DOCSLIB.ORG

Survivin Modulates Genes with Divergent Molecular Functions and Regulates Proliferation of Hematopoietic Stem Cells Through Evi-1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Survivin Modulates Genes with Divergent Molecular Functions and Regulates Proliferation of Hematopoietic Stem Cells Through Evi-1 Leukemia (2015) 29, 433–440 & 2015 Macmillan Publishers Limited All rights reserved 0887-6924/15 www.nature.com/leu ORIGINAL ARTICLE Survivin modulates genes with divergent molecular functions and regulates proliferation of hematopoietic stem cells through Evi-1 S Fukuda1, J Hoggatt2,3, P Singh2, M Abe1, JM Speth2,PHu2, EM Conway4, G Nucifora5, S Yamaguchi1 and LM Pelus2 The inhibitor of apoptosis protein Survivin regulates hematopoiesis, although its mechanisms of regulation of hematopoietic stem cells (HSCs) remain largely unknown. While investigating conditional Survivin deletion in mice, we found that Survivin was highly expressed in phenotypically defined HSCs, and Survivin deletion in mice resulted in significantly reduced total marrow HSCs and hematopoietic progenitor cells. Transcriptional analysis of Survivin À / À HSCs revealed altered expression of multiple genes not previously linked to Survivin activity. In particular, Survivin deletion significantly reduced expression of the Evi-1 transcription factor indispensable for HSC function, and the downstream Evi-1 target genes Gata2, Pbx1 and Sall2. The loss of HSCs following Survivin deletion and impaired long-term HSC repopulating function could be partially rescued by ectopic Evi-1 expression in Survivin À / À HSCs. These data demonstrate that Survivin partially regulates HSC function by modulating the Evi-1 transcription factor and its downstream targets and identify new genetic pathways in HSCs regulated by Survivin. Leukemia (2015) 29, 433–440; doi:10.1038/leu.2014.183 INTRODUCTION MATERIALS AND METHODS The endogenous inhibitor of apoptosis protein Survivin regulates Animals apoptosis, cell division and cell cycle1–3 and deregulated SPF female C57Bl/6 mice between 6 and 8 weeks of age were purchased expression of Survivin is frequently observed in solid tumors from the Jackson Laboratories (Bar Harbor, ME, USA). B6.SJL-PtrcAPep3B/ and in leukemia cells.4,5 Survivin is the fourth most highly BoyJ (B6.BoyJ) mice were bred at Indiana University (Indianapolis, IN, USA). 6 Mice in which the Survivin gene could be conditionally deleted expressed transcript in cancer cells, where its expression is ER fl/fl 16 commonly associated with a higher proliferative index, reduced by Tamoxifen (Cre -Survivin ) or polyinosinic:polycytidylic acid (polyI:polyC; Mx1-Cre Survivinfl/fl)17 have been previously described. apoptosis, resistance to chemotherapy and an increased rate of Littermate Survivinfl/fl mice without Cre were used as controls. PCR tumor recurrence. Although early studies suggested that Survivin primers used to distinguish the wild-type, floxed or deleted Survivin alleles was expressed only during development and in neoplastic adult were prepared as previously described.9 The institutional animal care and cells, it is now known that Survivin is expressed in normal tissues, use committee of Indiana University School of Medicine and Shimane including hematopoietic stem and progenitor cells,7,8 T cells,9–11 University School of Medicine approved all experimental procedures. neutrophils,12 erythroid cells13 and vascular endothelial cells.14,15 In addition to its role during development, Survivin plays Antibodies and cytokines physiologic roles in proliferation and cell cycle control in mice The following antibodies were purchased from BD Biosciences (San Diego, and humans, particularly in highly proliferating cell systems such CA, USA): anti-Fcg-III/II receptor; APC-conjugated anti-mouse c-kit (clone as hematopoiesis. Despite a better understanding of where and 2B8); R-Phycoerythrin (PE)-conjugated anti-mouse CD3 (clone 143-2C11), when