Using Microsatellite Analysis to Verify Breeding Records

Total Page:16

File Type:pdf, Size:1020Kb

Load more

REPORTS BREEDING, CULTIVARS, ROOTSTOCKS, AND GERMPLASM RESOURCES HORTSCIENCE 40(1):15–17. 2005. Breeding records for ‘Honeycrisp’ indicated that this cultivar came from a cross between ‘Honeygold’ (another University of Minnesota Using Microsatellite Analysis to cultivar) and ‘Macoun’. The dissimilarity of ‘Honeycrisp’ to these reported parents based Verify Breeding Records: A study of on several fruit characteristics (Tong et al., 1999) caused us to speculate that this recorded ‘Honeycrisp’ and Other Cold-hardy parentage might be incorrect. In the course of this research we were also able to confirm or reject the parentage indicated Apple Cultivars by breeding records for several varieties and to Paul R. Cabe1 identify putative parents in some cases where parentage was unknown or suspect, notably Biology Department, Washington and Lee University, Lexington, VA 24450 for ‘Haralson,’ one of the other most important Andrew Baumgarten and Kyle Onan introductions from the University of Minnesota breeding program. Breeding records indicated Biology Department, St. Olaf College, Northfield MN 55057 that ‘Malinda’ was the female parent of ‘Haral- James J. Luby son’ but the male parent was unknown as the Department of Horticulture Science, University of Minnesota, 1970 Folwell seed resulted from open pollination. Avenue, St. Paul, MN 55108 Materials and Methods David S. Bedford Cultivars examined and DNA Extraction. Department of Horticulture Science, Horticultural Research Center, 600 We examined ‘Honeycrisp’, its presumed par- Arboretum Boulevard, Excelsior, MN 55331 ents ‘Honeygold’ and ‘Macoun’, and a number of other cultivars and breeding selections from Additional index words. ‘Haralson,’ ‘Connell Red,’ ‘Macoun,’ ‘Honeygold,’ DNA, SSR, STR the University of Minnesota breeding program. Abstract. We used microsatellite loci to investigate the parentage of the apple cultivar DNA was extracted from fresh leaf tissue fol- ‘Honeycrisp’, a patented University of Minnesota introduction. In an attempt to find the lowing protocols in Doyle and Doyle (1990). correct parents, we also examined other apple varieties associated with the University Leaves were obtained from the University of of Minnesota apple breeding program. Based on written records from the 1960s, the Minnesota Horticultural Research Center in presumed parents of ‘Honeycrisp’ were ‘Honeygold’ and ‘Macoun’. We were able to Excelsior, Minnesota or the National Germ- exclude both of these as parents, but found that ‘Keepsake’ was consistent as one of the plasm Repository in Geneva, N.Y. For each parents. A second potential parent could not be discovered. ‘Haralson’, another com- extraction, one gram of tissue was ground mercially important cultivar from the University of Minnesota, is likely from a cross under liquid nitrogen. between ‘Malinda’ and ‘Wealthy’. Amplification of microsatellite loci. We amplified eleven microsatellite loci Despite anecdotal evidence, and even x domestica) to develop fingerprints that permit (Table 1) using the polymerase chain reac- breeding records, the origin of many important unique identity of several cultivars developed tion (PCR). We used microsatellite primers plant cultivars remains unknown or uncertain. in the University of Minnesota apple breeding GD12, GD15, GD96, GD142 (Hokanson Current genetic techniques now allow specific program since the 1920s. et al., 1998), 02b1, 05g8, 23g4 (Guilford et testing of putative parents, and can be used We began this research to confirm the al., 1997), CH02B10, CH02C06, CH01G12, to identify parents in cases where nothing parents of the University of Minnesota apple and CH01H02 (Gianfranceschi et al., 1998); is known. Microsatellites, a type of DNA ‘Honeycrisp’ using these genetic techniques. primers were chosen with preference for loci sequence also termed simple-sequence repeat (SSR) or short tandem repeat (STR) markers, Table 1. Primer sequences and dilutions used for each locus in this report. are ideal for this purpose. For instance, micro- Fluorescent Dilution satellite analysis has been used to identify the Locus Primer sequence Reference label PCR : H2O parentage of many wine grape varieties (Bow- GD12 F: TTgAggTgTTTCTCCCATTggA ers et al., 1999). Microsatellite profiles can also R: CTAACgAAgCCgCCATTTCTTT 1 6-FAM 1:50 be used as fingerprints of varieties that have GD15 F: CgAAAgTgAgCAACgAACTCC uses such as avoiding mislabeling of nursery R: ACTCCATCATCgggTggTg 1 HEX 1:40 GD96 F: CggCggAAAgCAATCACCT stock. In this study, we used microsatellite loci R: gCCAgCCCTCTATggTTCCAgA 1 TET 1:30 previously developed for use in apples (Malus GD142 F: ggCACCCAAgCCCCTAA R:ggAACCTACgACAgCAAAgTTACA 1 6-FAM 1:40 Received for publication 8 Mar. 2004. Accepted for 02b1 F: CCgTgATgACAAAgTgCA TgA publication 31 May 2004. We thank Stan Hokanson R: ATgAgTTTgATgCCCTTggA 2 6-FAM 1:50 and Amy Szewc-McFadden for technical advice 05g8 F: CggCCATCgATTATCTTACTCTT on their microsatellite protocols, Lisa Connors for R:ggATCAATGCACTgAAATAAACg 2 HEX 1:50 help with the microsatellite data collection, and