USOO626.1537B1 (12) United States Patent (10) Patent No.: US 6,261,537 B1 Klaveness et al. (45) Date of Patent: *Jul.17, 2001

(54) DIAGNOSTIC/THERAPEUTICAGENTS 5,632,983 5/1997 Tait et al.. HAVING MICROBUBBLES COUPLED TO 5,643,553 * 7/1997 Schneider et al...... 424/9.52 ONE OR MORE VECTORS 5,650,156 7/1997 Grinstaff et al...... 424/400 5,656.211 * 8/1997 Unger et al...... 264/4.1 5,665,383 9/1997 Grinstaff et al. . (75) Inventors: Jo Klaveness; Pál Rongved; Anders 5,690,907 11/1997 Lanza et al...... 424/9.5 Høgset; Helge Tolleshaug, Anne 5,716,594 2/1998 Elmaleh et al. . Naevestad; Halldis Hellebust; Lars 5,733,572 3/1998 Unger et al.. Hoff, Alan Cuthbertson; Dagfinn 5,780,010 7/1998 Lanza et al. . Levhaug, Magne Solbakken, all of 5,846,517 12/1998 Unger. Oslo (NO) 5,849,727 12/1998 Porter et al.. 5,910,300 6/1999 Tournier et al...... 424/9.34 (73) Assignee: Nycomed Imaging AS, Oslo (NO) FOREIGN PATENT DOCUMENTS (*) Notice: This patent issued on a continued pros ecution application filed under 37 CFR 2 145 505 4/1994 (CA). 19 626 530 1/1998 (DE). 1.53(d), and is subject to the twenty year 0 727 225 8/1996 (EP). patent term provisions of 35 U.S.C. WO91/15244 10/1991 (WO). 154(a)(2). WO 93/20802 10/1993 (WO). WO 94/07539 4/1994 (WO). Subject to any disclaimer, the term of this WO 94/28873 12/1994 (WO). patent is extended or adjusted under 35 WO 94/28874 12/1994 (WO). U.S.C. 154(b) by 0 days. WO95/03356 2/1995 (WO). WO95/03357 2/1995 (WO). (21) Appl. No.: 08/960,054 WO95/07072 3/1995 (WO). WO95/15118 6/1995 (WO). (22) Filed: Oct. 29, 1997 WO 96/39149 12/1996 (WO). WO 96/40277 12/1996 (WO). Related U.S. Application Data WO 96/40285 12/1996 (WO). WO 96/41617 12/1996 (WO). (63) Continuation-in-part of application No. 08/958.993, filed on WO 97/23855 7/1997 (WO). Oct. 28, 1997. (60) Provisional application No. 60/049.264, filed on Jun. 7, WO 97/33474 9/1997 (WO). 1997, provisional application No. 60/049,265, filed on Jun. WO 97/41898 11/1997 (WO). 7, 1997, and provisional application No. 60/049.268, filed WO 98/OO172 1/1998 (WO). on Jun. 7, 1997. WO 98/04293 2/1998 (WO). WO 98/19705 5/1998 (WO). (30) Foreign Application Priority Data WO 98/20856 5/1998 (WO). Oct. 28, 1996 (GB) ...... 9622366 WO 98/42384 10/1998 (WO). Oct. 28, 1996 (GB) ...... 9622367 OTHER PUBLICATIONS Oct. 28, 1996 (GB) ...... 9622368 Jan. 15, 1997 (GB) ...... 97OO699 Worthington Enzyme Manual, enzymes, enzyme reagents, Apr. 24, 1997 (GB) ...... 9708265 Jun. 6, 1997 (GB) ...... 9711842 related biochemicals; Worthington Biochemical Corpora Jun. 6, 1997 (GB) ...... 9711846 tion, 1972. Thomas Fritzsch, et al., “Microparticle Prepartions Made (51) Int. Cl." ...... A61B 8/00; A61 B 5/055; From Biodegradable Copolymers”, Apr. 1999. A61K 51/00; A61K 49/04; A61K 9/14 U.S. application No. 08/640,464, Unger, filed May 1, 1996. Muzykantov et al., J. Nuclear Medicine, 35(8): 1358–1365 (52) U.S. Cl...... 424/9.52; 424/9.32; 424/9.4; (1994). 424/1.29; 424/9.6; 424/489 Klibanov et al., Acta Radiologica, 38(Supp. 412): 113-120 (58) Field of Search ...... 424/9.52, 9.51, (1997). 424/489, 490, 498, 502, 450, 9.3, 9.32, * cited by examiner 9.4, 1.29, 9.6; 264/4, 4.1, 5; 427/213, 213.3, 213.36; 428/402, 402.21; 530/300, 326, Primary Examiner Michael G. Hartley 328; 600/458, 441 (74) Attorney, Agent, or Firm-Bacon & Thomas; Richard (56) References Cited E. Fichter U.S. PATENT DOCUMENTS (57) ABSTRACT 4,927,916 5/1990 Matsueda et al. . Targetable diagnostic and/or therapeutically active agents, 5,013,556 5/1991 Woodle et al. . e.g. ultrasound contrast agents, having reporters comprising 5,154,924 10/1992 Friden. gas-filled microbubbles stabilised by monolayers of film 5,198.424 3/1993 McEver. forming Surfactants, the reporter being coupled or linked to 5,356,633 10/1994 Woodle et al.. at least one vector. 5,505,932 4/1996 Grinstaff et al. . 5,534.241 7/1996 Torchillin et al. . 5,612,057 3/1997 Lanza et al. . 22 Claims, 2 Drawing Sheets U.S. Patent Jul. 17, 2001 Sheet 1 of 2 US 6,261,537 B1

256 Gm: 15.62 CW. 3439 144-1023) 18430 (92.2/)

U.S. Patent Jul. 17, 2001 Sheet 2 of 2 US 6,261,537 B1

18880 (94.4/)

FIT Clog F. G. 2. US 6,261,537 B1 1 2 DIAGNOSTIC/THERAPEUTICAGENTS chosen target, or it may bind only Selectively, having affinty HAVING MICROBUBBLES COUPLED TO also for a limited number of other molecules/structures, ONE OR MORE VECTORS again creating possible background problems. There is a limited body of prior art relating to targeted Applicants hereby claim benefit under 35 U.S.C. S119(e) 5 ultrasound contrast agents. Thus, for example, US-A- of provisional application No. 60/049,264 filed Jun. 7, 1997, 553 1980 is directed to systems in which the reporter com provisional application No. 60/049,265 filed Jun. 7, 1997 prises an aqueous Suspension of air or gas microbubbles and provisional application No. 60/049,268 also filed Jun. 7, Stabilised by one or more film-forming Surfactants present at 1997 and is a continuation-in-part of application Ser. No. least partially in lamellar or laminar form, said Surfactant(s) 08/958,993, filed Oct. 28, 1997, pending. being bound to one or more vectors comprising “bioactive This invention relates to diagnostic and/or therapeuti Species designed for Specific targeting purposes'. It is Stated cally active agents, more particularly to diagnostic and/or that the microbubbles are not directly encapsulated by therapeutically active agents incorporating moieties which Surfactant material but rather that this is incorporated in interact with or have affinity for sites and/or structures liquid-filled liposomes which stabilise the microbubbles. It within the body So that diagnostic imaging and/or therapy of 15 will be appreciated that lamellar or laminar Surfactant mate particular locations within the body may be enhanced. Of rial Such as phospholipids present in Such liposomes will particular interest are diagnostic agents for use in ultrasound inevitably be present in the form of one or more lipid imaging, which are hereinafter referred to as targeted ultra bilayers with the lipophilic tails “back-to-back” and the Sound contrast agents. hydrophilic heads both inside and outside (see e.g. It is well known that ultrasound imaging comprises a Schneider, M. on "Liposomes as drug carriers: 10 years of potentially valuable diagnostic tool, for example in Studies research” in Drug targeting, Nyon, Switzerland, Oct. 3-5, of the vascular System, particularly in cardiography, and of 1984, Buri, P. and Gumma, A. (Ed), Elsevier, Amsterdam tissue microvasculature. A variety of contrast agents has 1984). been proposed to enhance the acoustic images So obtained, EP-A-0727225 describes targeted ultrasound contrast including Suspensions of Solid particles, emulsified liquid 25 agents in which the reporter comprises a chemical having a droplets, gas bubbles and encapsulated gases or liquids. It is Sufficient vapour pressure Such that a proportion of it is a gas generally accepted that low density contrast agents which at the body temperature of the subject. This chemical is are easily compressible are particularly efficient in terms of asSociated with a Surfactant or albumin carrier which the acoustic backScatter they generate, and considerable includes a protein-, peptide- or carbohydrate-based cell interest has therefore been shown in the preparation of adhesion molecule ligand as vector. The reporter moieties in gas-containing and gas-generating Systems. Such contrast agents correspond to the phase shift colloid Gas-containing contrast media are also known to be systems described in WO-A-9416739; it is now recognised effective in magnetic resonance (MR) imaging, e.g. as that administration of Such phase shift colloids may lead to susceptibility contrast agents which will act to reduce MR generation of microbubbles which grow uncontrollably, Signal intensity. Oxygen-containing contrast media also rep 35 possibly to the extent where they cause potentially danger resent potentially useful paramagnetic MR contrast agents. ouS embolisation of, for example, the myocardial vascula Furthermore, in the field of X-ray imaging it has been ture and brain (see e.g. Schwarz, Advances in Echo-Contrast observed that gases Such as carbon dioxide may be used as 1994(3)], pp. 48–49). negative oral contrast agents or intravascular contrast WO-A-9320802 proposes that tissue-specific ultrasonic agents. 40 image enhancement may be achieved using acoustically The use of radioactive gases, e.g. radioactive isotopes of reflective oligolamellar liposomes conjugated to tissue inert gases Such as Xenon, has also been proposed in Specific ligands Such as antibodies, peptides, lectins etc. The Scintigraphy, for example for blood pool imaging. liposomes are deliberately chosen to be devoid of gas and So Targeted ultrasound contrast agents may be regarded as will not have the advantageous echogenic properties of comprising (i) a reporter moiety capable of interacting with 45 gas-based ultrasound contrast agents. Further references to ultrasound irradiation to generate a detectable signal; (ii) one this technology, e.g. in targeting to fibrin, thrombi and or more vectors having affinity for particular target Sites atherosclerotic areas are found in publications by and/or structures within the body, e.g. for Specific cells or Alkanonyuksel, H. et al. in J. Pharm. Sci. (1996) 85(5), areas of pathology; and (iii) one or more linkers connecting 486-490, J. Am. Coll. Cardiol. (1996)27(2) Suppl A, 298A; said reporter and vector(s), in the event that these are not 50 and Circulation, 68 Sci. Sessions, Anaheim Nov. 13-16, directly joined. 1995. The molecules and/or Structure to which the agent is There is also a number of publications concerning ultra intended to bind will hereinafter be referred to as the target. Sound contrast agents which refer in passing to possible use In order to obtain specific imaging of or a therapeutic effect of monoclonal antibodies as vectors without giving Signifi at a Selected region/structure in the body the target must be 55 cant practical detail and/or to reporters comprising materials present and available in this region/structure. Ideally it will which may be taken up by the reticuloendothelial System be expressed only in the region of interest, but usually will and thereby permit image enhancement of organs Such as the also be present at other locations in the body, creating liver-see, for example WO-A-9300933, WO-A-94.01140, possible background problems. The target may either be a WO-A-9408.627, WO-A-9428874, U.S. Pat. Nos. 5,088, defined molecular species (i.e. a target molecule) or an 60 499, 5,348,016 and 5,469,854. unknown molecule or more complex structure (i.e. a target The present invention is based on the finding that gas Structure) which is present in the area to be imaged and/or filled microbubbles stabilised by monolayers of film treated, and is able to bind Specifically or Selectively to a forming Surfactant material are particularly useful reporters given vector molecule. in targeted diagnostic and/or therapeutic agents. Thus, for The vector is attached or linked to the reporter moiety in 65 example, the flexibility and deformability of such thin order to bind these moieties to the region/structure to be monolayer membranes Substantially enhances the echoge imaged and/or treated. The vector may bind Specifically to a nicity of Such reporters relative to liposome Systems con US 6,261,537 B1 3 4 taining lipid bilayerS or multiples of Such bilayers. This may with CD71 FITC-labelled anti-transferrin antibody (filled permit the use of Very low doses of the reporter material to curve, right) showing that 92% of the population fluoresce. achieve high ultrasound contrast efficacy, with consequent FIG. 2: Flow cytometry data-comparison with negative safety benefits. control bubbles (left curve). 98% of the bubbles were Thus according to one aspect of the present invention calculated to be fluorescent. there is provided a targetable diagnostic and/or therapeuti Any biocompatible gas may be present in the reporter, the cally active agent, e.g. an ultrasound contrast agent, com term "gas' as used herein including any Substances prising a Suspension in an aqueous carrier liquid, e.g. an (including mixtures) Substantially or completely in gaseous injectable carrier liquid, of a reporter comprising gas-filled (including vapour) form at the normal human body tem microbubbles stabilised by monolayers of film-forming Sur perature of 37 C. The gas may thus, for example, comprise factant material, Said agent further comprising at least one air; nitrogen, OXygen; carbon dioxide, hydrogen; an inert gas VectOr. Such as helium, argon, Xenon or krypton, a Sulphur fluoride The term “monolayer” is used herein to denote that the Such as Sulphur hexafluoride, disulphur decafluoride or amphiphilic Surfactant moieties form monolayer films or trifluoromethylsulphur pentafluoride, Selenium hexafluo membranes Similar to So-called Langmuir-Blodgett films at ride; an optionally halogenated Silane Such as methylsilane the gas-liquid interfaces, with the lipophilic parts of the 15 or dimethylsilane; a low molecular weight hydrocarbon (e.g. amphiphiles aligning towards the gas phase and the hydro containing up to 7 carbon atoms), for example an alkane philic parts interacting with the water phase. Such as methane, ethane, a propane, a butane or a pentane, As indicated in WO-A-9729783, it is believed that elec a cycloalkane Such as cyclopropane, cyclobutane or troStatic repulsion between charged phospholipid mem cyclopentane, an alkene Such as ethylene, propene, propa branes encourages the formation of Stable and Stabilising diene or a butene, or an alkyne Such as acetylene or propyne; monolayers at microbubble-carrier liquid interfaces. The an ether Such as dimethyl ether; a ketone; an ester, a flexibility and deformability of such thin membranes are halogenated low molecular weight hydrocarbon (e.g. con believed to enhance the echogenicity of products according taining up to 7 carbon atoms); or a mixture of any of the to the invention disclosed therein relative to gas-filled lipo foregoing. Advantageously at least Some of the halogen Somes comprising one or more lipid bilayers. The amount of 25 atoms in halogenated gases are fluorine atoms; thus biocom phospholipid used to Stabilise Such microbubble-containing patible halogenated hydrocarbon gases may, for example, be aqueous Suspensions may be as low as that necessary for Selected from bromo chloro difluorome thane, formation of Single monolayers of Surfactant around each chlorodifluoromethane, dichlorodifluoromethane, gas microbubble, the resulting film-like Structure Stabilising bromotrifluoromethane, chlorotrifluoromethane, the microbubbles against collapse or coalescence. chloropentafluoroethane, dichlorote trafluoroethane, Microbubbles with a liposome-like surfactant bilayer are chlorotrifluoroethylene, fluoroethylene, ethylfluoride, 1,1- believed not to be obtained when such low phospholipid concentrations are used. difluoroethane and perfluorocarbons, e.g. perfluoroalkanes One advantageous embodiment of the invention is based Such as perfluorome thane, perfluoroethane, on the additional finding that limited adhesion to targets is perfluoropropanes, perfluorobutanes (e.g. perfluoro-n- a highly useful property of diagnostic and/or therapeutically 35 butane, optionally in admixture with other isomerS Such as active agents, which property may be achieved using vectors perfluoro-iso-butane), perfluoropentanes, perfluorohexanes giving temporary retention rather than fixed adhesion to a and perfluoroheptane S; perfluoroalkenes Such as target. Thus Such agents, rather than being fixedly retained perfluoropropene, perfluorobutenes (e.g. perfluorobut-2- at Specific Sites, may for example effectively exhibit a form ene) and perfluorobutadiene; perfluoroalkynes Such as of retarded flow along the vascular endothelium by virtue of 40 perfluorobut-2-yne; and perfluorocycloalkanes Such as their transient interactions with endothelial cells. Such perfluorocyclobutane, perfluoromethylcyclobutane, agents may thus become concentrated on the walls of blood perfluoro dimethylcyclobutane S, vessels, in the case of ultrasound contrast agents providing perfluorotrimethylcyclobutanes, perfluorocyclopentane, enhanced echogenicity thereof relative to the bulk of the perfluoro methylcyclope ntane, bloodstream, which is devoid of anatomical features. They 45 perfluorodimethylcyclopentanes, perfluorocyclohexane, therefore may permit enhanced imaging of the capillary perfluoromethylcyclohexane and perfluorocycloheptane. System, including the microvasculature, and So may facili Other halogenated gases include methyl chloride, fluori tate distinction between normal and inadequately perfused nated (e.g. perfluorinated) ketones Such as perfluoroacetone tissue, e.g. in the heart, and may also be useful in Visualising and fluorinated (e.g. perfluorinated) etherS Such as perfluo Structures Such as Kupffer cells, thrombi and atherosclerotic 50 rodiethyl ether. The use of perfluorinated gases, for example lesions or for visualising neo-vascularised and inflamed Sulphur hexafluoride and perfluorocarbons Such as tissue areas. The present invention is particularly Suited to perfluoropropane, perfluorobutanes and perfluoropentanes, imaging changes which occur in normal blood vessels may be particularly advantageous in View of the recognised Situated in areas of tissue necrosis. high stability in the bloodstream of microbubbles containing In a further embodiment of the present invention, one or 55 Such gases. more vectors may be attached to or included within the The gas may comprise a Substance Such as butane, reporter in a manner Such that the vectors are not readily cyclobutane, n-pentane, is opentane, neopentane, exposed to the target or target receptors. Increased tissue cyclopentane, perfluoropentane, perfluorocyclopentane, per Specificity may therefore be achieved by applying an addi fluorohexane or a mixture containing one or more Such gases tional process to expose the vectors, for example by expos 60 which is liquid at handling or processing temperatures but ing the agent after administration to external ultrasound So gaseous at body temperature, e.g. as described in the afore as to modify the diffusibility of the moieties containing the mentioned WO-A-9416739, since the film-forming surfac VectOrS. tant monolayers in reporter units according to the invention may Stabilise the resulting microbubbles against uncontrol BRIEF DESCRIPTION OF THE FIGURES 65 lable growth. FIG. 1: Flow cytometric comparison of negative control In principle, any appropriate film-forming Surfactant may microbubbles of DSPS (left curve) with bubbles conjugated be employed to form the gas-encapsulating monolayers, US 6,261,537 B1 S 6 including non-polymeric and non-polymerisable wall pholipids may advantageously be used in admixture with forming Surfactant materials, e.g. as described in WO-A- charged phospholipids containing two fatty acyl groups. 