Survivin is expressed, little is currently known about the GR-1 (clone RB6–8C5), B220 (clone RA3–6B2), Mac1 (clone M1/70) and mechanism of action of Survivin in normal adult cells or the Ter119 (clone Ter119); fluorescein isothiocyanate (FITC)-conjugated CD45.2 growth and proliferative pathways in which it participates. We and PE-conjugated CD45.1; rat IgG2a; rat IgG2b and hamster IgG. found that Survivin was highly expressed in primitive mouse Biotinylated lineage markers consisting of CD5, CD11b, Gr-1, 7-4 and hematopoietic stem cells (HSCs) and conditional deletion caused Ter119 were purchased from Miltenyi Biotech (Auburn, CA, USA). Recombinant human (rh) Flt3 ligand (FL), rh thrombopoietin (Tpo) and hematopoietic collapse. To gain insight into Survivin function in recombinant mouse stem cell factor (rmSCF) were purchased from R&D hematopoiesis, particularly in HSCs, we performed differential Systems (Minneapolis, MN, USA). Recombinant murine granulocyte- mRNA microarray analysis on mouse HSCs shortly following macrophage colony-stimulating factor was purchased from BioVision (Palo conditional Survivin deletion. Survivin deletion was associated Alto, CA, USA). Recombinant human erythropoietin was purchased from with a significant reduction in the expression of the transcription Amgen (Thousand Oaks, CA, USA). factor Evi-1 and its downstream target genes Gata2, Pbx1 and Sall2, transcription factors critical for normal hematopoiesis. The in vivo deletion of the survivin gene Ectopic expression of Evi-1 in HSCs significantly rescued the Survivinfl/fl and CreER-Survivinfl/fl mice received 5 mg Tamoxifen in corn oil hematopoietic collapse due to the loss of Survivin in vivo. These (Sigma-Aldrich, St Louis, MO, USA) intraperitoneally for 3 consecutive days, studies provide the first mechanistic insight of the role of Survivin rested for 3 days, treated for an additional 3 days with Tamoxifen at the in regulating genetic pathways required for HSC function. same dose and analyzed at 14 days following the final administration of 1Department of Pediatrics, Shimane University School of Medicine, Izumo, Japan; 2Department of Microbiology and Immunology, Indiana University School of Medicine, Indianapolis, IN, USA; 3Department of Stem Cell and Regenerative Biology, Harvard University, Cambridge, MA, USA; 4Centre for Blood Research, University of British Columbia, Vancouver, British Columbia, Canada and 5Department of Pathology, University of Chicago, Chicago, IL, USA. Correspondence: Dr S Fukuda, Department of Pediatrics, Shimane University School of Medicine, 89-1 Enya Cho, Izumo, Shimane 693-8501, Japan or Dr LM Pelus, Department of Microbiology and Immunology, Indiana University School of Medicine, 950 West Walnut Street, Indianapolis, IN 46202, USA. E-mail: [email protected] or [email protected] Received 16 March 2014; revised 13 May 2014; accepted 30 May 2014; accepted article preview online 6 June 2014; advance online publication, 4 July 2014 Survivin regulates hematopoietic stem cells through Evi-1 S Fukuda et al 434 Tamoxifen. Mx1-Cre Survivinfl/fl mice received 3 injections of 260 mg/mouse The correlation of gene expression with Survivin was determined by polyI:polyC (GE HealthCare Bioscience, Piscataway, NJ, USA) intraperitone- Pearson’s correlation analysis using Microsoft Excel. ally every other day (days 1, 3 and 5) and analyzed 14 days later. Red blood cells, platelets and the absolute neutrophil count were quantified using a Hemavet 950F hematology analyzer (Drew Scientific, Oxford, CT, USA). RESULTS Total nucleated cellularity was quantitated and marrow or spleen Survivin is expressed in mouse HSCs and disruption impairs hematopoietic stem and progenitor cells analyzed using flow cytometry hematopoiesis and colony forming cell (CFC) analysis. For CFC analysis, cells were cultured in methylcellulose medium containing growth factors as previously We previously demonstrated that Survivin is expressed