the 23g4 F: TTTCTCTCTCTTTCCCAACTC staff of the USDA-ARS National Plant Germplasm R: AgCCgCCTTgCATTAAATAC 2 HEX 1:5 Repository for help in obtaining samples. This work CH02B10 L: CAAggAAATCATCAAAgATTCAAg was funded in part by St. Olaf College, Washington R:CAAgTggCTTCggATAgTTg 3 TET 1:32 and Lee University, and the Office of Patents and CH02C06 L: TgACgAAATCCACTACTAATgCA Technology Marketing, University of Minnesota. R: gATTgCgCgCTTTTTAACAT 3 6-FAM 1:16 Mention of a trademark, proprietary product, or CH01G12 F: CCC ACC AAT CAA AAA TCA CC vendor does not constitute a guarantee or warranty R: TgA AgT ATg gTg gTg CgT TC 3 TET 1:32 of the product by the U.S. Dept. of Agriculture and CH01H02 L: AgA gCT TCg AgC TTC gTT Tg does not imply its approval to the exclusion of other R: ATC TTT Tgg TgC TCC CAC AC 3 6-FAM 1:32 products or vendors that also may be suitable. 1Hokanson et al., 1998. 1To whom reprint requests should be addressed; 2Guilford et al., 1997. e-mail [email protected]. 3Gianfreschi et al. 1998. HORTSCIENCE VOL. 40(1) FEBRUARY 2005 15 with high heterozygosity and allelic diversity. range were clearly visible (data not shown). 2. The average exclusion probability over Forward primers were labeled with either HEX, Electrophoresis of PCR-generated DNA the ten loci presented is 0.998, meaning only TET, or FAM (IDT DNA, Coralville, Iowa). fragments. Products from successful PCR 0.2% of randomly drawn cultivars could not The primers were used in conjunction with reactions were diluted (Table 1), and sent to a be excluded in any given comparison. standard PCR kits from Promega Corporation commercial laboratory (Advanced Center for (Madison, Wis.). The reactions contained 1.5 Genetic Analysis, University of Minnesota, Discussion mM MgCl2, 15 pmol of each primer, and 0.8 USA) for size analysis using an ABI Prism µL of template DNA (as described above), in 377 sequencer. For ‘Honeycrisp’, a brief inspection of a total reaction volume of 20 µL. Reactions Data analysis. Fragment sizing was done genotypes casts immediate doubt on the puta- used a manual hot start approach: the reaction using the program Genescan, and genotypes tive attribution. ‘Honeygold’ can be excluded mix was heated to 95 °C for 5 min, and 1 unit determined using Genotyper (Applied Bio- as a parent by two loci, and ‘Macoun’ can be (0.2 µL) of Taq DNA polymerase was added systems, Foster City, Calif.). Fragment sizes excluded by at least five loci. After obtaining to each reaction. were rounded to the nearest whole integer, this result, a number of other potential parents In general, amplification conditions were and grouped into allele groups. Each putative were checked; potential parents were identi- based on published protocols. Primers from or possible parentage assignment was manu- fied by searching University of Minnesota Guilford et al. (1997) and Hokanson et al. ally inspected; an assignment was considered breeding archives for other cultivars used in (1998) used a manual hot start with cycling supported if all loci were consistent with the crosses. A number of potential cultivars were parameters given below. Primer sets GD12, hypothesis of parentage. We were cognizant of excluded, including MN1607, ‘Spartan’, GD15, and GD96 were amplified with identical the problems introduced by null alleles, but did ‘Goodland’ (data not shown), and ‘Connell cycling parameters: initial denaturation at 96 not find any evidence of these in the data. Red’, all parents of seed progenies that were °C, followed by 35 cycles of 94 °C for 1 min The statistical power to exclude parents planted adjacent to the original seedling tree (denaturation), 52 °C for 2 min (annealing), is based on the number and frequencies of of ‘Honeycrisp’ according to field maps (data and 72 °C for 2 min (elongation), followed the alleles and the number of loci examined; not shown). Eventually, ‘Keepsake’ was by a final elongation period of 72 °C for 10 typically, loci with many alleles at about equal found to be genetically consistent as a parent min. Primer sets 02b1, 05g8, and 23g4 were frequency give the greatest power to exclude of ‘Honeycrisp,’ and this University of Min- initially denatured at 94 °C, followed by 35 parents. We calculated the average exclusion nesota cultivar would have been available for cycles of 94 °C for 40 s, 52 °C for 40 s, 72 °C probability over the ten variable loci to exclude breeding at that time. Additional information for 20 s, followed by a 10-min extension at a single parent where the other parent is not can be gleaned by examining the microsatel- 72 °C. Primer set GD142 used a touchdown known using the approach of Jamieson and lite genotype of MN1708, which, according to profile following an initial denaturation at 94 Taylor (1997). This is the most conservative selection records, was located only a few trees °C: denaturation cycles of 94 °C for 1 min approach since it is easier to exclude one away in the same orchard row and derived from and elongation cycles of 72 °C for 45 s were potential parent if the other is known.
Recommended publications
  • Germplasm Sets and Standardized Phenotyping Protocols for Fruit Quality Traits in Rosbreed

