(19) T ZZ ZZ _T
(11) EP 2 256 500 B1
(12) EUROPEAN PATENT SPECIFICATION
(45) Date of publication and mention (51) Int Cl.: of the grant of the patent: A61K 31/51 (2006.01) 23.04.2014 Bulletin 2014/17
(21) Application number: 10009323.6
(22) Date of filing: 03.03.2006
(54) Use of inhibitors of the enzyme TKTL1. Gebrauch von Inhibitoren des Enzyms TKTL1. Utilisation d’inhibiteurs de l’enzyme TKTL1.
(84) Designated Contracting States: • HEO HO JIN ET AL: "Protective effects of AT BE BG CH CY CZ DE DK EE ES FI FR GB GR quercetin and vitamin C against oxidative stress- HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI induced neurodegeneration", JOURNAL OF SK TR AGRICULTURAL AND FOOD CHEMISTRY, AMERICAN CHEMICAL SOCIETY, US, vol. 52, no. (30) Priority: 07.03.2005 EP 05004930 25, 15 December 2004 (2004-12-15), pages 17.06.2005 EP 05013170 7514-7517, XP002580650, ISSN: 0021-8561, DOI: 10.1021/JF049243R [retrieved on 2004-11-10] (43) Date of publication of application: • GEMA ALVAREZ ET AL: "Pyruvate Protection 01.12.2010 Bulletin 2010/48 Against beta-Amyloid- Induced Neuronal Death: Role of Mitochondrial Redox State", JOURNAL (62) Document number(s) of the earlier application(s) in OF NEUROSCIENCE RESEARCH, vol. 73, no. 2, accordance with Art. 76 EPC: 15 July 2003 (2003-07-15), pages 260-269, 06723195.1 / 1 856 537 XP55020916, • RAIS B ET AL: "Oxythiamine and (73) Proprietor: Coy, Dr., Johannes F. dehydroepiandrosterone induce a G1 phase 64853 Otzberg (DE) cycle arrest in Ehrlich’s tumor cells through inhibition of the pentose cycle", FEBS LETTERS, (72) Inventor: Coy, Dr., Johannes F. ELSEVIER, AMSTERDAM, NL, vol. 456, no. 1, 30 64853 Otzberg (DE) July 1999 (1999-07-30) , pages 113-118, XP004260049, ISSN: 0014-5793, DOI: (74) Representative: Rudolph, Ulrike 10.1016/S0014-5793(99)00924-2 Patentanwaltskanzlei Dr. U. Rudolph • Daniel A. Tennant ET AL: "Targeting metabolic In der Schanz 10 transformation for cancer therapy", Nature 69198 Schriesheim (DE) Reviews Cancer, vol. 10, no. 4, 1 April 2010 (2010-04-01), pages267-277, XP055059849, ISSN: (56) References cited: 1474-175X, DOI: 10.1038/nrc2817 US-A1- 2003 139 331 • DATABASE MEDLINE [Online] US NATIONAL LIBRARY OF MEDICINE (NLM), BETHESDA, MD, • CARL D BENNETT ET AL: "The Role of Dietary US 2008 WITTIG RAINER ET AL: ’The role of Fat in Protecting the Rat against Oxythiamine- glucose metabolism and glucose-associated produced Thiamine Deficiency", THE JOURNAL signalling in cancer.’ Database accession no. OF NUTRITION, vol. 99, no. 3, 1 November 1969 NLM19812737 & WITTIG RAINER ET AL: "The role (1969-11-01), pages 288-292, XP55020858, of glucose metabolism and glucose-associated signalling in cancer.", PERSPECTIVES IN MEDICINALCHEMISTRY 2008,vol. 1, 2008, pages 64-82, ISSN: 1177-391X
Note: Within nine months of the publication of the mention of the grant of the European patent in the European Patent Bulletin, any person may give notice to the European Patent Office of opposition to that patent, in accordance with the Implementing Regulations. Notice of opposition shall not be deemed to have been filed until the opposition fee has been paid. (Art. 99(1) European Patent Convention). EP 2 256 500 B1
Printed by Jouve, 75001 PARIS (FR) (Cont. next page) EP 2 256 500 B1
• DATABASE MEDLINE [Online] US NATIONAL LIBRARY OF MEDICINE (NLM), BETHESDA, MD, US 27 February 2006 LANGBEIN S ET AL: ’Expression of transketolase TKTL1 predicts colon and urothelial cancer patient survival: Warburg effect reinterpreted.’ Database accession no. NLM16465194 & LANGBEIN S ET AL: "Expression of transketolase TKTL1 predicts colon and urothelial cancer patient survival: Warburg effect reinterpreted.", BRITISH JOURNAL OF CANCER 27 FEB 2006, vol. 94, no. 4, 27 February 2006 (2006-02-27), pages 578-585, ISSN: 0007-0920 • DATABASE MEDLINE [Online] US NATIONAL LIBRARY OF MEDICINE (NLM), BETHESDA, MD, US 01 February 2010 SUN WENYUE ET AL: ’TKTL1is activated by promoter hypomethylation and contributes to head and neck squamous cell carcinoma carcinogenesis through increased aerobic glycolysis and HIF1alpha stabilization.’ Database accession no. NLM20103683 & SUN WENYUE ET AL:"TKTL1 is activated by promoter hypomethylation and contributes to head and neck squamous cell carcinoma carcinogenesis through increased aerobic glycolysis and HIF1alpha stabilization.", CLINICAL CANCER RESEARCH : AN OFFICIAL JOURNAL OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH 1 FEB 2010, vol. 16, no. 3, 1 February 2010 (2010-02-01), pages 857-866, ISSN: 1078-0432
2 1 EP 2 256 500 B1 2
Description some 3, the gene for TKTL2 is located on chromosome 4 and the gene for TKTL1 is located in band Xq28 on [0001] The invention relates to the use of a thiamine chromosome X. in humans. elected from the group consisting of oxythiamine, ben- [0004] One most important function of the enzyme fooxytiamine (=oxybenfotiamin), pyrithiamin and 2-meth- 5 TKTL1 in mammalian cells is its catalysator function dur- yithiamin for manufacturing a pharmaceutical composi- ing the fermentation of glucose to lactic acid in the pres- tion for the inhibition of the mammalian aerobic glucose ence of oxygen, i.e. under aerobic conditions. TKTL1 is fermentation metabolic pathway (mam-aGF) and for the tracer enzyme in the novel, first recently dicovered therapeutic treatment or controlling of diseases associ- so called mammalian aerobic glucose fermentation met- ated with an decreased or enhanced mammalian aerobic 10 abolic pathway or mammalian lactic acid fermentation glucose fermentation metabolic pathway (mam-aGF). process, respectively. In the following this newly discov- [0002] The invention is based on the novel scientific ered pathway is referred to as mammalian aerobic glu- discovery, that (1) a metabolism pathway which up to cose fermentation metabolic pathway or shortened to now has been known only from prokaryotic cells (for ex- mam-aGF, respectively. ample from lactobacillus), exists in mammalian organ- 15 [0005] Details of that mam-aGF are the following: isms - i.e. in mammalian cells - too, said metabolism path- way comprising the energy-yielding breaking down of A protein complex containing TKTL1 and glyceral- glucose to lactate , although sufficient free (molecular) dehyd-3-phosphate dehydrogenase (GAPD) allows oxygen is present and bioavailable i.e. aerobic conditions a nonoxidative glucose degradation. The electron exist, and that (2) the enzyme TKTL1 is the tracer enzyme 20 transfer does not involve mitochondria and allows a of said new glucose fermentation metabolism. mitochondria independent ATP production in TKTL1 [0003] Mammalian cells are able to break down glu- expressing cells. Application of anti-TKTL1 com- cose to lactic acid in the case of oxygen deficiency, finally pounds, or inhibitory thiamin-analogs, or paraben- leading to muscles ache. This anaerobic glucose degra- zoquinons (or benzoquinone-derivatives) can be ap- dation is performed via the Embden-Meyerhof-pathway. 25 plied for the inhibition of such a mitochondria inde- In the 1920s Otto Warburg discovered that also in the pendent ATP production (in particular for example presence of sufficient available amounts of oxygen mam- in tumors with a TKTL1 based sugar metabolism). malian cells are able to break down glucose to lactic acid, i.e. that mammalian cells are able to ferment glucose to [0006] Using the human TKTL1 protein the inventor of lactic acid even in the presence of sufficient amounts of 30 the present patent application confirmed the formation free bioavailable oxygen. He observed this anaerobic of glyceraldehyd-3-phosphate in an one-substrate reac- glucose to lactate degradation pathway in the presence tion utilizing X5P as sole carbon source. of oxygen in tumor tissues as well as in certain healthy [0007] The metabolism of X5P via TKTL1 result in the tissues like retina and testis. For historical reasons this formation of acetyl-CoA. The anaerobic glucose degra- glucose degradation to lactate even in the presence of 35 dation under aerobic conditions leads to lactate and the oxygen is named aerobic glycolysis or Warburg effect. building of the energy rich compound acetyl-CoA. The Since the start and end point (glucose and lactate) is the pyruvate dehydrogenase complex is then e.g. inhibited same as the glucose fermentation to lactate in the ab- by acetyl-CoA, and as a consequence, pyruvate is mainly sence of oxygen via the Embden-Meyerhof pathway, the reduced to lactate. lactate production has been interpreted as the result of 40 [0008] A schematic description of the complete mam- the Embden-Meyerhof pathway. However, in the course aGF are given in Fig. 13 and Fig. 14. of the experiments leading to the present invention it be- [0009] Details concerning the tracer enzyme TKTL1 of came obvious that it is the TKTL1 transketolase which that mam-aGF are the following: allows the glucose degradation or glucose fermentation, repectively, to lactate even in the presence of oxygen 45 During the experiments leading to the present inven- and that this glucose pathway is significantly different tion different TKTL1 isoforms were identified on pro- from the Embden-Meyerhof pathway. tein level using a novel monoclonal antibody (Linaris The TKTL1 transketolase gene has been discovered Biologische Produkte GmbH, Wertheim) specifically some years ago, namely 1996 by Coy et al. (Genomics detecting the TKTL1 protein. 32, 309-316). Due to a stop codon in a predicted coding 50 TKTL1 protein isoforms are part of a multi-protein exon, the TKTL1 transketolase gene has been annotated complex. Within this complex TKTL1 is also bound as a pseudogene in sequence data bases. Despite this, to transketolase unrelated proteins like glyceralde- in 2002 Coy demonstrated that the TKTL1 gene encodes hyd-3-phosphate dehydrogenase (GAPDH), DNa- an enzymatically active transketolase. The TKTL1 tran- seX (DNase1-like-1), Akt (= protein kinase B); his- sketolase is phylogentically cognate with the two other 55 tones, histon deacetylase, amyloid precursor protein known human transketolases TKT and TKTL2. However, and actin binding proteins. all three transketolase enzymes are encoded by different genes, whereby the gene for TKT is located on chromo- [0010] Known transketolases are homodimers of two
3 3 EP 2 256 500 B1 4 full length proteins harbouring all typical invariant tran- - taking (harvesting, collecting) a biological sam- sketolase amino acid residues. The transketolase-like ple of said individual (patient), gene encoded TKTL1 protein isoforms build TKTL1 ho- - determining the activity and/or concentration, mo/heterodimers and TKT/TKTL1 or TKTL2/TKTL1 het- and/or cellular localization and/or aggregation erodimers. The expression of TKTL1 protein isoforms - 5 status and/or dimerization status of the TKTL1 even an enzymatically non-active isoform - influences protein within said sample of said individual (pa- the enzymatic activity of a TKT or TKTL2 protein as part tient) and within a control sample, of a TKT/TKTL1 or TKTL2/TKTL1 heterodimer. A molec- - comparing the determined data obtained from ular switch and a proton wire synchronize the active sites said sample of said individual (patient) with the in TKT/TKTL1, TKTL2/TKTL1 and TKTL1/TKTL1 homo- 10 data obtained from the control sample, and heterodimers. - and taking (i) an enhanced or decreased level [0011] The proof that the TKTL1 gene (NM_012253; of activity and/or concentration of the TKTL1 Accession Numbers: X91817; BC025382) encodes a full protein in said sample of the individual com- length transketolase protein as well as smaller protein pared to the control sample as indication of an isoforms has important implications for basic research 15 enhanced or decreased, respectively, extend and medical health. (level) of use of the mammalian aerobic glucose [0012] Besides their enzymatic functions, the TKTL1 fermentation metabolic pathway "mam-aGF", proteins exhibit various different functions depending on and (ii) an abnormal cellular localization and/or the localization of the proteins in the mammalian cell and an abnormal aggregation status and/or an ab- on their state of aggregation. In mammalian cells the20 normal dimerization status of the TKTL1 protein TKTL1 protein is mainly located in the cytoplasm, but in said sample of the individual compared to the also occurs in the nucleus. Within the cytoplasm the main control sample as indication of an abnormal (de- function of TKTL1 is the catalysis of the (trans-)ketolase fective, disturbed, faulty) mammalian aerobic reaction. Additional functions of the TKTL1 proteins lo- glucose fermentation metabolic pathway. cated within the nucleus are associated with the control 25 of the cell cycle and mitosis, control of transcription (the [0016] The detection (determination) may be carried TKTL1 gene itself and others), and regulation of apopto- out in solution or using reagents fixed to a solid phase. sis. The detection of one or more molecular markers, such [0013] The TKTL1 proteins (with their functions de- as polypeptides or nucleic acids, may be performed in a pending on their localization or the state of aggregation) 30 single reaction mixture or in two or separate reaction mix- are designated as "moonlighting" proteins, since they ex- tures. Alternatively, the detection reactions for several ecute different functions depending on subcellular local- marker molecules may, for example, be performed si- ization, the cell type as well as its aggregation state. multaneously in multi-well reaction vessels. The markers [0014] The present disclosure is based on the object characteristic for the TKTL1 gene products may be de- (a) of making available a method for a qualitative and 35 tected using reagents that specifically