in the þ 7,22 described.18 Colonies were scored after 7 days. human CD34 cell population that contains HSCs, and is critical for CD34 þ cell proliferation and survival.7,8,23 It was also 17 Retrovirus transduction and competitive HSC transplants shown that Survivin deletion in mice impairs hematopoiesis. fl/fl fl/fl However, the expression of Survivin in primitive mouse HSCs Bone marrow cells from Cre-Survivin and Survivin mice were and the consequences of Survivin deletion on HSC function have transduced with ecotropic retrovirus generated using Phoenix Eco cells not been studied. We now show using RT-PCR analysis that and MSCV( À ) or mouse Evi-1 complementary DNA (cDNA). Briefly, neg lineage-depleted marrow cells were prestimulated with 100 ng/ml of mouse Survivin mRNA is expressed in the CD34 KSL cell rhTpo, rmSCF and rhFL for 48 h and were then infected with fresh population that is enriched for long-term repopulating HSCs and retrovirus supernatant containing MSCV( À ) or MSCV-Evi-119 for 2 in the KSL cell population that contains HSCs and hematopoietic consecutive days. Transduced marrow cells from CreER-Survivinfl/fl and progenitor cells (Figure 1a, upper panel). In addition, the mouse Survivinfl/fl mice were cultured in Iscove’s modified Dulbecco’s medium/ Survivin-121 splice variant that also demonstrates antiapoptotic 10% fetal bovine serum with 100 ng/ml of rhTpo, rmSCF and rhFL in the activity24 was also expressed in mouse HSCs and hematopoietic presence of 1 mM of 4OH-Tamoxifen (Sigma-Aldrich) for 7 days. Viable cells progenitor cells, but at significantly lower levels compared with were enumerated by Trypan blue exclusion and stained with antibodies full-length Survivin (Figure 1a, lower panel). Consistent with against c-kit, Sca-1, lineage markers and CD34. neg For competitive transplantation assays, bone marrow cells from the high expression of Survivin in CD34 KSL cells, analysis untreated Mx1-Cre Survivinfl/fl and Survivinfl/fl mice (CD45.2)
Load more

Recommended publications
  • Abnormal Embryonic Lymphatic Vessel Development in Tie1 Hypomorphic Mice Xianghu Qu, Kevin Tompkins, Lorene E
    © 2014. Published by The Company of Biologists Ltd | Development (2014) 141, 1417 doi:10.1242/dev.108969 CORRECTION Abnormal embryonic lymphatic vessel development in Tie1 hypomorphic mice Xianghu Qu, Kevin Tompkins, Lorene E. Batts, Mira Puri and H. Scott Baldwin There was an error published in Development 137, 1285-1295. Author name H. Scott Baldwin was incomplete. The correct author list appears above. The authors apologise to readers for this mistake. 1417 RESEARCH ARTICLE 1285 Development 137, 1285-1295 (2010) doi:10.1242/dev.043380 © 2010. Published by The Company of Biologists Ltd Abnormal embryonic lymphatic vessel development in Tie1 hypomorphic mice Xianghu Qu1, Kevin Tompkins1, Lorene E. Batts1, Mira Puri2 and Scott Baldwin1,3,* SUMMARY Tie1 is an endothelial receptor tyrosine kinase that is essential for development and maintenance of the vascular system; however, the role of Tie1 in development of the lymphatic vasculature is unknown. To address this question, we first documented that Tie1 is expressed at the earliest stages of lymphangiogenesis in Prox1-positive venous lymphatic endothelial cell (LEC) progenitors. LEC Tie1 expression is maintained throughout embryonic development and persists in postnatal mice. We then generated two lines of Tie1 mutant mice: a hypomorphic allele, which has reduced expression of Tie1, and a conditional allele. Reduction of Tie1 levels resulted in abnormal lymphatic patterning and in dilated and disorganized lymphatic vessels in all tissues examined and in impaired lymphatic drainage in embryonic skin. Homozygous hypomorphic mice also exhibited abnormally dilated jugular lymphatic vessels due to increased production of Prox1-positive LECs during initial lymphangiogenesis, indicating that Tie1 is required for the early stages of normal lymphangiogenesis.
