Supporting Information

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Supporting Information Brown et al. 10.1073/pnas.1114476109 SI Materials and Methods and silver enhancement was not required. Electron microscopy Strains and Conditions. A. tumefaciens C58 was grown in Luria– was performed on a JEOL JEM1010 at 60 kV, equipped with a Bertani (LB) broth medium or in AT minimal medium (1) TemCam-F416 (TVIPS) digital camera. supplemented with 0.5% (wt/vol) glucose and 15 mM ammo- nium sulfate and 0.1 mM acetosyringone at 26 °C. S. meliloti Electron Microscopy. Droplets of exponentially growing cultures fi 1021 was grown in LB medium supplemented with 2.5 mM were deposited onto a piece of para lm and E.M. carbon-for- fl CaCl and 2.5 mM MgSO at 26 °C. Brucella abortus 544 was mvar-coated copper grids (200 mesh) were oated onto the 2 4 droplets for 2 min. Excess liquid was removed with filter paper, grown in 2YT liquid medium at 37 °C and O. anthropi LMG 3331 fl was grown in LB medium at 30 °C. H. denitrificans was grown in and the grids were quickly washed four times oating onto Hyphomicrobium medium 337 containing 0.4% methylamine droplets of double distilled water, transferred to droplets of 1% hydrochloride (2) at 26 °C without shaking. P. hirschii was grown uranyl acetate in water for 2 min, washed once in double distilled on MMB medium (3) at 26 °C. When necessary, kanamycin was water, dried, and subjected to electron microscopy as described above for D-cys labeling. used at 100 μg/mL and 1 mM isopropyl-α-D-thio-galactoside (IPTG) was used as an inducer. TRSE Staining. The amine reactive dye, TRSE, binds to outer membrane proteins and the mobility of these proteins in E. coli is Construction and Imaging of FtsZ-eGFP Expression Strain. To enable severely restricted in the regions comprised of inert peptidoglycan localization studies of FtsZ (Atu2086), a translational fusion of fi FtsZ to eGFP was placed under the control of the lac promoter. (7). The TRSE staining protocol was modi ed to allow time-lapse A. tumefaciens The Atu2086 gene lacking the stop codon was amplified using the microscopy of individual growing cells. were grown to exponential phase and washed three times in 0.1 M NaHCO , FtsZ2-F-GFP (CATATGACGATACAGCTGCAAAAGCCT) and 3 pH 8.3 buffer by centrifugation for 5 min at 5000 × g.Washedcell FtsZ2-R-GFP (CTCGAGGTTGGACTGGCGGCGCAGGAA- pellets were resuspended in 200 μl of buffer and TRSE was added GGC) primers and cloned into the IPTG-inducible expression to a final concentration of 0.1 μg/mL. Cells were incubated in the vector pSRKKm (4), generating pJW164. eGFP was amplified dark for 5–10 min. B. abortus and O. anthropi cell were collected from pJZ383 (5) using primers XhoIgfp (CTCGAGATGAGT- during stationary phase, washed three times with PBS, and then AAAGGAGAAGAACTT) and gfpNheI (GCTAGCTCATTTG- incubated for 15 min with TRSE at a final concentration of 1 μg/mL TATAGTTCATCCATGCC). A fragment digested with XhoI and in the dark at room temperature. The bacteria were then washed NheI and containing eGFP was cloned into pJW164, generating the fi one time with buffer and two times with the appropriate medium. nal construct, pJW164G. pJW164G was introduced into wildtype A. tumefaciens cells were spotted on an agarose pad immediately A. tumefaciens. Before time-lapse microscopy, cells were diluted to after staining and observed using time-lapse microscopy. B. abortus an OD of 0.1 and grown in the presence of kanamycin (100 μg/mL) μ cellsweregrownfor3hinliquidmediumandO. anthropi cells were and 1 mM IPTG for 3 h. Dilute cell suspension (0.8 L) was then grown for 1 h in liquid medium before observation with time-lapse spotted on LB agarose pads containing kanamycin and IPTG and microscopy. imaged every 10 min using the methods for time-lapse microscopy described below. Time-Lapse Microscopy. For A. tumefaciens, LB medium (unless otherwise stated) containing 1% agarose was applied to a 25-mm D-cys Labeling. D-cys labeling was performed as previously de- × × fi μ by 75-mm glass slide to form an agarose pad (22 mm 22 mm scribed (6) with the following modi cations. D-cys (100 g/mL) 0.5 mm) capable of supporting the growth of the bacteria. Ex- was added to exponentially growing cultures (150 mL; OD600 = ponential phase cell culture was diluted to an OD600 of 0.05–0.2 0.1) of A. tumefaciens and the cultures were incubated further for and 0.8 μL was spotted on the agarose pad. The agarose pad was 150 min. At this stage cells (OD600∼0.6) were collected by cen- × covered with a coverslip and sealed using a 1:1:1 mixture of trifugation (5000 g; 5 min; room temperature), resuspended in Vaseline, lanolin, and paraffin. A Nikon Eclipse 90i light mi- an equal volume of prewarmed LB, centrifuged again as before, croscope equipped with a ×100 DIC Plan Apo VC oil objective and