recognize these quantitative detecting (and monitoring) of the extend (lev- molecules. The detection reaction for the marker mole- el) of use and the correct (normal, natural) process flow cules may comprise one or more reactions with detecting of the mammalian aerobic glucose fermentation meta- agents either recognizing the initial marker molecules or bolic pathway (mam-aGF) in a mammalian individual, i.e. recognizing the prior molecules used to recognize other a method for controlling whether that metabolism/path- 40 molecules. way/process actually proceeds in the investigated cells [0017] The detection reaction further may comprise a of the appropriate mammalian organism, if the case is reporter reaction indicating the presence or absence given in what extend and whether it proceeds "normal" and/or the level of the TKTL1 gene markers. The reporter or correct, respectively or with faults or aberrations, and reaction may be for example a reaction producing a col- (b) of making available a means with which that mam- 45 oured compound, a bioluminescence reaction, a fluores- aGF can be affected, in particular enhanced or inhibited. cence reaction, generally a radiation emitting reaction [0015] This object is achieved with a (in-vitro-) method etc.. In a preferred embodiment, different marker mole- for the qualitative and quantitative detecting (and moni- cules may be recognized by agents that produce different toring) the extend (level) of use and the correct (normal, reporter signals, so that the signals referring to marker natural) process flow of the eukaryotic aerobic glucose 50 molecules could be distinguished. fermentation metabolic pathway "mam-aGF" (or mam- [0018] Applicable formats for the detection reaction malian lactic acid fermentation process) in a mammalian may be, blotting techniques, such as Western-Blot, individual (patient), characterized in that Southern-blot, and Northern-blot. The blotting tech- niques are known to those of ordinary skilled in the art (a) the enzyme TKTL1 is used as indicator and target 55 and may be performed for example as electro-blots, sem- molecule and idry-blots, vacuum-blots or dot-blots. Amplification reac- (b) said method comprises the following steps: tions may also be applicable for the detection of e.g. nu- cleic acid molecules. Furthermore immunological meth-
4 5 EP 2 256 500 B1 6 ods for detection of molecules may be applied, such as tions (e.g. AGE formation, glyoxal. for example immunoprecipitation or immunological as- [0025] In addition said method may comprise the de- says, such as ELISA, RIA, lateral flow assays, immuno- tection of auto-antibodies directed against polypeptides cytochemical methods etc.. encoded by the TKTL1 gene. The polypeptides used for [0019] On the basis of the information obtained with 5 the methods may be used to detect the presence or ab- that method a medical practitioner is able to draw con- sence of such antibodies in body fluids by methods clusions concerning the state of health of the appropriate known to those of skill in the art. individual (patient) and to evolve schedules for therapy [0026] Said method is further suitable for performing if necessary. an in-vivo or in-vitro molecular imaging so that it is pos- [0020] Therefore said method is suitable and intended 10 sible to identify diseases associated with an increased for monitoring (detecting, surveying and observing) the or decreased or abnormal i.e. defective mam-aGF in a course of diseases, associated with an increased or de- very early stage, ideally before the appearance of the creased and/or abnormal, i.e. defective/faulty/disturbed typically known symptoms of that disease. In conse- mam-aGF. quence the individual or its doctor is able to medicate [0021] The determination of TKTL1 activity and/or con- 15 that disease at a very early point of time thereby signifi- centration may comprise determining the level of TKTL1 cantly increasing the chances of healing. gene products or determining the enzymatic activity of [0027] Molecular imaging differs from conventional TKTL1 in a sample. techniques because it identifies specific gene products [0022] Monitoring may comprise detecting the level of and intracellular processes like specific enzyme reac- TKTL1 gene products or TKTL1 enzymatic activity in20 tions. The altered substrate specificity and reaction samples taken at different points in time and determining modus of the TKTL1 enzyme can be used for the detec- the changes in said level. According to said changes the tion of cells or tissues with an enhanced or reduced course of the disease can be followed. The course of the TKTL1 enzyme activity. The altered substrate specificity disease may be used to select therapy strategies for the and reaction modus of the TKTL1 enzyme allows the particular individual. 25 discrimination between the enzymatic activity of three [0023] Another aspect of detecting and monitoring of transketolase(-like) enzymes thereby allowing the meas- the disease course may comprise the detection of mini- urement of TKTL1 enzymatic activity in vivo. The enzy- mal residual disease. This may comprise for example the matic activity can be detected by e.g. positron emission detection of a TKTL1 gene products level or TKTL1 en- tomography, chemoluminescence or radiographic imag- zymatic activity in one or more body samples following 30 ing. initial therapy of an individual once or at several time [0028] The molecular imaging may be based on the points. According to the level of TKTL1 gene products enzymatic conversion of inert or labelled compounds to detected in the samples one may select a suitable ther- molecules detectable in the course of molecular imaging apy for the particular individual. methods by the TKTL1 molecules. In another example [0024] Based upon the determined level of TKTL135 the molecular imaging method may be based on the use gene products or the determined enzymatic activity in of compounds carrying a suitable label for in vivo molec- the samples individuals can be subdivided into sub- ular imaging, such as radio isotopes, metal ions etc., spe- groups. Based upon these subgroups an assessment of cifically binding to TKTL1 molecules in vivo. prognosis may be done. According to the subgroups the [0029] These compounds are preferably non-toxic and therapy of the individuals affected by the various diseas- 40 may be eliminated from the circulation of organisms, such es may be tailored. For example the overexpression of as humans, in a time span, that allows for performing the TKTL1 gene and an enhanced activity of the pentose- detection of label accumulated in tissue overexpressing phosphate cycle suggest a mechanism by which thia- TKTL1 gene. In cases of a molecular imaging, for which mine (vitamin B1) promotes nucleic acid ribose synthesis clearance from the circulation is not relevant (for example and an enhanced glucose metabolism. Therefore the thi- 45 due to low background produced by the circulating mol- amine intake has direct consequences for a disease with ecules etc.) the compounds for use should be adminis- an overexpression of the transketolase like-1 gene. This tered in pharmaceutical acceptable form in compositions provides also background information and helps to de- that may additionally comprise any other suitable sub- velop guidelines for alternative treatments with antithia- stances, such as e.g. other diagnostically useful sub- mine transketolase inhibitors in the clinical setting. Anal- 50 stances, therapeutically useful substances, carrier sub- ysis of RNA ribose indicates that glucose carbons con- stances or the like. tribute to over 90% of ribose synthesis in cultured cervix [0030] The biological sample of the individual can be und pancreatic carcinoma cells and that ribose is syn- almost each tissue or liquid sample obtained from said thesized primarily through the thiamine dependent tran- individual. Isolated cells, lysed cells, cell debris, peptides sketolase pathway (> 70%). Antithiamine compounds 55 or nucleic acids of said individual are suitable samples, significantly inhibit nucleic acid synthesis. Thiamine or too. Further suitable samples are for example biopsy benfotiamine treatment activates TKTL1 and thereby the preparations, body fluids, secretions, a smear, serum, sugar metabolism and reduces toxic or unwanted reac- urine, semen, stool, bile, a liquid containing cells.
5 7 EP 2 256 500 B1 8
[0031] The determination in step (b) of the method can [0036] Just as well the determination in step (b) of the be carried out on the protein level, i.e. with the TKTL1 method can be carried out on the nucleic acid level, i.e. protein or a TKTL1 protein fragment as the target. Pref- with the TKTL1 nucleic acid or a fragment thereof as the erably the determination is carried out by using a mole- target. The term "TKTL1 nucleic acid" as used in the cule that specifically binds to the TKTL1 protein. 5 present context comprises the TKTL1 gene, TKTL1 mR- Preferably said molecule is an antibody directed to NAs and TKTL1 encoding nucleic acids. TKTL1 or a fragment of such anti-TKTL1-antibody or a [0037] In a preferred example the detection of the peptidomimetic comprising an antigen binding epitope, above mentioned relevant TKTL1 parameter in the sam- or a mini- antibody. ple should be performed by using at least one nucleic Suitable target molecules are the TKTL1 protein itself or 10 acid probe capable of hybridizing to a TKTL1 nucleic acid. fragment thereof or a fusion protein comprising the A suitable target molecule is the TKTL1 nucleic acid itself TKTL1 protein. as well as a chimeric nucleic acid comprising a TKTL1 [0032] The determination on the protein level, i.e. of encoding nucleic acid or fragments thereof. the TKTL1 gene products, can for example be carried [0038] The procedure for the detection of nucleic acids out in a reaction comprising an antibody specific for the 15 (DNA and/or RNA) can, for example, be carried out by a detection of the TKTL1 protein. The antibodies can be binding reaction of the molecule to be detected to com- used in many different detection techniques for example plementary nucleic acid probes, proteins with binding in Western-blot, ELISA or immunoprecipitation. Gener- specificity for the nucleic acids or any other entities spe- ally antibody based detection can be carried out as well cifically recognizing and binding to said nucleic acids. in vitro as directly in situ for example in the course of an 20 This method can be performed as well in vitro as directly immunohistochemical staining reaction. Any other meth- in situ for example in the course of a detecting staining od for determining the amount of particular polypeptides reaction. Another way of detecting the TKTL1 gene prod- in biological samples can be used according to the ucts in a sample on the level of nucleic acids performed present invention. in the method according to the present disclosure is an [0033] The reagent for the detection of the TKTL1 gene 25 amplification reaction of nucleic acids, which can be car- product may include any agent capable of binding to the ried out in a quantitative manner such as for example the TKTL1 protein molecule. Such reagents may include pro- polymerase chain reaction. In a preferred example real teins, polypeptides, nucleic acids, peptide nucleic acids, time RT PCR may be used to quantify the level of TKTL1 glycoproteins, proteoglycans, polysaccharides or lipids. RNA in samples. [0034] TKTL1 gene products as used may comprise 30 [0039] The TKTL1 sample for carrying out a positive polypeptides and nucleic acids encoded by the transke- control may comprise for example TKTL1 nucleic acids tolase like-1 gene. The polypeptides and polynucleotides or polypeptides or fragments thereof in applicable form, (cf. TKTL1, TKR: NM_012253; Accession numbers: such as solution or salt, peptides in applicable form, tis- X91817; BC025382) used for performing the method are sue section samples or positive cells. isolated. This means that the molecules are removed 35 [0040] In summary: the type (manner) of TKTL1 en- from their original environment. Naturally occurring pro- zymeactivity (normal, reduced orenhanced) can be iden- teins are isolated if they are separated from some or all tified in individuals based on TKTL1 gene mutations, re- of the materials, which coexist in the natural environment. duced or enhanced enzyme activities of the isolated Polynucleotides are isolated for example if they are TKTL1 protein or an in vivo imaging of the TKTL1 enzyme cloned into vectors. 40 reaction. Diagnosis can be performed by determining the [0035] In addition to TKTL1 protein variants with en- enzymatic activity of the TKTL1 protein isolated from the hanced or reduced levels of enzymatic activity, TKTL1 patient (e.g. serum, liquor, or other body fluids) or by in proteins with altered localization or aggregation and/or vivo imaging of TKTL1 enzyme activity. dimerization within the cell can be detected in patients. [0041] Kits for performing the method can contain di- Using monoclonal antibodies specifically detecting45 agnostic systems that rely on bioluminescence for visu- TKTL1 protein (Linaris Biologische Produkte, Wertheim) alizing tissues in situ. These systems can further include TKTL1 protein within the nucleus can be detected in cells compositions containing substrates that are converted isolated from body fluids. Using immunocytochemistry by the TKTL1 enzymatic activity. In particular these sys- the localization of TKTL1 within the nucleus and the cy- tems can include a composition that contains a biolumi- toplasm of cells from healthy individuals and patients can 50 nescence generating reaction. Administration of the be determined. In a subset of Alzheimer patients an en- compositions results in production of light by targeted hanced localization of TKTL1 is detectable within the nu- tissues that permits the detection and localization of cells cleus. A different aggregation of TKTL1 in Alzheimer pa- or tissues e.g. for surgical removal. tients is also present. Detection of this aggregation is [0042] For performing the method in course of a mo- possible using 2D-gel electrophoresis (Fig. 15). In addi- 55 lecular imaging, in particular a radiographic imaging of tion an aggregation with other proteins e.g. GAPDH can tissue,it is proposed touse a radio-opaque imaging agent be detected by an ELISA using antibodies for TKTL1 and that accumulates intracellular in tissue in proportion to GAPDH. its functional, or physiological, activity. In one example,