    [Show full text]
  • Discovery of Orphan Receptor Tie1 and Angiopoietin Ligands Ang1 and Ang4 As Novel GAG-Binding Partners
    78 Chapter 3 Discovery of Orphan Receptor Tie1 and Angiopoietin Ligands Ang1 and Ang4 as Novel GAG-Binding Partners 79 3.1 Abstract The Tie/Ang signaling axis is necessary for proper vascular development and remodeling. However, the mechanisms that modulate signaling through this receptor tyrosine kinase pathway are relatively unclear. In particular, the role of the orphan receptor Tie1 is highly disputed. Although this protein is required for survival, Tie1 has been found both to inhibit and yet be necessary for Tie2 signaling. While differing expression levels have been put forth as an explanation for its context-specific activity, the lack of known endogenous ligands for Tie1 has severely hampered understanding its molecular mode of action. Here we describe the discovery of orphan receptor Tie1 and angiopoietin ligands Ang1 and Ang4 as novel GAG binding partners. We localize the binding site of GAGs to the N- terminal region of Tie1, which may provide structural insights into the importance of this interaction regarding the formation of Tie1-Tie2 heterodimerization. Furthermore, we use our mutagenesis studies to guide the generation of a mouse model that specifically ablates GAG-Tie1 binding in vivo for further characterization of the functional outcomes of GAG-Tie1 binding. We also show that GAGs can form a trimeric complex with Ang1/4 and Tie2 using our microarray technology. Finally, we use our HaloTag glycan engineering platform to modify the cell surface of endothelial cells and demonstrate that HS GAGs can potentiate Tie2 signaling in a sulfation-specific manner, providing the first evidence of the involvement of HS GAGs in Tie/Ang signaling and delineating further the integral role of HS GAGs in angiogenesis.
    [Show full text]
  • Tumor Initiating but Differentiated Luminal-Like Breast Cancer Cells Are Highly Invasive in the Absence of Basal-Like Activity
    Tumor initiating but differentiated luminal-like breast cancer cells are highly invasive in the absence of basal-like activity Jiyoung Kima, René Villadsena, Therese Sørlieb,c, Louise Fogha, Signe Z. Grønlunda,d, Agla J. Fridriksdottira, Irene Kuhne, Fritz Rankf,1, Vera Timmermans Wielengaf, Hiroko Solvangb,g, Paul A. W. Edwardsh, Anne-Lise Børresen-Daleb,i, Lone Rønnov-Jessend, Mina J. Bisselle,2, and Ole William Petersena,2 aDepartment of Cellular and Molecular Medicine, Centre for Biological Disease Analysis and Danish Stem Cell Centre, Faculty of Health Sciences, University of Copenhagen, DK-2200 Copenhagen N, Denmark; bDepartment of Genetics, Institute for Cancer Research, Oslo University Hospital Radiumhospitalet, Montebello 0310, Oslo, Norway; cCancer Stem Cell Innovation Center, Oslo University Hospital, Norwegian Radium Hospital, 0310 Oslo, Norway; dCell and Developmental Biology, Department of Biology, University of Copenhagen, DK-2100 Copenhagen Ø, Denmark; eLife Sciences Division, Berkeley National Laboratory, Berkeley, CA 94720; fDepartment of Pathology, Rigshospitalet, DK-2100 Copenhagen Ø, Denmark; gDepartment of Biostatistics, Institute of Basic Medical Science, University of Oslo, 0317 Oslo, Norway; hDepartment of Pathology and Hutchison/MRC Research Centre, University of Cambridge, Cambridge CB2 0X2, United Kingdom; and iK. G. Jebsen Center for Breast Cancer Research, Institute for Clinical Medicine, Faculty of Clinical Medicine, University of Oslo, 0318 Oslo, Norway Contributed by Mina J. Bissell, February 28, 2012 (sent for review January 10, 2012) The majority of human breast cancers exhibit luminal epithelial these contradictions is the concept of tumor cell plasticity, i.e., the differentiation. However, most aggressive behavior, including possibility that differentiated luminal cells must acquire basal-like invasion and purported cancer stem cell activity, are considered traits to become malignant (10–14).