    Germplasm Sets and Standardized Phenotyping Protocols for Fruit Quality Traits in Rosbreed

    Germplasm Sets and Standardized Phenotyping Protocols for Fruit Quality Traits in RosBREED Jim Luby, Breeding Team Leader Outline of Presentation RosBREED Demonstration Breeding Programs Standardized Phenotyping Protocols Reference Germplasm Sets SNP Detection Panels Crop Reference Set Breeding Pedigree Set RosBREED Demonstration Breeding Programs Clemson U WSU Texas A&M UC Davis U Minn U Arkansas Rosaceae Cornell U WSU MSU MSU Phenotyping Affiliates USDA-ARS Driscolls Corvallis Univ of Florida UNH Standardized Phenotyping Protocols Traits and Standardized Phenotyping Protocols • Identify critical fruit quality traits and other important traits • Develop standardized phenotyping protocols to enable data pooling across locations/institutions • Protocols available at www.RosBREED.org Apple Standardized Phenotyping Firmness, Crispness – Instrumental, Sensory Sweetness, Acidity – Intstrumental, Sensory Color, Appearance, Juiciness, Aroma – Sensory At harvest Cracking, Russet, Sunburn Storage 10w+7d Storage 20w+7d Maturity Fruit size 5 fruit (reps) per evaluation Postharvest disorders Harvest date, Crop, Dropping RosBREED Apple Phenotyping Locations Wenatchee, WA St Paul, MN Geneva, NY • One location for all evaluations would reduce variation among instruments and evaluators • Local evaluations more sustainable and relevant for future efforts at each institution • Conduct standardized phenotyping of Germplasm Sets at respective sites over multiple (2-3) seasons • Collate data in PBA format, conduct quality control, archive Reference
  • BIX Minnesota Grown Apples Local 2018 Local Availability Apples