6 9 EP 2 256 500 B1 10 the imaging agent is a cell membrane-permeable, radio- Examples may comprise the administration of antisense opaque, selective substrate or high affinity ligand for constructs, of ribozymes, of enzyme inhibitors, the ad- TKTL1. ministration of antagonists of cofactors of TKTL1 The present disclosure therefore also relates to labeled polypeptides, such as e.g. antithiamine compounds or TKTL1 substrates and the use of same as imaging5 the reduced administration of essential cofactors for the agents, for example as positron emission tomography enzymatic activity (e.g. thiamine). (PET) imaging agents or magnetic resonance thomog- [0049] A preferred therapy of disorders associated with raphy (MRT) imaging agents for the noninvasive detec- the overexpression of TKTL1 gene comprises adminis- tion and localization of cells and tissues with an enhanced tration of antithiamine compounds or the reduction of thi- or reduced TKTL1 enzymatic activity. 10 amine uptake for individuals showing disorders charac- A very suitable labelled substrate for use as imaging terized by overexpression of TKTL1 gene. agents for PET is 18F-labeled TKTL1. The disclosure fur- [0050] In consequence the present disclosure also ther relates to methods of synthesizing labelled sub- comprises a pharmaceutical composition comprising an strates and to compositions comprising such analogues. effective amount of an inhibitor or activator of the activity [0043] In course of the experiments leading to the15 or concentration of the enzyme TKTL1 and a pharma- present disclosure it was further found that mutations of ceutically acceptable carrier. TKTL1 (e.g. during evolution of mammals, a deletion of [0051] A preferred example of such a pharmaceutical an exon encoding 38 amino acids happened in TKTL1) composition comprises a TKTL1 inhibitor elected from not only result in the lowering of substrate specificity but, the group consisting of oxythiamine, benfooxytiamine (= in addition, in a lower affinity for thiamine. Thus, a re- 20 oxybenfotiamin), hydroxypyruvate, pyruvate, p-hydroxy- duced thiamine level leads to an increased failure of phenylpyruvate, pyrithiamin, amprolium, 2-methylthia- some of the TKTL1 proteins resulting in damages being min, 2-methoxy-p-benzochinon (2-MBQ) und 2,6- due to decreased TKTL1 activity. These pathological dimethoxy-p-benzochinon (2,6-DMBQ), genistein, and changes can be avoided or at least corrected by activa- flavonols as e.g. quercetin, catechins, nitrilosides, an- tion of this metabolic pathway. Determination of thiamine 25 thocyanins; or derivatives thereof. affinity of TKTL1, or amount of TKTL1 or activity of TKTL1 [0052] A preferred example of such a pharmaceutical can be exploited to identify individuals who should be composition with TKTL1 inhibitor effect comprises one treatedwith thiamine orthiamine-derivates whicha better or more Amprolium derivatives having the chemical bioavailability (e.g. benfotiamine). structure (structural formular): [0044] Such individuals may be, for example diabetes 30 patients having diabetes associated phenomenons like retinopathy, (cardiac autonomic) neuropathy, or damag- ing of endothelial cells. [0045] In consequence the present disclosure further relates to a method for controlling the mam-aGF in an 35 mammalian subject (patient) in need of such controlling, wherein the controlling comprises administering of an ef- fective amount of at least one inhibitor or activator of the activity or concentration of the enzyme TKTL1. and/or at least one Flavonol having the chemical struc- [0046] With other words: The present disclosure fur- 40 ture (structural formular): ther relates to the use of an inhibitor of the activity or concentration of the enzyme TKTL1 for manufacturing a pharmaceutical composition for the inhibition or activa- tion of the mam-aGF, i.e. for therapeutic treatment or controlling of diseases associated with an decreased or 45 enhanced mam-aGF. [0047] This technical teaching is based on the scientific finding (in course of the novel and surprising discovery of the mam-aGF), that a further important property of the TKTL1 enzyme is its appropriateness as a target mole- 50 cule for an inhibitor or activator of the mam-aGF. [0053] Another preferred example of a pharmaceutical [0048] The treatment of disorders associated with composition with TKTL1 inhibitor effect comprises one overexpression of TKTL1 gene may comprise any meth- or more thiamin and/or benfotiamin derivatives having od suitable for the reduction of the activity of TKTL1 the chemical structure (structural formular) polypeptide in an individual or in cells of an individual. 55 These methods may comprise a reduction of the activity of TKTL1 polypeptide by means of reduction of gene ex- pression or by means of reduction of enzymatic activity.
7 11 EP 2 256 500 B1 12
[0057] And the activating benfotiamin derivates pref- erably have the chemical structure (structural formula):
5
for thiamine derivatives 10 and (b) :
15 [0058] Derivatives of the above listed activators or in- hibitors can be generated by substituting or adding one or more of the following groups:
linear and branched (C 1-C12) aliphatic alkyl groups, 20 substituted with at least one group chosen from OH, 5 5 NH2, SH, CN, CF3, halogen, CONHR, COOR , 5 5 5 5 OR , SR , SiOR , NHR , aliphatic (C 3-C6) rings, and 5 for benfotiamine derivatives. aromatic (C3-C6) rings, wherein R is chosen from [0054] One preferred inhibitory benfotiamine deriva- linear and branched 1 (C-C4) alkyl groups, aryl tive is oxybenfotiamine (= benfooxytiamin) having the 25 groups, chemical structure (structural formular): natural polymers, synthetic polymers, and copoly- mers, said polymers and copolymers carrying at leasttwo groups chosen from:hydroxyl, carboxylate, primary amine, secondary amine, tertiary amine, thi- 30 ol, and aldehyde;
a hydrogen atom, a halogen atom, CF 3, OH, OCF3, 7 7 7 COOH, R , OR7, and OCOR , wherein R is chosen from linear and branched 1 (C-C4) aliphatic alkyl groups; 35 a monohalogenated and polyhalogenated linear and branched (C 1-C4) alkyl groups, and from aryl groups, wherein the aryl groups are optionally substituted
with at least one group chosen from OH, NH2, SH, 8 8 8 CN, CF3, halogen, COOH, CONHR , COOR , OR , 40 SR8, and NHR8, wherein R8 is chosen from linear and branched (C 1-C12) alkyl radicals; and from linear and branched (C 1-C4) alkyl groups, and a CF 3 group. [0055] A preferred example of a pharmaceutical com- position with TKTL1 activator effect comprises thiamine [0059] The TKTL1 inhibitiors or activatiors may also be and/or benfotiamine and/or functionally equivalent, i.e 45 realized in form of one or more nucleic acid molecules, activating, derivates thereof. recombinant vectors, polypeptides, antisense RNA se- [0056] The activating thiamine derivatives preferably quence, ribozymes and/or antibodies. have the chemical structure (structural formula): [0060] Therefore another pharmaceutical composition which is suitable for the prevention or treatment of a dis- 50 ease associated with an abnormal cellular localization of the mutated TKTL1 protein, aggregation status and/or dimerization status (compared to a control contraception) is characterised in that it comprises an effective amount of a nucleic acid molecule, a recombinant vector, a 55 polypeptide, an antisense RNA sequence, a ribozyme or an antibody. [0061] This pharmaceutical composition may for ex- ample contain DNA that codes for a functional TKTL1.
8 13 EP 2 256 500 B1 14
The DNA may be administered in a way that allows the sition / dietary supplement comprises a TKTL1 inhibitor polypeptides to be generated in situ. Suitable expression elected from the group consisting of oxythiamine, ben- systems are known to those skilled in the art. Transgenic fooxytiamine, hydroxypyruvate, pyruvate, p-hydroxyphe- mammalian cells may be used for delivery and/or expres- nylpyruvate, pyrithiamin, amprolium, 2-methylthiamin, 2- sion of the nucleic acids. The appropriate methods are 5 methoxy-p-benzochinon (2-MBQ) und 2,6-dimethoxy- known to those of skill in the art. p-benzochinon (2,6-DMBQ), genistein, and flavonols as [0062] Alternatively, the pharmaceutical compositions e.g. quercetin, catechins, nitrilosides, anthocyanins; or may comprise one or more polypeptides. The polypep- derivatives thereof tides incorporated into pharmaceutical compositions [0068] An other preferred example of such a nutrient may be the TKTL1 polypeptides in combination with one 10 composition / dietary supplement comprises a TKTL1 ac- or more other known polypeptides such as for example tivator, especially thiamin or benfotiamine or one or more enzymes, antibodies, regulatory factors, such as cyclins, derivatives thereof. Said derivatives are preferably char- cyclin-dependent kinases or CKIs, or toxins. acterised by the above-mentioned chemical structure [0063] When blood sugar levels rise, some key kinds (structural formulas). of cell - including nerve cells (neurons) and the cells that 15 [0069] The present disclosure also relates to the use make up the fine blood cells of the retina of the eye and of a compound for the treatment of a disease associated the filtering units (glomeruli) of the kidney - are also flood- with an enhanced or decreased level or activity, an ab- ed with glucose. The resulting high sugar levels within normal cellular localization of the TKTL1 protein, aggre- these cells cause a logjam in the normal cellular metab- gation status and/or dimerization status compared to a olism of glucose. This backlog results glucose associated 20 control, wherein said compound is a compound identified cell damages and in a buildup within the cell of super- by a method comprising the following steps: reactive glucose-metabolic intermediates known as tri- osephosphates leading to advanced glycation endprod- (a) contacting a TKTL1 polypeptide as defined in the ucts (AGE). And once that happens, the excess glucose preceding claims or a cell expressing said polypep- and triosephosphates attack the surrounding proteins, 25 tide in the presence of components capable of pro- lipids, and DNA within the cell. viding a detectable signal in response to a biological An enhancement of the mam-aGF by activating the activity, preferably transketolase activity; and TKTL1 could be a corrective and preventive in that situ- (b) detecting presence or absence of a signal or in- ation. By the mam-aGF pathway glucose is degraded to crease of the signal generated from said biological nontoxic compounds like fatty acids therefore avoiding 30 activity, wherein the absence, decrease or increase advanced glycation endproduct damages. of the signal is indicative for a putative drug. [0064] Therefore, the disclosure relates to a method for the treatment of glucose and triosephosphate asso- [0070] The drug candidate may be a single compound ciated cell damages and prevention of AGE-associated or a plurality of compounds. The term "plurality of com- cell damages in a patient in need of such treatment com- 35 pounds" is to be understood as a plurality of substances prising administering an effective amount of at least one which may or may not be identical. Said compound or TKTL1 activator to said patient. plurality of compounds may be chemically synthesized [0065] With other words: Therefore the disclosure also or microbiologically produced and/or comprised in, for relates to the use of at least one TKTL1 activator for man- example, samples, e.g., cell extracts from, e.g., plants, ufacturing a pharmaceutical composition for the treat- 40 animals or microorganisms. Furthermore, said com- ment and prevention of AGE-associated cell damages in pound(s) may be known in the art but hitherto not known a patient. to be capable of suppressing or activating TKTL1 [0066] A defection/disturbance of the mam-aGF path- polypeptides. The reaction mixture may be a cell free way is not generally associated with a serious disease extract or may comprise a cell or tissue culture. Suitable but sometimes merely associate with disturbances of the 45 set ups are known to the person skilled in the art. The physical stage which indeed are subjective unpleasant, plurality of compounds may be, e.g., added to the reac- but do not need a medical treatment. Furthermore the tion mixture, culture medium, injected into a cell or oth- mam-aGF pathway can be controlled not only by activat- erwise applied to the transgenic animal. The cell or tissue ing or inhibiting the TKTL1 enzyme but also by limiting that may be employed in the method of the invention the substrate (glucose) for this metabolic pathway.50 preferably is a host cell, mammalian cell or non-human Therefore the present disclosure further provides nutrient transgenic animal of the invention described in the em- compositions / dietary supplements containing a low glu- bodiments hereinbefore. cose/carbohydrate content, a high oil/fat content and a [0071] If a sample containing a compound or a plurality moderate protein content and further comprising an ef- of compounds is identified, then it is either possible to fective amount of an inhibitor or activator of the activity 55 isolate the compound from the original sample identified or concentration of the enzyme TKTL1 and a pharma- as containing the compound capable of suppressing or ceutically acceptable carrier. activating TKTL1, or one can further subdivide the orig- [0067] A preferred example of such a nutrient compo- inal sample, for example, if it consists of a plurality of
