Supporting Information Brown et al. 10.1073/pnas.1114476109 SI Materials and Methods and silver enhancement was not required. Electron microscopy Strains and Conditions. A. tumefaciens C58 was grown in Luria– was performed on a JEOL JEM1010 at 60 kV, equipped with a Bertani (LB) broth medium or in AT minimal medium (1) TemCam-F416 (TVIPS) digital camera. supplemented with 0.5% (wt/vol) glucose and 15 mM ammo- nium sulfate and 0.1 mM acetosyringone at 26 °C. S. meliloti Electron Microscopy. Droplets of exponentially growing cultures fi 1021 was grown in LB medium supplemented with 2.5 mM were deposited onto a piece of para lm and E.M. carbon-for- fl CaCl and 2.5 mM MgSO at 26 °C. Brucella abortus 544 was mvar-coated copper grids (200 mesh) were oated onto the 2 4 droplets for 2 min. Excess liquid was removed with filter paper, grown in 2YT liquid medium at 37 °C and O. anthropi LMG 3331 fl was grown in LB medium at 30 °C. H. denitrificans was grown in and the grids were quickly washed four times oating onto Hyphomicrobium medium 337 containing 0.4% methylamine droplets of double distilled water, transferred to droplets of 1% hydrochloride (2) at 26 °C without shaking. P. hirschii was grown uranyl acetate in water for 2 min, washed once in double distilled on MMB medium (3) at 26 °C. When necessary, kanamycin was water, dried, and subjected to electron microscopy as described above for D-cys labeling. used at 100 μg/mL and 1 mM isopropyl-α-D-thio-galactoside (IPTG) was used as an inducer. TRSE Staining. The amine reactive dye, TRSE, binds to outer membrane proteins and the mobility of these proteins in E. coli is Construction and Imaging of FtsZ-eGFP Expression Strain. To enable severely restricted in the regions comprised of inert peptidoglycan localization studies of FtsZ (Atu2086), a translational fusion of fi FtsZ to eGFP was placed under the control of the lac promoter. (7). The TRSE staining protocol was modi ed to allow time-lapse A. tumefaciens The Atu2086 gene lacking the stop codon was amplified using the microscopy of individual growing cells. were grown to exponential phase and washed three times in 0.1 M NaHCO , FtsZ2-F-GFP (CATATGACGATACAGCTGCAAAAGCCT) and 3 pH 8.3 buffer by centrifugation for 5 min at 5000 × g.Washedcell FtsZ2-R-GFP (CTCGAGGTTGGACTGGCGGCGCAGGAA- pellets were resuspended in 200 μl of buffer and TRSE was added GGC) primers and cloned into the IPTG-inducible expression to a final concentration of 0.1 μg/mL. Cells were incubated in the vector pSRKKm (4), generating pJW164. eGFP was amplified dark for 5–10 min. B. abortus and O. anthropi cell were collected from pJZ383 (5) using primers XhoIgfp (CTCGAGATGAGT- during stationary phase, washed three times with PBS, and then AAAGGAGAAGAACTT) and gfpNheI (GCTAGCTCATTTG- incubated for 15 min with TRSE at a final concentration of 1 μg/mL TATAGTTCATCCATGCC). A fragment digested with XhoI and in the dark at room temperature. The bacteria were then washed NheI and containing eGFP was cloned into pJW164, generating the fi one time with buffer and two times with the appropriate medium. nal construct, pJW164G. pJW164G was introduced into wildtype A. tumefaciens cells were spotted on an agarose pad immediately A. tumefaciens. Before time-lapse microscopy, cells were diluted to after staining and observed using time-lapse microscopy. B. abortus an OD of 0.1 and grown in the presence of kanamycin (100 μg/mL) μ cellsweregrownfor3hinliquidmediumandO. anthropi cells were and 1 mM IPTG for 3 h. Dilute cell suspension (0.8 L) was then grown for 1 h in liquid medium before observation with time-lapse spotted on LB agarose pads containing kanamycin and IPTG and microscopy. imaged every 10 min using the methods for time-lapse microscopy described below. Time-Lapse Microscopy. For A. tumefaciens, LB medium (unless otherwise stated) containing 1% agarose was applied to a 25-mm D-cys Labeling. D-cys labeling was performed as previously de- × × fi μ by 75-mm glass slide to form an agarose pad (22 mm 22 mm scribed (6) with the following modi cations. D-cys (100 g/mL) 0.5 mm) capable of supporting the growth of the bacteria. Ex- was added to exponentially growing cultures (150 mL; OD600 = ponential phase cell culture was diluted to an OD600 of 0.05–0.2 0.1) of A. tumefaciens and the cultures were incubated further for and 0.8 μL was spotted on the agarose pad. The agarose pad was 150 min. At this stage cells (OD600∼0.6) were collected by cen- × covered with a coverslip and sealed using a 1:1:1 mixture of trifugation (5000 g; 5 min; room temperature), resuspended in Vaseline, lanolin, and paraffin. A Nikon Eclipse 90i light mi- an equal volume of prewarmed LB, centrifuged again as before, croscope