9521631; polymer Surfactant material, e.g. as described in Phosphatidylserines represent particularly preferred phos WO-A-9506518; and phospholipids, e.g. as described in pholipids of use in agents according to the invention and WO-A-9211873, WO-A-9217212, WO-A-9222247, WO-A- preferably constitute a Substantial part, e.g. at least 80% of 9428780, WO-A-95.03835 or WO-A-9729783. Advanta the phospholipid content thereof, for example 85-92%. geously 75%, preferably substantially all, of the film While we do not wish to be bound by theoretical forming Surfactant present in agents according to the considerations, it may be that ionic bridging between the invention is incorporated into monolayers at the gas-liquid carboxyl and amino groups of adjacent Serine moieties interfaces. contributes to the stability of such reporter systems. Pre Representative examples of useful phospholipids include ferred phosphatidylserines include Saturated (e.g. hydroge lecithins (i.e. phosphatidylcholines), for example natural nated or synthetic) natural phosphatidylserine and Synthetic lecithins Such as egg yolk lecithin or Soya bean lecithin and distearoylphosphatidylserine, dipalmitoylphosphati Synthetic or SemiSynthetic lecithin S. Such as dylserine and diarachidoylphosphatidylserine. dimyristoylphosphatidylcholine, dipalmitoylphosphatidyl Other potentially useful lipids include phosphatidyletha choline or distearoylphosphatidylcholine; phosphatidic 15 nolamines optionally admixed with one or more lipids Such acids; phosphatidylethanolamines, phosphatidylserines, as Stearic acid, palmitic acid, Stearylamine, palmitylamine, phosphatidylglycerols, phosphatidylinositols, cardiolipins, cholesterol, bisalkylglycerols, Sphingoglycolipids, Synthetic Sphingomyelins, fluorinated analogues of any of the fore lipids such as N,N-dimethyl-N-octade cyl-1- going, mixtures of any of the foregoing and mixtures with octadecanammonium chloride or bromide (DODAC, other lipids Such as cholesterol. DODAB), and/or maleic acid bisalkylesters. It has been found that the use of phospholipids predomi Additional exemplary lipids which may be used to pre nantly (e.g. at least 75%) comprising molecules individually pare gas-containing contrast agents include fatty acids, bearing net overall charge may be particularly Stearic acid, palmitic acid, 2-n-hexadecylstearic acid, oleic advantageous, especially when used as essentially the Sole 25 acid and other acid-containing lipid structures. Such lipid amphiphilic component of the reporter, and may convey Structures may be coupled by amide bond formation to valuable benefits in terms of parameterS Such as product amino acids containing one or more amino groups; the stability and acoustic properties. Without wishing to be resulting lipid-modified amino acids (e.g. dipalmitoyllysine bound by theoretical considerations, it is believed that or distearoyl-2,3-diaminopropionic acid) may be useful pre electroStatic repulsion between charged phospholipid mem cursors for the attachment of functionalised Spacer elements branes may encourage the formation of Stable monolayers at having coupling sites for conjugation of one or more vector the gas-liquid interfaces, as noted above, the flexibility and molecules. deformability of such thin membranes will enhance the Further useful Stabilisers include lipopeptides comprising echogenicity of reporters used in accordance with the inven a lipid attached to a peptide linker portion which is Suitably tion relative to gas-filled liposomes comprising one or more 35 functionalised for coupling to one or more vector molecules. lipid bilayers. A particular preference is the inclusion of a positively The use of charged phospholipids may also provide charged peptide linker element (e.g. comprising two or more reporters with advantageous properties regarding, for lysine residues) capable of anchoring through electrostatic example, Stability, dispersibility and resistance to coales interaction with reporter microbubbles stabilised by nega cence without recourse to additives Such as further Surfac 40 tively charged phospholipid or other Surfactant membranes. tants and/or Viscosity enhancers, thereby ensuring that the Another embodiment of the invention comprises func number of components administered to the body of a Subject tionalised microbubbles carrying one or more reactive upon injection of the contrast agents is kept to a minimum. groups for non-Specific reaction with receptor molecules Thus, for example, the charged Surfaces of the microbubbles located on cell Surfaces. Microbubbles comprising a thiol may minimise or prevent their aggregation as a result of 45 moiety, for example, may bind to cell Surface receptors via electroStatic repulsion. disulphide eXchange reactions. The reversible nature of Such Desirably at least 75%, preferably substantially all of reactions means that microbubble flow may be controlled by phospholipid material used in reporters in agents of the altering the redox environment. Similarly, functionalised invention consists of molecules bearing a net Overall charge microbubbles with membranes comprising activated esters under conditions of preparation and/or use, which charge 50 Such as N-hydroxySuccinimide esters may be used to react may be positive or, more preferably, negative. Representa with amino groups found on a multiplicity of cell Surface tive positively charged phospholipids include esters of phos molecules. phatidic acids Such as dipalmitoylphosphatidic acid or dis Previously proposed microbubble-containing contrast tearoylphosphatidic acid with aminoalcohols Such as agents based on phospholipids, for example as described in hydroxyethylethylenediamine. Examples of negatively 55 WO-A-9409829, are typically prepared by contacting pow charged phospholipids include naturally occurring (e.g. Soya dered Surfactant, e.g. freeze-dried preformed liposomes or bean or egg yolk derived), Semisynthetic (e.g. partially or freeze-dried or Spray-dried phospholipid Solutions, with air fully hydrogenated) and Synthetic phosphatidylserines, or other gas and then with aqueous carrier, agitating to phosphatidylglycerols, phosphatidylinositols, phosphatidic generate a microbubble Suspension which must then be acids and cardiolipins. The fatty acyl groups of Such phos 60 administered shortly after its preparation. Such processes, pholipids will typically each contain about 14–22 carbon however, Suffer the disadvantages that Substantial agitational atoms, for example as in palmitoyland Stearoyl groups. LySo energy must be imparted to generate the required dispersion forms of Such charged phospholipids are also useful in and that the size and size distribution of the microbubbles accordance with the invention, the term “lySo' denoting are dependent on the amount of energy applied and So phospholipids containing only one fatty acyl group, this 65 cannot in practice be controlled. preferably being ester-linked to the 1-position carbon atom The reporters or agents according to the present invention, of the glyceryl moiety. Such lySo forms of charged phos on the other hand, may advantageously be prepared by US 6,261,537 B1 7 8 generating a gas microbubble dispersion in an appropriate The use of charged phospholipids may also be of advan Surfactant (e.g. phospholipid)-containing aqueous medium, tage in that they will contain functional groupS Such as which may if desired previously have been autoclaved or carboxyl or amino which permit ready linking of Vectors, if otherwise Sterilised, and then, preferably after washing desired by way of linking units. It should be noted that other and/or size fractionation of the thus-formed microbubbles, functional groups may also be incorporated into Such Sys Subjecting the dispersion to lyophilisation, e.g. in the pres tems by mixing a lipid containing a desired functional group ence of one or more cryoprotectants/lyoprotectants, to yield with the film-forming Surfactant prior to microbubble gen a dried product which is readily reconstitutable in water/ eration. aqueous Solutions to generate consistently reproducible It is generally unnecessary to incorporate additives Such microbubble dispersions. This process is described in as emulsifying agents and/or Viscosity enhancerS Such as are greater detail in WO-A-9729783, the contents of which are commonly employed in many existing contrast agent for incorporated herein by reference; the ability to remove mulations into agents of the invention. AS noted above, this bubbles of unwanted size and exceSS Surfactant material is of advantage in keeping to a minimum the number of render this process of Substantial advantage over processes components administered to the body of a Subject and Such as those described in the aforementioned WO-A- 15 ensuring that the Viscosity of the agents is as low as possible. 9409829 and in prior art such as WO-A-9608234 (where Since preparation of the agents typically involves a freeze bubbles are generated on Site prior to injection by Shaking a drying Step as discussed above, it may however be advan Suspension of different phospholipids and Viscosity enhanc tageous to include a cryoprotectant/lyoprotectant or bulking erS Such as propylene glycol and glycerol). agent, for example an alcohol, e.g. an aliphatic alcohol Such The above-described process may be used to generate as t-butanol; a polyol Such as glycerol, a carbohydrate, e.g. reporter microbubbles with a very narrow size distribution, a Sugar Such as Sucrose, mannitol, trehalose or a e.g. Such that over 90% (e.g. at least 95%, preferably at least cyclodextrin, or a polysaccharide Such as dextran; or a 98%) of the microbubbles have volume mean diameter in polyglycol Such as polyethylene glycol. The use of physi the range 1-7 um and less than 5% (e.g. not more than 3%, ologically well-tolerated SugarS Such as Sucrose is preferred. preferably not more than 2%) of the microbubbles have 25 Lyophilised dried products prepared as described above Volume mean diameter above 7 um. The Washing Step may are especially readily reconstitutable in water, requiring only be used to ensure that the reporter is substantially free of minimal agitation Such as may, for example, be provided by unwanted components Such as exceSS lipids or Viscosity gentle hand-shaking for a few Seconds. The size of the enhancers. Agents containing reporters prepared in this way microbubbles So generated is consistently reproducible and may exhibit the following advantages over prior art contrast is independent of the amount of agitational energy applied, agent materials: in practice being determined by the size of the microbubbles Echogenicity per dose may be greatly enhanced since formed in the initial microbubble dispersion, Surprisingly Substantially all of the Surfactant material participate in this size parameter is Substantially maintained in the lyo stabilisation of the microbubbles as monolayers. In vivo philised and reconstituted product. Thus, Since the Size of the ultrasound tests in dogs have shown that ultrasound contrast 35 microbubbles in the initial dispersion may readily be con agents prepared as above may produce an increase in trolled by process parameterS Such as the method, Speed and backScattered signal intensity from the myocardium of 15 duration of agitation, the final microbubble size may readily dB following intravenous injection of doses as low as 0.1 ul be controlled. microbubbles/kg body weight. The lyophilised dried products have also proved to be Safety in Vivo is improved for the same reasons, Since 40 Storage Stable for at least Several months under ambient Such agents may, for example, be administered in doses Such conditions. The microbubble dispersions generated upon that the amount of phospholipid injected is as low as 0.1-10 reconstitution in water are stable for at least 8 hours, tug/kg body weight, e.g. 1–5 ug/kg. The use of Such low permitting considerable flexibility as to when the dried levels of Surfactant may clearly be of Substantial advantage 45 product is reconstituted prior to injection. in minimising possible toxic side effects. The high efficacy of these preferred reporters may make The high efficacy/dose ratio is also particularly advanta it possible to use smaller bubbles than usual while still geous in targeting applications, Since it is generally under generating ultrasound contrast effects Significantly above the stood that rather low amounts of reporter will accumulate at minimum detection levels of current ultrasound imaging Sites of interest when using products comprising vectors 50 equipment. Such Smaller bubbles have potential advantages having affinity for Such sites. These preferred reporters Such as reduced clogging of vessels, longer circulation according to the invention may therefore considerably times, greater ability to reach targets, and lower accumula improve contrast at Sites of interest compared to known tion in lungs or other non-target organs, and their use and targetable ultrasound contrast agents. Their high efficacy agents containing them constitute further features of the may effectively make it possible to “See' Single 55 invention. microbubbles using ultrasound, giving a Sensitivity close to It may also be possible to use such smaller bubbles to or potentially even higher than that of Scintigraphy, which exploit the enhanced ultrasound contrast effects of bubble currently is probably the most useful technique in targeting, clusters. It is known from theory that the ultrasound contrast although the resolution in Scintigraphic pictures is not effect of a specific number of bubbles with total volume V impressive. 60 in a dilute dispersion increaseS when the bubbles aggregate A particular advantage of phosphatidylserine-based to form a larger gas phase with the same total Volume V. It agents is their biocompatibility; thus no acute toxic effects may therefore be possible to use small bubbles which give Such as changes in blood preSSure or heart rate have been Substantially no ultrasound contrast until they are clustered observed in animal tests on dogs injected with intravenous (as may occur in target areas in preference to non-target sites boluses of phosphatidylserine-based contrast agents pre 65 having low densities of target molecules). Small bubbles pared as described above at doses of up to ten times a normal may also be designed to fuse, e.g. through interbubble imaging dose. binding promoted by interaction with the target, So as to US 6,261,537 B1 9 10 enhance contrast in target areas. Interbubble crosslinking membranes. Thus, the therapeutic compound may be linked and consequent clustering may also be effected if the to a part of the membrane, for example through covalent or reporter, in addition to carrying a vector leading to retention ionic bonds, or may be physically mixed into the Stabilising at Specific Sites, has unreacted linker moieties capable of material, particularly if the drug has similar polarity or reaction with functional groups on other bubbles. 