9 15 EP 2 256 500 B1 16 different compounds, so as to reduce the number of dif- ufacturing a pharmaceutical composition for the treat- ferent substances per sample and repeat the method with ment of cancer associated with an overexpression of the subdivisions of the original sample. Depending on TKTL1 enzyme in the tumor cells. the complexity of the samples, the steps described above [0077] Since it is known that large amounts of lactate can be performed several times, preferably until the sam- 5 lead to a matrix degradation and that this facilitates tissue ple identified according to the present method only com- remodeling and wound healing, the data and knowledges prises a limited number of or only one substance(s). Pref- obtained in the course of the experiments result in a fur- erably said sample comprises substances of similar ther part , namely in a method for treatment (or influenc- chemical and/or physical properties, and most preferably ing the processes) of tissue remodeling, wound healing said substances are identical. 10 etc in a patient in need of such treatment comprising ad- [0072] The compounds which can be tested and iden- ministering an effective amount of at least one TKTL1 tified may be peptides, proteins, nucleic acids, antibod- inhibitor or TKTL1 activator to said patient. ies, small organic compounds, hormones, peptidomimet- With other words: The disclosure also relates to the use ics, PNAs or the like. These compounds may also serve of at least one TKTL1 inhibitor or TKTL1 activator for as lead compounds for the development of analog com- 15 manufacturing a pharmaceutical composition for en- pounds. The analogs should have a stabilized electronic hancing or reducing the processes of tissue remodeling, configuration and molecular conformation that allows key wound healing etc. functional groups to be presented to the TKTL1 in sub- An example of such pharmaceutical composition com- stantially the same way as the lead compound. In partic- prising at least one TKTL1 inhibitor is intended to be ap- ular, the analog compounds have spatial electronic prop- 20 plied in restenosis in heart valves to prevent proliferation erties which are comparable to the binding region, but of endothelial cells. can be smaller molecules than the lead compound, fre- [0078] Since many years transketolase proteins and quently having a molecular weight below about 2 kD and transketolase enzyme activities have been related to preferablybelow about 1 kD.Identification ofanalog com- neurodegenerative diseases like Wernicke-Korsakoff pounds can be performed through use of techniques25 syndrome, Alzheimer diseasepatients, etc. However, the such as self-consistent field (SCF) analysis, configura- question, how this relation looks like remains open until tion interaction (CI) analysis, and normal mode dynamics completion of the present disclosure. analysis. Computer programs for implementing these In the course of the experiments leading to the present techniques are available; e.g., Rein, Computer-Assisted disclosure it was found, that both, patients with Alzheimer Modeling of Receptor-Ligand Interactions (Alan Liss,30 disease and patients with Wernicke-Korsakoff syn- New York, 1989). drome, have reduced TKTL1 enzyme acitivities and [0073] As known up to now the novel discovered mam- TKTL1 protein variants with different isoelectric points or aGF is regularly (normally, natively) present in healthy smaller size. In patients with Wernicke-Korsakoff syn- tissues like retina, endothelial cells, nervous tissue and drome it could be demonstrate that their cells do harbor testis. 35 TKTL1 protein isoforms with a reduced affinity for thia- [0074] In the course of the experiments it became ob- min. Since glycation (e.g. glucose is covalently bound to vious that in several tumor tissues the mam-aGF pro- the proteins - the chemical reaction is known as Schiff’s ceeds with high turn-over. In these tumor cells an over- base reaction) is one of the processes involved in amy- expressing of the TKTL1 enzyme was detected and like- loidogenesis and protein plaque generation leading to wise large amounts of lactate leading to a matrix degra- 40 neurodegenerative diseases (for example: the fibrils dation. These findings confirm the studies of Warburg, present in Alzheimer’s disease patients share several who detected that not only in the absence of oxygene properties common to glycated proteins and glycation but also in the presence of oxygen tumor tissue degrades causes the structural transition from folded, soluble form glucose to lactate, and that there is a correlation between to beta-fibrils) reduced TKTL1 enzyme activities results the degree of aerobic fermentative glucose degradation 45 in an enhancement of glycation and finally in enhanced (aerobic glycolysis), lactate production and malignancy. amyloidogenesis and protein plaque generation. By transcript and protein based analysis of the three TKT [0079] Due to these facts the present disclosure also family members it could be demonstrated, that the TKTL1 comprises a method for treatment of neurodegenerative gene is the transketolase gene/protein which is overex- diseases like Wernicke-Korsakoff syndrome, Alzheimer pressed in tumors. 50 disease etc. by inhibiting glycation via activation of the [0075] Therefore the present disclosure also compris- mam-aGF in a patient in need of such treatment com- es a method for the treatment of cancer associated with prising administering an effective amount of at least one an overexpression of TKTL1 enzyme in the tumor cells activator of TKTL1 enzyme activity to said patient (e.g. in a patient in need of such treatment comprising admin- thiamin or benfotiamine application in food). istering an effective amount of at least one TKTL1 inhib- 55 Furthermore, enhancing the TKTL1 activity and thereby itor to said patient. the mam-aGF can prevent the development of Alzheim- [0076] With other words: Therefore the disclosure also er’s disease in individuals with a predisposition due to relates to the use of at least one TKTL1 inhibitor for man- TKTL1. Thus, the present disclosure further comprises
10 17 EP 2 256 500 B1 18 a method to determine individuals with TKTL1 predispos- from four different tumor entities. (C) ing variants to identifiy individuals eligible for a preventive TKTL1 full length protein expressed in TKTL1 therapy. E. coli. In this context it should be mentioned that unwanted ap- optosis in cells like neurons can be reduced or blocked 5 Figure 3: Determination of transketolase activity by treatment of TKTL1 with activating compounds iden- of native (A) and recombinant (B) tified by the methods according to the disclosure. TKTL1 protein. [0080] For patients with diabetes mellitus it hasbeen shown recently that benfotiamine treatment of such pa- Figure 4: TKTL1 protein expression in A-B: nor- tients effects the blockade of three major pathways of 10 mal corpus tissue of gastric carcinoma hyperglycemic damage and prevents diabetic retinopa- patient 1; C-F: tumor tissue of gastric thy. Now, in the course of the experiments the inventors carcinoma patient 1; G-I: normal an- were able to identify the TKTL1 enzyme as the target of trum tissue of gastric carcinoma patient that benfotiamin treatment in those tissues (endothelial 2,J-N: gastric carcinoma cellsof patient cells, retina, and nerves) in which patients with diabetes 15 2, O,P: poorly differentiated gastric car- get cell damage due to AGE (advanced glycation end- cinoma; Q: colon carcinoma; R: super- product) formation or cell death. ficial bladder carcinoma; S,T: invasive AGE is also caused by an excess of glucose and triose- poorly differentiated bladder carcino- phosphates within cells. An enhancement of the mam- ma. Magnification: G x50; C,H, and J aGF by activating the TKTL1 would result in a degrada- 20 x100; A,B,D,E,I,K,M,O, and S x200; tion of glucose and triosephosphates. F,L,N,P,Q,R and T x400. Due to these facts the present disclosure also comprises a method for the treatment of AGE in patients, especially Figure 5: TKTL1 staining of noninvasive and in- diabetes patients, in need of such treatment, comprising vasive bladder carcinoma. administering an effective amount of at least one activa- 25 tor of TKTL1 enzyme activity to said patient, preferably Figure 6-8: Expression of TKTL1 and phosphor- benfotiamine. ylated Akt (ph-Akt) in paraffin embed- [0081] In the course of the experiments it was further ded sections of A-C: normal, papillary found that reducing the TKTL1 activity can cause growth (PTC), follicular (FTC), and undifferen- retardation and preferential reduction of adipose tissue. 30 tiated (UTC) thyroid cancer; D: normal By inhibition of TKTL1 in adipose tissue obesity can be and NSLC tissues, E: colon cancer; F: treated. normal bladder; G: prostate carcino- [0082] Diseases like sytemic lupus erythematosus mas. AEC = red staining; Counterstain- (SLE), rheumatoid arthritis, multiple sclerosis (MS), fibro- ing with haematoxylin = blue staining, myalgia, crohn’s disease, irritable bowel syndrome (IBS) 35 Yellowarrowheads indicate nuclear ph- have steadily risen for the past 80 years. Targeting AKT staining TKTL1 lead to a significant decrease in levels of auto- antibodies in patients with autoimmundiseases. Figure 9-10: Expression of TKTL1 in endothelial [0083] The present invention will be explained by cells. means of the following examples and figure. 40 Figure 11-12: Expression of TKTL1 in neuronal cells. Brief description of the drawings: Figure 13-14: schematic drawing of the mam-aGF [0084] pathway. 45 Figure 1: (A) Quantification of TKTL1 transcripts Figure 15: 2-dimensional (2D)-gel electrophoresis in gastric and lung adenocarcinoma of a multi-protein complex harboring samples and their corresponding nor- TKTL1 protein isoforms (arrow A), mal tissues. N - normal sample; T - tu- DNaseX, and GAPDH. mor sample; M - marker, 100 bp and 50 200 bp fragments are shown. Figure 16: 2D-gel electrophoresis of high molecu- lar weight TKTL1 protein isoforms (ar- Figure 2: (A) Expression pattern of the human row) identified by immunostaining. TKTL1 gene on northern blots of po- ly(A)+mRNA from different human adult 55 Figure 17: ELISA determination (A) of TKTL1 pro- tissues analysed with a TKTL1 cDNA tein isoforms and (B) of transketolase probe. (B) Expression of TKTL1 protein activity of isolated TKTL1 protein. Val- isoforms in five tumor cell lines derived ues obtained (A)A1-A5: from leuko-
11 19 EP 2 256 500 B1 20 cytes fromhealthy persons, (A)A6-A10: D3: from (B)leukocytes from AD pa- from fibroblasts from healthy persons, tients, (B)D4-D6: from fibroblast from (A)B1-B5: from serum from healthy per- AD patients, (B)D7-D9: from serum sons, (A)B6-B10: from brain cells from from AD patients, (B)D10-D12: from healthy persons, (A)A11-A12: without 5 brain cells from AD patients, (B)E1-E3: probe material (background level), from leukocytes from Morbus Parkin- (A)B11-B12: without probe material son patients, (B)E4-E6: from fibroblast (background level), (A)C1-C3: from from Morbus Parkinson patients, leukocytes from AD patients, (A)C4- (B)E7-E9: from serum from Morbus C6: from fibroblast from AD patients, 10 Parkinson patients, (B)E10-E12: from (A)C7-C9: from serum from AD pa- brain cells from Morbus Parkinson pa- tients, (A)C10-C12: from brain cells tients, (B)F1-F3: from leukocytes from from AD patients. (A)D1-D3: from leu- SLE patients, (B)F4-F6: from fibroblast kocytes from Morbus Parkinson pa- from SLE patients, (B)F7-F9: from se- tients, (A)D4-D6: from fibroblast from 15 rum from SLE patients, (B)F10-F12: Morbus Parkinson patients, (A)D7-D9: from kidney cells from SLE disease pa- from serum from Morbus Parkinson pa- tients, (B)G4-G6: from fibroblast from tients, (A)D10-D12: from brain cells multiple sclerosis patients, (B)G7-G9: from Morbus Parkinson patients, from serum from multiple sclerosis pa- (A)E1-E3: from leukocytes from Hunt- 20 tients, (B)G10-G12: from kidney cells ington disease patients. (A)E4-E6: from from multiple sclerosis patients, (B)H1- fibroblast from Huntington disease pa- H3: from leukocytes from diabetes type tients. (A)E7-E9: from serum from II patients, (B)H4-H6: from fibroblast Huntington disease patients, (A)E10- from diabetes type II patients, (B)H7- E12: from brain cells from Huntington 25 H9: from serum from diabetes type II disease patients, (A)F1-F3: from leuko- patients, (B)H10-H12: from kidney cells cytes from SLE patients, (A)F4-F6: from diabetes type II disease patients. from fibroblast from SLE patients. (A)F7-F9: from serum from SLE pa- General information concerning the Examples: tients. (A)F10-F12: from kidney cells 30 from SLE disease patients, (A)G1-G3: Origin and Cultivation of cells from leukocytes from Morbus Parkin- son patients. (A)G4-G6: from fibroblast [0085] The lung carcinoma cell line A549, the breast from Morbus Parkinson patients. carcinoma cell line MCF7, the liver carcinoma cell line (A)G7-G9: from serum from Morbus 35 HepG2, and the colon carcinoma cell lines HCT116 and Parkinson patients, (A)G10-G12: from HT29 were obtained from ATCC. Cells were grown in kidney cells from Morbus Parkinson RPMI 1640 or DMEM supplemented with 10% FCS, pen- disease patients, (A)H1-H3: from leu- icillin and streptomycin (Invitrogen) at 37°C with 5% CO 2. kocytes from diabetes type II Morbus Parkinson patients, (A)H4-H6: from fi- 40 Northern blot analysis broblast from diabetes type II patients, (A)H7-H9: from serum from diabetes [0086] A DNA probe from the 3’ untranslated region type II patients, (A)H10-H12: from kid- (residue 1627 to 2368) of the TKTL1 transcript (acc. no. ney cells from diabetes type II disease X91817) was labelled with [[alpha]-32P]dATP and [[al- patients, (B)A1-A5: from leukocytes45 pha]-32P]dCTP (3000 Ci/mmol) in a random primed re- from healthy persons, (B)A6-A10: from action (Feinberg and Vogelstein, 1983). Hybridization fibroblasts from healthy persons, was carried out in 0.5 M sodium phosphate, 7% SDS, (B)B1-B5: from serum from healthy per- 0.2% bovine serum albumin, 0.2% PEG 6000, 0.05% pol- sons, (B)B6-B10: from brain cells from yvinylpyrrolidone 360000, 0.05% Ficoll 70000 and 0.5% healthy persons, (B)A11-A12: without 50 dextran sulphate at 65°C overnight. Non-specifically probe material (background level), bound probe was removed by washing at 65°C in 40 mM (B)B11-B12: without probe material sodium phosphate, pH 7.2, 1% SDS for 60 min. Filters (background level), (B)C1-C3: from were exposed to X-ray film (Kodak) for 1-5 days. A mul- healthy persons, (B)C4-C6: from neu- tiple human adult tissue poly(A) + RNA northern blot was ronal cells from healthy persons,55 purchased from BD Biosciences Clontech. (B)C7-C9: from kidney cells from healthy persons, (B)C10-C12: from co- lon cells from healthy persons, (B)D1-