resuspended into 9 mL of prewarmed LB. A 3-mL sample was used for DIC microscopy and a Chroma 83700 triple filter (nonchased control) of the cell suspension was immediately cube was used with corresponding excitation and emission filters mixed with 6 mL of 6% (wt/vol) SDS in a boiling water bath under for epifluorescence microscopy. Images were captured every strong magnetic stirring. The remaining cell suspension was dis- 5 min using a Photometrics Cascade 1K cooled charge-coupled- tributed among an appropriate number of cultures with pre- device camera and Metamorph imaging software (Molecular warmed medium, and further incubated for the selected chase Devices). times, normally 45 and 90 min, roughly corresponding to one and For B. abortus and O. anthropi, time-lapse microscopy was two mass doublings. At the end of the chase time, cells were performed by placing cells on a microscope slide that was layered collected by centrifugation, resuspended into 3 mL of prewarmed with a 1% agarose pad containing 2YT medium and LB medium, medium, and immediately mixed with 6 mL of boiling 6% SDS as respectively. Fluorescence was observed at 583 nm. Samples described above. Samples were kept in a boiling water bath with were observed every hour at 37 °C for B. abortus and every 40 stirring for 6 h and then were left overnight at room temperature min at 32 °C for O. anthropi using a Nikon i80 fluorescence with moderate stirring. Further washing, biotinylation, immu- microscope and the NIS software from Nikon with a Orca ER nolabeling and silver enhancement were performed as described Hamamatsu camera. (6) except that a mouse monoclonal anti-biotin antibody (Mo- lecular Probes) and nanogold-conjugated anti-mouse antibody Agrobacterium Attachment to an Arabidopsis Root. Sterilized Ara- (Nanoprobes) were used as primary and secondary antibodies bidopsis thaliana seeds were placed on 1/2 MS salts plates with respectively. D-cys labeling for S. meliloti was completed as de- 1% agar and 1% sucrose and allowed to germinate and grow scribed above except that a 10 nm of Gold-proteinA conjugate until the roots were ∼3 cm long (8). Wild type A. tumefaciens was used in place of nanogold-conjugated anti-mouse antibody cells were grown in LB medium at 26 °C until reaching expo- Brown et al. www.pnas.org/cgi/content/short/1114476109 1of16 nential phase. TRSE stained cells (200 μL) were washed and (pH 4.95), 15% (vol/vol) methanol. Elution was monitored by resuspended in a solution containing 1 mM calcium chloride and measuring the absorbance at 204 nm. 0.4% sucrose. The bacterial cell culture was spotted into a Petri For the identification of muropeptides, each peak of the HPLC dish and a 10 mm root segment was floated in the bacterial cell profile was collected, vacuum dried, desalted, and subjected to culture in the dark at room temperature for 4 h. The root seg- MALDI-TOF (Autoflex; Bruker Daltonics) to determine the ments were rinsed in 1 mM calcium chloride and 0.4% sucrose molecular mass of the components. The specific sequence of and placed on an agarose pad containing 0.5 μg/mL Alexa Fluor amino acids and amino sugars in each muropeptide was defined 488-conjugated WGA (Invitrogen Molecular Probes), 1 mM by means of electrospray-ion trap MS/MS (LCQ Classic; Thermo- calcium chloride, and 0.4% sucrose. The attachment and growth Finnigan) of the HPLC-purified muropeptides. of A. tumefaciens cells to the root segments was observed using time-lapse microscopy. Analysis of Mother Cell Growth. A. tumefaciens was grown in LB to exponential phase and then introduced into a 0.1 × 1 × 50 mm Determination of Peptidoglycan Composition of A. tumefaciens and rectangular glass capillary (VitroCom). After sufficient time to S. meliloti by HPLC and MS. Peptidoglycan purification was per- allow attachment by motile cells (5–10 min), constant flow of formed by a modification of the boiling SDS extraction method sterile LB at ∼100 μm/s permitted observation of dividing cells (9). Cells were collected from exponentially growing cultures by through multiple divisions while washing away nascent motile centrifugation (6,000 × g; 15 min; 20 °C), suspended into a small daughters. A Nikon 90i microscope with 60× phase-contrast, oil volume of LB, and mixed 1:2 with 6% SDS in a boiling water immersion objective and motorized stage collected images from bath under strong magnetic stirring. The suspensions were kept multiple stage positions at 4-min intervals. A custom ImageJ under those conditions for 4 h, and then were left overnight at plugin tracked the size of individual cells through time using room temperature with stirring.
Recommended publications
  • A Study on the Phototrophic Microbial Mat Communities of Sulphur Mountain Thermal Springs and Their Association with the Endangered, Endemic Snail Physella Johnsoni