5 Solubility to the membrane material, So as to prevent it from Within the context of the present invention, the reporter leaking out of the product before it is intended to act in the unit will usually remain attached to the vectors. However, in body. The release of the drug may be initiated merely by one type of targeting procedure, Sometimes called “pre wetting contact with blood following administration or as a targeting, the vector (often a monoclonal antibody) is consequence of other internal or external influences, e.g. administered alone; Subsequently the reporter is dissolution processes catalyzed by enzymes or the use of of administered, coupled to a moiety which is capable of ultrasound. The destruction of gas-containing microparticles Specifically binding the pre-targeting vector molecule (when using external ultrasound is a well known phenomenon in the pre-targeting vector is an antibody, the reporter may be respect of ultrasound contrast agents, e.g. as described in coupled to an immunoglobulin-binding molecule, Such as WO-A-9325241; the rate of drug release may be varied protein A or an anti-immunoglobulin antibody). The advan 15 depending on the type of therapeutic application, using a tage of this protocol is that time may be allowed for Specific amount of ultrasound energy from the transducer. elimination of the vector molecules that do not bind their The therapeutic may be covalently linked to the encap targets, Substantially reducing the background problems that Sulating membrane Surface using a Suitable linking agent, are connected with the presence of an excess of reporter e.g. as described herein. Thus, for example, one may initially vector conjugate. Within the context of the present prepare a phospholipid or lipopeptide derivative to which invention, pre-targeting with one Specific vector might be the drug is bonded through a biodegradable bond or linker, envisaged, followed by reporter units that are coupled to and then incorporate this derivative into the material used to another vector and a moiety which binds the first vector. prepare the reporter, as described above. Again in the context of the present invention, for example Representative therapeutics Suitable for use in the present in assessment of blood perfusion rates in targeted areas Such 25 drug delivery compositions include any known therapeutic as the myocardium, it is of interest to measure the rate at drugs or active analogues thereof containing thiol groups which contrast agents bound to the target are displaced or which may be coupled to thiol-containing microbubbles released therefrom. This may be achieved in a controlled under oxidative conditions yielding disulphide groups. In manner by administration of an additional vector and/or combination with a vector or vectorS Such drug/vector other Substance able to displace or release the contrast agent modified microbubbles may be allowed to accumulate in from its target. target tissue; administration of a reducing agent Such as Ultrasound imaging modalities which may be used in reduced glutathione may then liberate the drug molecule accordance with the invention include two- and three from the targeted microbubble in the vicinity of the target dimensional imaging techniques Such as B-mode imaging cell, increasing the local concentration of the drug and (for example using the time-varying amplitude of the signal 35 enhancing its therapeutic effect. Alternatively the composi envelope generated from the fundamental frequency of the tion may initially be prepared without the therapeutic, which emitted ultrasound pulse, from Sub-harmonics or higher may then be coupled to or coated on the microbubbles harmonics thereof or from Sum or difference frequencies immediately prior to use; thus, for example, a therapeutic derived from the emitted pulse and Such harmonics, images may be added to a Suspension of microbubbles in aqueous generated from the fundamental frequency or the Second 40 media and Shaken in order to attach or adhere the therapeutic harmonic thereof being preferred), colour Doppler imaging to the microbubbles. and Doppler amplitude imaging, and combinations of the Other drug delivery systems include vector-modified two latter with any of the above modalities. Surprisingly phospholipid membranes doped with lipopeptide Structures excellent Second harmonic Signals have been obtained from comprising a poly-L-lysine or poly-D-lysine chain in com targeted monolayer-Stabilised microSpheres in accordance 45 bination with a targeting vector. Applied to gene therapy/ with the present invention. To reduce the effects of antisense technologies with particular emphasis on receptor movement, Successive images of tissueS Such as the heart or mediated drug delivery, the microbubble carrier is kidney may be collected with the aid of suitable synchro condensed with DNA or RNA via elecrostatic interaction nisation techniques (e.g. gating to the ECG or respiratory with the cationic polylysine. This method has the advantage movement of the Subject). Measurement of changes in 50 that the vector or vectors used for targeted delivery are not resonance frequency or frequency absorption which accom directly attached to the polylysine carrier moiety. The polyl pany arrested or retarded microbubbles may also usefully be ySine chain is also anchored more tightly in the microbubble made to detect the contrast agent. membrane due to the presence of the lipid chains. The use The present invention provides a tool for therapeutic drug 55 of ultrasound to increase the effectiveness of delivery is also delivery in combination with vector-mediated direction of considered useful. the product to the desired site. By “therapeutic' or “drug” is Alternatively free polylysine chains are firstly modified meant an agent having a beneficial effect on a specific with drug or vector molecules then condensed onto the disease in a living human or non-human animal. Whilst negative Surface of targeted microbubbles. combinations of drugs and ultrasound contrast agents have 60 Representative and non-limiting examples of drugs useful been proposed in, for example, WO-A-9428873 and WO-A- in accordance with the invention include antineoplastic 9507072, these products lack vectors having affinity for agents Such as Vincristine, vinblastine, Vindesline, buSulfan, particular sites and thereby show comparitively poor Specific chlorambucil, Spiroplatin, cisplatin, carboplatin, retention at desired SiteS prior to or during drug release. methotrexate, adriamycin, mitomycin, bleomycin, cytosine Therapeutic compounds used in accordance with the 65 arabinoside, arabinosyladenine, mercaptopurine, mitotane, present invention may be encapsulated in the interior of the procarbazine, dactinomycin (antinomycin D), daunorubicin, microbubbles or attached to or incorporated in the Stabilising doxorubic in hydrochloride, taxol, plicamycin, US 6,261,537 B1 11 12 aminoglutethimide, estramustine, flutamide, leuprolide, amine hydrochloride, methohexital Sodium or thiopental and megestrol acetate, tamoxifen, teStolactone, triloStane, amsa pharmaceutically acceptable Salts (e.g. acid addition salts crine (m-AMSA), asparaginase (L-asparaginase), etoposide, such as the hydrochloride or hydrobromide or base salts interferon a-2a and 2b, blood products Such as hematopor Such as Sodium, calcium or magnesium salts) or derivatives phyrins or derivatives of the foregoing, biological response (e.g. acetates) thereof. Other examples of therapeutics modifierS Such as muramylpeptides, antifungal agents Such include genetic material Such as nucleic acids, RNA, and as ketoconazole, nyStatin, griseofulvin, flucytosine, micona DNA of natural or Synthetic origin, including recombinant Zole or amphotericin B; hormones or hormone analogues RNA and DNA. DNA encoding certain proteins may be used Such as growth hormone, melanocyte Stimulating hormone, in the treatment of many different types of diseases. For estradiol, beclomethasone dipropionate, betamethasone, example, tumor necrosis factor or interleukin-2 genes may cortis one acetate, de Xame thaSone, flu niSolide, be provided to treat advanced cancers, thymidine kinase hydrocortisone, methylprednisolone, paramethasone genes may be provided to treat Ovarian cancer or brain acetate, prednisolone, prednisone, triamcinolone or fluidro tumors, interleukin-2 genes may be provided to treat cortisone acetate; Vitamins Such as cyanocobalamin or ret neuroblastoma, malignant melanoma or kidney cancer; and inoids, enzymes Such as alkaline phosphatase or manganese 15 interleukin-4 genes may be provided to treat cancer. Superoxide dismutase; antiallergic agents Such as amelex Lipophilic derivatives of drugs linked to the microbubble anox, inhibitors of tissue factor Such as monoclonal anti membrane through hydrophobic interactions may exhibit bodies and Fab fragments thereof, Synthetic peptides, non therapeutic effects as part of the microbubble or after release peptides and compounds downregulating tissue factor from the microbubble, e.g. by use of ultrasound. If the drug expression; inhibitors of platelets such as GPIa, GPIb and does not possess the desired physical properties, a lipophilic GPIb-IIIa, ADP receptors, thrombin receptors, von Will group may be introduced for anchoring the drug to the ebrand factor, prostaglandins, aspirin, ticlopidin, clopigogrel membrane. Preferably the lipophilic group should be intro and reopro; inhibitors of coagulation protein targets Such as duced in a way that does not influence the in Vivo potency FIIa, FVa, FVIIa, FVIIIA, FIXa, FXa, tissue factor, heparins, of the molecule, or the lipophilic group may be cleaved hirudin, hirulog, argatroban, DEGR-rFVIIa and annexin V: 25 releasing the active drug. Lipophilic groups may be intro inhibitors of fibrin formation and promoters of fibrinolysis duced by various chemical means depending on functional Such as t-PA, urokinase, Plasmin, Streptokinase, groups available in the drug molecule. Covalent coupling rt-Plasminogen Activator and rStaphylokinase; antiangio may be effected using functional groups in the drug mol genic factorS Such as medroxyprogesteron, pentosan ecule capable of reacting with appropriately functionalised poly Sulphate, Suramin, taxol, thalidomide, angiostatin, lipophilic compounds. Examples of lipophilic moieties interferon-alpha, metalloproteinase inhibitors, platelet factor include branched and unbranched alkyl chains, cyclic 4, Somatostatin, thromobospondin; circulatory drugs. Such as compounds, aromatic residues and fused aromatic and non propranolol, metabolic potentiatorS Such as glutathione; aromatic cyclic Systems. In Some instances the lipophilic antitubercularS Such as p-aminoSalicylic acid, isoniazid, moiety will consist of a Suitably functionalised Steroid, Such capreomycin Sulfate, cycloSexine, ethambutol, ethionamide, 35 as cholesterol or a related compound. Examples of func pyrazinamide, rifampin or Streptomycin Sulphate; antivirals tional groups particularly Suitable for derivatisation include Such as acyclovir, amantadine, azidothymidine, ribavirin or nucleophilic groups like amino, hydroxy and Sulfhydryl Vidarabine; blood vessel dilating agents Such as diltiazem, groupS. Suitable processes for lipophilic derivatisation of nifedipine, Verapamil, erythritol tetranitrate, isosorbide any drug containing a Sulfhydryl group, Such as captopril, dinitrate, nitroglycerin or pentaerythritol tetranitrate; antibi 40 may include direct alkylation, e.g. reaction with an alkyl otics Such as dapSone, chloramphenicol, neomycin, cefaclor, halide under basic conditions and thiol ester formation by cefadroxil, cephalexin, cephradine, erythromycin, reaction with an activated carboxylic acid. Representative clindamycin, lincomycin, amoxicillin, amplicillin, examples of derivatisation of any drug having carboxylic bacampicillin, carbenicillin, dicloxacillin, cyclacillin, functions, for example atenolol or chlorambucil, include picloxacillin, hetacillin, methicillin, nafcillin, penicillin, 45 amide and ester formation by coupling respectively with polymyxin or tetracycline; antiinflammatories Such as amines and alcohols possessing appropriate physical prop diflunisal, ibuprofen, indomethacin, meclefenamate, mefe erties. A preferred embodiment comprises attachment of namic acid, naproxen, phenylbutaZone, piroXicam, tolmetin, cholesterol to a therapeutic compound by forming a degrad aspirin or Salicylates, antiprotozoans Such as chloroquine, able ester bond. metronidazole, quinine or meglumine antimonate; antirheu 50 A preferred application of the present invention relates to matics Such as penicillamine, narcoticS Such as paregoric; angiogenesis, which is the formation of new blood vessels opiates Such as codeine, morphine or opium; cardiac glyco by branching from existing vessels. The primary Stimulus SideS Such as deslaneside, digitoxin, digoxin, digitalin or for this proceSS may be inadequate Supply of nutrients and digitalis; neuromuscular blockerS Such as atracurium oxygen (hypoxia) to cells in a tissue. The cells may respond meSylate, gallamine triethiodide, hexafluorenium bromide, 55 by Secreting angiogenetic factors, of which there are many; metocurine iodide, pancuronium bromide, Succinylcholine one example is vascular endothelial growth factor. These chloride, tubocurarine chloride or vecuronium bromide; factors initiate the Secretion of proteolytic enzymes which Sedatives Such as amobarbital, amobarbital Sodium, break down the proteins of the basement membrane, as well apropbarbital, butabarbital Sodium, chloral hydrate, as inhibitors which limit the action of these potentially ethchlorVynol, ethinamate, flurazepam hydrochloride, 60 harmful enzymes. The combined effect of loss of attachment glute thimide, methotrime praZine hydrochloride, and Signals from the receptors for angiogenetic factors is to methy prylon, midazolam hydrochloride, paraldehyde, cause the endothelial cells to move, multiply, and rearrange pentobarbital, Secobarbital Sodium, talbutal, temazepam or themselves, and finally to Synthesise a basement membrane triazolam, local anaesthetics Such as bupivacaine, around the new vessels. chloroprocaine, etidocaine, lidocaine, mepivacaine, 65 Tumors must initiate angiogenesis when they reach mil procaine or tetracaine; general anaesthetics Such as limeter size in order to keep up their rate of growth. AS droperidol, etomidate, fentanyl citrate with droperidol, ket angiogenesis is accompanied by characteristic changes in US 6,261,537 B1 13 14 the endothelial cells and their environment, this process is a Covalent coupling of reporter and vector may therefore be promising target for therapeutic intervention. The transfor effected using linking agents containing reactive moities mations accompanying angiogenesis are also very promis capable of reaction with Such functional groups. Examples ing for diagnosis, a preferred example being malignant of reactive moieties capable of reaction with sulfhydryl disease, but the concept also shows great promise in inflam groups include C.-haloacetyl compounds of the type mation and a variety of inflammation-related diseases. These X-CHCO-(where X=Br, Clor I), which show particular factors are also involved in re-vascularisation of infarcted reactivity for sulfhydryl groups but which can also be used parts of the myocardium, which occurs if a Stenosis is to modify imidazolyl, thioether, phenol and amino groups as released within a short time. described by Gurd, F. R. N. in Methods Enzymol. (1967) 11, A number of known receptorS/targets associated with 532. N-Maleimide derivatives are also considered selective angiogenesis are given in Subsequent tables. Using the towards Sulfhydryl groups, but may additionally be useful in targeting principles described in the present disclosure, coupling to amino groups under certain conditions. angiogenesis mav be detected by the majority of the imaging N-maleimides may be incorporated into linking Systems for modalities in use in medicine. Contrast-enhanced ultrasound reporter-vector conjugation as described by Kitagawa, T. et may possess additional advantages, the contrast medium 15 al. in Chem. Pharm. Bull. (1981) 29, 1130 or used as being microSpheres which are restricted to the interior of polymer crosslinkers for bubble stabilisation as described by blood vessels. Even if the target antigens are found on many Kovacic, P. et al. in J. Am. Chem. Soc. (1959) 81, 1887. cell types, the microSpheres will attach exclusively to endot Reagents Such as 2-iminothiolane, e.g. as described by helial cells. Traut, R. et al. in Biochemistry (1973) 12, 3266, which So-called prodrugs may also be used in agents according introduce a thiol group through conversion of an amino to the invention. Thus drugs may be derivatised to alter their group, may be considered as Sulfhydryl reagents if linking physicochemical properties and to adapt them for inclusion occurs through the formation of disulphide bridges. Thus into the reporter, Such derivatised drugs may be regarded as reagents which introduce reactive disulphide bonds into prodrugs and are usually inactive until cleavage of the either the reporter or the vector may be useful, Since linking derivatising group regenerates the active form of the drug. 25 may be brought about by disulphide exchange between the By targeting gas-filled microbubbles containing a vector and reporter; examples of Such reagents include prodrug-activating enzyme to areas of pathology, one may Ellman's reagent (DTNB), 4,4'-dithiodipyridine, methyl-3- image targeting the enzyme, making it possible to visualise nitro-2-pyridyl disulphide and methyl-2-pyridyl disulphide when the microbubbles are targeted properly to the area of (described by Kimura, T. et al. in Analyt. Biochem. (1982) pathology and at the same time have disappeared from 122, 271). non-target areas. In this way one can determine the optimal Examples of reactive moieties capable of reaction with time for injection of prodrug into individual patients. amino groups include alkylating and acylating agents. Rep Another alternative is to incorporate the prodrug, resentative alkylating agents include: prodrug-activating enzyme and vector in the same i) C-haloacetyl compounds, which show specificity 35 towards amino groups in the absence of reactive thiol microbubbles in a system where the prodrug will only be groups and are of the type X-CHCO-(where X=Cl, activated after Some external Stimulus. Such a Stimulus may, Br or I), e.g. as described by Wong, Y-H. H. in for example, be a tumour-specific protease as described Biochemistry (1979) 24, 5337; above, or bursting of the microbubbles by external ultra ii) N-maleimide derivatives, which may react with amino Sound after the desired targeting has been achieved. 40 groups either through a Michael type reaction or Therapeutics may easily be delivered in accordance with through acylation by addition to the ring carbonyl the invention to diseased or necrotic areas, for example in the heart, general vasculature, and to the liver, Spleen, group as described by Smyth, D. G. et al. in J. Am. kidneys and other regions Such as the lymph System, body Chem. Soc. (1960) 82,4600 and Biochem.J. (1964) 91, cavities or gastrointestinal System. 589; 45 iii) aryl halides Such as reactive nitrohaloaromatic com Products according to the present invention may be used pounds, for targeted therapeutic delivery either in vivo or in vitro. In the latter context the products may be useful in in Vitro iv) alkyl halides as described by McKenzie, J. A. et al. in Systems. Such as kits for diagnosis of different diseases or J. Protein Chem. (1988) 7, 581; characterisation of different components in blood or tissue 50 v) aldehydes and ketones capable of Schiff's base forma Samples. Similar techniques to those used to attach certain tion with amino groups, the adducts formed usually blood components or cells to polymer particles (e.g. mono being Stabilised through reduction to give a Stable disperse magnetic particles) in vitro to separate them from a amine; Sample may be used in the present invention, using the low Vi) epoxide derivatives Such as epichlorohydrin and density of the reporter units in agents of the present inven 55 bisoxiranes,which may react with amino, Sulfhydryl or tion to effect Separation of the gas-containing material by phenolic hydroxyl groups, flotation and repeated washing. Vii) chlorine-containing derivatives of S-triazines, which Coupling of a reporter unit to a desired vector (and/or are very reactive towards nucleophiles Such as amino, therapeutic drug) may be achieved by covalent or non Sufhydryl and hydroxy groups, covalent means, usually involving interaction with one or 60 viii) aziridines based on S-triazine compounds detailed more functional groups located on the reporter and/or vector above, e.g. as described by Ross, W. C. J. in Adv. and/or any intervening linker group/spacer element. Cancer Res. (1954) 2, 1, which react with nucleophiles Examples of chemically reactive functional groups which Such as amino groups by ring opening; may be employed for this purpose include amino, hydroxyl, ix) Squaric acid diethyl esters as described by Tietze, L. F. Sulfhydryl, carboxyl, and carbonyl groups, as well as car 65 in Chem. Ber. (1991) 124, 1215; and bohydrate groups, vicinal diols, thioethers, 2-aminoalcohols, X) C.