Using Microsatellite Analysis to Verify Breeding Records

REPORTS BREEDING, CULTIVARS, ROOTSTOCKS, AND GERMPLASM RESOURCES HORTSCIENCE 40(1):15–17. 2005. Breeding records for ‘Honeycrisp’ indicated that this cultivar came from a cross between ‘Honeygold’ (another University of Minnesota Using Microsatellite Analysis to cultivar) and ‘Macoun’. The dissimilarity of ‘Honeycrisp’ to these reported parents based Verify Breeding Records: A study of on several fruit characteristics (Tong et al., 1999) caused us to speculate that this recorded ‘Honeycrisp’ and Other Cold-hardy parentage might be incorrect. In the course of this research we were also able to confirm or reject the parentage indicated Apple Cultivars by breeding records for several varieties and to Paul R. Cabe1 identify putative parents in some cases where parentage was unknown or suspect, notably Biology Department, Washington and Lee University, Lexington, VA 24450 for ‘Haralson,’ one of the other most important Andrew Baumgarten and Kyle Onan introductions from the University of Minnesota breeding program. Breeding records indicated Biology Department, St. Olaf College, Northfield MN 55057 that ‘Malinda’ was the female parent of ‘Haral- James J. Luby son’ but the male parent was unknown as the Department of Horticulture Science, University of Minnesota, 1970 Folwell seed resulted from open pollination. Avenue, St. Paul, MN 55108 Materials and Methods David S. Bedford Cultivars examined and DNA Extraction. Department of Horticulture Science, Horticultural Research Center, 600 We examined ‘Honeycrisp’, its presumed par- Arboretum Boulevard, Excelsior, MN 55331 ents ‘Honeygold’ and ‘Macoun’, and a number of other cultivars and breeding selections from Additional index words. ‘Haralson,’ ‘Connell Red,’ ‘Macoun,’ ‘Honeygold,’ DNA, SSR, STR the University of Minnesota breeding program. Abstract. We used microsatellite loci to investigate the parentage of the apple cultivar DNA was extracted from fresh leaf tissue fol- ‘Honeycrisp’, a patented University of Minnesota introduction. In an attempt to find the lowing protocols in Doyle and Doyle (1990). correct parents, we also examined other apple varieties associated with the University Leaves were obtained from the University of of Minnesota apple breeding program. Based on written records from the 1960s, the Minnesota Horticultural Research Center in presumed parents of ‘Honeycrisp’ were ‘Honeygold’ and ‘Macoun’. We were able to Excelsior, Minnesota or the National Germ- exclude both of these as parents, but found that ‘Keepsake’ was consistent as one of the plasm Repository in Geneva, N.Y. For each parents. A second potential parent could not be discovered. ‘Haralson’, another com- extraction, one gram of tissue was ground mercially important cultivar from the University of Minnesota, is likely from a cross under liquid nitrogen. between ‘Malinda’ and ‘Wealthy’. Amplification of microsatellite loci. We amplified eleven microsatellite loci Despite anecdotal evidence, and even x domestica) to develop fingerprints that permit (Table 1) using the polymerase chain reac- breeding records, the origin of many important unique identity of several cultivars developed tion (PCR). We used microsatellite primers plant cultivars remains unknown or uncertain. in the University of Minnesota apple breeding GD12, GD15, GD96, GD142 (Hokanson Current genetic techniques now allow specific program since the 1920s. et al., 1998), 02b1, 05g8, 23g4 (Guilford et testing of putative parents, and can be used We began this research to confirm the al., 1997), CH02B10, CH02C06, CH01G12, to identify parents in cases where nothing parents of the University of Minnesota apple and CH01H02 (Gianfranceschi et al., 1998); is known. Microsatellites, a type of DNA ‘Honeycrisp’ using these genetic techniques. primers were chosen with preference for loci sequence also termed simple-sequence repeat (SSR) or short tandem repeat (STR) markers, Table 1. Primer sequences and dilutions used for each locus in this report. are ideal for this purpose. For instance, micro- Fluorescent Dilution satellite analysis has been used to identify the Locus Primer sequence Reference label PCR : H2O parentage of many wine grape varieties (Bow- GD12 F: TTgAggTgTTTCTCCCATTggA ers et al., 1999). Microsatellite profiles can also R: CTAACgAAgCCgCCATTTCTTT 1 6-FAM 1:50 be used as fingerprints of varieties that have GD15 F: CgAAAgTgAgCAACgAACTCC uses such as avoiding mislabeling of nursery R: ACTCCATCATCgggTggTg 1 HEX 1:40 GD96 F: CggCggAAAgCAATCACCT stock. In this study, we used microsatellite loci R: gCCAgCCCTCTATggTTCCAgA 1 TET 1:30 previously developed for use in apples (Malus GD142 F: ggCACCCAAgCCCCTAA R:ggAACCTACgACAgCAAAgTTACA 1 6-FAM 1:40 Received for publication 8 Mar. 2004. Accepted for 02b1 F: CCgTgATgACAAAgTgCA TgA publication 31 May 2004. We thank Stan Hokanson R: ATgAgTTTgATgCCCTTggA 2 6-FAM 1:50 and Amy Szewc-McFadden for technical advice 05g8 F: CggCCATCgATTATCTTACTCTT on their microsatellite protocols, Lisa Connors for R:ggATCAATGCACTgAAATAAACg 2 HEX 1:50 help with the