    BIX Minnesota Grown Apples Local 2018 Local Availability Apples

    BIX BIX Minnesota Grown Apples Local 2018 Local Availability Apples *Apple varieties & availability vary per orchard and growing conditions. These are approximate starting times for your favorite varieties. Paula Reds Honeycrisp An early season favorite, this apple is great for A great mid-season apple with a crispy and juicy cooking and eating, as it is not too tart and not texture makes Honeycrisp a customer favorite! to sweet. Available week of 9/17 Available week of 8/27 BIX Item #1000 #1021 BIX Item #1050 SweeTango Zestar Great for salads, this variety is sweet, juicy, & crisp. One of the newest varieties from the U of M, *Pepin Heights Orchard Exclusive variety* this early season apple has a crisp, juicy texture and a zesty flavor with a hint of brown sugar. Available week of 9/3 Available week of 9/3 BIX Item #1385 BIX Item #1320 Haralson Still Midwest’s favorite baking apple, it will be Riverbelle perfect for your Grandma’s Apple Pie recipe! This variety makes for a good all purpose apple, with sweet flavor and great crispness. Available week of 10/8 *Very limited availability, but large in size!* BIX Item #1015 #1200 Available week of 9/10 Pazazz BIX Item #1376 Perfect balance of brix and starch; explosive crunch; very sweet with McIntosh a subtle tart flavor, similar to a honeycrisp. This variety is a smaller apple with red and green tender flesh. This apples is great for pies, Available week of 10/29 cider and applesauce, as well as school lunches. BIX Item #1311 Available week of 9/14 Apple Cider BIX Item #1310 #1500 Apple Cider Cortland Fresh pressed cider to capture the flavors This variety is versatile and is a perfect and aromas of the apple harvest season.
  • Apples: Organic Production Guide

    Apples: Organic Production Guide

    A project of the National Center for Appropriate Technology 1-800-346-9140 • www.attra.ncat.org Apples: Organic Production Guide By Tammy Hinman This publication provides information on organic apple production from recent research and producer and Guy Ames, NCAT experience. Many aspects of apple production are the same whether the grower uses low-spray, organic, Agriculture Specialists or conventional management. Accordingly, this publication focuses on the aspects that differ from Published nonorganic practices—primarily pest and disease control, marketing, and economics. (Information on March 2011 organic weed control and fertility management in orchards is presented in a separate ATTRA publica- © NCAT tion, Tree Fruits: Organic Production Overview.) This publication introduces the major apple insect pests IP020 and diseases and the most effective organic management methods. It also includes farmer profiles of working orchards and a section dealing with economic and marketing considerations. There is an exten- sive list of resources for information and supplies and an appendix on disease-resistant apple varieties. Contents Introduction ......................1 Geographical Factors Affecting Disease and Pest Management ...........3 Insect and Mite Pests .....3 Insect IPM in Apples - Kaolin Clay ........6 Diseases ........................... 14 Mammal and Bird Pests .........................20 Thinning ..........................20 Weed and Orchard Floor Management ......20 Economics and Marketing ........................22 Conclusion
  • An Old Rose: the Apple