-haloalkyl ethers, which are more reactive alkylating 2-aminothiols, guanidinyl, imidazolyl and phenolic groups. agents than normal alkyl halides because of the acti US 6,261,537 B1 15 16 Vation caused by the ether oxygen atom, e.g. as 1, 1'- carbonyl diimidazole; and described by Benneche, T. et al. in Eur. J. Med. Chem. N-carb alko Xy dihydro quinoline S Such as (1993) 28,463. N-(ethoxycarbonyl)-2-ethoxy-1,2-dihydroquinoline. Representative amino-reactive acylating agents include: Other potentially useful reactive moieties include Vicinal i) isocyanates and isothiocyanates, particularly aromatic diones Such as p-phenylenediglyoxal, which may be used to derivatives, Which form stable urea and thiourea react with guanidinyl groups, e.g. as described by Wagner et derivatives respectively and have been used for protein al. in Nucleic acid Res. (1978) 5,4065; and diazonium salts, crosslinking as described by Schick, A. F. et al. in J. which may undergo electrophilic Substitution reactions, e.g. Biol. Chem. (1961) 236, 2477; as described by Ishizaka, K. and Ishizaka T. in J. Immunol. ii) sulfonyl chlorides, which have been described by (1960) 85, 163. Bis-diazonium compounds are readily pre Herzig, D. J. et al. in Biopolymers (1964) 2, 349 and pared by treatment of aryl diamines with Sodium nitrite in which may be useful for the introduction of a fluores acidic Solutions. It will be appreciated that functional groups cent reporter group into the linker; in the reporter and/or vector may if desired be converted to other functional groups prior to reaction, e.g. to confer iii) Acid halides; 15 additional reactivity or Selectivity. Examples of methods iv) Active esters such as nitrophenyle Sters or useful for this purpose include conversion of amines to N-hydroxysuccinimidyl esters; carboxylic acids using reagents Such as dicarboxylic anhy V) acid anhydrides Such as mixed, symmetrical or drides, conversion of amines to thiols using reagents Such as N-carboxyanhydrides; N-acetylhomoc y Steine thiol act one, Vi) other useful reagents for amide bond formation as S-acetylmercaptoSuccinic anhydride, 2-liminothiolane or described by Bodansky, M. et al. in Principles of thiol-containing Succinimidyl derivatives, conversion of thi Peptide Synthesis (1984) Springer-Verlag; ols to carboxylic acids using reagents Such as vii) acylazides, e.g. wherein the azide group is generated C-haloacetates, conversion of thiols to amines using from a preformed hydrazide derivative using Sodium reagents Such as ethylenimine or 2-bromoethylamine; con nitrite, e.g. as described by Wetz, K. et al. in Anal. 25 version of carboxylic acids to amines using reagents Such as Biochem. (1974) 58, 347; carbodiimides followed by diamines; and conversion of viii) azlactones attached to polymerS Such as alcohols to thiols using reagents Such as tosyl chloride bisacrylamide, e.g. as described by Rasmussen, J. K. in followed by transesterification with thioacetate and hydroly Reactive Polymers (1991) 16, 199; and sis to the thiol with Sodium acetate. iX) Imidoesters, which form stable amidines on reaction Vector-reporter coupling may also be effected using with amino groups, e.g. as described by Hunter, M. J. enzymes as Zero-length linking agents; thus, for example, and Ludwig, M. L. in J. Am. Chem. Soc. (1962) 84, transglutaminase, peroxidase and Xanthine oxidase may be 3491. used to produce linked products. Reverse proteolysis may Carbonyl groupS. Such as aldehyde functions may be also be used for linking through amide bond formation. reacted with weak protein bases at a pH Such that nucleo 35 Non-covalent vector-reporter coupling may, for example, philic protein Side-chain functions are protonated. Weak be effected by electroStatic charge interactions e.g. between bases include 1,2-aminothiols Such as those found in a polylysinyl-functionalised reporter and a polyglutamyl N-terminal cysteine residues, which selectively form stable functionalised vector, through chelation in the form of Stable 5-membered thiazolidine rings with aldehyde groups, e.g. as metal complexes or through high affinity binding interaction described by Ratner, S. et al. in J. Am. Chem. Soc. (1937) 59, 40 Such as avidin/biotin binding. Polylysine, coated non 200. Other weak bases such as phenyl hydrazones may be covalently to a negatively charged membrane Surface may used, e.g. as described by Heitzman, H. et al. in Proc. Natl. also increase non-specifically the affinity of a microbubble Acad. Sci. USA (1974) 71, 3537. for a cell through charge interactions. Aldehydes and ketones may also be reacted with amines Alternatively, a vector may be coupled to a protein known to form Schiff's bases, which may advantageously be Sta 45 to bind phospholipids. In many instances, a Single molecule bilised through reductive amination. Alkoxylamino moieties of phospholipid may attach to a protein Such as a readily react with ketones and aldehydes to produce Stable translocase, while other proteins may attach to Surfaces alkoxamines, e.g. as described by Webb, R. et al. in Bio consisting mainly of phospholipid head groupS and So may conjugate Chem. (1990) 1, 96. be used to attach vectors to phospholipid microSpheres, one Examples of reactive moieties capable of reaction with 50 example of Such a protein is f2-glycoprotein I (Chonn, A., carboxyl groups include diazo compounds Such as diaZoac Semple, S. C. and Cullis, P. R., Journal of Biological etate esters and diazoacetamides, which react with high Chemistry (1995) 270, 25845–25849). Phosphatidylserine Specificity to generate ester groups, e.g. as described by binding proteins have been described, e.g. by Igarashi, K. et Herriot R. M. in Adv. Protein Chem. (1947) 3, 169. Car al. in Journal of Biological Chemistry 270(49), boxylic acid modifying reagents Such as carbodiimides, 55 29075-29078; a conjugate of a vector with such a which react through O-acylurea formation followed by phosphatidylserine-binding protein may therefore be used to amide bond formation, may also usefully be employed; attach the vector to phosphatidylserine-encapsulated linking may be facilitated through addition of an amine or microbubbles. When the amino acid sequence of a binding may result in direct vector-receptor coupling. Useful water protein is known, the phospholipid-binding portion may be soluble carbodiimides include 1-cyclohexyl-3-(2- 60 Synthesised or isolated and used for conjugation with a morpholinyl-4-ethyl)carbodiimide (CMC) and 1-ethyl-3-(3- vector, thus avoiding the biological activity which may be dimethylaminopropyl)carbodiimide (EDC), e.g. as located elsewhere in the molecule. described by Zot, H. G. and Puett, D. in J. Biol. Chem. It is also possible to obtain molecules that bind Specifi (1989) 264, 15552. Other useful carboxylic acid modifying cally to the surface (or in the “membrane”) of microspheres reagents include isoxazolium derivatives Such as Wood 65 by direct Screening of molecular libraries for microSphere wards reagent K, chloro for mate S. Such as binding molecules. For example, phage libraries displaying p-nitrophenylchloroformate; carbonyldiimidazoles Such as Small peptides may be used for Such Selection. The Selection US 6,261,537 B1 17 18 may be made by Simply mixing the microSpheres and the or vectors or directly to the reporter in the same molecule phage display library and eluting the phages binding to the where the PEG does not serve as a spacer. floating microSpheres. If desired, the Selection may be done So-called Zero-length linking agents, which induce direct under “physiological conditions” (e.g. in blood) to eliminate covalent joining of two reactive chemical groups without peptides which cross-react with blood components. An introducing additional linking material (e.g. as in amide advantage of this type of Selection procedure is that only bond formation induced using carbodiimides or binding molecules that do not destabilise the microSpheres enzymatically) may, if desired, be used in accordance with the invention, as may agentS Such as biotin/avidin Systems should be Selected, Since only binding molecules attached to which induce non-covalent reporter-vector linking and intact floating microSpheres will rise to the top. It may also agents which induce hydrophobic or electrostatic interac be possible to introduce some kind of “stress” during the tions. Selection procedure (e.g. pressure) to ensure that destabilis Most commonly, however, the linking agent will com ing binding moieties are not Selected. Furthermore the prise two or more reactive moieties, e.g. as described above, Selection may be done under shear conditions, for example connected by a Spacer element. The presence of Such a by first letting the phages react with the microSpheres and Spacer permits bifunctional linkers to react with Specific then letting the microSpheres pass through a Surface coated 15 functional groups within a molecule or between two differ with anti-phage antibodies under flow conditions. In this ent molecules, resulting in a bond between these two com way it may be possible to Select binders which may resist ponents and introducing extrinsic linker-derived material Shear conditions present in Vivo. Binding moieties identified into the reporter-vector conjugate. The reactive moieties in in this way may be coupled (by chemical conjugation or via a linking agent may be the same (homobifunctional agents) peptide synthesis, or at the DNA-level for recombinant or different (heterobifunctional agents or, where several vectors) to a vector molecule, constituting a general tool for dissimilar reactive moieties are present, heteromultifunc attaching any vector molecule to the microSpheres. tional agents), providing a diversity of potential reagents A vector which comprises or is coupled to a peptide, that may bring about covalent bonding between any chemi lipo-oligosaccharide or lipopeptide linker which contains a cal Species, either intramolecularly or intermolecularly. element capable of mediating membrane insertion may also 25 The nature of extrinsic material introduced by the linking be useful. One example is described by Leenhouts, J. M. et agent may have a critical bearing on the targeting ability and al. in Febs Letters (1995) 370(3), 189-192. Non-bioactive general Stability of the ultimate product. Thus it may be molecules consisting of known membrane insertion anchor/ desirable to introduce labile linkages, e.g. containing Spacer Signal groupS may also be used as Vectors for certain arms which are biodegradable or chemically Sensitive or applications, an example being the Hi hydrophobic Segment which incorporate enzymatic cleavage Sites. Alternatively from the Na,K-ATPase C.-subunit described by Xie, Y. and the Spacer may include polymeric components, e.g. to act as Morimoto, T. in J. Biol. Chem. (1995) 270(20), Surfactants and enhance bubble Stability. The Spacer may 11985–11991. The anchor group may also be fatty acid(s) or also contain reactive moieties, e.g. as described above to cholesterol. enhance Surface crosslinking, or it may contain a tracer Coupling may also be effected using avidin or 35 element Such as a fluorescent probe, Spin label or radioactive streptavidin, which have four high affinity binding sites for material. biotin. Avidin may therefore be used to conjugate vector to Contrast agents according to the present invention are reporter if both vector and reporter are biotinylated. therefore useful in all imaging modalities Since contrast Examples are described by Bayer, E. A. and Wilchek, M. in elements Such as X-ray contrast agents, light imaging Methods Biochem. Anal. (1980) 26, 1. This method may also 40 probes, Spin labels or radioactive units may readily be be extended to include linking of reporter to reporter, a incorporated in or attached to the reporter units. proceSS which may encourage bubble association and con Spacer elements may typically consist of aliphatic chains Sequent potentially increased echogenicity. Alternatively, which effectively separate the reactive moieties of the linker avidin or Streptavidin may be attached directly to the Surface by distances of between 5 and 30 A. They may also comprise of reporter microparticles. 45 macromolecular structures such as PEGs, which have been Non-covalent coupling may also utilise the bifunctional given much attention in biotechnical and biomedical appli nature of bispecific immunoglobulins. These molecules can cations (see e.g. Milton Harris, J. (ed) "Poly(ethylene glycol) Specifically bind two antigens, thus linking them. For chemistry, biotechnical and biomedical applications” Ple example, either bispecific IgG or chemically engineered num Press, New York, 1992). PEGs are soluble in most bispecific F(ab)2 fragments may be used as linking agents. 50 Solvents, including water, and are highly hydrated in aque Heterobifunctional bispecific antibodies have also been ous environments, with two or three water molecules bound reported for linking two different antigens, e.g. as described to each ethylene glycol Segment; this has the effect of by Bode, C. et al. in J. Biol. Chem. (1989) 264,944 and by preventing adsorption either of other polymers or of proteins Staerz, U. D. et al. in Proc. Natl. Acad. Sci. USA (1986) 83, onto PEG-modified Surfaces. PEGs are known to be non 1453. Similarly, any reporter and/or vector containing two or 55 toxic and not to harm active proteins or cells, whilst more antigenic determinants (e.g. as described by Chen, Aa covalently linked PEGs are known to be non-immunogenic et al. in Am. J. Pathol. (1988) 130, 216) may be crosslinked and non-antigenic. Furthermore, PEGS may readily be modi by antibody molecules and lead to formation of multi-bubble fied and bound to other molecules with only little effect on croSS-linked assemblies of potentially increased echogenic their chemistry. Their advantageous Solubility and biological ity. 60 properties are apparent from the many possible uses of PEGS Linking agents used in accordance with the invention will and copolymers thereof, including block copolymerS Such as in general bring about linking of Vector to reporter or PEG-polyurethanes and PEG-polypropylenes. reporter to reporter with Some degree of Specificity, and may Appropriate molecular weights for PEG Spacers used in also be used to attach one or more therapeutically active accordance with the invention may, for example, be between agents. 65 120 Daltons and 20 kDaltons. In Some instances it is considered advantageous to include The major mechanism for uptake of particles by the cells a PEG component as a Stabiliser in conjunction with a vector of the reticuloendothelial system (RES) is opsonisation by US 6,261,537 B1 19 20 plasma proteins in blood; these mark foreign particles which been used in the form of nanoparticles for Selective are then taken up by the RES. The biological properties of drug delivery (see Forestier, F., Gerrier, P., Chaumard, PEG spacer elements used in accordance with the invention C., Quero, A. M., Couvreur, P. and Labarre, C. in J. may serve to increase contrast agent circulation time in a Antimicrob. Chemoter. (1992) 30, 173–179); similar manner to that observed for PEGylated liposomes iv) polyvinyl alcohols, which are water-Soluble and gen (see e.g. Klibanov, A. L. et al. in FEBS Letters (1990) 268, erally regarded as biocompatible (see e.g. Langer, R. in 235-237 and Blume, G. and Cevc, G. in Biochim. BiophyS. Acta (1990) 1029, 91-97). Increased coupling efficiency to J. Control. Release (1991) 16, 53–60); areas of interest may also be achieved using antibodies v) copolymers of vinyl methyl ether with maleic bound to the termini of PEG spacers (see e.g. Maruyama, K. anhydride, which have been stated to be bioerodible et al. in Biochim. Biophys. Acta (1995) 1234, 74–80 and (see Finne, U., Hannus, M. and Urtti, A. in Int. J. Hansen, C. B. et al. in Biochim. Biophys. Acta (1995) 1239, Pharm. (1992) 78. 237–241); 133–144). Vi) polyvinylpyrrolidones, e.g. with molecular weight less In Some instances it is considered advantageous to include than about 25,000, which are rapidly filtered by the a PEG component as a Stabiliser in conjunction with a vector kidneys (see Hespe, W., Meier, A. M. and Blankwater, or vectors or directly to the reporter in the same molecule 15 Y. M. in Arzeim.-Forsch./Drug Res. (1977) 27, where the PEG does not serve as a spacer. 