DOCSLIB.ORG

Identification of Novel Genes and Transcription Factors Involved in Spleen, Thymus and Immunological Development and Function

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification of Novel Genes and Transcription Factors Involved in Spleen, Thymus and Immunological Development and Function Genes and Immunity (2006) 7, 101–112 & 2006 Nature Publishing Group All rights reserved 1466-4879/06 $30.00 www.nature.com/gene ORIGINAL ARTICLE Identification of novel genes and transcription factors involved in spleen, thymus and immunological development and function BG Hoffman1, KL Williams2, AH Tien1,VLu1, T Ruiz de Algara1, JP-Y Ting2 and CD Helgason1,3 1BC Cancer Agency, Vancouver, BC, Canada; 2University of North Carolina Chapel Hill, Lineberger Comprehensive Cancer Center, Chapel Hill, NC, USA and 3Department of Surgery, Faculty of Medicine, University of British Columbia, Vancouver, BC, Canada We constructed and analyzed six serial analysis of gene expression (SAGE) libraries to identify genes with previously uncharacterized roles in spleen or thymus development. A total of 625 070 tags were sequenced from the three spleen (embryonic day (E)15.5, E16.5 and adult) and three thymus (E15.5, E18.5 and adult) libraries. These tags corresponded to 83 182 tag types, which mapped unambiguously to 36 133 different genes. Genes over-represented in these libraries, compared to 115 mouse SAGE libraries (www.mouseatlas.org), included genes of known and unknown immunological or developmental relevance. The expression profiles of 11 genes with unknown roles in spleen and thymus development were validated using reverse transcription-qPCR. We further characterized the expression of one of these candidates, RIKEN cDNA 9230105E10 that encodes a murine homolog of Trim5a, in numerous adult tissues and immune cell types. In addition, we demonstrate that transcript levels are upregulated in response to TLR stimulation of plasmacytoid dendritic cells and macrophages. This work provides the first evidence of regulated and cell type-specific expression of this gene. In addition, these observations suggest that the SAGE libraries provide an important resource for further investigations into the molecular mechanisms regulating spleen and thymus organogenesis, as well as the development of immunological competence. Genes and Immunity (2006) 7, 101–112. doi:10.1038/sj.gene.6364270; published online 15 December 2005 Keywords: SAGE; Trim5a; transcription factor Introduction developing spleen can no longer be seen at this time in Hox11À/À, capsulinÀ/À and Bapx1À/À mice,1–3,5 confirm- Comparatively little is known about the molecular ing the critical role of these transcription factors in spleen mechanisms regulating the development of the spleen organogenesis. The first hematopoietic cells begin to and thymus. Considerably more attention has been appear in the spleen anlage, and between E13.5 and focused on elucidating the mechanisms regulating approximately E16.5, the spleen is a site of hematopoiesis lymphoid cell development and function, although it is in the fetus. Shortly after E16.5 hematopoiesis migrates to likely that many genes critical to these processes remain the bone marrow and lymphoid precursors begin to to be discovered. infiltrate the spleen. Thereafter, the final organization of Development of the mouse spleen begins just before the spleen is established with the formation of the white embryonic day 11.5 (E11.5) with condensation of the pulp, containing B-cell follicles, T cells as well as mesenchyme underlying the dorsal mesogastrium lymphocytes and antigen-presenting dendritic cells epithelium.1 The genetic mechanisms underlying the (DCs) in the marginal zone, and the red pulp, which is generation of these initial splenic precursors are essen- composed of a complex system of blood vessels that tially unknown. By E11.5, the expression of several allow the removal of old or damaged red blood cells.6,7 transcription factors essential to spleen organogenesis Thymus development begins as early as E10.5 with the including Hox11, Nkx2.5, capsulin/Pod-1, Wt1 and Bapx1 proliferation of cells in the posterior part of the third can be detected.1–3 The molecular hierarchy regulating pharyngeal pouch.8,9 Subsequently, thymic precursor expression of these transcription factors, and the path- cells migrate and fuse at the