    A Study on the Phototrophic Microbial Mat Communities of Sulphur Mountain Thermal Springs and Their Association with the Endangered, Endemic Snail Physella Johnsoni

    A Study on the Phototrophic Microbial Mat Communities of Sulphur Mountain Thermal Springs and their Association with the Endangered, Endemic Snail Physella johnsoni By Michael Bilyj A thesis submitted to the Faculty of Graduate Studies in partial fulfillment of the requirements for the degree of Master of Science Department of Microbiology Faculty of Science University of Manitoba Winnipeg, Manitoba October 2011 © Copyright 2011, Michael A. Bilyj 1 Abstract The seasonal population fluctuation of anoxygenic phototrophs and the diversity of cyanobacteria at the Sulphur Mountain thermal springs of Banff, Canada were investigated and compared to the drastic population changes of the endangered snail Physella johnsoni. A new species and two strains of Rhodomicrobium were taxonomically characterized in addition to new species of Rhodobacter and Erythromicrobium. Major mat-forming organisms included Thiothrix-like species, oxygenic phototrophs of genera Spirulina, Oscillatoria, and Phormidium and purple nonsulfur bacteria Rhodobacter, Rhodopseudomonas and Rhodomicrobium. Aerobic anoxygenic phototrophs comprised upwards of 9.6 x 104 CFU/cm2 of mat or 18.9% of total aerobic heterotrophic bacterial isolates at certain sites, while maximal purple nonsulfur and purple sulfur bacteria were quantified at 3.2 x 105 and 2.0 x 106 CFU/cm2 of mat, respectively. Photosynthetic activity measurements revealed incredibly productive carbon fixation rates averaging 40.5 mg C/cm2/24 h. A temporal mismatch was observed for mat area and prokaryote-based organics to P. johnsoni population flux in a ―tracking inertia‖ manner. 2 Acknowledgements It is difficult to express sufficient gratitude to my supervisor Dr. Vladimir Yurkov for his unfaltering patience, generosity and motivation throughout this entire degree.
  • Alpine Soil Bacterial Community and Environmental Filters Bahar Shahnavaz

