products were purified using a MultiScreen magnetic resonance can be a predictive marker of the polymerase chain reaction (PCR) plate (Millipore, Bille- ventricular arrhythmia and poor prognosis in HCM [31]. rica, MA, USA) and directly sequenced using the ABI- In recent years, mutation-specific risk stratification was PRISM BigDye-terminator cycle sequencing reaction kit considered to be not possible, but genetic test-based risk and ABI 3130xl genetic analyzer (Applied Biosystems, stratification seemed to be clinically informative [32]. Foster City, CA, USA). When a mutation was detected, we The TNNT2 mutation has the third-ranked incidence of confirmed that it was not presenting 363 Japanese normal familial HCM, and the genotype–phenotype correlation of chromosomes by direct sequencing. 123 Heart Vessels (2013) 28:785–794 787 Table 1 Primers used for Exon Forward (50–30) Reverse (50–30) amplification of fragments from TNNT2 2 GAGCTCTTCTGAGGAAGGCA CTACCCAGAATCCGAGGGAC 3 and 4 CAGGGCAGCGTGGACTCCC CCCAGGGCTCCCAGGATTT 5 CCATTCTCTGCTCTGGGTTC GTGCACATGGGAAAGCTGTTCT 6 TAGGGCTTATCTGTGGGGAAGGC CTTCCCTGGAAAGAGCACTG 7 GAAATGGAAATCCACAGGGA TACTGCACCCCGTTCCATCA 8 and 9 CTCTAGGAAGGATCAGGGCCC CTCACAAAAGGGATGGAGGA 10 GCGATGTCACCTTCTCCCTA CACCGCACCCGGCCAATA 11 GGTTTCCAATCCTTTCCCCTAA GCTGCAGTGGACACCTCATTC 12 GCCTTTGTCTTCCTGCCTTCTC CAGCCAGCCCAATCTCTTCACT 13 ACAGGGAGGGGGCAATCTGGCC CCCAGAGCAGATGCGGGCAGTG 14 ACTGGGTGCTGCCGTCTGGTC AAGGGGGCTGTTGGGGAATAGG 15 CACTCAGCCCCCTTCTCC AAGCTTCTCCGCCCCACATTTC 16 GGCACCCCAGTCCTACCC GTCCCCCTCAACAGCACTTTT The PCR conditions of these genes were modified and mother and mother’s family had no symptoms or abnormal fragments were analyzed by electrophoresis, as described findings. The proband and her brother and father (Fig. 1; previously [36, 37]. III-2, III-1, I-2) showed mild LVH (maximum wall thick- Proband patients bearing TNNT2 mutations were addi- ness \20 mm).