12 21 EP 2 256 500 B1 22
Western blot analysis Example 2: Isolation and Purification of the TKTL1 full length protein [0087] For Western blot analysis, cells were lysed in lysis buffer (50 mM Tris-HCl pH 7.5, 150 mM sodium [0091] The TKTL1 full length protein was expressed in chloride, 1% NP40, 0.5% sodium deoxycholate, 0.1% 5 E. coli and was isolated by affinity purification through SDS, 0.02% sodium azide, 1 mM phenylmethylsulfonyl the N-terminal His-tag. One mg of affinity purified TKTL1 fluoride). Aliquots of 50 mg of soluble protein was loaded protein was loaded onto a 4-20%-gradient SDS gel and into each well, electrophoresed on 12.5% SDS-polyacr- stained with Coomassie. Proteins different in size were ylamide gels, and transferred to polyvinylidene difluoride detected. The largest protein (66kDa) represents the N- membranes (Millipore). For detection of TKTL1-proteins 10 terminal His-tagged full length TKTL1 protein, whereas the HRP-coupled JFC12T10 MAb was used in a final smaller TKTL1 proteins are likely due to C-terminal pro- concentration of 1 mg/ml. The MAb was visualized with teolytic cleavage already present prior to isolation pro- an ECL Western blot detection system (Amersham Phar- cedure. Note that the migration of the recombinant 66kDa macia Biotech). His-tagged TKTL1-full length protein indicates a size of 15 75 kDa. Sizes of the protein marker are indicated in kDa. Enzyme-linked immunosorbent assay (ELISA) Example 3: Determining the level of TKTL1 gene ex- [0088] TKTL1 protein affinity-purified from cell lines pression in tissues by measuring the TKTL1 mRNA was determined using common standard ELISA tech- levels niques. Three different affinity-purified mouse IgG mon- 20 oclonal anti-TKTL1 antibodies (5 mg/ml) were used for [0092] Dissections of biopsies can be semi-quantita- coating of ELISA plates. Horseradish peroxidase conju- tively analysed for the mRNA level of TKTL1 gene in an gated anti-TKTL1 antibody JFC12T10 was used at 5 in-situ staining reaction. The staining reaction is per- mg/ml as the secondary reagent. Bound proteins in the formed as follows: multi-protein complex were affinitiy-purified from cell25 The tissue dissections are incubated in ascending etha- lines using antibodies directed TKTL1, DNaseX, ph-Akt, nol concentrations up to 100% ethanol. After evaporation GAPDH. Binding to certain proteins was assesed by ELI- of the alcohol the dissections are boiled in 10 mM citrate SA technique, using e.g. the combination of TKTL1 and buffer (pH 6,0) for pre-treatment of the tissue. The hy- GAPDH antibodies; and the combination of TKTL1 and bridization mixture is prepared by mixing 50 ml of ready DNaseX antibodies; and the combination of ph-Akt and 30 to use hybridization buffer (DAKO A/S, Glostrup, Dan- DNaseX antibodies. mark) with about 5-10 pmol of the probes. The probes are fluorescein-labelled oligonucleotides of the following 2D-analysis of multi-protein complexes sequence: TCTCATCACAAGCAGCACAGGAC
[0089] The samples were analysed by high resolution 35 Example 4: Determination of transketolase activity 2D gel electrophoresis (8x7 cm). 2.5 mg of protein was of native (A) and recombinant (B) TKTL1 protein applied to two 2D gels for each sample and 2D gel was stained by silver and the proteins of the second one were [0093] The two-substrate and one-substrate reaction transferred to PVDF membranes by semidry electroblot- of native (A) and recombinant (B) TKTL1 protein was ting for immunostaining. 40 determined by the production of NADH as measured by gain in absorbance at 340 nm. Xylulose-5-phosphate Example 1: Expression pattern of the human TKTL1 (X5P) and ribose-5-phosphate (R5P) were used to de- gene on northern blots of poly(A) +mRNA from differ- termine the two-substrate reaction, whereas X5P alone enthuman adult tissues analysed with a TKTL1 cDNA was used for the one-substrate reaction. In Fig. 3 one probe 45 representative of three independent enzymatic assays leading to similar results is shown. [0090] Expression pattern of the human TKTL1 gene was analysed with a TKTL1 cDNA probe on Northern Example 5: Determination of TKTL1 isoforms by ELI- blots of poly(A)+mRNA from different human adult tis- SA sues. The results are shown in Figure 2 (A). Four tran- 50 scripts of 1.4, 1.9, 2.5, and 2.7 kb are detectable. Where- [0094] The combination of TKTL1 antibody JFC6T8 as the main transcript in most tissues is 2.5 kb in size, in and JFC5T3 determines a TKTL1 protein isoform spe- heart the small transcript of 1.4 is abundant and the 2.5 cifically present in patients with neurodegenerative dis- and 2.7 kb transcripts are missing. Transcript sizes are eases. The antibodies JFC6T8 and JFC5T3 were cou- indicated in kb. 55 pled to an ELISA plate, and incubated with samples from healthy persons and patients. After removing unspecific bound material, enzymatic activity was determined as described above. High enzymatic activities were ob-
13 23 EP 2 256 500 B1 24 tained in samples of healthy persons. The individual re- Tris[pH7.5], 5mM imidazole, 5 mM beta-mercaptoetha- sults are listed in Fig. 17 (A) nol, 500 mM NaCl, and 1% Triton X-100) by freezing (dry ice, 10 min) and thawing (37°C, 5 min) 3 times. Soluble Example 6: Identification of high molecular weight protein fractions were obtained by centrifugation of the 5 TKTL1 protein isoforms by 2D-gel electrophoresis cell lysate at 12.000 xg for 30 min at 4°C. His6-TKTL1 protein was purified with Ni-NTA resins (Qiagen) accord- [0095] High molecular weight TKTL1 protein isoforms ing to the manufacturer’s instructions with elution buffer from a patient with a neurodegenerative disease (AD) containing 200 mM imidazole. Imidazole and salt were were isolated analyzed by 2D-gel electrophoresis and subsequently removed by dialysis against 0.1 M Tris (pH identified by immunostaining. The results are shown in 10 7.5). The purified enzyme was stored at -20°C in 40% Fig. 16. glycerol and 0.1 % dithiothreitol (DTT).
Example 7: Multi-protein complex harboring TKTL1, (B) Providing native protein isoforms isolated from hu- DNaseX, and GAPDH man cells 15 [0096] The multi-protein complex harboring TKTL1, [0100] Native TKTL1 proteins and protein complexes DNaseX, and GAPDH was affinity-purified from human harboring TKTL1, both harvested from human cell lines, chronic myelogenous leukemia K562 cells using TKTL1 must be purified, for example via affinity-purification. This antibody JFC12T10 coupled to carbo-link. A 2-dimen- can be realized as following: sional (2D)-gel electrophoresis of that multi-protein com- 20 plex was carried out. TKTL1 protein isoforms (arrow A) 10 mg of MAb JFC12T10 was coupled to 2 ml carbo- and other proteins present in the complex were identified link according to the manufacturer’s instructions by immunostaining and sequence determination. The re- (carbo-link; Pierce). Cells were grown in serum free sults are shown in Fig. 15. media (ISF-1, InVivoBioTech Services GmbH). After 25 centrifugation, the pellet of 2.2x109 cells was re- Example 8: Transketolase activity of TKTL1 isolated solved in 50 ml PBS containing protease inhibitors from healthy and patient derived specimens, deter- cocktail (Roche). A cell lysis was performed using a mined with ELISA french press, followed by a centrifugation at 50.000 xg. The supernatant was filtered (0.2 mm) and bind- [0097] TKTL1 antibody JFC3T9 was coupled to an ELI- 30 ing of supernatant to affinity material was performed SA plate, and incubated with samples from healthy per- over night at 4°C (batch modus). After transfer to a sons and patients. After removing unspecific bound ma- column, a wash procedure was performed with 150 terial, enzymatic activity was determined as described mM PBS buffer pH 7.4. For elution of column at- above. High enzymatic activities were obtained in sam- tachedproteins 100mM Glycin-HClpH 2.0 was used. ples of healthy persons. The individual results are listed 35 Two proteins peaks, detected using a UV 280 nm- in Fig. 17 (B). based detection system, have been collected and neutralized with Tris pH 7.4. Example 9: Assays for detection of compounds for enhancing or reducing the TKTL1 enzyme activity [0101] Enzymatic tests can be performed with the re- 40 combinant or the native, affinity purified TKTL1 protein. [0098] Since the TKTL1 protein isoforms represent moonlighting proteins, different assays for identifying ac- (C) Detection of suitable compounds by determining the tive small compounds have to be applied. Assays for de- two-substrate transketolase reaction. tection of compounds for enhancing or reducing the TKTL1 enzyme activity can be performed by the recom- 45 [0102] binant protein isoforms or by native protein isoforms iso- lated from human cells. (C-1) The transketolase (two-substrate) activity of TKTL1 was measured by a coupled enzyme assay (A) Providing recombinant TKTL1 protein isoforms at 25°C. Reactions were started by addition of re- 50 combinant and native TKTL1 protein (a) in the pres- [0099] This can be realized by expression of recom- ence of the test compound and (b) in the absence binant TKTL1 protein isoforms in E.coli. The TKTL1 open of the test compound and determined spectrophoto- reading frame (MADAE...CMLLN) of cDNA sequence metrically by the rate of reduction of NAD+ in the (acc. no. BC025382) was cloned into the pDEST17 vec- following reaction sequence: xylulose-5-phosphate tor (Invitrogen). Bacterial expression was performed in 55 (X5P) and ribose-5-phosphate (R5P) > (TKTL1 ac- the E. coli strain BL21-AI (Invitrogen), and expression tivity) > glyceraldehyde-3-phosphate, sedoheptu- was induced with 0.2% arabinose at 21°C for 4 h. Crude lose-7-phosphate > (glyceraldehyde-3-phosphate cell lysate was prepared in lysis buffer (20mM dehydrogenase activity [GAPDH]) > NAD + -> NADH
14 25 EP 2 256 500 B1 26
+ H+, 1,3-phosphoglycerate. an otherwise complete reaction mix of 100 Transketolase two-substrate activity (a) in the pres- mmol/L Tris-HCl (pH 7,5), 5 mmol/L xylulose 5 ence of the test compound and (b) in the absence phophate, 1,2 mmol/L MgCl2, 3 mmol/L phos- of the test compound was determined in the following phate, 0,1 mmol/L NADH, 2000 U/L glycerol-3- reaction (final concentrations): 4 mM X5P, 4 mM 5 phosphate dehydrogenase and triose phophate + R5P, 500 mM NAD , 2 mM MgCl 2, 200 mM thiamine isomerase. Reactions are conducted at 37°C. PP, 5 mg recombinant TKTL1 protein, or 4 mg native The oxidation of NADH, which is directly propor- TKTL1 protein, 3 U GAPDH, 0.15 mol/l Tris buffer tional to transketolase activity, is followed by pH 7.4 in a reaction volume of 1 ml. Transketolase monitoring the decrease in absorbance at 340. one-substrate activity was determined by omitting 10 R5P, using X5P solely as substrate. GAPDH was (D-2) via reduction of NAD: obtained from Sigma. Transketolase activity (a) in the presence of the (C-2) Transketolase activity (a) in the presence of test compound and (b) in the absence of the test the test compound and (b) in the absence of the test 15 compound is measured by using a conventional compound can be measured by using a conventional enzyme-linked method under conditions in enzyme-linked method under conditions in which which coupling enzymes are not limiting. Reac- coupling enzymes are not limiting. Reactions are in- tions are initiated by the addition of transketola- itiated by the addition of transketolase protein to an se protein (a) together with the test compound otherwise complete reaction mix of 100 mmol/L Tris- 20 and (b) in the absence of the test compound to HCl (pH 7,5), 10 mmol/L ribose 5-phosphate, 2 an otherwise complete reaction mix of 100 mmol/L xylulose 5-phophate, 1,2 mmol/L MgCl 2, 0,1 mmol/L Tris-HCl (pH 7,5), 5 mmol/L xylulose 5 mmol/L NADH, 2000 U/L glycerol-3-phosphate de- phophate, 3 mmol/L phosphate, 1,2 mmol/L