    Alpine Soil Bacterial Community and Environmental Filters Bahar Shahnavaz

    Alpine soil bacterial community and environmental filters Bahar Shahnavaz To cite this version: Bahar Shahnavaz. Alpine soil bacterial community and environmental filters. Other [q-bio.OT]. Université Joseph-Fourier - Grenoble I, 2009. English. tel-00515414 HAL Id: tel-00515414 https://tel.archives-ouvertes.fr/tel-00515414 Submitted on 6 Sep 2010 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. THÈSE Pour l’obtention du titre de l'Université Joseph-Fourier - Grenoble 1 École Doctorale : Chimie et Sciences du Vivant Spécialité : Biodiversité, Écologie, Environnement Communautés bactériennes de sols alpins et filtres environnementaux Par Bahar SHAHNAVAZ Soutenue devant jury le 25 Septembre 2009 Composition du jury Dr. Thierry HEULIN Rapporteur Dr. Christian JEANTHON Rapporteur Dr. Sylvie NAZARET Examinateur Dr. Jean MARTIN Examinateur Dr. Yves JOUANNEAU Président du jury Dr. Roberto GEREMIA Directeur de thèse Thèse préparée au sien du Laboratoire d’Ecologie Alpine (LECA, UMR UJF- CNRS 5553) THÈSE Pour l’obtention du titre de Docteur de l’Université de Grenoble École Doctorale : Chimie et Sciences du Vivant Spécialité : Biodiversité, Écologie, Environnement Communautés bactériennes de sols alpins et filtres environnementaux Bahar SHAHNAVAZ Directeur : Roberto GEREMIA Soutenue devant jury le 25 Septembre 2009 Composition du jury Dr.
  • 17, 3203–3222, 2020 © Author(S) 2020

    17, 3203–3222, 2020 © Author(S) 2020

    Biogeosciences, 17, 3203–3222, 2020 https://doi.org/10.5194/bg-17-3203-2020 © Author(s) 2020. This work is distributed under the Creative Commons Attribution 4.0 License. The contribution of microbial communities in polymetallic nodules to the diversity of the deep-sea microbiome of the Peru Basin (4130–4198 m depth) Massimiliano Molari1, Felix Janssen1,2, Tobias R. Vonnahme1,a, Frank Wenzhöfer1,2, and Antje Boetius1,2 1Max Planck Institute for Marine Microbiology, Bremen, Germany 2HGF MPG Joint Research Group for Deep-Sea Ecology and Technology, Alfred Wegener Institute for Polar and Marine Research, Bremerhaven, Germany apresent address: UiT the Arctic University of Tromsø, Tromsø, Norway Correspondence: Massimiliano Molari ([email protected]) Received: 16 January 2020 – Discussion started: 3 February 2020 Revised: 27 April 2020 – Accepted: 15 May 2020 – Published: 25 June 2020 Abstract. Industrial-scale mining of deep-sea polymetal- tween the Clarion–Clipperton Fracture Zone (CCZ) and the lic nodules will remove nodules in large areas of the sea Peru Basin suggest that changes in environmental setting floor. The regrowth of the nodules by metal precipita- (e.g. sedimentation rates) also play a significant role in struc- tion is estimated to take millions of years. Thus, for fu- turing the nodule microbiome. ture mining impact studies, it is crucial to understand the role of nodules in shaping microbial diversity and function in deep-sea environments. Here we investigated microbial- community composition based on 16S rRNA gene sequences 1 Introduction retrieved from sediments and nodules of the Peru Basin (4130–4198 m water depth). The nodule field of the Peru Polymetallic nodules (or manganese nodules) occur in Basin showed a typical deep-sea microbiome, with domi- abyssal plains (4000–6000 m water depth) and consist pri- nance of the classes Gammaproteobacteria, Alphaproteobac- marily of manganese and iron as well as many other metals teria, Deltaproteobacteria, and Acidimicrobiia.
  • DNA and RNA-SIP Reveal Nitrospira Spp. As Key Drivers of Nitrification in 2 Groundwater-Fed Biofilters