    [Show full text]
  • Alagille Watson Syndrome (JAG1) Sequencing & Deletion/Duplication
    Lab Dept: Anatomic Pathology Test Name: ALAGILLE WATSON SYNDROME (JAG1) SEQUENCING General Information Lab Order Codes: JAG1 Synonyms: Alagille Watson Syndrome; Cholestasis with Peripheral Pulmonary Stenosis; Arteriohepatic Dysplasia; Syndromatic Hepatic Ductular Hypoplasia; ALGS1 CPT Codes: Sequencing: 81407 – Molecular pathology Level 8 Deletion/Duplication- High Density Targeted Array 81406 – Molecular pathology Level 7 Test Includes: Analysis of bi-directional sequencing. Also includes a targeted array CGH analysis with exon-level resolution to evaluate for a deletion or duplication of one exon of this gene. Logistics Test Indications: Alagille Syndrome is one of the major forms of chronic liver disease in children and is an autosomal dominant disorder with high penetrance but variable expressivity. The main clinical findings include cholestatis due to bile duct paucity, a characteristic facial appearance, and cardiovascular, eye and skeletal abnormalities. Cardiovascular findings include tetralogy of Fallot or singular manifestations thereof, peripheral pulmonary artery stenosis, atrial and/or ventricular septal defects, and coarction of the aorta. Butterfly vertebra is the most common skeletal finding. Other findings include narrowing of interpeduncular spaces in the lumbar spine, spina bifida occulta, and short fingers and ulnae. Facial features consist of broad forehead, triangular face, prominent zygomatic arch and moderate hypertelorism. Posterior embryotoxon and retinal pigmentary changes are common opthalmological findings. ALGS1 is caused by mutations in the JAG1 gene. It encodes jagged-1, a ligand for the Notch receptors. Notch proteins are transmembrane receptors and are components of signaling pathways important for cell fate. JAG1 is expressed in the developing heart and other structures affected in Alagille syndrome. Over 90% of patients with Alagille syndrome have a mutation in the JAG1 gene.
    [Show full text]
  • Increased HOXA5 Expression Provides a Selective Advantage for Gain of Whole Chromosome 7 in IDH Wild-Type Glioblastoma
    Downloaded from genesdev.cshlp.org on May 11, 2018 - Published by Cold Spring Harbor Laboratory Press Increased HOXA5 expression provides a selective advantage for gain of whole chromosome 7 in IDH wild-type glioblastoma Patrick J. Cimino,1,2,17 Youngmi Kim,1,17 Hua-Jun Wu,3,4,5 Jes Alexander,1 Hans-Georg Wirsching,1,6 Frank Szulzewsky,1 Ken Pitter,7 Tatsuya Ozawa,1,8 Jiguang Wang,9,10,16 Julio Vazquez,11 Sonali Arora,1 Raul Rabadan,9,10 Ross Levine,12 Franziska Michor,3,4,5,13,14,15 and Eric C. Holland1 1Division of Human Biology, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109, USA; 2Department of Pathology, Division of Neuropathology, University of Washington, Seattle, Washington 98104, USA; 3Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, Harvard T.H. Chan School of Public Health, Boston, Massachusetts 02215, USA; 4Department of Biostatistics, Harvard T.H. Chan School of Public Health, Boston, Massachusetts 02115, USA; 5Department of Stem Cell and Regenerative Biology, Harvard University, Cambridge, Massachusetts 02138, USA; 6Department of Neurology, University Hospital Zurich, Zurich 8091, Switzerland; 7Department of Cancer Biology and Genetics, Memorial Sloan Kettering Cancer Center, New York, New York 10065, USA; 8Division of Brain Tumor Translational Research, National Cancer Center Research Institute, Tokyo 104-0045, Japan; 9Department of Biomedical Informatics, Columbia University, New York, New York 10027, USA; 10Department of Systems Biology, Columbia University, New York,
    [Show full text]
  • Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Long Noncoding RNA ANRIL Promotes Non–Small Cell Lung
    Published OnlineFirst December 12, 2014; DOI: 10.1158/1535-7163.MCT-14-0492 Cancer Biology and Signal Transduction Molecular Cancer Therapeutics Long Noncoding RNA ANRIL Promotes Non–Small Cell Lung Cancer Cell Proliferation and Inhibits Apoptosis by Silencing KLF2 and P21 Expression Feng-qi Nie1, Ming Sun2, Jin-song Yang3, Min Xie2, Tong-peng Xu1, Rui Xia2, Yan-wen Liu2, Xiang-hua Liu2, Er-bao Zhang2, Kai-hua Lu1, and Yong-qian Shu1 Abstract Recent evidence highlights long noncoding RNAs (lncRNA) was increased in NSCLC tissues, and its expression level was as crucial regulators of cancer biology that contribute to essen- significantly correlated with tumor–node–metastasis stages and tial cancer cell functions such as cell proliferation, apoptosis, tumor size. Moreover, patients with high levels of ANRIL and metastasis. In non–small cell lung cancer (NSCLC), several expression had a relatively poor prognosis. In addition, taking lncRNAs' expressions are misregulated and have been nomi- advantage of loss-of-function experiments in NSCLC cells, we nated as critical actors in NSCLC tumorigenesis. LncRNA ANRIL found that knockdown of ANRIL expression could impair cell was first found to be required for the PRC2 recruitment to and proliferation and induce cell apoptosis both in vitro and vivo. silencing of p15INK4B, the expression of which is induced by the Furthermore, we uncover that ANRIL could not repress p15 ATM–E2F1 signaling pathway. Our previous study showed that expression in PC9 cells, but through silencing of KLF2 and P21 ANRIL was significantly upregulated in gastric cancer, and it transcription. Thus, we conclusively demonstrate that lncRNA could promote cell proliferation and inhibit cell apoptosis by ANRIL plays a key role in NSCLC development by associating silencing of miR99a and miR449a transcription.