hydrogenase and triose phophate isomerase. Reac- MgCl2, 0,1 mmol/L NAD, 2000 U/L glyceralde- tions are conducted at 37°C. The oxidation of NADH, 25 hyde-3-phosphate dehydrogenase. Reactions which is directly proportional to transketolase activ- are conducted at 37°C. The reduction of NAD, ity, is followed by monitoring the decrease in absorb- which is directly proportional to ketolase activity, ance at 340 nm. is followed by monitoring the increase at 340 nm. In addition, generation of acetyl-phosphate (C-3) Substrates (in variable concentrations) can be 30 can be measured. tested as possible donors if erythrose-4-phosphate (1 mM) as acceptor is used. In such a reaction fruc- (E) Determining transketolase reaction with further sub- tose-6-phosphate will be build. With the enzymes strates glucose-6-phosphate-dehydrogenase and 6-phos- phoglucose-isomerase, fructose-6-phosphate will 35 [0104] Transketolase activity (a) in the presence of the be oxidized to 6-phosphogluconolactone, leading to test compound and (b) in the absence of the test com- the generation of NADPH. pound is measured by using a conventional enzyme- linked method under conditions in which coupling en- (C-4) Formaldehyde (variable concentrations) as ac- zymes are not limiting. Reactions are initiated by the ad- ceptorcan be used leading to dihydroxyacetone.The 40 dition of transketolase protein (a) together with the test following reaction of glycerin-dehydrogenase builds compound and (b) in the absence of the test compound glycerin, concomittant with an oxidation of NADH. to an otherwise complete reaction mix of 100 mmol/L Tris-Cl (pH 7.5), 5 mmol/L acetaldehyde, 5 mmol/L pyru- (D) Determining the one-substrate transketolase reac- vate, 1,2 mmol/L MgCl2. The reaction leads to 3-hy- 45 tion droxybutanon (acetoin)and CO 2. Reactions are conduct- ed at 37°C. Transketolase activity is measured by HPLC- [0103] chromatography. [0105] Further substrates can be: (D-1) via oxidation of NADH: 50 (a) Formaldehyde and pyruvate leading to hydroxy- Transketolase activity (a) in the presence of the aceton and CO2. test compound and (b) in the absence of the test (b) Glycerinaldehyde and pyruvate leading to 1-des-
compound is measured by using a conventional oxyxylulose and and CO2. enzyme-linked method under conditions in which coupling enzymes are not limiting. Reac- 55 (F) In vivo assays for identification of TKTL1 inhibitors tions are initiated by the addition of transketola- based on lactate production se protein (a) together with the test compound and (b) in the absence of the test compound to [0106] Cell lines, which can be tested are, e.g., gliob-
15 27 EP 2 256 500 B1 28 lastomacell line LN18, coloncancer cell lineHT29, breast extract AVEMAR or apple extracts. Substrates or sub- cancer cell line MCF7. Cell lines have to be grown in strate-analogues specific for TKTL1 can be used to ac- media containing 2 mg/ml glucose (a) in the presence of celerate or inhibit TKTL1 enzymatic activity. Reactions the test compound and (b) in the absence of the test specific for the TKTL1 protein isoforms can be exploited compound. 5 to inhibit or activate TKTL1 enzyme activities. Glucose consumption and lactate production has to be Compounds which inhibit the TKTL1 enzymatic activity determined for 5 days. Every day the glucose and lactate can be used to prevent obesity. content in the media is tested. As an additional control, [0108] Thus, compounds can be identified which will glioblastoma cell line LN229 could be used, which does lead to a reduced glucose consumption or lactate pro- not show high glucose consumption and a high lactate 10 duction. Such compounds are, e.g., useful for reducing production rate. obesity, for reducing or inhibiting spermatogenesis, lac- tate production in sperms (leading to a matrix degrada- Example 10: Screening methods for drug candidates tion in uterus) thus can be applied as contraceptives. [0109] Moreover, compounds can be identified which (A) Assays for single compound testing 15 will lead to an enhanced glucose consumption or lactate production. Such compounds can be used, e.g., for ac- [0107] Cell lines (e.g., as described above) should be celerating wound healing and bone repair, for reducing grown with and without the compound to be tested. As and normalizing blood glucose levels in diabetes mellitus synthetic test compounds, for example, thiamin, oxythi- patients, for preventing or reducing pathological altera- amin, p-hydroxyphenylpyruvate, pyrithiamin, amprolium, 20 tions in small and large vessels in diabetes mellitus pa- 2-methylthiamin, benfooxytiamine, benfotiamine, 2- tients, for reducing retinopathies or neuropathies in dia- methoxy-p-benzochinon (2-MBQ) und 2,6- dimethoxy- betes mellitus patients and for inhibiting or preventing p-benzochinon (2,6-DMBQ), genistein, and flavonols as neurodegenerative diseases like Alzheimer disease, e.g. quercetin, catechins, nitrilosides and anthocyanins Wernicke-Korsakoff syndrome, Huntington disease, and or derivatives of them can be used. 25 Morbus Parkinson. Derivatives of the above listed compounds can be gen- erated by substituting or adding one or more of the fol- (B) Assays for determining compounds influencing the lowing groups: protein-proteininteractions of themutated TKTL1 protein isoforms 30 linear and branched (C1-C12) aliphatic alkyl groups, substituted with at least one group chosen from OH, [0110] Protein-protein interactions play a role both in 5 5 NH2, SH, CN, CF3, halogen, CONHR, COOR , regulating enzymatic activity and in signal transduction 5 5 5 5 OR , SR , SiOR , NHR , aliphatic (C 3-C6) rings, and pathways that regulate cellular function. The number of 5 aromatic (C3-C6) rings, wherein R is chosen from small molecules protein-protein interaction inhibitors 35 linear and branched (C1-C4) alkyl groups, (SMPIIs) is growing rapidly. Living cells are continuously aryl groups, exposed to a variety of signals from their micro- and mac- natural polymers, synthetic polymers, and copoly- ro-environment. Many of these signals are detected by mers, said polymers and copolymers carrying at receptors present on the cell surface, and are then proc- least two groups chosen from: hydroxyl, carboxylate, essed and transduced by intracellular signalling cas- primary amine, secondary amine, tertiary amine, thi- 40 cades. Because the ultimate site of action in a signalling ol, and aldehyde; cascade is often far from the cell surface, an inherent
a hydrogen atom, a halogen atom, CF 3, OH, OCF3, feature of intracellular signalling pathways is the require- COOH, R7, OR7, and OCOR 7, wherein R 7 is chosen ment that proteins translocate from one position to an- from linear and branched (C1-C4) aliphatic alkyl other within the cell. These translocations, and thus cell groups; 45 signalling and response, depend critically on protein-pro- a monohalogenated and polyhalogenated linear and tein interactions that mediate protein translocation
branched (C 1-C4) alkyl groups, and from aryl groups, through the intracellular space. wherein the aryl groups are optionally substituted [0111] As an example of a typical signal transduction
with at least one group chosen from OH, NH2, SH, pathway involving protein translocation, the signalling 8 8 8 50 CN, CF3, halogen, COOH, CONHR , COOR , OR , and protein translocation steps involved in the cellular SR8, and NHR8, wherein R8 is chosen from linear response of the phosphatidylinositol 3 kinase (PI3K) and branched (C1-C12) alkyl radicals; and pathway to a growth factor such as insulin is depicted. from linear and branched (C1-C4) alkyl groups, and This pathway influences and is influenced by TKTL1. a CF3 group. 55 1. Insulin binds to and activates its receptor at the Natural products, or extracts or fractions thereof can also cell surface. Upon activation, the receptor recruits be used to identify compounds for activating or inhibiting adaptor proteinsand activates intracellular signalling TKTL1 enzymatic activity, e.g., fermented wheat germ molecules including PI3K.
16 29 EP 2 256 500 B1 30
2. Activated PI3K increases the plasma membrane [0115] Cell-based assays that monitor the intracellular concentration of the lipid phosphatidylinositol 3,4,5- behaviour of target molecules, rather than binding or cat- triphosphate (PIP3). alytic activity of purified proteins, can now be used in 3. PIP3 in the plasma membrane provides docking high-throughput screens to discover and profile SMPPI- sites for protein kinases including Akt1/PKBa and 5 Is. PDK1; Akt is activated by PDK1 only when both are [0116] Known transketolase (TKT) genes encode a docked at the membrane. This translocation step is single protein with enzymatic activity, whereas TKTL1 an absolute requirement for Akt activation. transcripts and proteins different in size have been de- 4. Once activated by PDK1 at the plasma membrane, tected. Furthermore, part of the TKTL1 protein(s) is Akt is free to diffuse back into the cell interior, where 10 present in the nucleus of cells. Therefore the one gene it can phosphorylate substrate such as the transcrip- / one protein / one function relationship is wrong for the tion factor Forkhead (FKHR, FOXOA1). TKTL1 gene. Known transketolases are homodimers of 5. Unphosphorylated FKHR normally resides in the two full length proteins harbouring all typical invariant nucleus, where it modulates genes involved in cell transketolase amino acid residues. The transketolase- cycle arrest and apoptosis. However, once phospho- 15 like gene encoded TKTL1 protein isoforms build TKTL1 rylated by Akt1, FKHR translocates to the cytoplasm, homo/heterodimers and TKT/TKTL1 (and where it can no longer modulate target genes. TKTL2/TKTL1) heterodimers. The expression of TKTL1 protein isoforms - even an enzymatically non-active - in- [0112] Protein-protein interactions and translocations fluences the enzymatic activity of a TKT protein as part are involved at each of these steps, notably for Akt1 and 20 of a TKT/TKTL1 heterodimer. The same is also true for Forkhead. Thus, a signal initiated by the binding of insulin TKTL2/TKTL1 heterodimers. A molecular switch and a to a cell surface receptor modulates the transcription of proton wire synchronizes the active sites in TKT/TKTL1 genes involved in cellular growth and survival via a se- heterodimers and TKTL1/TKTL1 homo- and heterodim- quential cascade of protein translocation events. The ers. Another type of protein interaction is present as therapeutic relevance of this becomes clear when one 25 TKTL1 protein isoforms are part of a multi-protein com- considers that altered signalling responses are often key plex. TKTL1 proteins are bound to transketolase unre- distinguishing features between cells in normal and dis- lated proteins like GAPDH, DNaseX (DNA acc. No. eased tissues. X90392; protein acc. No. CAA62037), (phosphorylat- ed)Akt, histone, histone acetylase, actin binding protein, (C) Assays for small-molecule protein-protein interaction 30 and amyloid precursor protein (APP). The presence or inhibitors binding of each member of the multi-protein complex changes. The changes are influenced by the transloca- [0113] Historically, large peptides and natural products tion of cytoplasmic localized proteins to the nucleus. have been considered the primary compound classes Once arrived in the nucleus, the former cytosolic proteins capable of modulating protein-protein interactions. How- 35 do exerts functions different to the function within the ever, there is growing evidence in the literature and from cytoplasm. We have detected a translocation of DNaseX screening initiatives to suggest that small molecules can from the cytoplasm to the nucleus in apoptotic and tumor also modulate the interactions responsible for protein- cells. We have also detected a translocation of ph-Akt protein complexes. These compounds may act either di- from the cytoplasm to the nucleus in tumor cells (Fig. rectly - via inhibition at the protein-protein interface - or 40 6-8). A translocation of GAPDH has been detected in indirectly - via binding to an allosteric site and induction apoptotic neuronal cells. The release from cytoplasmic of a conformational change of the target protein or an binding sites or the new synthesis of proteins, which are associated molecule. directly translocated into the nucleus, leads to multi-pro- [0114] Traditional small molecule drug discovery fo- tein complexes which are inducing apotosis. This apop- cuses primarily on the activity of compounds against pu- 45 tosis is the basis for the death of cells, e.g. neurons in rified targets, such as binding to cell-surface receptors brains of patients with neurodegenerative diseases. In or inhibition of the catalytic activity of enzymes. While tumor cells the sucide molecule DNaseX is present in these approaches have led to the development of a large the nucleus, (but exerts no DNase activity,) which would number of useful drugs, they clearly have limitations. Be- lead to apoptosis and cell death of the tumor cells. In- cause of the complex network environment in which in- 50 stead, binding to this multi-protein complex leads to in- tracellular signalling occurs, it is advantageous to screen activation of DNaseX in tumor cells. Therefore apoptosis compounds in living cells to reproduce the pathway and is blocked. In neurodegenerative diseases DNaseX, network context in which the drug will eventually have to GAPDH and TKTL1 lead to apoptosis of cells, cells which act. When employed as part of a pathway screening strat- should not die. The unwanted apoptosis lead to the se- egy, cell-based translocation assays offer an opportunity 55 vere effects. to discover and progress entirely new classes of com- [0117] Bound proteins in the multi-protein complex pounds that act primarily by modulating protein interac- were affinitiy-purified from cell lines using antibodies di- tions. rected against TKTL1, DNaseX, ph-Akt, and GAPDH.