midline. Interactions ways they function within, are only beginning to be between the thymic epithelium and the surrounding established.1,4 By E13.5, the splenic primordium is visible neural crest-derived mesenchyme play a key role in as a ridge of cells on the dorsal stomach. A normally expansion of thymic precursors.9,10 Several studies have highlighted the importance of transcription factors such as Foxn1, Hoxa3, Pax1 and Pax9 in early thymus Correspondence: Dr CD Helgason, British Columbia Cancer development.8,9,11–17 These studies point to a hierarchy Agency, 675 West 10th Avenue, Vancouver, B.C., V5Z 1L3, Canada. E-mail: [email protected] of transcription factor expression, with Foxn1 and Hoxa3 Received 19 September 2005; revised 12 October 2005; accepted 13 playing a role in early thymic development and Pax9 and October 2005; published online 15 December 2005 Pax1 becoming involved subsequently.8,9 At roughly the SAGE analysis of spleen and thymus development BG Hoffman et al 102 same time that Foxn1 expression becomes critical to candidate uncharacterized genes, a mouse homolog of thymic development (E11.5), hematopoietic precursors the primate Trim5a HIV-1 restriction factor, was further begin to invade the thymic primordium. Interestingly, assessed in numerous adult tissues as well as various Foxn1À/À mice lack expression of the chemokines TECK immune cell types including macrophages, DCs and and SDF-1, suggesting that these molecules are targets of various T-cell populations. Our results demonstrate Foxn1 and that they are critical in attracting prothymo- regulated expression of this transcript in macrophages cytes to the thymus.8 At E11.5, the thymic epithelium is and Flt-3L-derived DC populations in response to TLR not fully differentiated and is unable to support T-cell stimulation. The libraries created and described herein development. By E14.5, concomitant with maturation of provide a unique and valuable resource for the identi- the thymic epithelium, T-cell precursors become fully fication of developmentally and immunologically rele- committed to the T-cell lineage at least in part via the vant transcripts in the spleen and thymus. Moreover, we Notch signaling pathway.18–23 Thymocyte interactions provide the first evidence that expression of an im- with the thymic epithelium and mesenchyme are critical munologically relevant transcript identified in these to the proper development of both the thymus and the libraries is differentially regulated. thymocytes. Lineage-committed T cells drive the estab- lishment of the appropriate architecture of cortical thymic epithelial cells. Subsequently, the final maturation of T cells induces the expansion and organization of Results medullary thymic epithelial cells. Overview of the libraries Serial analysis of gene expression (SAGE) analysis, like A total of 625 070 tags were sequenced to generate the six microarrays, provides a quantitative analysis of gene LongSAGE spleen and thymus libraries (available at expression profiles. However, it has the additional www.mouseatlas.org or http://cgap.nci.nih.gov/SAGE). advantage that it permits the identification of novel These include three spleen libraries from: E15.5 when the transcripts, which has been improved by the develop- spleen is predominantly erythropoietic, E16.5 when ment of a LongSAGE protocol, which generates 21 mers lymphocytes begin to appear in this tissue and adult that enhances the efficiency and confidence of tag-to- (84 days post-natal (dpn)) when the spleen is fully gene mapping. SAGE also has the added benefit that the mature and functional. Similarly, we generated three data are digital and thus easily shared among investiga- thymus libraries from: E15.5 when a mature thymic tors and compared across different experiments and epithelium is present and T-cell precursors become fully tissues.24,25 committed, E18.5 when mature T cells are first estab- The analysis of expression patterns associated with lished and from 84 dpn when the thymus is fully mature different stages of spleen and thymus development is and functional. A summary of the libraries is shown in expected to further facilitate our understanding of the Table 1. genetic cascade required for their development. In Analysis of these libraries revealed expression of addition, such studies are likely to provide insights into 83 182 different tag