    An Old Rose: the Apple

    This is a republication of an article which first appeared in the March/April 2002 issue of Garden Compass Magazine New apple varieties never quite Rosaceae, the rose family, is vast, complex and downright confusing at times. completely overshadow the old ones because, as with roses, a variety is new only until the next This complexity has no better exemplar than the prince of the rose family, Malus, better known as the variety comes along and takes its apple. The apple is older in cultivation than the rose. It presents all the extremes in color, size, fragrance place. and plant character of its rose cousin plus an important added benefit—flavor! One can find apples to suit nearly every taste and cultural demand. Without any special care, apples grow where no roses dare. Hardy varieties like the Pippins, Pearmains, Snow, Lady and Northern Spy have been grown successfully in many different climates across the U.S. With 8,000-plus varieties worldwide and with new ones introduced annually, apple collectors in most climates are like kids in a candy store. New, Favorite and Powerhouse Apples New introductions such as Honeycrisp, Cameo and Pink Lady are adapted to a wide range of climates and are beginning to be planted in large quantities. The rich flavors of old favorites like Spitzenburg and Golden Russet Each one is a unique eating experience that are always a pleasant surprise for satisfies a modern taste—crunchy firmness, plenty inexperienced tasters. of sweetness and tantalizing flavor. Old and antique apples distinguish These new varieties show promise in the themselves with unusual skin competition for the #1 spot in the world’s colors and lingering aftertastes produce sections and farmers’ markets.
  • Hanson's Garden Village Edible Fruit Trees

    Hanson's Garden Village Edible Fruit Trees

    Hanson’s Garden Village Edible Fruit Trees *** = Available in Bare Root for 2020 All Fruit Trees Available in Pots, Except Where Noted APPLE TREES Apple trees are not self fertile and must have a pollination partner of a different variety of apple that has the same or overlapping bloom period. Apple trees are classified as having either early, mid or late bloom periods. An early bloom apple tree can be pollinated by a mid bloom tree but not a late bloom tree. A mid bloom period apple could be used to pollinate either an early or late bloom period apple tree. Do not combine a late bloomer with an early bloom period apple. Apple trees are available in two sizes: 1) Standard – mature size 20’-25’ in height and 25’-30’ width 2) Semi-Dwarf (S-M7) – mature size 12’-15’ in height and 15’-18’ width —————————————————————–EARLY BLOOM—————————————————————— Hazen (Malus ‘Hazen’): Standard (Natural semi-dwarf). Fruit large and dark red. Flesh green-yellow, juicy. Ripens in late August. Flavor is sweet but mild, pleasant for eating, cooking and as a dessert apple. An annual bearer. Short storage life. Hardy variety. Does very well without spraying. Resistant to fire blight. Zones 3-6. KinderKrisp (Malus ‘KinderKrisp’ PP25,453): S-M7 (Semi-Dwarf) & Standard. Exceptional flavor and crisp texture, much like its parent Honeycrisp, this early ripening variety features much smaller fruit. Perfect size for snacking or kid's lunches, with a good balance of sweet flavors and a crisp, juicy bite. Outstanding variety for homeowners, flowering early in the season and ripening in late August, the fruit is best fresh from the tree, hanging on for an extended period.
  • Brightonwoods Orchard

    Brightonwoods Orchard

    Managing Diversity Jimmy Thelen Orchard Manager at Brightonwoods Orchard 2020 Practical Farmers of Iowa Presentation MAP ORCHARD PEOPLE ORCHARD PEOPLE • UW-Parkside Graduate • Started at Brightonwoods in 2006 • Orchard Manager and in charge of Cider House • Case Tractor Hobby & Old Abe's News ORCHARD HISTORY • Initial sales all from on the farm (1950- 2001) “Hobby Orchard” • Expansion into multiple cultivars (10 acres) • 1980's • Added refrigeration • Sales building constructed ORCHARD HISTORY • Retirement begets new horizons • (1997-2020) • Winery (2000-2003) additional 2 acres of trees for the winery and 30+ varieties of apples & pears ORCHARD HISTORY • Cider House (2006) with UV light treatment and contract pressing • Additional ½ acre of Honeycrisp ORCHARD HISTORY • Additional 3 acres mixed variety higher density planting ~600 trees per acre ORCHARD HISTORY • Addition of 1 acre of River Belle and Pazazz ORCHARD • Not a Pick- your-own • All prepicked and sorted • Not Agri- entertainment focused ACTIVITIES WHERE WE SELL • Retail Focused • At the Orchard • Summer / Fall Farmers' Markets • Winter Farmers' Markets • Restaurants • Special Events ADDITIONAL PRODUCTS • Honey, jams & jellies • Pumpkins & Gourds • Squash & Garlic • Organic vegetables on Sundays • Winery Products • Weekend snacks and lunches 200+ VARIETIES Hubardtson Nonesuch (October) Rambo (September) Americus Crab (July / August) Ida Red (October) Red Astrashan (July–August) Arkansas Black (October) Jersey Mac (July–August) Red Cortland(September) Ashmead's Kernal (October)
  • Apple Scab: a Disease of Apple and Crabapple Martin A