    DNA and RNA-SIP Reveal Nitrospira Spp. As Key Drivers of Nitrification in 2 Groundwater-Fed Biofilters

    bioRxiv preprint doi: https://doi.org/10.1101/703868; this version posted July 16, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 DNA and RNA-SIP reveal Nitrospira spp. as key drivers of nitrification in 2 groundwater-fed biofilters 3 4 Running title: Nitrospira drives nitrification in groundwater-fed biofilters 5 Authors: Arda Gülay1,4*, Jane Fowler1, Karolina Tatari1, Bo Thamdrup3, Hans-Jørgen Albrechtsen1, 6 Waleed Abu Al-Soud2, Søren J. Sørensen2 and Barth F. Smets1* 7 1 Department of Environmental Engineering, Technical University of Denmark, Building 113, Miljøvej, 2800 8 Kgs Lyngby, Denmark. Phone: +45 45251600. FAX: +45 45932850. e-mail: [email protected], jfow@ 9 env.dtu.dk, [email protected], [email protected]* 10 2 Department of Biology, University of Copenhagen, Universitetsparken 15, Building 1, 2100 Copenhagen, 11 Denmark. Phone: +45 35323710. FAX: +45 35322128. e-mail: [email protected], [email protected] 12 3 Nordic Center for Earth Evolution, Department of Biology, University of Southern Denmark, Campusvej 55, 13 5230 Odense, Denmark. Phone: +45 35323710. FAX: +45 35322128. e-mail: [email protected] 14 4 Department of Organismic and Evolutionary Biology, Harvard University, Cambridge, MA, United States, 15 26 Oxford St, Cambridge, MA 02138, Phone: +1 (617)4951564. e-mail: [email protected] 16 17 *Corresponding authors 18 Keywords: Nitrification, comammox, Nitrospira, DNA SIP, RNA SIP 19 bioRxiv preprint doi: https://doi.org/10.1101/703868; this version posted July 16, 2019.
  • Information to Users

    Information to Users

    INFORMATION TO USERS This manuscript has been reproduced from themicrofilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer. The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, prim bleedthrough, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note win indicate the deletion. Oversize materials (e.g^ maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book. Photographs inchiried in the original manuscript have been reproduced xerographically in this copy. Higher quality 6" x 9" black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order. A Be<l & Howell Information Company 300 North ZeeO Road. Ann Arbor. Ml 48106-1346 USA 313.- 761-4700 800/ 521-0600 BACTERIA ASSOCIATED WITH WELL WATER: BIOGEOCHEMICAL TRANSFORMATION OF FE AND MN, AND CHARACTERIZATION AND CHEMOTAXIS OF A METHYLOTROPHIC HYPHOMICROBIUM SP. DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in the Graduate School of The Ohio State University By Laura Tuhela, B.S., M.S.
  • Hyphal Proteobacteria, Hirschia Baltica Gen. Nov. , Sp. Nov

    Hyphal Proteobacteria, Hirschia Baltica Gen. Nov. , Sp. Nov

    INTERNATIONALJOURNAL OF SYSTEMATICBACTERIOLOGY, Oct. 1990, p. 443451 Vol. 40. No. 4 0020-7713/9O/040443-O9$02.00/0 Copyright 0 1990, International Union of Microbiological Societies Taxonomic and Phylogenetic Studies on a New Taxon of Budding, Hyphal Proteobacteria, Hirschia baltica gen. nov. , sp. nov. HEINZ SCHLESNER," CHRISTINA BARTELS, MANUEL SITTIG, MATTHIAS DORSCH, AND ERKO STACKEBRANDTT Institut fur Allgemeine Mikrobiologie, Christian-Albrecht-Universitat, 2300 Kiel, Federal Republic of Germany Four strains of budding, hyphal bacteria, which had very similar chemotaxonomic properties, were isolated from the Baltic Sea. The results of DNA-DNA hybridization experiments, indicated that three of the new isolates were closely related, while the fourth was only moderately related to the other three. Sequence signature and higher-order structural detail analyses of the 16s rRNA of strain IFAM 141gT (T = type strain) indicated that this isolate is related to the alpha subclass of the class Proteobacteriu. Although our isolates resemble members of the genera Hyphomicrobium and Hyphomonas in morphology, assignment to either of these genera was excluded on the basis of their markedly lower DNA guanine-plus-cytosine contents. We propose that these organisms should be placed in a new genus, Hirschiu baltica is the type species of this genus, and the type strain of H. bdtica is strain IFAM 1418 (= DSM 5838). Since the first description of a hyphal, budding bacterium, no1 and formamide were tested at concentrations of 0.02 and Hyphomicrobium vulgare (53), only the following additional 0.1% (vol/vol). Utilization of nitrogen sources was tested in genera having this morphological type have been formally M9 medium containing glucose as the carbon source.
  • Deterioration of an Etruscan Tomb by Bacteria from the Order Rhizobiales