types after stringent quality selection: the numerous transcription factors, cell surface proteins 47 727 in the spleen libraries (58% unique to the spleen and signaling pathway components involved in the libraries as compared to the thymus libraries) and 55 282 maturation and function of lymphocytes. We thus in the thymus libraries (64% unique). Of these tags, 45% created six SAGE libraries representing critical stages of (37 202) mapped to known transcripts using the Refseq, spleen (E15.5 and E16.5) and thymus (E15.5 and E18.5) MGC and Ensembl transcript databases, 23% (19 214) to development, as well as libraries from the corresponding known genes using the Ensembl genes database, 12% adult tissues. Here, we describe the analyses of these (9626) to the genome using the Golden path database and libraries focusing on the identification of transcription 0.1% (100) to the mitochondrial genome or to noncoding factors, signaling pathway members and uncharacter- genes using the Genebank database. The remaining 20% ized genes. We next validated the expression of seven (17 040) of the tags could not be
Load more

Recommended publications
  • TEAD3 (NM 003214) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC210621 TEAD3 (NM_003214) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: TEAD3 (NM_003214) Human Tagged ORF Clone Tag: Myc-DDK Symbol: TEAD3 Synonyms: DTEF-1; ETFR-1; TEAD-3; TEAD5; TEF-5; TEF5 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC210621 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATAGCGTCCAACAGCTGGAACGCCAGCAGCAGCCCCGGGGAGGCCCGGGAGGATGGGCCCGAGGGCCTGG ACAAGGGGCTGGACAACGATGCGGAGGGCGTGTGGAGCCCGGACATCGAGCAGAGCTTCCAGGAGGCCCT GGCCATCTACCCGCCCTGCGGCCGGCGGAAGATCATCCTGTCAGACGAGGGCAAGATGTACGGCCGAAAT GAGTTGATTGCACGCTATATTAAACTGAGGACGGGGAAGACTCGGACGAGAAAACAGGTGTCCAGCCACA TACAGGTTCTAGCTCGGAAGAAGGTGCGGGAGTACCAGGTTGGCATCAAGGCCATGAACCTGGACCAGGT CTCCAAGGACAAAGCCCTTCAGAGCATGGCGTCCATGTCCTCTGCCCAGATCGTCTCTGCCAGTGTCCTG CAGAACAAGTTCAGCCCACCTTCCCCTCTGCCCCAGGCCGTCTTCTCCACTTCCTCGCGGTTCTGGAGCA GCCCCCCTCTCCTGGGACAGCAGCCTGGACCCTCTCAGGACATCAAGCCCTTTGCACAGCCAGCCTACCC CATCCAGCCGCCCCTGCCGCCGACGCTCAGCAGTTATGAGCCCCTGGCCCCGCTCCCCTCAGCTGCTGCC TCTGTGCCTGTGTGGCAGGACCGTACCATTGCCTCCTCCCGGCTGCGGCTCCTGGAGTATTCAGCCTTCA TGGAGGTGCAGCGAGACCCTGACACGTACAGCAAACACCTGTTTGTGCACATCGGCCAGACGAACCCCGC CTTCTCAGACCCACCCCTGGAGGCAGTAGATGTGCGCCAGATCTATGACAAATTCCCCGAGAAAAAGGGA GGATTGAAGGAGCTCTATGAGAAGGGGCCCCCTAATGCCTTCTTCCTTGTCAAGTTCTGGGCCGACCTCA
    [Show full text]
  • Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice
    Loyola University Chicago Loyola eCommons Biology: Faculty Publications and Other Works Faculty Publications 2013 Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice Mihaela Palicev Gunter P. Wagner James P. Noonan Benedikt Hallgrimsson James M. Cheverud Loyola University Chicago, [email protected] Follow this and additional works at: https://ecommons.luc.edu/biology_facpubs Part of the Biology Commons Recommended Citation Palicev, M, GP Wagner, JP Noonan, B Hallgrimsson, and JM Cheverud. "Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice." Genome Biology and Evolution 5(10), 2013. This Article is brought to you for free and open access by the Faculty Publications at Loyola eCommons. It has been accepted for inclusion in Biology: Faculty Publications and Other Works by an authorized administrator of Loyola eCommons. For more information, please contact [email protected]. This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 3.0 License. © Palicev et al., 2013. GBE Genomic Correlates of Relationship QTL Involved in Fore- versus Hind Limb Divergence in Mice Mihaela Pavlicev1,2,*, Gu¨ nter P. Wagner3, James P. Noonan4, Benedikt Hallgrı´msson5,and James M. Cheverud6 1Konrad Lorenz Institute for Evolution and Cognition Research, Altenberg, Austria 2Department of Pediatrics, Cincinnati Children‘s Hospital Medical Center, Cincinnati, Ohio 3Yale Systems Biology Institute and Department of Ecology and Evolutionary Biology, Yale University 4Department of Genetics, Yale University School of Medicine 5Department of Cell Biology and Anatomy, The McCaig Institute for Bone and Joint Health and the Alberta Children’s Hospital Research Institute for Child and Maternal Health, University of Calgary, Calgary, Canada 6Department of Anatomy and Neurobiology, Washington University *Corresponding author: E-mail: [email protected].