    Apple Scab: a Disease of Apple and Crabapple Martin A

    South Dakota State University Open PRAIRIE: Open Public Research Access Institutional Repository and Information Exchange Fact Sheets SDSU Extension 4-1-2007 Apple Scab: A Disease of Apple and Crabapple Martin A. Draper South Dakota State University Rhoda Burrows Kim Maxson-Stein Follow this and additional works at: http://openprairie.sdstate.edu/extension_fact Recommended Citation Draper, Martin A.; Burrows, Rhoda; and Maxson-Stein, Kim, "Apple Scab: A Disease of Apple and Crabapple" (2007). Fact Sheets . Paper 138. http://openprairie.sdstate.edu/extension_fact/138 This Other is brought to you for free and open access by the SDSU Extension at Open PRAIRIE: Open Public Research Access Institutional Repository and Information Exchange. It has been accepted for inclusion in Fact Sheets by an authorized administrator of Open PRAIRIE: Open Public Research Access Institutional Repository and Information Exchange. For more information, please contact [email protected]. FS939 AppleFS939 Scab APPLE SCAB A Disease of Apple and Crabapple Martin A. Draper Extension plant pathologist Without question, the most common and aesthetically damaging disease of apples and crab apples in South Dakota is apple scab. Susceptible varieties can be defoliated Rhoda Burrows by midsummer in severe years. Extension horticulturist Cool, wet conditions in May and June favor early disease development. Under those Kim Maxson-Stein conditions, both leaf and fruit infections can occur. In severe cases of early infection, Extension plant diagnostician there may be fruit drop. Early defoliation weakens trees and increases the likelihood of winter injury or injury from other pests. Infected fruits are blemished and often severely deformed. While a single season of apple scab does not seriously harm apple trees, heavy defoliation causes the trees to be less attractive, reduces growth and yield, and increases susceptibility to winter injury, predisposing the trees to other pests.
  • Americus Crab Americus Crab -Side Arkansas Black Arkansas Black -Side Ashmeads Kernel

    Americus Crab Americus Crab -Side Arkansas Black Arkansas Black -Side Ashmeads Kernel

    Americus Crab Americus Crab -side Arkansas Black Arkansas Black -side Ashmeads Kernel Ashmeads Kernel -side Baldwin Baldwin -side Beacon Beacon -side Bella Vista Bella Vista -side Binet Blanc Binet Blanc -side Blenheim Orange Blenheim Orange -side Blushing Golden Blushing Golden -side BWO Early WI Red BWO Early WI Red -side BWO Sweet Thingy BWO Sweet Thingy -side Calville Blanc dHiver Calville Blanc dHiver -side Chenango Strawberry Chenango Strawberry -side Chestnut Crab Chestnut Crab -side Chisel Jersey (faux) -side Chisel Jersey (faux) Coat Jersey Coat Jersey -side Connell Red Connell Red -side Coos Bay Late Coos Bay Late -side Cornell Sour Cornell Sour -side Cornell Sweet Cornell Sweet -side Cortland Cortland -side Cox's Orange Pippin Cox's Orange Pippin -side Cricket Creek Yellow Crab Cricket Creek Yellow Crab - Crimson King Crimson King -side Crispin Crispin -side side Davey Davey -side Dolgo Crab Dolgo Crab -side Domaine Domaine -side DS-99 DS-99 -side DS 428 DS 428 -side Duchess of Oldenburg Duchess of Oldenburg -side Early Jon Early Jon -side Empire Empire -side English Golden Russet English Golden Russet -side Esopus Spitzenberg Esopus Spitzenberg -side Fireside Fireside - side Frequin Rouge Frequin Rouge -side Fuji Fuji -side Gala Gala -side Gallia Beauty Gallia Beauty -side Genesis II Genesis II -side Golden Delicious Golden Delicious -side Golden Nugget Golden Nugget -side Granny Smith Granny Smith -side Gravenstein Gravenstein -side Greendale Greendale -side Grimes Golden Grimes Golden -side Haralson Haralson -side Holdren's
  • WYOMING APPLE PROJECT: Old Trees Meet New Technology