    [Show full text]
  • Src-Family Kinases Impact Prognosis and Targeted Therapy in Flt3-ITD+ Acute Myeloid Leukemia
    Src-Family Kinases Impact Prognosis and Targeted Therapy in Flt3-ITD+ Acute Myeloid Leukemia Title Page by Ravi K. Patel Bachelor of Science, University of Minnesota, 2013 Submitted to the Graduate Faculty of School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2019 Commi ttee Membership Pa UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE Commi ttee Membership Page This dissertation was presented by Ravi K. Patel It was defended on May 31, 2019 and approved by Qiming (Jane) Wang, Associate Professor Pharmacology and Chemical Biology Vaughn S. Cooper, Professor of Microbiology and Molecular Genetics Adrian Lee, Professor of Pharmacology and Chemical Biology Laura Stabile, Research Associate Professor of Pharmacology and Chemical Biology Thomas E. Smithgall, Dissertation Director, Professor and Chair of Microbiology and Molecular Genetics ii Copyright © by Ravi K. Patel 2019 iii Abstract Src-Family Kinases Play an Important Role in Flt3-ITD Acute Myeloid Leukemia Prognosis and Drug Efficacy Ravi K. Patel, PhD University of Pittsburgh, 2019 Abstract Acute myelogenous leukemia (AML) is a disease characterized by undifferentiated bone-marrow progenitor cells dominating the bone marrow. Currently the five-year survival rate for AML patients is 27.4 percent. Meanwhile the standard of care for most AML patients has not changed for nearly 50 years. We now know that AML is a genetically heterogeneous disease and therefore it is unlikely that all AML patients will respond to therapy the same way. Upregulation of protein-tyrosine kinase signaling pathways is one common feature of some AML tumors, offering opportunities for targeted therapy.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • UC Riverside UC Riverside Electronic Theses and Dissertations
    UC Riverside UC Riverside Electronic Theses and Dissertations Title The Role of AMPK and miR-92a in the Shear Stress Regulation of KLF2 Permalink https://escholarship.org/uc/item/25z876bc Author Wu, Wei Publication Date 2010 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA RIVERSIDE The Role of AMPK and miR-92a in the Shear Stress Regulation of KLF2 A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Cellular, Molecular and Developmental Biology by Wei Wu December 2010 Dissertation Committee: Dr. John Shyy, Chairperson Dr. Ameae Walker Dr. Kathryn Defea Copyright by Wei Wu 2010 ii The Dissertation of Wei Wu is approved: ------------------------------------------ ------------------------------------------ ------------------------------------------ Committee Chairperson University of California, Riverside iii Acknowledgements It is a pleasure to thank those who made this dissertation possible. First of all, I would like to thank CMDB program for giving me the opportunity to pursue my Ph.D degree in UCR. A hearty thanks to Dr. Anthony W. Norman, Dr. Helen Henry and the professors who taught and encouraged me in these past years. I owe my deepest gratitude to my major professor, Dr. John Y-J. Shyy, for his guidance and support. I am also grateful to Dr. Ameae M. Walker and Dr. Kathryn Defea for their valuable discussions and constructive suggestions. I am thankful to all of my colleagues and friends for their generous help and precious discussion on my work. My parents and parents-in-law, thanks for your support and unconditional love. Even though we are thousand of miles away, you were always there whenever I needed you.