    Deterioration of an Etruscan Tomb by Bacteria from the Order Rhizobiales

    OPEN Deterioration of an Etruscan tomb by SUBJECT AREAS: bacteria from the order Rhizobiales SOIL MICROBIOLOGY Marta Diaz-Herraiz1*, Valme Jurado1*, Soledad Cuezva2, Leonila Laiz1, Pasquino Pallecchi3, Piero Tiano4, MICROBIOLOGY TECHNIQUES Sergio Sanchez-Moral5 & Cesareo Saiz-Jimenez1 Received 1Instituto de Recursos Naturales y Agrobiologia, IRNAS-CSIC, Avda. Reina Mercedes 10, 41012 Sevilla, Spain, 2Departamento de 23 September 2013 Ciencias de la Tierra y del Medio Ambiente, Universidad de Alicante, 03690 San Vicente del Raspeig, Spain, 3Soprintendenza per i Beni Archeologici della Toscana, 50143 Firenze, Italy, 4CNR Istituto per la Conservazione e Valorizzazione dei Beni Culturali, Accepted 50019 Sesto Fiorentino, Italy, 5Museo Nacional de Ciencias Naturales, MNCN-CSIC, 28006 Madrid, Spain. 10 December 2013 Published The Etruscan civilisation originated in the Villanovan Iron Age in the ninth century BC and was absorbed by 9 January 2014 Rome in the first century BC. Etruscan tombs, many of which are subterranean, are one of the best representations of this culture. The principal importance of these tombs, however, lies in the wall paintings and in the tradition of rich burial, which was unique in the Mediterranean Basin, with the exception of Correspondence and Egypt. Relatively little information is available concerning the biodeterioration of Etruscan tombs, which is caused by a colonisation that covers the paintings with white, circular to irregular aggregates of bacteria or requests for materials biofilms that tend to connect each other. Thus, these colonisations sometimes cover extensive surfaces. Here should be addressed to we show that the colonisation of paintings in Tomba del Colle is primarily due to bacteria of the order C.S.-J.
  • Supplementary Information

    Supplementary Information

    Supplementary Information Comparative Microbiome and Metabolome Analyses of the Marine Tunicate Ciona intestinalis from Native and Invaded Habitats Caroline Utermann 1, Martina Blümel 1, Kathrin Busch 2, Larissa Buedenbender 1, Yaping Lin 3,4, Bradley A. Haltli 5, Russell G. Kerr 5, Elizabeta Briski 3, Ute Hentschel 2,6, Deniz Tasdemir 1,6* 1 GEOMAR Centre for Marine Biotechnology (GEOMAR-Biotech), Research Unit Marine Natural Products Chemistry, GEOMAR Helmholtz Centre for Ocean Research Kiel, Am Kiel-Kanal 44, 24106 Kiel, Germany 2 Research Unit Marine Symbioses, GEOMAR Helmholtz Centre for Ocean Research Kiel, Duesternbrooker Weg 20, 24105 Kiel, Germany 3 Research Group Invasion Ecology, Research Unit Experimental Ecology, GEOMAR Helmholtz Centre for Ocean Research Kiel, Duesternbrooker Weg 20, 24105 Kiel, Germany 4 Chinese Academy of Sciences, Research Center for Eco-Environmental Sciences, 18 Shuangqing Rd., Haidian District, Beijing, 100085, China 5 Department of Chemistry, University of Prince Edward Island, 550 University Avenue, Charlottetown, PE C1A 4P3, Canada 6 Faculty of Mathematics and Natural Sciences, Kiel University, Christian-Albrechts-Platz 4, Kiel 24118, Germany * Corresponding author: Deniz Tasdemir ([email protected]) This document includes: Supplementary Figures S1-S11 Figure S1. Genotyping of C. intestinalis with the mitochondrial marker gene COX3-ND1. Figure S2. Influence of the quality filtering steps on the total number of observed read pairs from amplicon sequencing. Figure S3. Rarefaction curves of OTU abundances for C. intestinalis and seawater samples. Figure S4. Multivariate ordination plots of the bacterial community associated with C. intestinalis. Figure S5. Across sample type and geographic origin comparison of the C. intestinalis associated microbiome.
  • Appendices Physico-Chemical