1158–1162); Other representative Spacer elements include Structural Vii) polymers and copolymers of short-chain aliphatic type polysaccharides Such as polygalacturonic acid, hydroxyacids Such as glycolic, lactic, butyric, Valeric glycosaminoglycans, heparinoids, cellulose and marine and caproic acids (see e.g. Carli, F. in Chim. Ind. polysaccharides Such as alginates, chitosans and carrageen (Milan) (1993) 75, 494-9), including copolymers ans, Storage-type polysaccharides Such as Starch, glycogen, which incorporate aromatic hydroxyacids in order to dextran and aminodextrans, polyamino acids and methyl and increase their degradation rate (see Imasaki, K., ethyl esters thereof, as in homo-and co-polymers of lysine, Yoshida, M., Fukuzaki, H., Asano, M., Kumakura, M., glutamic acid and aspartic acid; and polypeptides, oligosac Mashimo, T., Yamanaka, H. and Nagai. T. in Int. J. charides and oligonucleotides, which may or may not con 25 Pharm. (1992) 81, 31–38); tain enzyme cleavage Sites. viii) polyesters consisting of alternating units of ethylene In general, Spacer elements may contain cleavable groups glycol and terephthalic acid, e.g. Dacron', which are Such as vicinal glycol, azo, Sulfone, ester, thioester or non-degradable but highly biocompatible, disulphide groups. Spacers containing biodegradable meth iX) block copolymers comprising biodegradable segments ylene diester or diamide groups of formula of aliphatic hydroxyacid polymers (see e.g. Younes, H., Nataf, P. R., Cohn, D., Appelbaum, Y. J., Pizov, G. and -(Z).Y.X.C(R'R').X.Y. (Z)- Uretzky, G. in Biomater. Artif Cells Artif. Organs where X and Z are selected from -O-, -S-, and (1988) 16, 705–719), for instance in conjunction with -NR- (where R is hydrogen or an organic group); each Y 35 polyurethanes (see Kobayashi, H., Hyon, S. H. and is a carbonyl, thiocarbonyl, Sulphonyl, phosphoryl or similar Ikada, Y. in “Water-curable and biodegradable acid-forming group: m and n are each Zero or 1; and R' and prepolymers' J. Biomed. Mater. Res. (1991) 25, R are each hydrogen, an organic group or a group —X.Y. 1481–1494); (Z), , or together form a divalent organic group may also X) polyurethanes, which are known to be well-tolerated in be useful; as discussed in, for example, WO-A-9217436 40 implants, and which may be combined with flexible Such groups are readily biodegraded in the presence of “Soft” segments, e.g. comprising poly(tetra methylene esterases, e.g. in Vivo, but are stable in the absence of Such glycol), poly(propylene glycol) or poly(ethylene enzymes. They may therefore advantageously be linked to glycol) and aromatic "hard” segments, e.g. comprising therapeutic agents to permit slow release thereof. 4,4'-methylenebis(phenylene isocyanate) (see e.g. PolyN-(2-hydroxyethyl)methacrylamides are poten 45 Ratner, B. D., Johnston, A. B. and Lenk, T. J. in J. tially useful Spacer materials by virtue of their low degree of Biomed. Mater. Res: Applied Biomaterials (1987) 21, interaction with cells and tissues (see e.g. Volfová, I., Rihov 59–90; Sa Da Costa, V. et al. in J. Coll. Interface Sci. a, B. and V. R. and Vetvicka, P. in J. Bioact. Comp. Polymers (1981) 80,445-452 and Affrossman, S. et al. in Clinical (1992) 7, 175-190). Work on a similar polymer consisting Materials (1991) 8, 25–31); mainly of the closely related 2-hydroxypropyl derivative 50 xi) poly(1,4-dioxan-2-ones), which may be regarded as showed that it was endocytosed by the mononuclear phago biodegradable esters in view of their hydrolysable ester cyte System only to a rather low extent (see Goddard, P., linkages (see e.g. Song, C. X., Cui, X. M. and Williamson, I., Bron, J., Hutchkinson, L. E., Nicholls, J. and Schindler, A. in Med. Biol. Eng. Comput. (1993) 31, Petrak, K. in J. Bioct. Compat. Polym. (1991) 6, 4-24). S147-150), and which may include glycolide units to Other potentially useful polymeric Spacer materials 55 improve their absorbability (see Bezwada, R. S., include: Shalaby, S. W. and Newman, H. D. J. in Agricultural i) copolymers of methyl methacrylate with methacrylic and Synthetic polymers. Biodegradability and utiliza acid; these may be erodible (see Lee, P. I. in Pharm. tion (1990) (ed Glass, J. E. and Swift, G.), 167–174 Res. (1993) 10, 980) and the carboxylate substituents ACS symposium Series, #433, Washington D.C., may cause a higher degree of Swelling than with neutral 60 U.S.A.-American Chemical Society); polymers, xii) polyanhydrides Such as copolymers of Sebacic acid ii) block copolymers of polymethacrylates with biode (octanedioic acid) with bis(4-carboxy-phenoxy) gradable polyesters (see e.g. San Roman, J. and propane, which have been shown in rabbit studies (see Guillen-Garcia, P. in Biomaterials (1991) 12, Brem, H., Kader, A., Epstein, J. I., Tamargo, R. J., 236-241); 65 Domb, A., Langer, R. and Leong, K.W. in Sel. Cancer iii) cyanoacrylates, i.e. polymers of esters of Ther. (1989) 5,55–65) and rat studies (see Tamargo, R. 2-cyanoacrylic acid-these are biodegradable and have J., Epstein, J. I., Reinhard, C. S., Chasin, M. and Brem, US 6,261,537 B1 21 22 H. in J. Biomed. Mater. Res. (1989) 23, 253–266) to be useful for controlled release of drugs in the brain -continued without evident toxic effects; Sulfo-SAPB -NH. photoreactive water-soluble xiii) biodegradable polymers containing ortho-ester Homobifunctional linking agents groups, which have been employed for controlled release in vivo (see Maa, Y. F. and Heller, J. in J. Linking agent Reactivity Comments Control. Release (1990) 14, 21–28); and BS -NH. xiv) polyphosphaZenes, which are inorganic polymers BMH -SH consisting of alternate phosphorus and nitrogen atoms BASED(1) photoreactive iodinable disulphide linker BSCOES -NH. (see Crommen, J. H., Vandorpe, J. and Schacht, E. H. Sulfo-BSCOES -NH. water-soluble in J. Control. Release (1993) 24, 167–180). DFDNB -NH The following tables list linking agents and agents for DMA -NH. protein modification which may be useful in preparing DMP -NH. targetable agents in accordance with the invention. DMS -NH. 15 DPDPB -SH disulphide linker DSG -NH. DSP -NH. disulphide linker DSS -NH Heterobifunctional linking agents DST -NH. Sulfo-DST -NH. water-soluble Linking agent Reactivity 1 Reactivity 2 Comments DTBP -NH. disulphide linker DTSSP -NH disulphide linker ABH carbohydrate photoreactive EGS -NH. ANB-NOS -NH. photoreactive Sulfo-EGS -NH. water-soluble APDP(1) -SH photoreactive iodinable SPBP -NH. disulphide Biotinylation agents linker APG -NH. photoreactive reacts 25 Agent Reactivity Comments selectively with Arg at pH biotin-BMCC -SH 7-8 biotin-DPPE* preparation of ASIB(1) -SH photoreactive iodinable biotinylated liposomes ASBA(1) -COOH photoreactive iodinable biotin-LC-DPPE* preparation of EDC -NH -COOH Zero-length biotinylatea liposomes linker biotin-HPDP -SH disulphide linker GMBS -NH. -SH biotin-hydrazide carbohydrate Sulfo-GMBS -NH. -SH water-soluble biotin-LC- carbohydrate HSAB -NH photoreactive hydrazide Sulfo-HSAB -NH. photoreactive water-soluble iodoacetyl-LC- -NH. MBS -NH. -SH 35 biotin Sulfo-MBS -NH. -SH water-soluble NHS-iminobiotin -NH. reduced affinity for MCH carbohydrate -SH avidin MPBH carbohydrate -SH NHS-SS-biotin -NH. disulphide linker NHS-ASA(1) -NH. photoreactive iodinable photoactivatable nucleic Sulfo-NHS- -NH photoreactive water-soluble, biotin acids ASA(1) iodinable sulfo-NHS-biotin -NH. water-soluble sulfo-NHS-LC- -NH. photoreactive water-soluble, 40 sulfo-NHS-LC- -NH. ASA(1) iodinable biotin PDPH carbohydrate -SH disulphide Agents for protein modification linker PNP-DTP -NH. photoreactive Agent Reactivity Function SADP -NH. photoreactive disulphide linker 45 Ellman's reagent -SH quantifies/detects/protects Sulfo-SADP -NH. photoreactive water-soluble DTT -S.S.- reduction disulphide 2- -S.S.- reduction linker mercaptoethanol SAED -NH photoreactive disulphide 2-mercaptylamine -S.S.- reduction linker Traut's reagent -NH. introduces -SH SAND -NH. photoreactive water-soluble 50 SATA -NH. introduces protected -SH disulphide AMCA-NHS -NH. fluorescent labelling linker AMCA-hydrazide carbohydrate fluorescent labelling SANPAH -NH. photoreactive AMCA-HPDP -S.S.- fluorescent labelling sulfo-SANPAH -NH photoreactive water-soluble SBF-chloride -S.S.- fluorescent detection of -SH SASD(1) -NH. photoreactive water-soluble N-ethylmaleimide -S.S.- blocks -SH iodinable 55 NHS-acetate -NH blocks and acetylates -NH disulphide citraconic -NH. reversibly blocks and linker anhydride introduces negative charges SAB -NH -SH DTPA -NH introduces chelator sulfo-SIAB -NH. -SH water-soluble BNPS-skatole tryptophan cleaves tryptophan residue SMCC -NH. -SH Bolton-Hunter -NH. introduces iodinable group Sulfo-SMCC -NH. -SH water-soluble SMPB -NH -SH 60 Notes: (1) = iodinable; (2) = fluorescent Sulfo-SMPB -NH. -SH water-soluble Notes: DPPE = dipalmitoylphosphatidylethanolamine; LC = long chain SMPT -NH. -SH sulfo-LC-SMPT -NH -SH water-soluble Other potentially useful protein modifications include SPDP -NH -SH Sulfo-SPDP -NH. -SH water-soluble partial or complete deglycosidation by neuraminidase, sulfo-LC-SPDP -NH -SH water-soluble 65 endoglycosydases or periodate, Since deglycosidation often sulfo-SAMCA(2) -NH. photoreactive results in less uptake by liver, Spleen, macrophages etc., whereas neo-glycosylation of proteins often results in US 6,261,537 B1 23 24 increased uptake by the liver and macrophages); preparation vi) Protease substrates/inhibitors. Proteases are involved of truncated forms by proteolytic cleavage, leading to in many pathological conditions. Many Substrates/ reduced size and Shorter half life in circulation; and inhibitors are non-peptidic but, at least in the case of cationisation, e.g. as described by Kumagi et al. in J. Biol. Chem. (1987) 262, 15214-15219; Triguero et al. in Proc. inhibitors, are often bioactive. Natl. Acad. Sci. USA (1989) 86,4761-4765; Pardridge et al. Vii) Vector molecules may be generated from combina in J. Pharmacol. Exp. Therap. (1989) 251, 821-826 and torial libraries without necessarily knowing the exact Pardridge and Boado, Febs Lett. (1991) 288, 30–32. molecular target, by functionally Selecting (in vitro, ex Vectors which may be usefully employed in targetable Vivo or in vivo) for molecules binding to the region/ agents according to the invention include the following: Structure to be imaged. i) Antibodies, which can be used as vectors for a very viii) Various Small molecules, including bioactive com wide range of targets, and which have advantageous properties Such as very high specificity, high affinity (if pounds known to bind to biological receptors of various desired), the possiblity of modifying affinity according kinds. Such vectors or their targets may be used for to need etc. Whether or not antibodies will be bioactive generate non-bioactive compounds binding to the same will depend on the Specific vector/target combination. 15 targets. Both conventional and genetically engineered antibod ix) Proteins or peptides which bind to glucosamioglycan ies may be employed, the latter permitting engineering Side chains e.g. heparan Sulphate, including of antibodies to particular needs, e.g. as regards affinity glucoso aminoglycan-binding portions of larger and Specificity. The use of human antibodies may be molecules, as binding to glucosoaminoglycans does not preferred to avoid possible immune reactions against result in a biological response. Proteoglycans are not the vector molecule. A further useful class of antibodies found on red blood cells, which eliminates undesirable comprises So-called bi- and multi-specific antibodies, adsorption to these cells. i.e. antibodies having Specificity for two or more dif Other peptide vectors and lipopeptides thereof of particu ferent antigens in one antibody molecule. Such anti lar interest for targeted ultrasound imaging are listed below: bodies may, for example, be useful in promoting for 25 Atherosclerotic plaque binding peptide S Such as mation of bubble clusters and may also be used for YRALVDTLK (SEQ ID NO: 26), YAKFRE various therapeutic purposes, e.g. for carrying toxic TLEDTRDRMY (SEQ ID NO: 27) and moieties to the target. Various aspects of bispecific RALVDTEFKVKQEAGAK (SEQ ID NO:28); Thrombus antibodies are described by McGuinness, B. T. et al. in binding peptides such as NDGDFEEIPEEYLQ (SEQ ID Nat. Biotechnol. (1996) 14, 1149-1154; by George, A. NO:29) and GPRG (SEQ ID NO:30), Platelet binding pep J. et al. in J. Immunol. (1994) 152, 1802–1811; by tides such as PLYKKIIKKLLES (SEQ ID NO:31); and Bonardi et al. in Cancer Res. (1993) 53, 3015-3021; cholecystokinin, C.-melanocyte-stimulating hormone, heat and by French, R. R. et al. in Cancer Res. (1991) 51, Stable enterotoxin 1, vasoactive intestinal peptide, Synthetic 2353-2361. alpha-M2 peptide from the third heavy chain ii) Cell adhesion molecules, their receptors, cytokines, 35 complementarity-determininig region and analogues thereof growth factors, peptide hormones and pieces thereof. for tumour targeting. Such vectors rely on normal biological protein-protein The following tables identify various vectors which may interactions with target molecule receptors, and So in be targeted to particular types of targets and indicated areas many cases will generate a biological response on of use for targetable diagnostic and/or therapeutic agents binding with the targets and thus be bioactive; this may 40 according to the invention which contain Such vectors. be a relatively insignificant concern with vectors which target proteoglycans. iii) Non-peptide agonists/antagonists or non-bioactive binders of receptorS for cell adhesion molecules, Protein and peptide vectors - antibodies cytokines, growth factors and peptide hormones. This 45 category may include non-bioactive vectors which will Vector be neither agonists nor antagonist but which may type Target Comments/areas of use Ref antibodies CD34 vascular diseases in general, nonetheless exhibit valuable targeting ability. (general) Ola wall (e.g iv) Oligonucleotides and modified oligonucleotides which myocardium), activated bind DNA or RNA through Watson-Crick or other types 50 endothelium, immune cells of base-pairing. DNA is usually only present in extra antibodies ICAM-1 vascular diseases in general, (general) Ola (e.g cellular space as a consequence of cell damage, So that myocardium), activated Such oligonucleotides, which will usually be non endothelium, immune cells bioactive, may be useful in, for example, targeting of antibodies ICAM-2 vascular diseases in general, necrotic regions, which are associated with many dif 55 (general) Ola (e.g ferent pathological conditions. Oligonucleotides may myocardium), activated endothelium, immune cells also be designed to bind to specific DNA- or RNA antibodies ICAM-3 vascular diseases in general, binding proteins, for example transcription factors (general) Ola (e.g which are very often highly overexpressed or activated myocardium), activated in tumour cells or in activated immune or endothelial endothelium, immune cells 60 antibodies E-selectin vascular diseases in general, cells. Combinatorial libraries may be used to select (general) Ola (e.g oligonucleotides which bind Specifically to any pos myocardium), activated Sible target molecules and which therefore may be endothelium, immune cells antibodies P-selectin vascular diseases in general, employed as Vectors for targeting. (general) Ola wall (e.g v) DNA-binding drugs may behave similarly to 65 myocardium), activated oligonuclotides, but may exhibit biological acitvity endothelium, immune cells and/or toxic effects if taken up by cells. US 6,261,537 B1 25 26 b) I. Roitt, J. Brostoff, and D. Male. 1985. Immunology, -continued London: Gower Medical Publishing, p. 4.7 c) Stromblad, S., and D. A. Cheresh. 1996. “Integrins, Protein and peptide vectors - antibodies angiogenesis and vascular cell Survival’. Chemistry & Vector Biology 3: 881-885. type Target Comments fareas of use Ref antibodies PECAM vascular diseases in general, (general) normal vessel wall (e.g myocardium), activated Protein and peptide vectors - cell adhesion molecules ete endothelium, immune cells antibodies Integrins, vascular diseases in general, Vector (general) e.g. VLA-1, normal vessel wall (e.g type Target Comments/areas of use Ref VLA-2, VLA-3, myocardium), activated VLA-4, endothelium, immune cells L-selectin CD34 vascular diseases in VLA-5, VLA-6, MadCAM1 general, normal vessel wall f51C-7, 15 GlyCam 1 (e.g. myocardium), activated f51Cls, f1Clv, endothelium, Lymph nodes LFA-1, Mac Other carbohydrate vascular diseases in 14 1, CD41a, selectins ligands general, normal vessel wall etc. (sialyl Lewis X) (e.g. myocardium), activated antibod ies GlyCAM Vessel wall in lymph nodes heparan sulfate endothelium (genera (quite specific for lymph nodes) RGD- integrins vascular diseases in antibod ies MadCam 1 Vessel wall in lymph nodes peptides general, normal vessel wall (genera (quite specific for lymph nodes) (e.g. myocardium), activated antibod ies fibrin Thrombi endothelium (genera PECAM PECAM, Endothelium, 15 antibod ies Tissue Activated endothelium, tumours and other Cells in immune system (genera Factor Integrins, Laminin, Endothelium, 16 antibod ies Myosin Necrosis, myocardial infaction 25 C.S. collagen, Vessel wall (genera VLA-1, fibronectin, etc. antibod ies CEA Tumours VLA-2, VCAM-1, (genera (carcino VLA-3, thrombospondin, embryona 1 VLA-4, vitronection etc. antigen) VLA-5, antibod ies Mucins Tumours VLA-6, (genera ) f1C.7. antibod ies Multiple Tumours B1Cls, (genera drug f51Clv, resistance LFA-1, protein Max-1, antibod ies Prostate Prostate cancer 35 CD41a, (genera specific etc. antigen Integrin Integrins, Cells in immune system 17 antibod ies Cathepsin B Tumours (proteases of various 1O receptors, e.g. VLA-1, vessel wall (genera ) kinds are often more or less C.S. VLA-2, VLA-3, etc. specifically overexpressed in a Laminin, VLA-4, VLA-5, variety of tumours - Cathepsin B collagen, VLA-6, 3C-7, is such a protease) 40 fibro- B1Cls, antibodies Transferrin Tumors, 11 nectin, BCtv, LFA-1, (genera l) receptor vessel wall VCAM-1, Mac-1, MoAO Tumours 12 thrombo- CD41a, etc. 9.2.27 Antigen upregulated on cell growth spondin, VAP-1 Adhesion molecule 13 vitronectin Band 3 Upregulated during phagocytic 45 etc. protein activity Nerve cell proteoglycans 19 antibodies CD34(sialomu endothelial cells adhesion N-CAM cin) molecule (homophilic) antibodies CD31(PECAM endothelial cells (N-CAM) 1) integrin CD31 endothelial cells antibodies intermediate 50 CVB3 (PECAM-1) filaments RGD- integrins angiogenesis necrotic peptides cells/tissue antibodies CD44 tumour cells antibodies B2-micro general globulin 55 MHC class 1 general antibodies integrin tumours; angiogenesis Vectors comprising cytokines/growth factors/peptide antibodies hormones and fragments thereof Vector type Target Comments fareas of use Ref REFERENCES 60 Epidermal growth EGF-receptor or Tumours factor related a) Heider, K. H., M. Sproll, S. Susani, E. Patzelt, P. receptors Nerve growth NGF-receptor Tumours 21 Beaumier, E. Ostermann, H. Ahorn, and G. R. Adolf. factor 1996. “Characterization of a high-affinity monoclonal Somatostatin ST-receptor Tumours 22 antibody specific for CD44v6 as candidate for immuno 65 Endothelin Endothelin- Vessel wall therapy of Squamous cell carcinomas'. Cancer Immunol receptor ogy Immunotherapy 43: 245-253. US 6,261,537 B1 27 28