    [Show full text]
  • Pan-Cancer Molecular Classes Transcending Tumor Lineage Across 32 Cancer Types, Multiple Data Platforms, and Over 10,000 Cases Fengju Chen1, Yiqun Zhang1, Don L
    Published OnlineFirst February 9, 2018; DOI: 10.1158/1078-0432.CCR-17-3378 Biology of Human Tumors Clinical Cancer Research Pan-Cancer Molecular Classes Transcending Tumor Lineage Across 32 Cancer Types, Multiple Data Platforms, and over 10,000 Cases Fengju Chen1, Yiqun Zhang1, Don L. Gibbons2,3, Benjamin Deneen4,5,6,7, David J. Kwiatkowski8,9, Michael Ittmann10, and Chad J. Creighton1,11,12,13 Abstract Purpose: The Cancer Genome Atlas data resources represent of immune infiltrates were most strongly manifested within a an opportunity to explore commonalities across cancer types class representing 13% of cancers. Pathway-level differences involving multiple molecular levels, but tumor lineage and involving hypoxia, NRF2-ARE, Wnt, and Notch were manifested histology can represent a barrier in moving beyond differences in two additional classes enriched for mesenchymal markers and relatedtocancertype. miR200 silencing. Experimental Design: On the basis of gene expression data, we Conclusions: All pan-cancer molecular classes uncovered classified 10,224 cancers, representing 32 major types, into 10 here, with the important exception of the basal-like breast molecular-based "classes." Molecular patterns representing tissue cancer class, involve a wide range of cancer types and would or histologic dominant effects were first removed computation- facilitate understanding the molecular underpinnings of ally, with the resulting classes representing emergent themes cancers beyond tissue-oriented domains. Numerous biolog- across tumor lineages. ical processes associated with cancer in the laboratory Results: Key differences involving mRNAs, miRNAs, proteins, setting were found here to be coordinately manifested and DNA methylation underscored the pan-cancer classes. One across large subsets of human cancers.
    [Show full text]
  • Multiomics of Azacitidine-Treated AML Cells Reveals Variable And
    Multiomics of azacitidine-treated AML cells reveals variable and convergent targets that remodel the cell-surface proteome Kevin K. Leunga, Aaron Nguyenb, Tao Shic, Lin Tangc, Xiaochun Nid, Laure Escoubetc, Kyle J. MacBethb, Jorge DiMartinob, and James A. Wellsa,1 aDepartment of Pharmaceutical Chemistry, University of California, San Francisco, CA 94143; bEpigenetics Thematic Center of Excellence, Celgene Corporation, San Francisco, CA 94158; cDepartment of Informatics and Predictive Sciences, Celgene Corporation, San Diego, CA 92121; and dDepartment of Informatics and Predictive Sciences, Celgene Corporation, Cambridge, MA 02140 Contributed by James A. Wells, November 19, 2018 (sent for review August 23, 2018; reviewed by Rebekah Gundry, Neil L. Kelleher, and Bernd Wollscheid) Myelodysplastic syndromes (MDS) and acute myeloid leukemia of DNA methyltransferases, leading to loss of methylation in (AML) are diseases of abnormal hematopoietic differentiation newly synthesized DNA (10, 11). It was recently shown that AZA with aberrant epigenetic alterations. Azacitidine (AZA) is a DNA treatment of cervical (12, 13) and colorectal (14) cancer cells methyltransferase inhibitor widely used to treat MDS and AML, can induce interferon responses through reactivation of endoge- yet the impact of AZA on the cell-surface proteome has not been nous retroviruses. This phenomenon, termed viral mimicry, is defined. To identify potential therapeutic targets for use in com- thought to induce antitumor effects by activating and engaging bination with AZA in AML patients, we investigated the effects the immune system. of AZA treatment on four AML cell lines representing different Although AZA treatment has demonstrated clinical benefit in stages of differentiation. The effect of AZA treatment on these AML patients, additional therapeutic options are needed (8, 9).
    [Show full text]