17 31 EP 2 256 500 B1 32
Binding to certain proteins was assed by ELISA tech- e.g. diabetes mellitus, Wernicke-Korsakoff syndrome, nique, using e.g. the combination of TKTL1 and GAPDH Huntington disease. Those patients should be treated antibodies; the combination of TKTL1 and DNaseX an- with a TKTL1 activator compound. tibodies; the combination of TKTL1 and ph-Akt antibod- [0122] An in vivo assay with cells can be performed for ies; the combination of TKTL1 and TKT antibodies; the 5 screening small compound inhibiting the translocation to combination of TKTL1 and TKTL2 antibodies. the nucleus or the aggregation of TKTL1 protein within the nucleus, as monitored e.g. by (in vivo) immunohisto- (D) In vivo high-throughput screen to discover and profile chemical methods. Cells can be analysed for the pres- SMPPIIs for influencing protein-protein interactions of ence of high molecular weight complexes harbouring TKTL1 protein isoforms 10 TKTL1 or the presence of protein complexes with re- duced solubility. The above mentioned in vivo assays [0118] SMPPIIs can be identified which influence the can also be performed using a TKTL1-GFP fusion pro- generation of TKTL1 homo/heterodimers andtein. TKT/TKTL1 heterodimers and the interaction to other proteins of the multi-protein complex. SMPPIIs can be 15 Example 11 : Controlling of the mam-aGF via nutri- identified which influence the generation of TKTL1 pro- tion based therapy tein interactions with such other proteins e.g. DNaseX, GAPDH or amyloid beta peptide (A beta). SMPPIIs can [0123] A further example relates to a novel therapeutic be identified which influence the generation of TKTL1 approach which is based on the expression of TKTL1 protein aggregates. 20 and its concomitant sugar metabolism. Besides the inhi- [0119] SMPPIIs can be identified which influence the bition of TKTL1 enzymatic activity by small compounds protein-protein interaction with other proteins and the fol- or inhibitory substrates, TKTL1 enzymatic activity can lowing generation of protein aggregates e.g. GAPDH or also be inhibited by limited substrate availability through amyloid beta peptide (A beta). SMPPIIs can be identified application of a targeted nutrition. The targeted nutritian which influence the translocation of TKTL1 protein iso- 25 based therapy or prevention consists of a test for the forms e.g. translocation from cytoplasm to nucleus. determination of TKTL1 enzymatic acitivity in tumors or [0120] The altered substrate specificity and reaction non malignant cells/tissues followed by a specific nutri- modus of the TKTL1 enzyme can be used for the de- tion. struction of cells or tissues with an enhanced TKTL1 en- [0124] The basic nutrition consists of a selected fatty zyme activity. Application of a nontoxic substrate can be 30 acids composition, preferably in an amount of 55 to applied to patients with enhanced TKTL1 enzyme activ- 65%(w/w); a selected carbohydrate composition, prefer- ity. Cells with an enhanced expression of TKTL1, harbor ably, in an amount of 5 to 15%(w/w) with, preferably, less a gene product (TKTL1 enzyme) which targets the cells than 2%(w/w) glucose (or starch) content, preferably, forselective killing. Thosecells, which show anenhanced mainly comprising fructose, oligofructose, galactose, ol- TKTL1 enzymatic activity, convert the nontoxic substrate 35 igogalactose; a selected protein (aminoacid) composi- into a toxic drug by rendering the cells sensitive to a non- tion, preferably, in an amount of 10 to 25%(w/w) with, toxic prodrug or a chemotherapeutic agent, thereby elim- preferably, more than 40%(w/w) (lysine, leucine), and, inating unwanted cells. This strategy of killing unwanted preferably, more than 30%(w/w) (isoleucine, phenyla- cells can be e.g. applied for epithelial cell (head and neck, lanine, threonine, tryptophan, tyrosine); tocotrienol and oesophagus, gastric, colon and rectum and urothelial 40 electron acceptors or combination thereofs: cells) by administering nontoxic prodrugs e.g. in food. A preferred embodiment consist: (E) Mutations within the TKTL1 gene have been detected leaden to TKTL1 protein isoforms with different isoelec- a) 62% of a combination of fatty acids (see Table tric properties and reduced affinities for thiamine: 45 1); b) 12% carbohydrates with less than 2% glucose [0121] A test can be performed identifying mutations (or starch) content, mainly consisting of fruc- within the TKTL1 gene by DNA-based methods. A test tose, oligofructose, galactose, oligogalactose; can be performed by isolating TKTL1 protein isoforms c) 18% proteins with more than 40% (lysine, leu- using a monoclonal antibody specific for the TKTL1 pro- 50 cine), and more than 30% (isoleucine, phenyla- tein(s). The antibody could be attached to microtiter lanine, threonine, tryptophan, tyrosine) plates. Serum or other samples could be analyzed and d) Tocotrienol (e.g. gamma-tocotrienol) the TKTL1 protein isoform can be isolated form these e) at least one electron acceptor, such as, for specimens. A standardized enzymatic transketolase test example, parabenzoquinones, benzoquinones, could be performed allowing the determination of tran- 55 hydroxyquinones and derivates thereof. sketolase acitivity or Km-values for thiamine. Using this procedure, individuals with reduced TKTL1 activities [0125] The basic nutrition in combination with a phar- could be identified prior to the beginning of the disease maceutically acceptable carrier and thiamin or thiamin
18 33 EP 2 256 500 B1 34 derivates (etc. benfotiamine) which are activating the endogenous peroxidase was performed with 5 min incu- TKTL1 enzymatic activity will be applied to prevent or bation with 3%-H2O2. Then, sections were exposed to treat neurodegenerative diseases, diabetes, diabetes biotin blocking system (DAKO) for 10 min to block en- complications, metabolic syndrome, macro- and micro- dogenous avidin-biotin. After two washes in Tris/saline vascular damages, aging, retinal cell damage, central, 5 buffer (TBS), slides were incubated with 1% goat serum inflammation of endothelial cells, and peripheral neuro- for 30 min to block unspecific staining. Successively, sec- nal cell damage, because in normal (not malignant) cells tions were exposed to mouse anti-TKTL1 (clone like, for example, retina cells, central and peripheral neu- JFC12T10; mouse IgG2b) antibody (25 mg/ml) or anti- rons, and endothelial cells, the TKTL1 activity protects Ser473 phospho-Akt (587F11; mouse IgG2b; Cell Sign- from damaging effects of insufficient sugar metabolism 10 aling Technology) overnight at 4°C. Then slides were leading to AGE or radical formation. washed in TBS and incubated with biotinilated anti- [0126] For cancer treatment the daily basic nutrition mouse immunoglobulins for 30 min at room temperature has to be adjusted, preferably, to a maximal total amount and treated with streptavidin-peroxidase (DAKO). Stain- of 0.2 mg thiamine. This can be done by selection of ing was revealed using 3-amino-9-ethylcarbazole (AEC) nutrition with low thiamine level, by thiaminase treatment 15 substrate. Nuclei counterstaining was performed using of nutrition or by heating/boiling of nutrition. The basic aqueous haematoxylin. nutrition with a pharmaceutically acceptable carrier and The results of that immunohistochemical staining are low levels of thiamine or the basic nutrition with low levels shown in Figure 6,7 and 8. For each cancer type one of thiamine supplemented with inhibitory thiamine ana- representative of three independent experiments is logs (etc. oxythiamin, oxybenfotiamine) is administered 20 shown. TKTL1 and phosphorylated Akt are highly ex- to cancer patients, if a high TKTL1-activity and/or tran- pressed in thyroid cancer tissue. Non small lung cancer script/protein concentration in their tumors or metastases (NSLC) and colon carcinomas express high levels of is detected. This nutritional approach leads to an inhibi- TKTL1 and phosphorylated Akt. tion of TKTL1 enzymatic, thereby reducing glucose me- tabolism and inhibiting tumor proliferation. 25 Example 13: Detecting of the TKTL1-protein-level in tumors of gastric carcinoma patients, colon carcino- Table 1: Example of a fatty acid mixture in weight %: mapatient and noninvasive and invasive bladdercar- caprylic acid (C8) 46.6 cinoma patients capric acid (C10) 28.2 linoleic acid (ω6-C18:2) 3.6 30 [0128] The TKTL1 protein expression in tumors of SDA (ω3-C18:4) 0.2 three gastric carcinoma patients (Fig. 4 A-P), one colon carcinoma patient (Fig. 4 Q), one noninvasive bladder ETA (ω3-C20:4) 0.3 carcinoma patient (Fig. 4 R) and one invasive bladder EPA (ω3-C20:5) 5.7 carcinoma patient (Fig. 4 S-T) was determind and com- ω DPA ( 3-C22:5) 0.9 35 pared with corresponding normal tissue. DHA (ω3-C22:6) 4.9 TkTL1 protein determination was carried out by help of other 9.6 a monoclonal anti-TKTL1 antibody. The anti-TKTL1 an- total MCFA’s 74.8 tibody was revealed by diaminobenzidine tetrahydro- total n-3 PUFA’s 12.0 chloride (DAB; brown staining). Counterstaining was per- total other 13.2 40 formed with haematoxylin (blue staining). DHA : EPA 0.86 [0129] The specimens of gastric carcinoma patient 1 n-3 : n-6 3.1 reveal strong cytoplasmic expression of TKTL1 in tumor tissue but no expression in the surrounding stroma cells (Fig. 4 C-F). Note the heterogenous expression in tumor MCFA = Medium chain fatty acids, i.e. fatty acids having 45 cells (Fig. 4 E-F) The corresponding normal tissue shows 8-14 carbon atoms), PUFA=Polyunsaturated Fatty Ac- no expression of TKTL1 (Fig. 4 A-B). ids, i.e. fatty acids having more than one double bond) The specimens of gastric carcinoma patient 2 reveal strong cytoplasmic expression within tumor cells (Fig. 4 Example 12: Detecting of the TKTL1-Protein-Level in J-N) and heterogenous expression in tumor cells (Fig. 4 cancer tissue and in normal (healthy) tissue of thy- 50 L). The corresponding normal antrum tissue shows no roidea, lung and colon expression of TKTL1 (Fig. 4 G-I). The specimens of gastric carcinoma patient 3 reveal nu- [0127] Five mm thick human cancer and normal paraf- clear expression in a poorly differentiated gastric carci- fin sections of thyroid tissue, lung tissue and colon tissue noma (Fig. 4 O-P). were analyzed by immunohistochemistry. Dewaxed sec- 55 The specimens of colon carcinoma patient reveals cyto- tions were heated for antigen unmasking in 10 mM so- plasmic staining (Fig. 4 Q). dium citrate (pH 6.0) for 1 minute at 450 W followed by The specimens of the patient with superficial bladder car- 5 minutes at 100 W. After rinse in dH2O, inhibition of cinoma reveals no expression of TKTL1 (Fig. 4 R).