-continued -continued Vectors comprising cytokines/growth factors/peptide Miscellaneous protein and peptide vectors hormones and fragments thereof Vector type Target Comments fareas of use Ref Vector type Target Comments/areas of use Ref Retinal survival proteoglycans 39 Interleukin-1 IL-1-receptor Inflammation, activated 23 factor specific cells of different kinds receptors Interleukin-2 IL-2-receptor Inflammation, activated 24 Heparin-binding proteoglycans 40 cells of different kinds brain nitrogen specific Chemokines (ca. Chemokine Inflammation 25 receptors 20 different receptors, Apollipoprotein, proteoglycans 41 cytokines partly proteoglycans C.S. specific sharing apolipoprotein B receptors receptors) (e.g., LDL Tumour necrosis TNF-receptors Inflammation 15 receptor) factor Apollipoprotein E LDL receptor 42 Parathyroid PTH-receptors Bone diseases proteoglycans hormone Kidney diseases Adhesion- proteoglycans 43 Bone BMP-receptors Bone Diseases promoting Morphogenetic proteins, Protein e.g. Purpurin Calcitonin CT-receptors Bone diseases Viral coat proteoglycans 44 Colony Corresponding Endothelium 26 proteins, stimulating specific e.g. HIV. Herpes factors (G-CSF, receptors, Microbial fibronectin, 45 GM-CSF, M-CSF, proteoglycans adhesins, e.g. collagen, IL-3) 25 “Antigen 85' fibrinogen, Insulin like IGF-I receptor Tumours, complex of vitronectin, growth factor I other growing tissues mycobacteria heparan sulfate Atrial ANF-receptors Kidney, B-amyloid proteoglycans f-amyloid accumulates 46 Natriuretic vessel wall precursor in Alzheimer's disease Factor Tenascin, heparan sulfate, 47 Vasopressin Vasopressin Kidney, e.g. tenascin C integrins receptor vessel wall VEGF VEGF-receptor Endothelium, regions of angiogenesis Fibroblast FGF-receptors, Endothelium 27 growth factors Proteoglycans Angiogenesis Schwann cell proteoglycans 28 35 Vectors comprising non-peptide agonists/antagonists or growth factor specific non-bioactive binders of receptors for cytokines/growth receptors factors/peptide hormones/cell adhesion molecules Vector type Target Comments fareas of use Ref 40 Several agonists/antagonists 48 are known for such factors 49 acting through G-protein Miscellaneous protein and peptide Vectors coupled receptors Target Ref Endothelin Endothelin Vessel wall Vector type Comments/areas of use antagonist receptor Streptavidin Kidney Kidney diseases 29 45 Desmopressin Vasopressin Kidney Bacterial Fibronectin Vessel wall 3O (vasopressin receptor Vessel wall fibronectin analogue) binding proteins Demoxytocin Oxytocin Reproductive organs, Fc-part of Fc-receptors Monocytes 31 (Oxytocin Receptor Mammary glands, antibodies macrophages analogue) Brain liver 50 Angiotensin II Angiotensin II Vessel wall Transferrin transferrin Tumours 11 receptor receptors brain receptor vessel walls antagonists adrenal gland Streptokinase? thrombi thrombi CV-11974, tissue TCV-116 plasminogen non-peptide RGD- integrins Cells in immune system 50 analogues vessel wall etc. activator 55 Plasminogen, Fibrin Thrombi, 32 plasmin tumours Mast cell proteoglycans 33 proteinases Elastase proteoglycans 34 Lipoprotein proteoglycans 35 Vectors comprising anti-angiogenic factors lipase 60 Coagulation proteoglycans 36 Vector type Target Comments fareas of use Ref enzymes Extracellular proteoglycans 37 Angiostatin EC of tumors plasminogen fragment K Superoxide cartilage-derived EC of tumors J dismutase inhibitor Heparin cofactor proteoglycans 38 65 B-Cyclodextrin tumors, C II tetradecasulfate inflammation US 6,261,537 B1 29 30

-continued Vector molecules other than recognized angiogenetic Vectors comprising anti-angiogenic factors factors with known affinity for receptors associated with angiogenesis Vector type Target Comments/areas of use Ref Comments/ Vector type Target areas of use Ref fumagillin and tumors, E angiopoietin umors, B analogs inflammation inflammation Interferon-C. EC of tumors K C2-antiplasmin umors, Interferon-Y EC of tumors E inflammation combinatorial libraries, umors, for instance: interleukin-12 EC of tumors E compounds from inflammation compounds that bind linomide tumors, A. to basement membrane inflammation 15 after degradation endoglin umors, D medroxy- EC of tumors K inflammation progesterOne endosialin umors, D inflammation metalloproteinase EC of tumors K endostatin collagen umors, M inhibitors fragment inflammation Factor VII related umors, D pentosan polysulfate EC of tumors K antigen inflammation platelet factor 4 EC of tumors M fibrinopeptides umors, ZC inflammation Somatostatin EC of tumors K fibroblast growth factor, tumors, E Suramin EC of tumors K basic inflammation 25 Taxol EC of tumors K hepatocyte growth factor tumors, I inflammation thalidomide EC of tumors K insulin-like growth umors, R Thrombospondin EC of tumors K factor inflammation interleukins umors, e.g.: IL-8 I inflammation leukemia inhibitory umors, A. factor inflammation metalloproteinase umors, e.g., batimastat E inhibitors inflammation Vectors comprising angiogenic factors Monoclonal antibodies umors, for instance: to inflammation angiogenetic fac Comments, 35 tors or their re Vector type Target areas of use Ref ceptors, or to components of acidic fibroblast growth EC of tumors K the fibrinolytic actor system adenosine EC of tumors K peptides, for instance umors, B, Q Angiogenin EC of tumors K cyclic RGDFV inflammation Angiotensin II EC of tumors K 40 placental growth factor tumors, J basement membrane components tumors e.g., tenascin, M inflammation collagen IV placental umors, E basic fibroblast growth EC of tumors K proliferin-related inflammation actor protein Bradykinin EC of tumors K plasminogen umors, M Calcitonin gene-related EC of tumors K 45 inflammation peptide plasminogen activators umors, D epidermal growth factor EC of tumors K inflammation Fibrin tumors K plasminogen activator umors, U, V Fibrinogen tumors K inhibitors inflammation Heparin EC of tumors K platelet activating umors, inhibitors of A. histamine EC of tumors K 50 actor antagonists inflammation angiogenesis hyaluronic acid or fragments EC of tumors K platelet-derived growth tumors, E hereof actor inflammation Interleukin-1C. EC of tumors K pleiotropin umors, ZA aminin, laminin fragments EC of tumors K inflammation nicotinamide EC of tumors K proliferin umors, E platelet activating factor EC of tumors K 55 inflammation platelet-derived endothelial EC of tumors K proliferin related umors, E growth factor protein inflammation prostaglandins E1, E2 EC of tumors K selectins umors, e.g., E-selectin D spermine EC of tumors K inflammation spermine EC of tumors K SPARC umors, M Substance P EC of tumors K inflammation 60 ransforming growth factor-C. EC of tumors K snake venoms umors, O ransforming growth factor-f EC of tumors K (RGD-containing) inflammation Tumor necrosis factor-C. EC of tumors K Tissue inhibitor of umors, eg, TIMP-2 U vascular endothelial growth EC of tumors K metalloproteinases inflammation actor/vascular permeability thrombin umors, H actor inflammation vitronectin A. 65 thrombin-receptor-activat tumors, H ing tetradecapeptide inflammation US 6,261,537 B1 31 32

-continued -continued Vector molecules other than recognized angiogenetic Receptors/targets associated with angiogenesis factors with known affinity for receptors associated with angiogenesis Comments/ Vector type Target areas of use Ref Comments, platelet-derived growth tumors, Vector type Target areas of use Ref factor receptors inflammation Selectins: E-, P umors, thymidine phosphorylase tumors, D inflammation inflammation Sialyl Lewis-X umors, blood group antigen tumor growth factor tumors, ZA inflammation inflammation stress proteins: umors, molecular chaperones glucose regulated, inflammation heat shock families 15 and others syndecan umors, inflammation Receptors/targets associated with angiogenesis hrombospondin umors, inflammation Comments, TIE receptors umors, tyrosine kinases with Ig Vector type Target areas of use Ref inflammation and EGF-Iike dormains issue factor umors, biglycan umors, dermatan sulfate X inflammation inflammation proteoglycan issue inhibitor of umors, e.g., TIMP-2 CD34 umors, L metalloproteinases inflammation inflammation ransforming growth umors, CD44 umors, F actor receptor inflammation inflammation 25 urokinase-type umors, collagen type I, IV, umors, A. plasminogen activator inflammation VI, VIII inflammation receptor decorin umors, dermatan sulfate Y Vascular cellular umors, inflammation proteoglycan adhesion molecule inflammation dermatan sulfate umors, X (VCAM) proteoglycans inflammation Vascular endothelial umors, endothelin umors, G growth factor related inflammation inflammation protein endothelin umors, G Vascular endothelial receptors inflammation umors, growth factor-A inflammation fibronectin OS P receptor FIk-1/KDR, Flt-4 umors, VEGF receptor D 35 inflammation von Willebrand factor - tumors, FLT1 (fms-like umors, VEGF-A receptor O related antigen inflammation tyrosine kinase) inflammation heparan sulfate umors, p inflammation hepatocyte growth umors, I factor receptor (c-met) inflammation 40 insulin-like growth umors, R Oligonucleotide vectors factorfmannose-6- inflammation phosphate receptor Vector type Target Comments fareas of use Ref integrins: Tumors, D, and fis, inflammation P Oligonucleotides DNA made Tumours 51 integrin Cly?is, 45 complementary to available by Myocardial infarction integrin Clo?1, . laminin receptor repeated necrosis All other diseases that integrins C6, Sequences, e.g. involves necrosis integrins B1, genes for integrin Clf, ribosomal RNA, integrin Cly?is, Alu-sequences integrin Cls subunit of the fibronectin 50 Oligonucleotides DNA made Tumours 51 receptor complementary to available by integrin Clfs, disease-specific necrosis in a fibrin receptors. mutations (e.g. region of the Intercellular adhesion tumors, p mutated relevant disease molecule-1 and -2 inflammation oncogenes) Jagged gene product umors, T 55 Oligonucleotides DNA of infective Viral or bacterial 51 inflammation complementary to agent infections Ly-6 umors, a lymphocyte activation N DNA of infecting inflammation protein agent. matrix umors, D Triple or As in above As in above examples 51 metalloproteinases inflammation quadruple-helix examples MHC class II umors, forming inflammation 60 Oligonucleotides Notch gene product umors, T oligonucleotides DNA-binding Tumours inflammation with recognition protein, e.g. Activated endothelium Osteopontin OS Z. sequence for transcription Activated immune cells PECAM umors, alias CD31 P DNA- or RNA factors (often inflammation binding proteins Overexpressed/ plasminogen activator tumors, ZC 65 activated in receptor inflammation tumours Or US 6,261,537 B1 33 34

-continued -continued Oligonucleotide vectors Receptors comprising DNA-binding drugs Vector type Target Comments/areas of use Ref Vector type Target Comments fareas of use Ref activated echinomycin endotheliumf bleomycin etc. immune cells

Receptors comprising protease Substrates Modified Oligonucleotide vectors Vector type Target Comments fareas of use Ref Vector type Target Comments fareas of use Ref 15 Peptidic or non cathepsin B Tumours, a variety of which Phosphorothioate As for As for unmodified oligos 51 peptidic may more or less specifically oligos unmodified Substrates overexpress proteases of oligos various kinds, e.g. 2'-O-methyl As for As for unmodified oligos 51 Cathepsin B substituted unmodified oligos oligos circular oligos As for As for unmodified oligos 51 unmodified oligos oligos As for As for unmodified oligos 51 Receptors comprising protease inhibitors containing unmodified 25 hairpin oligos Target Comments fareas of use Ref Structure to Vector type decrease Peptidic or non Cathepsin B Tumours, a variety of degradation peptidic which may more or less oligos with As for As for unmodified oligos 51 inhibitors specifically overexpress terminal unmodified e.g. N-acetyl proteases of various phosphorothioate oligos Leu-Leu kinds, e.g. Cathepsin B 2'-fluoro oligos As for As for unmodified oligos 51 norleucinal unmodified bestatin Aminopeptidases Tumours, oligos (2S,3R)-3- e.g. on cell Surfaces 2'-amino oligos As for As for unmodified oligos 51 Amino-2-hydroxy unmodified 4-phenyl oligos 35 butanoyl-L- DNA-binding As for Increased binding affinity 52 eucine drugs conjugated unmodified as compared to pure oligos hydrochloride) to oligos (for oligos Pefabloc (4-(2- Serine proteases Tumours, examples, see aminoethyl)- vessel wall below) benzenesulfonyl etc. Peptide Nucleic As for Increased binding affinity 53 40 fluoride Acids (PNAs, unmodified and stability compared to hydrochloride) oligonucleotides oligos standard oligos. Commercially Angiotensin Endothelial cells with a peptide available converting backbone) inhibitors enzyme e.g. kaptopril 45 enalapri ricionopril Low specificity Coagulation Vessel wall injury, non-peptidic factors tumours, Nucleoside and nucleotide vectors compounds etc. Protease nexins proteoglycans 56 Vector type Target Comments fareas of use Ref 50 (extracellular protease Adenosine or Adenosine Vessel wall 54 inhibitors) analogues receptors Heart Antithrombin proteoglycans, 57 ADP, UDP, UTP Various Many tissues, e.g. brain, 55 Coagulation and others nucleotide spinal cord, kidney, spleen factors receptors 55

Vectors from combinatorial libraries Receptors comprising DNA-binding drugs 60 Vector type Target Comments fareas of use Ref Vector type Target Comments fareas of use Ref Antibodies with Any of above Any diseased or normal 58, acridine DNA made Tumours, Structure targets-or may structure of interest, e.g. 59, derivatives available by Myocardial infarction and determined be unknown when thrombi, tumours or walls 60 distamycin necrosis all other diseases involving during make functional of myocardial vessels netropsin necrosis or other processes 65 generation selection of actinomycin D liberating DNA from cells process vector binding US 6,261,537 B1 35 36

-continued

Vectors from combinatorial libraries Glyco) Lipid vectors Ref Vector type Target Comments/areas of use Ref Vector type Target Comments fareas of use GM1 gangliosides cholera bacteria diagnosis/treatment of to chosen in the cholera diseased gastrointestinal Structure tract Peptides with Any of above Any diseased or normal 58, platelet PAF receptors diagnosis of inflammation sequence targets-or may structure of interest, e.g. 59, activating factor (PAF) determined be unknown when thrombi, tumours or walls 60 antagonists during make functional of myocardial vessels Prostoglandin Prostoglandin diagnosis of inflammation generation selection of antagonists of receptors process vector binding 15 inflammation to chosen Thromboxane Leukotriene diagnosis of inflammation diseased antagonists of receptors inflammation Structure Oligonucleotides Any of above Any diseased or normal 58, with sequence targets-or may structure of interest, e.g. 59, determined be unknown when thrombi, tumours or walls 60 during make functional of myocardial vessels generation selection of Small molecule vectors process vector binding to chosen Vector type Target Comments fareas of use Ref diseased 25 Adrenalin Corresponding Structure receptors Modifications of Any of above Any diseased or normal 58, Betablockers Adrenergic beta- Myocardium for beta-1 oligos obtained targets-or may structure of interest, e.g. 59, receptors blockers Alpha-blockers Adrenergic Vessel wall as above be unknown when thrombi, tumours or walls 60 alpha-receptors make functional of myocardial vessels benzodiazepines selection of serotonin Serotonin vector binding analogues receptors to chosen anti-histamines Histamine- Vessel wall receptors diseased Acetyl-choline ACh-receptors Structure 35 receptor Other chemicals Any of above Any diseased or normal 58, antagonists with structure targets-or may structure of interest, e.g. 59, Verapamil Ca'-channel Heart muscle determined be unknown when thrombi, tumours or walls 60 blocker during nifedipin Cat-channel Heart muscle make functional of myocardial vessels blocker generation selection of 40 Amiloride Na'/H'-exchanger Blocks this exchanges in process vector binding kidney and is generally to chosen upregulated in cells diseased stimulated by growth Structure factors. Digitalis Na/K-ATP-ases myocardium glycosides peripheral vasculature, 45 central nervous system Thromboxaef Thromboxanef Vessel wall, Prostaglandin prostaglandin Endothelium receptor receptors Carbohydrate vectors antagonists or agonists Vector type Target Comments/areas of use Ref 50 Glutathione Glutathione Lung, receptors Brain CO macrophages general activation? Leukotriene glycoproteins inflammation receptors oligosaccharides Asialo- liver 61 Biotin biotin transport 65 with terminal glycoprotein protein on cell galactose receptor 55 surface Hyaluronan aggrecan (a 62 Folate folate transport Tumours 66 proteoglycan) protein on cell “link proteins' surface cell-surface Riboflavin riboflavin 67 receptors: CD44 transport Mannose 63 Blood brain barrier, 60 protein on cell Brain tumours and other surface diseases causing changes in BBB Bacterial Blood brain barrier, 64 glycopeptides Brain tumours and other REFERENCES diseases causing changes in BBB 65 1. Nourshargh, S. and Williams, T. J. (1995). Semin. Cell Biol. 6, 317-326. 2. Simmons, D. L. (1996). TIBTECH 14, 221-222. US 6,261,537 B1 37 38 3. Baumhueter, S., Dybdal, N., Kyle, C., and Lasky, L. A. 32. Blume, G., Cevc, G., Crommelin, M. D., Bakker (1994). Blood 84, 2554–2565. Woudenberg, I. A., Kluft, C., and Storm, G. (1993). 4. Rosenthall, L. and Leclerc, J. (1995).Clin. Nucl. Med. 20, Biochim. Biophys. Acta 1149, 180-184. 398-402. 33. Stevens, R. L., and K. F. Austen. 1989. Immunology 5. Contrino, J., Hair, G., Kreutzer, D. L., and Rickles, F. R. Today 10: 381-386 (1996). Nature Med 2, 209-215. 34. Redini, F., J. M. Tixier, M. Petitou, J. Chouay, L. Robert, 6. Torchilin, V. P., Narula, J., Halpern, E., and Khaw, B. A. and W. Hornebeck. 1988. Biochen. J. 252: 515-19. (1996). Biochim. Biophys. Acta 1279, 75–83. 35. Persson, B., O. G. Bengtsson, S. Enerback, T. 7. Wittig, B. M., Hach, A., Hahn, K., Meyer Zum, B., KH, Olivecrona, and H. Jornwall. 1989. Eur. J. Biochem. 179: and Dippold, W. G. (1993). Eur. J. Cancer 29A, 39-45. 