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • Single-Cell Sequencing of Human Ipsc-Derived Cerebellar Organoids Shows Recapitulation of Cerebellar Development
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.01.182196; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Single-cell sequencing of human iPSC-derived cerebellar organoids shows recapitulation of cerebellar development Samuel Nayler1*, Devika Agarwal3, Fabiola Curion2, Rory Bowden2,4, Esther B.E. Becker1,5* 1Department of Physiology, Anatomy and Genetics; University of Oxford; Oxford, OX1 3PT; United Kingdom 2Wellcome Centre for Human Genetics; University of Oxford; Oxford, OX3 7BN; United Kingdom 3Weatherall Institute for Molecular Medicine; University of Oxford; Oxford, OX3 7BN; United Kingdom 4Present address: Walter and Eliza Hall Institute of Medical Research, Parkville Victoria 3052; Australia 5Lead contact *Correspondence: [email protected], [email protected] Running title: hiPSC-derived cerebellar organoids 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.01.182196; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. ABSTRACT Current protocols for producing cerebellar neurons from human pluripotent stem cells (hPSCs) are reliant on animal co-culture and mostly exist as monolayers, which have limited capability to recapitulate the complex arrangement of the brain. We developed a method to differentiate hPSCs into cerebellar organoids that display hallmarks of in vivo cerebellar development. Single- cell profiling followed by comparison to an atlas of the developing murine cerebellum revealed transcriptionally-discrete populations encompassing all major cerebellar cell types.
    [Show full text]
  • SOX12 Contributes to the Activation of the JAK2/STAT3 Pathway and Malignant Transformation of Esophageal Squamous Cell Carcinoma
    ONCOLOGY REPORTS 45: 129-138, 2021 SOX12 contributes to the activation of the JAK2/STAT3 pathway and malignant transformation of esophageal squamous cell carcinoma CHUNGUANG LI1*, MAOLING ZHU2*, JI ZHU1, QIJUE LU1, BOWEN SHI1, BIN SUN3 and HEZHONG CHEN1 1Department of Thoracic Surgery, Changhai Hospital, Second Military Medical University, Shanghai 200438; 2Department of Gastroenterology, Yangpu Hospital, Tongji University School of Medicine, Shanghai 200090; 3Molecular Oncology Laboratory, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, Shanghai 200438, P.R. China Received May 15, 2020; Accepted October 6, 2020 DOI: 10.3892/or.2020.7863 Abstract. As a crucial transcription factor, sex-determining cells in vitro. Recombinant protein of SOX12 could restore the region Y box 12 (SOX12) is closely related with tumorigenesis aggressive phenotype of ESCC cells. Furthermore, knockdown and malignant transformation in various malignant tumor of the expression of SOX12 inhibited the activation of the Janus types. To date, the specific function of SOX12 in esophageal kinase 2 (JAK2)/signal transducer and activator of transcrip- squamous cell carcinoma (ESCC) has remained largely tion 3 (STAT3) signaling pathway by decreasing the expression elusive and requires further investigation. The present study of the JAK2/STAT3 signaling pathway. Recombinant protein aimed to determine whether aberrant expression of SOX12 is of SOX12 could recover the activation of the JAK2/STAT3 associated with malignant development of ESCC. The expres- signaling pathway. Analysis of the clinical data revealed that sion level of SOX12 in ESCC cells and tissues was analyzed overexpression of SOX12 indicated shorter overall survival by RT-qPCR and western blotting. Short hairpin RNA time (OS; P=0.0341) and disease-free survival time (DFS; (shRNA) targeting SOX12 was transfected into ESCC cells to P=0.04).
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Figure S1. Representative Report Generated by the Ion Torrent System Server for Each of the KCC71 Panel Analysis and Pcafusion Analysis
    Figure S1. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. A Figure S1. Continued. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. B Figure S2. Comparative analysis of the variant frequency found by the KCC71 panel and calculated from publicly available cBioPortal datasets. For each of the 71 genes in the KCC71 panel, the frequency of variants was calculated as the variant number found in the examined cases. Datasets marked with different colors and sample numbers of prostate cancer are presented in the upper right. *Significantly high in the present study. Figure S3. Seven subnetworks extracted from each of seven public prostate cancer gene networks in TCNG (Table SVI). Blue dots represent genes that include initial seed genes (parent nodes), and parent‑child and child‑grandchild genes in the network. Graphical representation of node‑to‑node associations and subnetwork structures that differed among and were unique to each of the seven subnetworks. TCNG, The Cancer Network Galaxy. Figure S4. REVIGO tree map showing the predicted biological processes of prostate cancer in the Japanese. Each rectangle represents a biological function in terms of a Gene Ontology (GO) term, with the size adjusted to represent the P‑value of the GO term in the underlying GO term database.