19 35 EP 2 256 500 B1 36
The specimens of the patient with an invasive poorly dif- (ABC) and diaminobenzidine tetrahydrochloride (DAB) ferentiated bladder carcinoma reveals strong cytoplas- (Elite kit; Vector Laboratories), and counterstained with mic expression (Fig. 4 S-T). Mayer’s haematoxylin. A comparison of noninvasive and invasive bladder car- The results of the immunohistochemical stainings are cinoma tissue is shown in Fig. 5. The non-invasive blad- 5 shown in Figure 4,5, and 9-16. der carcinoma tissue shows non or only few staining which indicates no expression of TKTL1 while the inva- Example 17: Quantification of TKTL1 transcripts in sive bladder carcinoma tissue shows strong staining that gastric and lung adenocarcinoma samples and their indicates strong expression of TKTL1. corresponding normal tissues 10 Example 14: Expression of TKTL1 protein isoforms [0133] 15 ml of the real-time PCR reaction was loaded in five tumor cell lines derived from four different onto a 3%-agarose gel to visualize the 150 bp TKTL1 tumor entities amplification product. Expression differences between tumor and corresponding normal tissue have been cal- [0130] The expression of TKTL1 protein isoforms in 15 culated on basis of the real-time data and are shown as five tumor cell lines derived from four different tumor en- fold-induction in tumor sample relative to the correspond- tities were detected using a MAb specifically detecting ing normal sample. (B) Real-time transcript quantification TKTL1 protein isoforms and not reacting with other tran- of TKT, TKTL1, TKTL2, and β-actin gene in a lung ade- sketolase family members. The results are shown in Fig. nocarcinoma and corresponding normal sample. The 2 (B). Each cell line do show a unique expression pattern 20 highest expression level is observed for the β-actin. With- of TKTL1 protein isoforms. The molecular weight stand- in the transketolase gene family, the TKT gene shows ard is indicated in kDa. the highest expression level. The TKTL1 and TKTL2 ex- pression level in normal lung is low compared to that of Example 15: Expression of TKTL1 and phosphorylat- TKT and β-actin. In contrast to this, the expression level ed Akt (ph-Akt) in cancer and normal tissue 25 of TKTL1 in lung adenocarcinoma is 60-fold higher than in the corresponding normal tissue. [0131] Immunohistochemical analysis of TKTL1 or ph- Akt was carried out on paraffin-embedded sections of Example18: Diagnosis of neurodegenerative diseas- normal, papillary (PTC), follicular (FTC), and undifferen- es tiated (UTC) thyroid cancer (Fig. 6 A-C), of normal and 30 NSLC tissues (Fig. 7 D), of colon cancer (fig. 7 E) and of [0134] Fibroblast cell lines, foreskin fibroblasts or leu- normal or bladder and prostate cancer (Fig 8 F-G) with kocytes from healthy subjects and patient with Alzheim- Anti-TKTL1 or anti-ph-Akt. Anti-TKTL1 or anti-ph-Akt er’s disease, or other neurodegenerative diseases were was revealed by 3-amino-9-ethylcarbazole (AEC; red analyzed for TKTL1 abnormalities by means of ELISA, staining). Counterstaining was performed with haema- 35 electrofocusing gel analysis, 2D-gel electrophoresis and toxylin (blue staining). Negative controls were performed immunostaining. The ELISA experiments were per- using isotype matched IgG. formed by different ELISA approaches. One type of ELI- TKTL1 is mainly localized within the cytoplasm, but a SA represents a typical ELISA, where catching or detect- nuclear staining can also be identified in a subset of tu- ing antibody is directed against a certain protein. The mors. Phoshorylated Akt is localized within the cytoplasm 40 other type of ELISA used consisted of an antibody direct- and/or the nucleus. ed against one protein and an antibody against another protein. An example for type 1 ELISA is the combination Example 16: Detecting of the TKTL1-Level in patients of TKTL1 antibody JFC12T10 and TKTL1 antibody with gastric carcinoma, patients with colon carcino- JFC10T9. JFC12T10 detects an epitop of the TKTL1 pro- ma, patients with noninvasive bladder carcinoma 45 tein, and does not cross react with TKT or TKTL2. and patients with invasive bladder carcinoma JFC10T9 detects another epitop of TKTL1. Using the ELISA JFC12T10/JFC10T9 TKTL1 protein can be de- [0132] Three mm thick paraffin sections were heated tected and measured. An example for Type 2 ELISA is for antigen unmasking in 10 mM sodium citrate (pH 6.0) antibody JFC12T10 directed against TKTL1 and anti- 50 for 5 minutes at 900 W, for 5 min at 900 W in dH 20, and body JFC11D8 directed against DNaseX. Using this ELI- for 5 min in 10 mM sodium citrate (pH 6.0) at 900 W. After SA the protein interaction of TKTL1 and DNaseX can be a wash in phosphate/saline buffer (PBS), inhibition of en- determined. Both types of ELISA reactions were per- dogenous peroxidase was performed as above dis- formed with samples from healthy persons and patients. cribed. Then, sections were exposed 15 min to biotin- One type of sample consisted of bodyfluids like serum avidin blocking buffer (Vector Laboratories). Blocking of 55 and was directly analysed for the presence of proteins unspecific staining was performed with goat serum as and protein interactions. Another type of analysis was described above. Primary antibodies were visualized performed using an antibody (e.g. JFC12T10 or with avidin-biotinylated horseradish peroxidase complex JFC11D8) coupled to carbo-link. Using affinity purifica-
20 37 EP 2 256 500 B1 38 tion procedures we isolated multi-protein complexes of weight complexes in nuclei of patients with neurodegen- cells (derived from cell culture or native tissues). The erative disease patients like AD (JFC7T4). Using ELISA multi-protein complexes were analysed by electrofocus- reactions or immunohistochemical stainings, those dis- ing or 2D-gel electrophoresis followed by immunostain- ease specific TKTL1 variants can be identified in body ing or determination of enzymatic activity (e.g. transke- 5 fluids (e.g. serum), or in tissue samples (e.g. leukocytes, tolase two- or one-substrate reaction; DNase test, GAP- fibroblasts, biopsies). Furthermore in combination with DH activity). Using these assays, protein isoforms could antibodies directed against other proteins present in be identified specifically present in patients with neuro- those multi-protein complexes, ELISA can be performed degenerative diseases like AD. In patients with neurode- detecting the presence of protein interactions. Such an generative disorders like AD patients, TKTL1 variants 10 type 2 ELISA consisting of TKTL1 antibody JFC8T7 and have been detected with high alkaline pI, lower two- or DNaseX antibody JFC7D4 identified a protein interaction one-substrate reaction, and lower thiamin affinity. Addi- of TKTL1 and DNaseX, specific for cells going into ap- tionally, using standard PAGE smaller protein isoforms optosis. Another type 2 ELISA consisting of TKTL1 anti- and a higher amount of smaller protein in comparison to body JFC8T7 and GAPDH antibody JFC3G6 identified full length TKTL1 were detected in intact cells or cell ex- 15 a protein interaction of TKTL1 and GAPDH, specific for tracts from those patients compared to healthy persons. cells going into apoptosis. The presence of these protein Furthermore reduced two- or one-substrate reaction of complexes can be expoited for the detection and therapy TKTL1, or lower thiamin affinity of TKTL1 has been ob- of neurodegenerative diseases. The identification of served in healthy persons which later on (month and such protein interactions between TKTL1 and other pro- years later) showed neurodegenerative disease like AD. 20 teins like GAPDH, DNaseX, and ph-Akt can be exploited The observed TKTL1 variants lead to reduced sugar me- for the isolation of antiapoptotic compounds. Those com- tabolism in cells. These reduced sugar metabolism lead pounds can be used as pharmaceutical agents for the to enhanced AGE formation and AGE formation lead to treatment of neurodegenerative diseases. Compounds high molecular protein aggregates and cell death. This specifically binding to TKTL1 can be identified by affinity unwanted cell death of cells necessary for proper brain 25 labeling, and e.g. by means of BIAcore technology. An- function, is an important cause for these neurodegener- tiapoptotic effect can be detected using reduced pro- ative diseases. To identify individuals which do have grammed cell death (visualized by e.g. apoptotic ladder, TKTL1 variants with a reduced two- or one-substrate re- caspase-3, annexin). TKTL1 and GAPDH are tightly action or lower thiamin affinity, TKTL1 antibodies were bound to each other. The TKTL1 (trans-)ketolase reac- established, which can be used to isolate TKTL1 proteins 30 tion cleaving sugars like X5P leads to the production of from samples to be tested (e.g. JFC12T10). Those sam- GAP. As GAPDH is tightly bound to TKTL1, the produced ples can be body fluids (e.g. serum) or cell samples (e.g. GAP is directly used from GAPDH which lead to the pro- proteins of fibroblasts or leukocytes). TKTL1 antibodies duction 1,3-phosphoglycerate concomittant with the re- coupled to ELISA plates catch the TKTL1 proteins and duction of NAD + to NADH + H +. For the isolation of small after washing away TKT and TKTL2 proteins, 35 the compounds inhibiting TKTL1 and GAPDH interactions (trans-)ketolase two- or one substrate reaction can be different NAD+ concentrations should be used since the enzymatically determined in a coupled enzymatic reac- binding of some compounds is depend on the concen- tion by e.g. building the reduced NADH (the enzymatic tration of NAD+. Another type of protein interaction was assays are described above). Similarly the enzymatic re- detected using antibody JFC12T10 as sole antibody. If action was performed at different concentrations of thia- 40 theTKTL1 protein ispresent as a single protein, no ELISA min. By reducing the thiamine level in the assay TKTL1 reaction should work if just one antibody is used as catch- variants were identified in patients with neurodegenera- ing and detecting antibody. In case of TKTL1 antibody tive diseases with a reduced affinity for thiamine. Using JFC12T10 can be used as catching and detecting anti- this approach of ELISA and enzymatic analysis, TKTL1 body. Therefore, using this antibody protein interactions variants can be identified which predispose to neurode- 45 of TKTL1 and another TKTL1 protein can be detected. generative diseases at a timepoint before signs of neu- As some of the TKTL1 protein isoforms miss N-terminal rodegenerative diseases are present. This can be ex- protein sequences dimers consisting of TKTL1 and ploited for a prevention of neurodegenerative diseases TKTL1 can be discriminated into homo- and hetero e.g. by appliccation of better soluble thiamine derivates TKTL1-dimers. Some of the dimers consists of full length like benfotiamine or a diet with reduced levels or certain 50 TKTL1 protein bound to another full length TKTL1 protein types of sugars (e.g. glucose). In addition to the identifi- (TKTL1 homodimer). Some of the dimers consists of a cation of TKTL1 variants with a reduced two- or one- full length TKTL1 protein and a smaller TKTL1 isoform, substrate reaction or lower thiamin affinity, TKTL1 vari- where the N-terminus is missing. The discrimination can ants with a reduced solubility or TKTL1 variants present be performed using TKTL1 antibodies located at different in high molecular weight complexes were identified in 55 sites within the TKTL1 protein. E.g. N-terminal located neurodegenerative disease patients like AD. The inven- TKTL1 antibodies can be used with C-terminal located tors establised TKTL1 specific antibodies specifically re- antibodies and the result of this ELISA can be compared acting with TKTL1 variants present in high molecular with an ELISA using only C-terminally located antibodies.
21 39 EP 2 256 500 B1 40
The ratio between those two ELISA results can be used Revendications for the identification of patients and for the identification of healthy persons which will later on get a TKTL1-asso- 1. Utilisation d’une thiamine choisie dans le groupe ciacted disease. (See also Fig. 11-12) composé de l’oxythiamine, la benfooxythiamine 5 (=oxybenfothiamine), la pyrithiamine et la 2-méthyl- Example 19 : Expression of TKTL1 in endothelial thiamine pour la fabrication d’une composition phar- cells maceutique pour l’inhibition du processus métaboli- que de fermentation aérobie mammifère du glucose [0135] The majority of normal tissues and cells do (mammalian aerobic glucose fermentation metabo- show no expression of TKTL1. In the retina, in endothelial 10 lic pathway, mam-aGF) et pour le traitement théra- cells and in neuronal cells an expression of TKTL1 is peutique ou le contrôle d’affections associées à une present. Retina, endothelial cells and neuronal cells get diminution ou une augmentation du processus mé- damaged by high glucose levels. As shown in Fig. 9 and tabolique de fermentation aérobie mammifère du Fig. 10 TKTL1 protein is expressed in the nucleus and/or glucose (mam-aGF). the cytoplasm of endothelial cells (and retina, and neu- 15 ronal cells; not shown). 2. Utilisation selon la revendication 1, dans laquelle la thiamine est la benfooxythiamine (= oxybenfothia- mine) ou un dérivé équivalént fonctionnellement de Claims celle-ci ayant la fonction d’inhiber le processus mé- 20 tabolique de fermentation aérobie mammifère du 1. Use of a thiamine selected from the group consisting glucose (mam-aGF). of oxythiamine, benfooxytiamine (-oxybenfotiamin), pyrithiamin and 2-methylthiamin for manufacturing a pharmaceutical composition for the inhibition of the mammalian acrobic glucose fermentation metabolic 25 pathway (mam-aGF) and for use in therapeutic treat- ment or controlling of diseases associated with an enhanced mammalian aerobic glucose fermentation metabolic pathway (mam-aGF). 30 2. The use according to claim 1, wherein the thiamine is benfooxytiamine (-oxybenfotiamin) or a function- ally equivalent derivative thereof having the function of inhibition of the mammalian aerobic glucose fer- mentation metabolic pathway (mam-aGF). 35
Patentansprüche
1. Verwendung eines Thiamins, ausgewählt aus der 40 Gruppe bestehend aus: Oxythiamin, Benfooxytia- min (=Oxybenfotiamin),Pyrithiamin und 2-Methylthi- amin, zur Herstellung einer pharmazeutischen Zu- sammensetzung für die Hemmung des aeroben Glu- kose Fermentations-Stoffwechselwegs in Säugern 45 (mammalian aerobic glucose fermentation metabo- lic pathway - mam-aGF) und zur Verwendung bei der therapeutischen Behandlung oder Überwa- chung von Krankheiten, die mit einem gesteigerten aeroben Glukose Fermentations-Stoffwechselweg 50 in Säugern (mam-aGF) assoziiert sind.
2. Verwendung gemäß Anspruch 1, wobei das Thiamin ein Benfooxytiamin (=Oxybenfotiamin) ist oder ein funktional equivalentes Derivat davon, welches die 55 Funktion der Hemmung des aeroben Glukose Fer- mentations-Stoffwechselwegs in Säugern (mam- aGF) aufweist.
22 EP 2 256 500 B1
23 EP 2 256 500 B1
24 EP 2 256 500 B1
25 EP 2 256 500 B1
26 EP 2 256 500 B1
27 EP 2 256 500 B1
28 EP 2 256 500 B1
29 EP 2 256 500 B1
30 EP 2 256 500 B1
31 EP 2 256 500 B1
32 EP 2 256 500 B1
33 EP 2 256 500 B1
34 EP 2 256 500 B1
35 EP 2 256 500 B1
36 EP 2 256 500 B1
37 EP 2 256 500 B1
38 EP 2 256 500 B1
39 EP 2 256 500 B1
REFERENCES CITED IN THE DESCRIPTION
This list of references cited by the applicant is for the reader’s convenience only. It does not form part of the European patent document. Even though great care has been taken in compiling the references, errors or omissions cannot be excluded and the EPO disclaims all liability in this regard.
Non-patent literature cited in the description
• COY et al. Genomics, 1996, vol. 32, 309-316 [0003]
40