    Appendices Physico-Chemical

    http://researchcommons.waikato.ac.nz/ Research Commons at the University of Waikato Copyright Statement: The digital copy of this thesis is protected by the Copyright Act 1994 (New Zealand). The thesis may be consulted by you, provided you comply with the provisions of the Act and the following conditions of use: Any use you make of these documents or images must be for research or private study purposes only, and you may not make them available to any other person. Authors control the copyright of their thesis. You will recognise the author’s right to be identified as the author of the thesis, and due acknowledgement will be made to the author where appropriate. You will obtain the author’s permission before publishing any material from the thesis. An Investigation of Microbial Communities Across Two Extreme Geothermal Gradients on Mt. Erebus, Victoria Land, Antarctica A thesis submitted in partial fulfilment of the requirements for the degree of Master’s Degree of Science at The University of Waikato by Emily Smith Year of submission 2021 Abstract The geothermal fumaroles present on Mt. Erebus, Antarctica, are home to numerous unique and possibly endemic bacteria. The isolated nature of Mt. Erebus provides an opportunity to closely examine how geothermal physico-chemistry drives microbial community composition and structure. This study aimed at determining the effect of physico-chemical drivers on microbial community composition and structure along extreme thermal and geochemical gradients at two sites on Mt. Erebus: Tramway Ridge and Western Crater. Microbial community structure and physico-chemical soil characteristics were assessed via metabarcoding (16S rRNA) and geochemistry (temperature, pH, total carbon (TC), total nitrogen (TN) and ICP-MS elemental analysis along a thermal gradient 10 °C–64 °C), which also defined a geochemical gradient.
  • Advance View Proofs

    Advance View Proofs

    Microbes Environ. Vol. 00, No. 0, 000-000, 2015 https://www.jstage.jst.go.jp/browse/jsme2 doi:10.1264/jsme2.ME14123 Bacterial Community Analysis of Drinking Water Biofilms in Southern Sweden KATHARINA LÜHRIG1,2, BJÖRN CANBÄCK3, CATHERINE J. PAUL1,4, TOMAS JOHANSSON3, KENNETH M. PERSSON2,4, and PETER RÅDSTRÖM1* 1Applied Microbiology, Department of Chemistry, Lund University, P.O. Box 124, SE-221 00 Lund, Sweden; 2Sydvatten AB, Hyllie Stationstorg 21, SE-215 32 Malmö, Sweden; 3Microbial Ecology Group, Department of Biology, Lund University, Sölvegatan 37, SE-223 62 Lund, Sweden; and 4Water Resources Engineering, Department of Building and Environmental Technology, Lund University, P.O. Box 118, SE-221 00 Lund, Sweden (Received August 28, 2014—Accepted January 10, 2015—Published online February 21, 2015) Next-generation sequencing of the V1-V2 and V3 variable regions of the 16S rRNA gene generated a total of 674,116 reads that described six distinct bacterial biofilm communities from both water meters and pipes. A high degree of reproducibility was demonstrated for the experimental and analytical work-flow by analyzing the communities present in parallel water meters, the rare occurrence of biological replicates within a working drinking water distribution system. The communities observed in water meters from households that did not complain about their drinking water were defined by sequences representing Proteobacteria (82–87%), with 22–40% of all sequences being classified as Sphingomonadaceae. However, a water meter biofilm community from a household with consumer reports of red water and flowing water containing elevated levels of iron and manganese had fewer sequences representing Proteobacteria (44%); only 0.6% of all sequences were classified as Sphingomonadaceae; and, in contrast to the other water meter communities, markedly more sequences represented Nitrospira and Pedomicrobium.
  • Lists of Names of Prokaryotic Candidatus Taxa