    WYOMING APPLE PROJECT: Old Trees Meet New Technology

    WYOMING APPLE PROJECT: Old trees meet new technology pple trees have been grown in cultivars that may be more productive the samples identified, with all AWyoming since at least the 1870s. in Wyoming’s challenging climatic 15 originally bred or selected in The largest orchards produced conditions. states and countries with average apples for market sales, rootstock temperatures or winter conditions trees for local residents, and even Identifying the cultivars similar to Wyoming (for example, The project uses genetic developed new cultivars that Minnesota, Wisconsin, South Dakota, fingerprinting techniques to see if improved yield and performance Russia, and Canada). cultivars of historical trees could be under Wyoming’s cold and drought- Cultivars identified most identified. DNA markers are reliable prone conditions. frequently were: identification tools for cultivars For example, Lander, or “Apple • ‘Wealthy’ was identified most (71) and for the study of similarity by City,” at one time had over 4,700 and occurred in the most locales assessing their genetic differences. trees drawn from 207 cultivars. These across Wyoming (12) (Figure 1). The project also preserves some of trees naturally aged and died or the apple cultivars by grafting them • ‘Haralson’ (25 trees across nine were removed, and now only a small onto vigorous young rootstocks. locales), percentage of these historical trees Leaf samples were collected from are still alive in Wyoming. • ‘Patten’s Greening’ (23, four 510 heritage apple trees from 91 sites Recognizing how few historic locales), in 19 towns in Wyoming. Genetic trees are left triggered the University • ‘Yellow Transparent’ (20, nine material from known cultivars from of Wyoming’s Wyoming Apple Project locales), the USDA-National Plant Germplasm funded by specialty crop grants System, Seed Savers Exchange, and • ‘Northwestern Greening’ (16, from the Wyoming Department of Washington State University apple seven locales).
  • Tree Fruit Varieties for the Great North Woods

    Tree Fruit Varieties for the Great North Woods

    Education Center and Info Line practical solutions to everyday questions Toll free Info Line 1-877-398-4769 M-F • 9 AM - 2 PM Tree Fruit Varieties for the Great North Woods Growing fruit in Coös County and other colder sites in New Hampshire can be challenging for the home grower. Winter temperatures of -30o to -35o F or even colder are not uncommon. A short growing season, often as short as 90 days is an additional risk fruit growers face in the Great North Woods. The tree fruit varieties listed in this fact sheet have been selected with these limits in mind. They have been selected for their ability to withstand winter temperatures common in northern New Hampshire and ripen a crop of quality fruit in a short growing season. Pest resistance and value for certain uses such as canning or freezing have been noted where appropriate. A partial list of nurseries that offer many of these tree fruit varieties has been included at the end of this fact sheet. Fruit trees require a significant commitment of time and effort. Information on the cultural requirements for the Figure 1 – Liberty apple ready for harvest. various fruits is available at County Extension offices Photo: W. Lord throughout New Hampshire. See the website at: www.extension.unh.edu Apples Most apple cultivars will not set fruit without cross pollination. Plant at least two varieties to ensure cross-pollination. In addition, insect pollination by honey bees and a variety of native pollinators such as bumble bees is essential. We recommend apple cultivars with resistance to apple scab, cedar apple rust and other apple diseases for home gardeners.
  • Portland Nursery Buyer's Fruit Tree List for 2021