    [Show full text]
  • Anti-NFYC Antibody (ARG66549)
    Product datasheet [email protected] ARG66549 Package: 100 μl anti-NFYC antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes NFYC Tested Reactivity Hu, Ms Tested Application IHC-P, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name NFYC Antigen Species Human Immunogen KLH-conjugated synthetic peptide encompassing a sequence within the N-term region of Human NFYC. Conjugation Un-conjugated Alternate Names HAP5; NF-YC; Nuclear transcription factor Y subunit gamma; Nuclear transcription factor Y subunit C; CBF-C; HSM; CBFC; Transactivator HSM-1/2; CAAT box DNA-binding protein subunit C; H1TF2A Application Instructions Application table Application Dilution IHC-P 1:100 - 1:200 WB 1:500 - 1:1000 Application Note IHC-P: Antigen Retrieval: Heat mediation was performed in Sodium citrate buffer (pH 6.0). * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Calculated Mw 50 kDa Observed Size 50 kDa Properties Form Liquid Purification Affinity purification with immunogen. Buffer 0.42% Potassium phosphate (pH 7.3), 0.87% NaCl, 0.01% Sodium azide and 30% Glycerol. Preservative 0.01% Sodium azide Stabilizer 30% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. www.arigobio.com 1/2 Note For laboratory research only, not for drug, diagnostic or other use.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Intrinsic Specificity of DNA Binding and Function of Class II Bhlh
    INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS APPROVED BY SUPERVISORY COMMITTEE Jane E. Johnson Ph.D. Helmut Kramer Ph.D. Genevieve Konopka Ph.D. Raymond MacDonald Ph.D. INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS by BRADFORD HARRIS CASEY DISSERTATION Presented to the Faculty of the Graduate School of Biomedical Sciences The University of Texas Southwestern Medical Center at Dallas In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY The University of Texas Southwestern Medical Center at Dallas Dallas, Texas December, 2016 DEDICATION This work is dedicated to my family, who have taught me pursue truth in all forms. To my grandparents for inspiring my curiosity, my parents for teaching me the value of a life in the service of others, my sisters for reminding me of the importance of patience, and to Rachel, who is both “the beautiful one”, and “the smart one”, and insists that I am clever and beautiful, too. Copyright by Bradford Harris Casey, 2016 All Rights Reserved INTRINSIC SPECIFICITY OF BINDING AND REGULATORY FUNCTION OF CLASS II BHLH TRANSCRIPTION FACTORS Publication No. Bradford Harris Casey The University of Texas Southwestern Medical Center at Dallas, 2016 Jane E. Johnson, Ph.D. PREFACE Embryonic development begins with a single cell, and gives rise to the many diverse cells which comprise the complex structures of the adult animal. Distinct cell fates require precise regulation to develop and maintain their functional characteristics. Transcription factors provide a mechanism to select tissue-specific programs of gene expression from the shared genome.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Chain Gene Induced by GM-CSF Β Receptor Regulation of Human High-Affinity Ige Molecular Mechanisms for Transcriptional
    Molecular Mechanisms for Transcriptional Regulation of Human High-Affinity IgE Receptor β-Chain Gene Induced by GM-CSF This information is current as Kyoko Takahashi, Natsuko Hayashi, Shuichi Kaminogawa of September 23, 2021. and Chisei Ra J Immunol 2006; 177:4605-4611; ; doi: 10.4049/jimmunol.177.7.4605 http://www.jimmunol.org/content/177/7/4605 Downloaded from References This article cites 39 articles, 16 of which you can access for free at: http://www.jimmunol.org/content/177/7/4605.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 23, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Molecular Mechanisms for Transcriptional Regulation of Human High-Affinity IgE Receptor ␤-Chain Gene Induced by GM-CSF1 Kyoko Takahashi,*† Natsuko Hayashi,*‡ Shuichi Kaminogawa,† and Chisei Ra2* The ␤-chain of the high-affinity receptor for IgE (Fc␧RI) plays an important role in regulating activation of Fc␧RI-expressing cells such as mast cells in allergic reactions.
    [Show full text]