    Lists of Names of Prokaryotic Candidatus Taxa

    NOTIFICATION LIST: CANDIDATUS LIST NO. 1 Oren et al., Int. J. Syst. Evol. Microbiol. DOI 10.1099/ijsem.0.003789 Lists of names of prokaryotic Candidatus taxa Aharon Oren1,*, George M. Garrity2,3, Charles T. Parker3, Maria Chuvochina4 and Martha E. Trujillo5 Abstract We here present annotated lists of names of Candidatus taxa of prokaryotes with ranks between subspecies and class, pro- posed between the mid- 1990s, when the provisional status of Candidatus taxa was first established, and the end of 2018. Where necessary, corrected names are proposed that comply with the current provisions of the International Code of Nomenclature of Prokaryotes and its Orthography appendix. These lists, as well as updated lists of newly published names of Candidatus taxa with additions and corrections to the current lists to be published periodically in the International Journal of Systematic and Evo- lutionary Microbiology, may serve as the basis for the valid publication of the Candidatus names if and when the current propos- als to expand the type material for naming of prokaryotes to also include gene sequences of yet-uncultivated taxa is accepted by the International Committee on Systematics of Prokaryotes. Introduction of the category called Candidatus was first pro- morphology, basis of assignment as Candidatus, habitat, posed by Murray and Schleifer in 1994 [1]. The provisional metabolism and more. However, no such lists have yet been status Candidatus was intended for putative taxa of any rank published in the journal. that could not be described in sufficient details to warrant Currently, the nomenclature of Candidatus taxa is not covered establishment of a novel taxon, usually because of the absence by the rules of the Prokaryotic Code.
  • Compile.Xlsx

    Compile.Xlsx

    Silva OTU GS1A % PS1B % Taxonomy_Silva_132 otu0001 0 0 2 0.05 Bacteria;Acidobacteria;Acidobacteria_un;Acidobacteria_un;Acidobacteria_un;Acidobacteria_un; otu0002 0 0 1 0.02 Bacteria;Acidobacteria;Acidobacteriia;Solibacterales;Solibacteraceae_(Subgroup_3);PAUC26f; otu0003 49 0.82 5 0.12 Bacteria;Acidobacteria;Aminicenantia;Aminicenantales;Aminicenantales_fa;Aminicenantales_ge; otu0004 1 0.02 7 0.17 Bacteria;Acidobacteria;AT-s3-28;AT-s3-28_or;AT-s3-28_fa;AT-s3-28_ge; otu0005 1 0.02 0 0 Bacteria;Acidobacteria;Blastocatellia_(Subgroup_4);Blastocatellales;Blastocatellaceae;Blastocatella; otu0006 0 0 2 0.05 Bacteria;Acidobacteria;Holophagae;Subgroup_7;Subgroup_7_fa;Subgroup_7_ge; otu0007 1 0.02 0 0 Bacteria;Acidobacteria;ODP1230B23.02;ODP1230B23.02_or;ODP1230B23.02_fa;ODP1230B23.02_ge; otu0008 1 0.02 15 0.36 Bacteria;Acidobacteria;Subgroup_17;Subgroup_17_or;Subgroup_17_fa;Subgroup_17_ge; otu0009 9 0.15 41 0.99 Bacteria;Acidobacteria;Subgroup_21;Subgroup_21_or;Subgroup_21_fa;Subgroup_21_ge; otu0010 5 0.08 50 1.21 Bacteria;Acidobacteria;Subgroup_22;Subgroup_22_or;Subgroup_22_fa;Subgroup_22_ge; otu0011 2 0.03 11 0.27 Bacteria;Acidobacteria;Subgroup_26;Subgroup_26_or;Subgroup_26_fa;Subgroup_26_ge; otu0012 0 0 1 0.02 Bacteria;Acidobacteria;Subgroup_5;Subgroup_5_or;Subgroup_5_fa;Subgroup_5_ge; otu0013 1 0.02 13 0.32 Bacteria;Acidobacteria;Subgroup_6;Subgroup_6_or;Subgroup_6_fa;Subgroup_6_ge; otu0014 0 0 1 0.02 Bacteria;Acidobacteria;Subgroup_6;Subgroup_6_un;Subgroup_6_un;Subgroup_6_un; otu0015 8 0.13 30 0.73 Bacteria;Acidobacteria;Subgroup_9;Subgroup_9_or;Subgroup_9_fa;Subgroup_9_ge;