    Portland Nursery Buyer's Fruit Tree List for 2021

    Portland Nursery Buyer’s Fruit Tree List for 2021 Apple root stocks Cherry rootstock Figs Akane m26, m27 Bing gisela,newroot,mah Black Mission Arkansas Black m106 Black Gold gisela Black Spanish Ashmead's Kernel m26 Black Tartarian mahaleb Brown Turkey Belle de Boskoop m111 Carmine Jewel gisela, own-root Chicago Hardy Bramley m106 Combination, 4-way gisela, mazzard Excell Caville Blanc m111 Corum mahaleb King Chehalis m106 Evans gisela Lattarula Combination, 4-way m106 Glacier gisela Negronne Cox Orange Pippin m26,m106 Lapin gisela,mahaleb Olympian Early Pink Lady m26 Meteor mahaleb Oregon Prolific Empire m106 Montmorency gisela,mahaleb Panache Enterprise m106 North Star mahaleb Peter's Honey Espalier, 2-tier or 3-tier m106 Rainier gisela,newroot,mah Petite Negra Freedom m26 Royal Ann gisela Stella Fuji m27,m26,m106 Sam gisela Vern's Brown Turkey Gala m27,m26 Stella gisela,mahaleb Granny Smith gen935,m106 Sweetheart gisela,newroot,mah Olive Gravenstein m27,m26 Van gisela Arbequina Haralson antonovka Vandelay gisela Honeycrisp m27,m26,gen935 Pawpaw King David m111 Plum Mango Liberty m27,m26 Beauty citation,mar2624 Overleese Melrose m26,m106 Blue Damson st. julian a Shenandoah Northern Spy m106 Brooks mar2624 Pink Lady m27,m26 Burgundy citation Mulberry Pink Pearl m26 Catalina citation Beautiful Day Pristine m26 Combination, 4-way krymsk,mar2624 Illinois Everbearing Red McIntosh m26 Early Italian mar2624 Oscar Roxbury Russet m106 Elephant Heart mar2624 Pakistan Spartan m106 French Petite mar2624 Teas Weeping Spitzenberg m106 Green Gage mar2624 William's Pride m26 Hollywood citation Persimmon Winesap m106 Imperial Epineuse st. julian a Fuyu Yellow Newton m106 Italian citation, mar2624 Yellow Transparent m106 Methley mar2624 Nuts Nadia st.
  • APPLE Talk S Anyone “The Mango of Your Eye”? with This Great Diversity It’S No Wonder Ever Heard of a “Plum Polisher”? Does They’Ve Become Such a Part of Our Lives

    APPLE Talk S Anyone “The Mango of Your Eye”? with This Great Diversity It’S No Wonder Ever Heard of a “Plum Polisher”? Does They’Ve Become Such a Part of Our Lives

    APPLE TALK s anyone “the mango of your eye”? With this great diversity it’s no wonder Ever heard of a “plum polisher”? Does they’ve become such a part of our lives. I“a fig a day keep the doctor away”? Ranging in texture from tender to crisp and There’s good reason that there are more in flavor from sweet to tart, apples are perfect sayings about apples than about any other for snacking or for whipping up a pie. Plus, fruit. Apples are the most varied food on they’re a good source of fiber and vitamins the planet, according to the U.S. Apple A and C as well as antioxidants. Association. There are more than 7,500 Autumn is a great time to enjoy your known varieties of apples grown world- favorites fresh from the orchards—or try wide and about 2,500 varieties grown in some of the new varieties. Use our guide to the United States. help you make the best match. ■ Apple Tips • The best way to store apples is inside a plastic bag in the crisper drawer of your refrigerator. • To make a 9-inch pie, you will need 2 pounds of apples (6–8 medium apples). ! ! LUNDS AND BYERLy’s APPLE GUIDE Variety FLAVor* Texture* FRESH & salad Pie Sauce BAKING Braeburn Slightly tart Crisp Very good Excellent Good Very good Cameo Sweet Slightly crisp Very good Very good Good Very good Cortland Slightly tart Crisp Excellent Excellent Very good Good Fireside Slightly sweet Slightly crisp Excellent Fair Fair Good Fuji Sweet Crisp Excellent Good Fair Very good Gala Slightly sweet Slightly crisp Excellent Very good Fair Very good Gingergold Slightly sweet Slightly crisp