1327-1329. 8. Mariani, G., Molea, N., Bacciardi, D., Boggi, U., 36. Danielsson, A., E. Raub, U. Lindahl, and I. Bjork. 1986. Fornaciari, G., Campani, D., Salvadori, P. A., Giulianotti, J. Biol. Chen. 261: 15467-73. P. C., Mosca, F., and Gold, D. V. (1995). Cancer Res. 55, 37. Adachi, T., and S. L. Marklund. 1989. J. Biol. Chem. 5911S-5915S. 264: 8537-41. 9. Scott, A. M., Rosa, E., Mehta, B. M., Divgi, C. R., Finn, 15 38. Maimone, M. M., and D. M. Tollefsen. 1990. J. Biol. R. D., Biedler, J. L., Tsuruo, T., Kalaigian, H., and Larson, Chen. 265: 18263-71. S. M. (1995). Nucl. Med. Biol. 22, 497-504. 39. Berman, P., P. Gray, E. Chen, K. Keyser, and D. e. a. 10. Panchal, R. G. et al. (1996), Nat. Biotechnol. 14, Eherlich. 1987. Cell 51: 135-42. 852-856. 40. Huber, D., P. Gautschi-Sova, and P. Böhlen. 1990. 11. Wagner, E. et al. (1994), Adv. Drug Deliv. Rev. 14, Neurochem . Res. 15: 435-439 113-115. 41. P. Vijayagopal, B. Radhnakrishnamurthy, G. S. Beren 12. Ballou, B., Fisher, G. W., Waggoner, A. S., Farkas, D. L., son. 1995. Biochim. Biophys. Acta 1272: 61-67. Reiland, J. M., Jaffe, R., Mujumdar, R. B., Mujumdar, S. 42. Dyer, C. A., and L. K. Curtiss. 1991. J. Biol. Chem. 266 R., and Hakala, T. R. (1995). Cancer Immunol. Immu (34): 22803–22806. nother. 41, 257-263. 25 43. Rauvala, H., J. Merenmies, R. Pihlaskari, M. 13. Salmi, M. and Jalkanen, S. (1995). Eur. J. Immunol. 25, Kormalainen, M. L. Huhtala, and P. Panula. 1988. J. Cell 28O3-2812. Biol. 107: 2293-2305. 14. McEver, R. P. 1992. Curr. Opin. Cell Biol. 4, 840–49. 15. DeLisser, H. M., Newman, P. J., and Albelda, S. A. 44. Wu Dunn, D., and P. G. Spear. 1989. J. Virol. 63: 52–58. (1994). Immunol. Today 15, 490–495. 45. Patti, J. M., and M. Hook. 1994. Curr. Opin. Cell Biol. 16. Metcalf, B. W. et al., eds. (1994): Cellular Adhesion. 6: 752-758. Molecular Definition to Therapeutic Potential. Plenum 46. Snow, A. D., M. G. Kinsella, E. Parks, R. T. Sekiguchi Press, New York, 1994. et al. 1995. Arch. Biochem. Biophys. 320: 84-95 17. Felding-Habermann, B. and Cheresh, D. A. 1993. Curr: 47. Fischer, D., R. Chiquet-Ehrismann, C. Bernasconi, M. Opin. Cell Biol. 5,864-868. Chiquet. 1995. J. Biol. Chem. 270: 3378–84. 18. Schwarzbauer, J. E. 1991. Curr. Opin. Cell Biol. 3, 35 48. Wells, J. A. (1996), Science 273, 449–450. 786-791. 49. Longo, F. M. and Mobley, W. C (1996), Nat. Biotechnol. 19. Burg, M. A., Halfter, W., Cole, G. J. 1995. J. Neurosci. 14, 1092. Res. 41, 49-64. 50. Samanen, J. M. et al. (1994), in Metcalf, B. W. et al. 20. Dean, C.J., Eccles, S.A., Valeri, M., Box, G., Allan, S., (eds.): Cellular Adhesion. Molecular Definition to Thera McFarlane, C., Sandle, J., and Styles, J. (1993). Cell 40 peutic Potential. pp-259-290. Plenum Press, New York, Biophys. 22, 111-127. 1994. 21. LeSauteur, L. et al. (1996), Nat. Biotechnol. 14, 51. Ellington, A. D. and Conrad, R. (1995). In Biotechnol 1120–1122. ogy Annual Review, Vol 1. M. R. Elgewely, ed. (Elsevier 22. Wiseman, G. A. and Kvols, L. K. (1995). Semin. Nucl. Science Pub), pp. 185-214. Med. 25, 272-278. 45 52. Asseline, V. et al. (1994), PNAS USA 81,3297-3301. 23. van der Laken, C. J., Boerman, O. C., Oyen, W. J., van 53. Nielsen, P. E. et al. (1991), Science 254, 1497–1500. de Ven, M. T., Claessens, R. A., van der Meer, J. W., and 54. Shepherd, R. K. et al. (1996), Circ. Res. 78,627-634. Corstens, F. H. (1995). Eur. J. Nucl. Med. 22, 1249–1255. 55. Webb, T. E. et al. (1996), Mol. Pharmacol. 50,258-265. 24. Signore, A., Chianelli, M., Ferretti, E., Toscano, A., 56. Farrell, D. H., and D. D. Cunningham. 1986. Proc. Natl. Britton, K. E., Andreani, D., Gale, E. A., and Pozzilli, P. 50 Acad. Sci. USA 83: 6858-62 (1994). Eur. J. Endocrinol. 131, 57. Craig, P. A., S. T. Olson, and J. D. Shore. 1989. J. Biol. 25. Howard, O. M. Z. et al. (1996), TIBTECH 14, 46–51. Chen. 264: 5452-61. 26. Korpelainen, E.I., Gamble, J. R., Smith, W. B., Dottore, 58. Abelson, J. N., ed., (1996): Meth. Enzymol. 267. Com M., Vadas, M. A., and Lopez, A. F. (1995). Blood 86, binatorial Chemistry. Academic Press, San Diego 1996. 176-182. 55 59. Cortese, R, ed. (1996): Combinatorial Libraries. 27. Klagsbrun, M. 1990. “Curr. Opin. Cell Biol. 2: 857–863. Synthesis, Screening and Application Potential. Walter de 28. Ratner, N., D. Hong, M. A. Lieberman, R. P. Bunge, and Gruyter. Berlin 1996. L. Glaser. 1988. Proc. Natl. Acad. Sci. USA 85: 6992–6. 60. Wu, A. M. (1996), Nat. Biotech. 14, 429–431. 29. Schechter, B., Arnon, R., Colas, C., Burakova, T, and 61. Wadhwa, M. S. (1995), Bioconj. Chem. 6, 283-291. Wilchek, M. (1995). KIDNEY INTERNATIONAL.47, 60 62. Toole, B. P. 1990. Curr. Opin. Cell Biol. 2,839–844 1327-35. 63. Umezawa, F. and Eto, Y. (1988) Biochem. Biophys. Res. 30. Valentin-Weigand, P., Talay, S., R, Kaufhold, A., Commun. 153, 1038-1044 Timmis, K., N, and Chhatwal, G., S (1994). MICRO 64. Spellerberg, B., Prasad, S., Cabellos, C., Burroughs, M., BIAL. PATHOGENESIS. 17, 111-20. Cahill, P. and Tuomanen, E. (1995) J. Exp. Med. 182, 31. Betageri, G. V., Black, C. D., Szebeni, J., Wahl, L. M., 65 1037-1043. and Weinstein, J. N. (1993). J. Pharm. Pharmacol. 45, 65. Shi, F. L., C. Bailey, A. W. Malick, and K. L. Audus. 48-53. 1993. Pharmaceutical Research 10: 282-288 US 6,261,537 B1 39 40 66. Lee, R. J., and P. S. Low. 1995. Biochim. Biophys. amiquinsin, amisome tradine, amisulpride, amiterol, Acta-Biomembranes 1233: 134-144 amithioZone, amitraz, amitriptyline, amitriptylinoxide, 67. Said, H. M., D. Hollander, and R. Mohammadkhani. amiXetrine, amlexanoX, amlodipine, amobarbital, 1993. Biochim. Biophys.Acta 1148: 263-268. a modiaquine, amogastrin, amola none, a monofide, 68. Passe, T.J., D. A. Bluemke and S. S. Siegelman. 1997. 5 amoproxan, amopy roquin, amorolfine, amocanate, Radiology 203: 593-600. amo Sulalol, amotriphene, amoxapine, amoxecaine, Representative examples of drugs useful in accordance amoxicillin, amoxydramine camsilate, amperozide, with the invention include: abamectin, abundiazole, amphecloral, amphenidone, amphetamine, amphotalide, acaprazine, acabrose, acebrochol, aceburic acid, acebutolol, amphotericin B, amplicillin, ampiroXicam, amprolium, acecainide, ace carbromal, ace clidine, ace clofenac, ampyrimine, ampyZine, amduinate, amrinone, amsacrine, ace dapsone, ace diasulfone, acedoben, ace fluranol, amygdalin, amylene, amylmetacresol, amyl nitrite, anage acefurtiamine, acefylline clofibrol, acefylline piperazine, Stone acetate, anagrelide, anaXirone, anazocine, anazolene, aceglatone, aceglutamide, ace glutamide aluminium, ancarolol, ancitabine, androstanediol, androstanol acemetacin, acenocoumarol, aceperone, acepromazine, propionate, androstenetrione, androstenonol propionate, aceprometazine, acequinoline, aceSulfame, acetaminophen, 15 anethole, anguidine, anidoxime, anilamate, anilleridine, acetaminoSalol, acetanilide, acetarSone, acetazolamide, aniline, anilopam, anipamil, aniracetam, anirolac, anisacril, acetergamine, acetiamine, acetiromate, acetohexamide, anisindione, anisopirol, aniSoylbromacrylic acid, acetohydroxamic acid, acetomeroctol, acetophenazine, anitraZafen, anpirtoline, anSOXetine, antafenite, antazoline, acetorphine, acetoSulfone, acetriozate, acetryptine, acetyl anta Zonite, anthelmycin, anthiolimine, anthralin, choline chloride, acetylcolchinol, acetylcy Steine, anthramycin, antienite, antimony potassium tartrate, anti acetyldigitoxin, acetylleucine, acetylsalicyclic acid, mony thioglycolate, antipyrine, antrafenine, apalcillin, acevaltrate, aceXamic acid, acifran, acipimox, acitemate, apa Zone, apicycline, apomorphine, apo Vincamine, acitretin, acivicin, aclantate, aclarubicin, aclatonium apraclonidine, apramycin, aprindine, aprobarbital, aprofene, napadisilate, acodazole, aconiazide, aconitine, acoXatrine, aptazapine, aptocaine, arabinosylmercaptopurine, aranotin, acridorex, acrihellin, acrisorcin, acrivastine, acrocinide, 25 arbaprostil, arbekacin, arclofenin, arfendazam, arginine, acronine, actinoquinol, actodigin, acyclovir, adafenoxate, arginine glutamat, arildone, arnolol, aronixil, arotinolol, adamexine, ademetionine, adenosine phosphate, adibendan, arpinocid, arpromidine, arsanilic acid, arSthinol, artemisinin, adicillin, adimolol, adinazolam, adiphenine, aditeren, articaine, asaley, ascorbic acid, ascorbyl palmitate, aditoprim, adrafinil, adren alone, afloqualone, afurolol, asocainol, aspartame, aspartic acid, asperlin, aspoxicillin, aganodine, ajmaline, aklomide, alacepril, alafosfalin, ala astemizole, atameStane, atenolol, atipameZole, atiproSin, nine mustard, alanosine, alaproclate, alazanine triclofenate, atolide, atracurium besilate, atromepine, atropine, atropine albendazole, albendazole oxide, albuterol, albutoin, oxide, auranofin, aurothoiglucose, aurothioglycanide, alclofenac, alcometasone dipropionate, alcloxa, alcuronium avilamycin-A, avridine, aXamozide, azabon, azabuperone, chloride, aldioxa, aldosterone, alepride, aletamine, aZacitodine, a Zaclor Zine, a Zaconazole, a Zacosterol, alexidine, alfacalcidol, alfadeX, alfadolone, alfaprostol, 35 azacyclonol, azaftoZine, azaguanidine, azaloxan, azametho alfaxalone, alfentanil, alfuZosin, algestone acetonide, alge nium bromide, azamulin, azanator, azanidazole, azaperone, Stone acetophenide, alibendol, aliconazole, allifedrine, aZapicyl, a Zaprocin, a Zaquinzole, a Zaribine, a Zarole, aliflurane, alimadol, alinidine, alipamide, alitame, aZaSerine, azaspirium chloride, azastene, aZaStrptonigrin, alizapride, allantoin, alletorphine, allobarbital, alloclamide, aZatodine, azathioprine, azauridine, azelastine, aZepeXole, allocupreide, allomethadione, allopurinol, allylestrenol, 40 aZepindole, azetepa, azidamfenicol, azidocillin, azimeXon, allyl isothicyanate, allylprodine, allylthiourea, almadrate aZintamide, azipramine, azithromycin, azlocillin, azolimine, Sulfate, almasilate, almecillin, almestrone, alminoprofen, a ZoSemide, a Zotomycin, aztreonam, a Zumolene, almitrine, almoxatone, alonacic, alonimid, aloxiStatin, bacampicillin, baclofen, bacmecillinam, balsalazide, aloZafone, alpertine, alphacetylmethadol, alphameprodine, bamaluzole, bambuterol, bamethan, bamifylline, bamipine, alphamethadol, alphaprodine, alphavinylaziridinoethyl 45 bamnidazole, baduiloprim, barbexaclone, barbital, acetate, alpidem, alpiropride, alprazolam, alprenolol, barucainide, batilol, baZinaprine, becanthone, beclamide, alproStadil, alrestatin, altanserin, altapizone, alteconazole, beclobrate, beclomethasone dipropionate, beclotiamine, althiazide, altrenogest, altretamine, aluminium acetate, alu befiperide, befunolol, befuraline, bekanamycin, belarizine, minium clofibrate, aluminium Subacetate, alverine, amadi beloxamide, be marinone, be me gride, be metizide, none acetate, amafolone, amanozine, amantadine, amanta 50 be mitradine, benacty Zine, be nafeintrine, benanserin, nium bromide, amantocillin, ambasilide, ambaZone, benapry Zine, benaxibine, benazepril, bencianol, bencisteine, ambenonium chloride, ambenoxan, ambroXol, ambruticin, benclonidine, bency clane, bendamustine, bendaZac, ambucaine, ambucetamide, ambuphylline, ambuSide, ambu bendazol, benderizine, bendroflumethiazide, benethamide tonium bromide, amcinafal, amcinafide, amcinonide, penicillin, benexate, benflorex, benfoSformin, benfotiamine, amdinocillin, amdinocillin pivoxil, amebucort, amedalin, 55 benfurodil he misuccinate, benhepaZone, benidipine, ametantrone, ameZepine, ameZinium metilsulfate, amfenac, benmoxin, benolizime, benorilate, benorterone, benoxafos, amfepentorex, amfetaminil, amflutizole, amfonelic acid, benoxaprofen, benoximate, benperidol, beinproperine, amicarbalide, amicibone, amicloral, amicycline, amidantel, benrixate, benSalan, benSeraZide, benSuldaZic acid, amidapsone, amidephrine, amiflamine, amifloverine, bentazepam, bentemazole, bentiamine, bentipimine, amifloxacin, amifostine, amikacin, amikhelline, amiloride, 60 bentiromide, benurestat, benzaldehyde, benzalkonium aminacrine, amindocate, amineptine, aminobenzoic acid, chloride, benzaprinoxide, benzarone, benzbromarone, aminocaproic acid, aminoethyl nitrate, aminoglutethimide, benze Strol, benzethidine, ben Zethonium chloride, aminohippuric acid, aminometradine, aminopentamide, ben Zetimide, ben Zilonium bromide, ben Zindopyrine, aminophylline, aminopromazine, aminopterin, aminopyrine, benziodarone, benzmalecene, benznidazole, benzobarbital, aminoquinol, aminoquinuride, aminorex, aminoSalicyclic 65 benzocaine, benzoclidine, benzoctamide, benzodepa, ben acid, aminothiadiazole, aminothiazole, amiodarone, Zododecinium chloride, benzoic acid, benzoin, benzonatate, amiperone, amiphe azole, amipizone, amiprilose, benzopyrronium bromide, benzoquinium chloride, US 6,261,537 B1 41 42 benzotript, benzoxicuine, benzoxonium chloride, benzoyl butriptyline, butropium bromide, butylated hydroxyanisole, peroxide, benzoylpas, benzphetamine, benzpiperylon, ben butylated hydroxytoluene, butylparaben, butynamine, Zpyrinium bromide, ben Zguercin, benzquinamide, buZepide metiodide, cabastine, cabergoline, cadralazine, benzthiazide, benztropine, benzydamine, benzylpenicillin, cafaminol, cafedrine, caffeine, calcifediol, calcitrol, calcium benzylsulfamide, beperidium iodide, bephenium naphtoate, citrate, calcium dobesilate, calcium glubionate, calcium bepiastine, bepridil, beraprost, berberine Sulfate, bermastine, gluceptate, calcium gluconate, calcium glycerophosphate, bermoprofen, berythromycin, beSulpamide, beslunide, beta calcium hypophosphite, calcium lactate, calcium caroteine, betacetylmethadol, betahistine, be taine, lactobionate, calcium levulinate, calcium mandelate, cal betameprodine, betamethadol, betamethasone, betametha cium pantothenate, calcium phosphate dibasic, calcium Sone acetate, betamethasone acibutate, betamethasone phophate tribasic, calcium Saccharate, calcium Stearate, benzoate, betamethasone dipropionate, betamethasone calusterone, camazepam, cambendazole, camiverine, phosphate, betamethasone Valerate, betamicin, betaprodine, camoStast, camphotamide, camptothecin, camylofin, betaxolol, betazole, bethanechol chloride, bethanidine, can bisol, cannabinol, can renoic acid, can re none, betiatide, betoxycaine, bevantolol, bevonium metilsulfate, cantharidine, capobenic acid, capreomycin, caproxamine, bezafibrate, bezitramide, bialamicol, bibenzonium bromide, 15 capsaicine, captamine, captodiame, captopril, capuride, bibrocathol, bicifadine, biclodil, biclofibrate, biclotymol, caracemide, caramiphen, carazolol, carbachol, carbadox, bico Zamycin, bidima Zium iodine, bietamiverine, carbaldrate, carbamazepine, carbamide peroxide, carbantel bietaserpine, bife melane, bife pramide, bifluranol, lauryl Sulfate, carbaril, carbarSone, carbaspirin calcium, bifonazole, binedaline, binfloxacin, binfibrate, bioallethrin, carbaZeran, carbazochrome, carbazachrome Salicylate, car bioresmethrin, biotin, bipenamol, biperiden, biphenamine, bazachrome Sulfonate, carbazocine, carbeniciltin, carbeni biriperone, bisacodyl, bisantrene, bis(aziridinyl)butanediol, cillin indanyl, carbencillin phenyl, carbenoxolone, bisbendazole, bisbentiamine, bisfenaZone, bisfentidine, bis carben Zide, carbestrol, carbetapentane, carbidopa, muth betanaphthol, bismuth-triglycollamate, bismuth carbimazole, carbinoxamine, carbiphene, carbocloral, Subgallate, bismuth Subsalicylate, bisorbin, bisoprolol, carbocysteine, carbofenotion, carbol-fuSchin, carbomycin, bisorcic, bioxatin acetate, bispyrithione magSulfeX, 25 carboplatin, carboprost, carboprost methyl, carboquone, bithionol, bithionoloxide, bitipaZone, bitoterol, bitOScantate, carbromal, carbubarb, carburazepam, carbutamide, bleomycin, blue nSomycin, bofumustine, bolandiol carbuterol, carcainium chloride, carebastine, carfentanil, dipropionate, bolasterone, bolazine, bolde none carfimate, carisoprodol, carmantadine, carmetizide, undecylenate, bolenol, bolmantalate, bometolol, bopindolol, carmofur, carmustine, carnidazole, carnitine, carocainide, bornaprine, bornaprolol, bornelone, botiacrine, boxidine, caro Verine, caro Xa Zone, carpe ridine, cape rone, brallobarbital, braZergoline, brefonalol, bremazocine, carphenazine, carpindolol, carpiramine, carprofen, carpro brequinar, bretylium tosylate, brindoxime, brivundine, nium chloride, carSalam, cartaZolate, carteolol, carubicin, brobactam, broclepride, brocresine, brocrinat, brodimoprim, carumonam, carvedilol, carZenide, carZolamide, cathine, brofaromine, brofeZil, brofoXine, brolaconazole, cathinone, cefaclor, cefadroxil, cefalonium, cefaloram, brolamfetamine, bromacrylide, bromadoline, bromamid, 35 cefamandole, cefamandole naftate, cefaparole, cefatrizine, bromazepam, brom chlore none, brome bric acid, cefazaflur, cefazedone, cefazolin, cefbuperaZone, cefcanel, bromerguride, brometenamine, bromfenac, brom hexine, cefcanel dialoxate, cefedrolor, cefempidone, cefepime, bromindione, bromisoValum, bromociclen, bromocriptine, cefetamet, cefetrizole, cefvitril, cefixime, cefimenoXime, bromodiphenhydramine, bromofenofos, bromopride, cefmepidium chloride, cefimetazole, cefminox, cefodizime, bromoxandide, bromperidol, bromperidol decanoate, 40 cefonizid, cefoperaZone, ceforanide, cefotaxime, cefotetan, brompheniramine, bronopol, broparestrol, broperamole, cefotiam, cefoxazole, cefoXitin, cefpimizole, cefpiramide, bropirimine, broquinaldol, broSotamide, broSuximide, ce fpirome, cefpo do Xime, cefpodoxime proxetil, brotianide, brotizolam, brovaneXine, brovincamine, cefauinome, cefrotil, cefroXadine, cefSulodin, cefSumide, broXaldine, broXaterol, broxitalamic acid, broXuridine, ceftazidime, cefteram, cefteZole, ceftiofur, ceftiolene, broxyquinoline, bruceantin, brucine, bucainide, bucetin, 45 ceftioxide, ceftizoxime, ceftriaxone, cefuracetime, buciclovir, bucillamine, bucindolol, bucladeSine, buclizine, cefuroxime, cefuraxime axetil, cefurZonam, celiprolol, buclosamide, bucloxic acid, bucolome, bucricaine, cephacetrile, cephalexin, cephaloglycin, cephaloridine, bucromarone, bucrylate, bucumolol, budesonide, budipine, cephalothin, cephapirin, cephradine, cetaben, cetamolol, budotitane, budralazine, bufenadrine, bufeniode, bufetolol, cetheXonium chloride, cetiedil, cetirizine, cetocycline, bufeXamac, bufeZolac, buflomedil, bufogenin, buformin, 50 cetoheXazine, cetophenicol, cetotiamine, cetoxime, bufrolin, bufuralol, bumadizone, bumecaine, bumepidil, ce