equipped with a ×100 DIC Plan Apo VC oil objective and resuspended into 9 mL of prewarmed LB. A 3-mL sample was used for DIC microscopy and a Chroma 83700 triple filter (nonchased control) of the cell suspension was immediately cube was used with corresponding excitation and emission filters mixed with 6 mL of 6% (wt/vol) SDS in a boiling water bath under for epifluorescence microscopy. Images were captured every strong magnetic stirring. The remaining cell suspension was dis- 5 min using a Photometrics Cascade 1K cooled charge-coupled- tributed among an appropriate number of cultures with pre- device camera and Metamorph imaging software (Molecular warmed medium, and further incubated for the selected chase Devices). times, normally 45 and 90 min, roughly corresponding to one and For B. abortus and O. anthropi, time-lapse microscopy was two mass doublings. At the end of the chase time, cells were performed by placing cells on a microscope slide that was layered collected by centrifugation, resuspended into 3 mL of prewarmed with a 1% agarose pad containing 2YT medium and LB medium, medium, and immediately mixed with 6 mL of boiling 6% SDS as respectively. Fluorescence was observed at 583 nm. Samples described above. Samples were kept in a boiling water bath with were observed every hour at 37 °C for B. abortus and every 40 stirring for 6 h and then were left overnight at room temperature min at 32 °C for O. anthropi using a Nikon i80 fluorescence with moderate stirring. Further washing, biotinylation, immu- microscope and the NIS software from Nikon with a Orca ER nolabeling and silver enhancement were performed as described Hamamatsu camera. (6) except that a mouse monoclonal anti-biotin antibody (Mo- lecular Probes) and nanogold-conjugated anti-mouse antibody Agrobacterium Attachment to an Arabidopsis Root. Sterilized Ara- (Nanoprobes) were used as primary and secondary antibodies bidopsis thaliana seeds were placed on 1/2 MS salts plates with respectively. D-cys labeling for S. meliloti was completed as de- 1% agar and 1% sucrose and allowed to germinate and grow scribed above except that a 10 nm of Gold-proteinA conjugate until the roots were ∼3 cm long (8). Wild type A. tumefaciens was used in place of nanogold-conjugated anti-mouse antibody cells were grown in LB medium at 26 °C until reaching expo- Brown et al. www.pnas.org/cgi/content/short/1114476109 1of16 nential phase. TRSE stained cells (200 μL) were washed and (pH 4.95), 15% (vol/vol) methanol. Elution was monitored by resuspended in a solution containing 1 mM calcium chloride and measuring the absorbance at 204 nm. 0.4% sucrose. The bacterial cell culture was spotted into a Petri For the identification of muropeptides, each peak of the HPLC dish and a 10 mm root segment was floated in the bacterial cell profile was collected, vacuum dried, desalted, and subjected to culture in the dark at room temperature for 4 h. The root seg- MALDI-TOF (Autoflex; Bruker Daltonics) to determine the ments were rinsed in 1 mM calcium chloride and 0.4% sucrose molecular mass of the components. The specific sequence of and placed on an agarose pad containing 0.5 μg/mL Alexa Fluor amino acids and amino sugars in each muropeptide was defined 488-conjugated WGA (Invitrogen Molecular Probes), 1 mM by means of electrospray-ion trap MS/MS (LCQ Classic; Thermo- calcium chloride, and 0.4% sucrose. The attachment and growth Finnigan) of the HPLC-purified muropeptides. of A. tumefaciens cells to the root segments was observed using time-lapse microscopy. Analysis of Mother Cell Growth. A. tumefaciens was grown in LB to exponential phase and then introduced into a 0.1 × 1 × 50 mm Determination of Peptidoglycan Composition of A. tumefaciens and rectangular glass capillary (VitroCom). After sufficient time to S. meliloti by HPLC and MS. Peptidoglycan purification was per- allow attachment by motile cells (5–10 min), constant flow of formed by a modification of the boiling SDS extraction method sterile LB at ∼100 μm/s permitted observation of dividing cells (9). Cells were collected from exponentially growing cultures by through multiple divisions while washing away nascent motile centrifugation (6,000 × g; 15 min; 20 °C), suspended into a small daughters. A Nikon 90i microscope with 60× phase-contrast, oil volume of LB, and mixed 1:2 with 6% SDS in a boiling water immersion objective and motorized stage collected images from bath under strong magnetic stirring. The suspensions were kept multiple stage positions at 4-min intervals. A custom ImageJ under those conditions for 4 h, and then were left overnight at plugin tracked the size of individual cells through time using room temperature with stirring.