microsatellite data collection, and the 23g4 F: TTTCTCTCTCTTTCCCAACTC staff of the USDA-ARS National Plant Germplasm R: AgCCgCCTTgCATTAAATAC 2 HEX 1:5 Repository for help in obtaining samples. This work CH02B10 L: CAAggAAATCATCAAAgATTCAAg was funded in part by St. Olaf College, Washington R:CAAgTggCTTCggATAgTTg 3 TET 1:32 and Lee University, and the Office of Patents and CH02C06 L: TgACgAAATCCACTACTAATgCA Technology Marketing, University of Minnesota. R: gATTgCgCgCTTTTTAACAT 3 6-FAM 1:16 Mention of a trademark, proprietary product, or CH01G12 F: CCC ACC AAT CAA AAA TCA CC vendor does not constitute a guarantee or warranty R: TgA AgT ATg gTg gTg CgT TC 3 TET 1:32 of the product by the U.S. Dept. of Agriculture and CH01H02 L: AgA gCT TCg AgC TTC gTT Tg does not imply its approval to the exclusion of other R: ATC TTT Tgg TgC TCC CAC AC 3 6-FAM 1:32 products or vendors that also may be suitable. 1Hokanson et al., 1998. 1To whom reprint requests should be addressed; 2Guilford et al., 1997. e-mail [email protected]. 3Gianfreschi et al. 1998. HORTSCIENCE VOL. 40(1) FEBRUARY 2005 15 with high heterozygosity and allelic diversity. range were clearly visible (data not shown). 2. The average exclusion probability over Forward primers were labeled with either HEX, Electrophoresis of PCR-generated DNA the ten loci presented is 0.998, meaning only TET, or FAM (IDT DNA, Coralville, Iowa). fragments. Products from successful PCR 0.2% of randomly drawn cultivars could not The primers were used in conjunction with reactions were diluted (Table 1), and sent to a be excluded in any given comparison. standard PCR kits from Promega Corporation commercial laboratory (Advanced Center for (Madison, Wis.). The reactions contained 1.5 Genetic Analysis, University of Minnesota, Discussion mM MgCl2, 15 pmol of each primer, and 0.8 USA) for size analysis using an ABI Prism µL of template DNA (as described above), in 377 sequencer. For ‘Honeycrisp’, a brief inspection of a total reaction volume of 20 µL. Reactions Data analysis. Fragment sizing was done genotypes casts immediate doubt on the puta- used a manual hot start approach: the reaction using the program Genescan, and genotypes tive attribution. ‘Honeygold’ can be excluded mix was heated to 95 °C for 5 min, and 1 unit determined using Genotyper (Applied Bio- as a parent by two loci, and ‘Macoun’ can be (0.2 µL) of Taq DNA polymerase was added systems, Foster City, Calif.). Fragment sizes excluded by at least five loci. After obtaining to each reaction. were rounded to the nearest whole integer, this result, a number of other potential parents In general, amplification conditions were and grouped into allele groups. Each putative were checked; potential parents were identi- based on published protocols. Primers from or possible parentage assignment was manu- fied by searching University of Minnesota Guilford et al. (1997) and Hokanson et al. ally inspected; an assignment was considered breeding archives for other cultivars used in (1998) used a manual hot start with cycling supported if all loci were consistent with the crosses. A number of potential cultivars were parameters given below. Primer sets GD12, hypothesis of parentage. We were cognizant of excluded, including MN1607, ‘Spartan’, GD15, and GD96 were amplified with identical the problems introduced by null alleles, but did ‘Goodland’ (data not shown), and ‘Connell cycling parameters: initial denaturation at 96 not find any evidence of these in the data. Red’, all parents of seed progenies that were °C, followed by 35 cycles of 94 °C for 1 min The statistical power to exclude parents planted adjacent to the original seedling tree (denaturation), 52 °C for 2 min (annealing), is based on the number and frequencies of of ‘Honeycrisp’ according to field maps (data and 72 °C for 2 min (elongation), followed the alleles and the number of loci examined; not shown). Eventually, ‘Keepsake’ was by a final elongation period of 72 °C for 10 typically, loci with many alleles at about equal found to be genetically consistent as a parent min. Primer sets 02b1, 05g8, and 23g4 were frequency give the greatest power to exclude of ‘Honeycrisp,’ and this University of Min- initially denatured at 94 °C, followed by 35 parents. We calculated the average exclusion nesota cultivar would have been available for cycles of 94 °C for 40 s, 52 °C for 40 s, 72 °C probability over the ten variable loci to exclude breeding at that time. Additional information for 20 s, followed by a 10-min extension at a single parent where the other parent is not can be gleaned by examining the microsatel- 72 °C. Primer set GD142 used a touchdown known using the approach of Jamieson and lite genotype of MN1708, which, according to profile following an initial denaturation at 94 Taylor (1997). This is the most conservative selection records, was located only a few trees °C: denaturation cycles of 94 °C for 1 min approach since it is easier to exclude one away in the same orchard row and derived from and elongation cycles of 72 °C for 45 s were potential parent if the other is known.

Load more