traXate, chaulmo Sulfone, chendiol, chiniofon, bu metanide, bumetrizole, bunaftine, bunamidine, chlophedianol, chloracy Zine, chloral betaine, chloral bunamiodyl, bunaprolast, bunaZosin, bunitrolol, bunolol, hydrate, chloralo Se, chlorambucil, chloramine, buparvaquone, bupicomide, bupivacaine, bupranolol, chloramphenicol, chloramphenicol palmitate, chloram buprenorphine, bupropion, buquine ran, buquinolate, 55 phenicol Succinate, chlora Zanil, chlorbenzoxamine, buquiterine, buramate, burodiline, buSpirone, buSulfan, chlorb et amide, chlorcyclizine, chlordan to in, butabarbital, but acaine, but acetin, but a clamol, chlordiazepoxide, chlordimorine, chlorhexadol, butadia Zamide, butafosfan, but alamine, but albital, chlorhexidine, chlorhexidine phosphanilate, chlorindanol, butamben, butamirate, butamisole, butamoxane, butanediol chlorisondamine chloride, chlormadinone acetate, cyclic Sulfite, butanilicaine, butaniXin, butanserin, 60 chlormero drin, chlorime Zanone, chlormidazole, butantrone, butape razine, but a prost, but averine, chloronaphazine, chloroaZodin, chlorobutanol, chlorocreSol, butedronate, buterizine, bute tamate, but ethamine, chlorodihydroxyandrostenone, chloroethyl meSylate, buthiazide, butibufen, butidrine, butikacin, butilfenin, 5-chloro-3'-fluoro-2'3-dideoxyuridine, chloroguanide, butinazocine, butinoline, butirosin, butixirate, butobendine, chlorophe no thane, chlorop rednisone acetate, butoconazole, butocrolol, butoctamide, butofilolol, 65 chloroprocaine, chloropyramine, chloroquine, butonate, butopamine, butopiprine, butoprozine, butopy chloroSerpidine, chlorothen, chlorothiazide, chlorotriansene, rammonium iodide, butorphanol, butoxamine, butoxylate, chloroxine, chloroxylenol, chlorozotocin, chlorphenesin, US 6,261,537 B1 43 44 chlorphenesin carbamate, chlorpheniramine, chlorphenoc colchicine, colestolone, colfenamate, colforsin, colterol, tium amsonate, chlorphenoxamine, chlorphentermine, conessine, conorphone, copper gluconate, cormethasone chlorproetha Zine, chlorproguanil, chlorpromazine, acetate, corticosterone, cortisone acetate, cortisu Zol, chlorpropamide, chlorprothixene, chlorquinaldol, cortivaZol, cortodoxone, cotarnine chloride, cotinine, chlortetracycline, chlorthalidone, chlorthenoxazine, cotriptyline, coumaphos, coumaZoline, coumermycin, chlorZoaXaZone, chloe calciferol, cholic acid, choline coume tarol, creatinolfosfate, crisinatol, croconazole, chloride, choline glycerophosphate, chromocarb, cromakalim, cromitrile, cromolyn, cropropamide, chromonar, ciadox, ciameXon, cianergoline, cianidol, crospovidone, crotamiton, crotetamide, crotoniazide, cianopramine, ciapilome, cicaprost, cicarperOne, ciclactate, crufomate, cup rimy Xin, cuproxoline, cyacetacide, ciclafrine, ciclaZindol, cicletanine, ciclomenol, ciclonicate, cyamemazine, cyanocobalamine, cyclacillin, cyclandelate, ciclonium bromide, ciclopiroX, ciclopramine, cicloprofen, cyclarbamate, cyclazocine, cyclazodone, cyclexanone, cicloprolol, ciclosidomine, ciclotizolam, ciclotropium cyclindole, cycliramine, cyclizine, cyclobarbital, bromide, cicloxilic acid, cicloxolone, cicortonide, cicrotic cyclobendazole, cycloben Zaprine, cyclobutoic acid, acid, cido Xepin, cifenline, cifostodine, ciglitaZone, cyclobutyrol, cyclofenil, cycloguanil, cloheximide, ciheptolane, ciladopa, cilastatine, cilaZapril, cilaZaprilat, 15 cyclole u cine, cyclo men ol, cyclomethic one, cilobamine, cillofungin, ciloStamide, ciloStaZol, ciltoprazine, cyclomethycaine, cyclopentamine, cyclopenthiazide, cimaterol, cimenoXin, cimepanol, cimetidine, cimetropium cyclopentolate, cyclope naZine, cyclophosphamide, bromide, cimoxatone, cinchonine, cinchophen, cinecromen, cyclopregnol, cyclopyrronium bromide, cycloSerine, cine paXadil, cinepaZet, cinepazic acid, cinepa Zide, cycloSporine, cyclothiazide, cyclovalone, cycotiamine, cinfenine, cinfenoac, cinflumide, cingestol, cinitapride, cy crimine, cyheptamide, cyheptropine, cynarine, cinmetacin, cinnamaverine, cinnamedrine, cinnarizine, cin cype namine, cypothrin, cyprazepam, cyprenophine, narizine clofibrate, cinnofuradione, cincotramide, cinodine, cyprodenate, cyproheptadine, cyprolidol, cyproduinate, cinolazepam, cinoquidox, cinoaxin, cinoxate, cinoXolone, cyproterone acetate, cyproximide, cystine, cytarabine, cinooxopaZide, cinperene, cinprazole, cinpropa Zide, dacarbazine, dacemazine, dacisteine, dacinomycin, dacuro cinromide, cintaZone, cintriamide, cinperone, ciprafamide, 25 nium bromide, dagapamil, dalbraminol, daledalin, ciprafaZone, ciprefadol, ciprocinonide, ciprofibrate, daltroban, dametralast, damotepine, danazol, danitracen, ciprofloxacin, cipropride, ciprocquaZone, ciprostene, danosteine, danthron, dantrolene, dapiprazole, dapsone, ciramadol, cirazoline, cisapride, cisconazole, cismadinone, daptomycin, darenzepine, darodipine, datelliptium chloride, cisplatin, cistineXine, citalopram, citatepine, citenamide, dunorubicin, daZadrol, dazepinil, dazidamine, dazmegrel, cite naZone, citicoline, citiolone, clamidoxic acid, daZolicine, dazopride, daZoquinast, dacoxiben, deanol clamoxyquin, clanfenur, clanobutin, clantifen, aceglumate, deanol acetaminobenzoate, deaZauridine, clarithromycin, clavulanic acid, claZolam, clazolimine, deboxamet, debrisoquin, decame thonium bromide, claZuril, clebopride, cle famide, clemastine, clemeprol, decime mide, decitropine, declaben, declenperone, clemizole, clenbuterol, clenpirin, cletoquine, clibucaine, decloxizine, decominol, decoquinate, deditonium bromide, clidafidine, clidanac, clidinum bromide, climaZolam, 35 deferoxamine, deflazacort, defosfamide, dehydroacetic acid, climbazole, climiqualine, clindamycin, clindamycin dehydroe me tine, dehydro-7-methylte Stosterone, palmitate, clindamycin phosphate, clinofibrate, clinolamide, delanterone, delapril, delergotrile, delfantrine, delmadinone cliquinol, clioxanide, clipoxamine, cliprofen, clobazam, acetate, delmetacin, delmopinol, delorazepam, deloxone, clobenoside, clobenzepam, clobenzorex, clobenztropine, del proste nate, dembrexine, demecarium bromide, clobetasol propionate, clobetaSone butyrate, clobutinol, 40 demeclocycline, demecolcine, demecycline, demegestone, clobu Zarit, clocan famide, clocapramine, clociguanil, demelverine, demexiptiline, democonazole, demoxepam, clocinizine, clocortolone acetate, clocortolone pivalate, de naverine, denbufylline, denipride, denopamine, clocoumarol, clodacaine, clodanolene, cloda Zon, denpidaZone, denZimol, deoxyspergualin, depramine, clodoxopone, clodronic acid, clofazimine, clofenamic acid, deprodone, deprostil, deptropine, derpanicate, desacetyl clofenamide, clofenciclan, clofenetamine, clofenoxyde, 45 colchicine tartrate, desaspidin, desiclovir, descinolone clofen VinfoS, clofeverine, clofeXamide, clofeZone, acetonide, deserpidine, desipramine, deslanoSide, clofibrate, clofibric acid, clofibride, clofilium phosphate, de Smethylcolchicine, de Smethyl misonidazole, cloflucarban, clofoctol, cloforex, clofurac, clogestone de Smethylmoramide, de Socriptine, de Soge Strel, acetate, cloguanamil, clomacran, clomegestone acetate, deSomorphine, desonide, desoximetasone, desoxycorticos clometacin, clometherone, clomethiazole, clometocillin, 50 terone acetate, de Soxy cortico Sterone piva late, clomifenoxide, clominorex, clomiphene, clomipramine, desoxypyridoxine, detajmium bit artrate, detanosal, clomocycline, clomoxir, clonazepam, clonazoline, deterenol, detomidine, detorubicin, detrothronine, clonidine, clonitaZene, clonitrate, cloniXeril, clonixin, devapamil, dexamethasone, dexamethasone acefurate, dex clopamide, clopen thiXol, cloperastine, cloperidone, amethasone acetate, dexamethasone dipropionate, dexam clopidogrel, clopidol, clopimozide, clopipazan, clopirac, 55 ethasone phosphate, dexamisole, dexbrompheniramine, cloponone, cloprednol, cloprostenol, cloprothiazole, deXchlorpheniramine, dexclamol, dexetimide, deXetoZoline, cloquinate, cloquinozine, cloracetadol, cloranolol, dexfenfluramine, deximafen, dexindoprofen, dexivacaine, cloraZepate, clorethate, clorexolone, clorgiline, cloricromen, de Xlofexidine, de Xime de to midine, de XOXadrol, cloridarol, clorindanic acid, clorindione, clormecaine, de Xpan the nol, de Xpropranolol, de Xproxibute ne, cloroperone, clorophene, cloroqualone, clorotepine, 60 de Xe coverine, de Xtilidine, de Xtroamphetamine, clorprenaline, clorSulon, clortermine, closantel, closiramine, deXtrofemine, dextromethorphan, dextromoramide, clostebol, clothiapine, clothixamide, clotiazepam, clotica dextrorphan, dextrothyroXine, deZaguanine, dezocine, Sone propionate, clotioxone, clotrimazole, clovoxamine, diacerein, diacetamate, diacetolol, diacetylmorphine, cloxace pride, cloxacillin, cloxacillin ben Zathine, diamfenetide, diaminomethylphena Zinium chloride, cloxazolam, cloxestradiol, cloximate, cloXotestosterone, 65 diamo caine, diam promide, diamtha Zole, cloxypendyl, cloxyquin, clozapine, cobamide, cocaine, dian hydrogalactitol, diap amide, diarbarone, cocarboxylase, codeine, codoxime, cofisatin, cogaZOcine, diathymoSulfone, diatrizoic acid, diaveridine, diazepam, US 6,261,537 B1 45 46 diaziquone, diazoacetylglycine hydrazide, diaZouracil, droclidinium bromide, drocode, drofenine, droloxifene, diaZOxide, dibekacin, dibemethine, dibenamine, dibenzepin, drometrizole, dromoStanolone, dromoStanolone propionate, dibrompropamidine, dibromsalan, dibroSpidium chloride, dronabinol, dropempine, droperidol, droprenilamine, dibucaine, dibuprol, dibupyrone, dibuSadol, dicarbine, drop ropiZine, drotaverine, drotebanol, droxacin, dicarfen, dichlorallyl lawsone, dichlorisone acetate, droxicainide, droxicam, droxidopa, droxypropine, dichi or me Za none, dichloroflu or me thane, dulofibrate, dulo Zafone, duome tacin, duoperone, dichloromethotrexate, dichlorophen, dichlorophenarsine, dup racetam, durapatite, dyclonine, dydrogesterone, dichlorote trafluoroethane, dichloro Xylenol, dymanthine, dyphylline, ebastine, elbrotidine, ebSelen, dichlorphenamide, dichlorvos, diciferron, dicirenone, ecastolol, echinomycin, echothiophate iodide, ecipramidil, dicla Zuril, diclofenac, diclofensine, diclofurime, eclanamine, eclaZolast, econazole, ectylurea, edelfosine, diclometide, diclonixin, dicloxacillin, dicobalt edetate, edetic acid, edetol, edifolone, edogestrone, edoxudine, edro dicolinium iodide, dicreSulene, dicumarol, dicyclomine, phonicum chloride, efaroXan, efetozole, efornithine, didemnin, dideoxycytidine, didro Valtrate, dieldrin, efloxate, efrotomycin, elantrine, elanzepine, elderfield's die nestrol, die noge St, die thadione, dietha Zine, pyrimidine mustard, elfazepam, elagic acid, elliptinium diethylpropion, diethylstilbestrol, diethylstilbestrol 15 acetate, elmustine, elnadipine, eltenac, eltoprazine, elucaine, diphosphate, diethylStilbe Strol dip ropio nate, elziverine, embramine, embutramide, emepronium bromide, diethylthiambute ne, diethyltolu amide, dietifen, emetine, emiglitate, emilium tosylate, emopanil, difebarbamate, difemerine, difemetorex, difenamizole, emorfaZone, emylcamate, enalapril, enalaprilat, enbucrilate, difencloxazine, dife noximide, difenoxin, difetarSone, encainide, enciprazine, enclomiphene, encyprate, endomide, difeterol, diflorasone diacetate, difloxacin, difluanine, endralazine, endry Sone, enefexine, eneStebol, enfenamic diflucortolone, diflurcortolone pivalate, diflumidone, acid, enflurane, eniclobrate, enilconazole, eniloSpirone, diflunisal, diflupredinate, diftalone, digalloyl trioleate, enisoprost, enocitabine, enolicam, enoxacin, enoXamast, digito Xin, digoxin, dihexy verine, dihydrala Zine, enoXimone, enoXolone, eniprazole, eniproline, enprazepine, dihydroaZacytidine, dihydroergotamine, dihydrolenperone, enprofylline, enpromate, enproStil, enrofloxacin, entSufon dihydro Stre p to my cin, dihydro tachy Ste rol, 25 Sodium, enviomycin, enviradene, epalretat, epanolol, dihydroxy fluoro proge Strone, diisopromine, eperisone, ephedrine, epicainide, epicillin, epicriptine, diisopropanolamine, dilaZep, dile Valol, dilmefone, epieStriol, epimestrol, epinastine, epinephrine, epinephryl diloxanide, diltiazem, dimabefylline, dimecamine, dime borate, epipropidine, epirizole, epiroprim, epirubicin, colonium iodide, dimecrotic acid, dimefadane, dimefline, epithiazide, epitioStanol, epoprostenol, epoStane, dimelazine, dimenorfan, dimenhydrinate, dimenoxadol, eprazinone, eproVafen, eproXindine, eproZinol, epsiprantel, dimeheptanol, dimepranol, dimepregnen, dimeproZan, eptaloprost, eptazocine, equilin, erdosteine, ergocalciferol, dimer cap rol, dime Sna, dime Sone, dimetacrine, ergoloid meSylates, ergonoVine, ergosterol, ergotamine, dime tam feta mine, dime thadio ne, ericolol, erizepine, erocainide, erythrityl tetranitrate, dimethaminostyrylcquinoline, dimethazan, dimethindene, erythromycin, erythromycin acistrate, erythromycin dimethiodal, dimethisoquin, dimethisterone, dimetholizine, 35 ethylsuccinate, erythromycin propionate, erythrosine, dimethoxanate, dimethylhydroxyte Stosterone, eSaprazole, esculamine, eSeridine, esflurbiprofen, eSmolol, dimethylnorandrostadienone, dimethylnortestosterone, eSorubicin, esprocquin, estaZolam, estradiol, estradiol dimethylstilbestrol, dimethyl, dimethylthiambutene, dim benzoate, estradiol cypionate, estradiol dipropionate, estra ethyltubocurarinium chloride, dimetipirium bromide, diol enanthate, estradiol undecylate, estradiol Valerate, dimetofrine, dimetridazole, diminaZene, dimoxamine, 40 estramustine, estramustine phosphate, estrapronicate, dimoxaprost, dimoxyline, dimpylate, dinaline, dinaZafone, estraZinol, estriol, estrofurate, estrone, estrone hydrogen diniprofylline, dinitolmide, dinoprost, dinoprostone, dinsed, Sulfate, estropipate, eSuprone, etabenzarone, etacepride, dioSmin, dioxadillol, dioxadrol, dioxamate, dioxaphetyl etafedrine, etafenone, etameStrol, etamiline, etamiphyllin, butyrate, dioxethedrin, dioxifedrine, dioxybenzone, dipe etamocycline, etanidazole, etanterol, etaqualone, etasuline, nine bromide, diperodon, diphemanil methylsulfate, 45 etazepine, etazolate, etebenecid, eterobarb, etersalate, diphenadione, diphenan, diphenhydramine, diphendiol, ethacridine, ethacrynic acid, ethambu tol, ethamivan, diphenoxylate, diphenylpraline, diphoxazide, dipipanone, etham Sylate, ethanolamine oleate, etha verine, dipipoverine, dipliverin, diprafenone, diprenorphine, ethchlorVynol, ethenZamide, ethazide, ethidium chloride, diprobutine, diprofene, diprogulic acid, diproleandomycin, ethinamate, ethinyl estradiol, ethiofoS, ethionamide, diprocqualone, diproteverine, diprotrio Zate, diproXadol, 50 eth Sterone, ethoheptazine, ethomoxane, ethonam, dipyridamole, dipyrithione, dipyrocetyl, dipyrone, ethopropazine, ethoSuximide, ethotoin, ethoxazene, dirithromycin, disobutamide, disofenin, disoglu Side, ethoxazorutoSide, ethoXZolamide, ethyybenztropine, ethyl disopyramide, disoxaril, distigmine bromide, disulergine, biscoumacetate, ethyl carfluZepate, ethyl cartrizoate, ethyl disulfamide, disulfiram, disuprazole, ditazole, ditercalinium dibunate, ethyl dirazepate, ethylenediamine, ethyleStrenol, chloride, dithiazanine iodide, ditiocarb, ditiomustine, 55 ethylhydro cup reine, ethyl lofla Ze pate, ditolamide, ditophal, divabuterol, dixanthogen, dizatrifone, ethylmethylthiambutene, ethylmorphine, 9-ethyl-6- dizocilpine, dobu pride, dobutamine, docarpamine, mercaptopurine, ethyl nitrite, ethylnorepinephrine, doconazole, docusate, doliracetam, domaZoline, domiodol, ethylparaben, ethylphenace mide, ethylStibamine, domiphen bromide, domipizone, domoprednate, domoxin, ethynerone, ethynodiol diacetate, ethypicone, etibendazole, domperidone, don, donetidine, dopamantine, dopamine, 60 eticlopride, eticyclidine, etidocaine, etidronic acid, dopexamine, dopropidil, dogualast, dorastine, doreptide, etifelmine, etifenin, etifoxine, etilamfetamine, etillefrine, doSergoside, dotarizine, dotefonium bromide, dothiepin, etillefrine pivalate, etintidine, etiochlanolone, etipirium doxacurium chloride, doxaminol, doxapram, doxaprost, iodide, etiproston, etiracetam, etiroXate, etisazole, doxazosin, doxefazepam, doxenitoin, doxepin, doxibetasol, etisomicin, etisulergine, etizolam, etocarlide, etocrylene, doxifluridine, doxofylline, doxorubicin, doxpicomine, 65 etodolac, etodroXZine, etofamide, etofenamate, etofenproX, doxycycline, doxylamine, drame dilol, draquinolol, etofibrate, etoformin, etofuradine, etofylline, etoglucid, deaZidox, dribendazole, drindene, drobuline, drocinonide, etolorex, etolotifen, etoloxamine, etomidate, etomidoline, US 6,261,537 B1 47 48 etomoxir, etonitaZene, etoperidone, etoposide, etoprindole, folic acid, fomidacillin, fominoben, fomocaine, fonazine, etoprine, etorphine, etoSalamide, etoxadrol, etoxeridine, fopiirtoline, forfenimex, formebolone, forme torex, etoZolin, etrabamine, etretinate, etryptamine, etymemazine, formintraZole, formocortal, formoterol, fosarilate, eucalyptol, eucatropine, eugenol, euprocin, evandamine, foSazepam, foScarnet, foscolic acid, foSenazide, Evans blue, exalamide, exametazine, exaprolol, exepanol, fosfocreatine, fosfomycin, foSfonet, foSfosal, foSinapril, foS exifone, exiproben, fallintolol, fallipamil, famiraprinium menic acid, foSmidomycin, forpirate, fostedil, fostriecin, chloride, famotidine, famotine, famiprofaZone, fanetizole, fotemustine, fotreamine, frabuprofen, frentizole, fronepidil, fantridone, faZadinium bromide, faZaribine, febantel, froxiprost, ftaXilide, ftivazide, ftorafur, ftormetazine, febarbamate, februpol, febuverine, feclemine, feclobuZone, ftorpropazine, fubrogonium iodide, fuchsin, fumagillin, fedrilate, felbamate, felbinac, felipyrine, felodipine, fumo Xcillin, fuprazole, furacrinic acid, furafylline, femoxetine, fenabutene, fenacetinol, fenaclon, fenadiazole, furalazine, furaltadone, furaprofen, furazabol, furazolidone, fenaptic acid, fenalamide, fenalcomine, fenamifuril, furazolium chloride, furbucillin, furcloprofen, furegrelate, pe namole, fenaperone, fenbendazole, fenbencillin, furethidine, furfenorex, furidarone, furmethoxadone, fenbufen, fenbutraZate, fencamfamine, fencibutirol, fen furobufen, furodazole, furofenac, furomazine, furosemide, cleXonium metilsulfate, fenclofenac, fenclonine, fenclorac, 15 furoStilbestrol, furSalan, furSultiamine, furterene, furtretho fenlozic acid, fendiline, fendosal, feneritrol, fenestrel, nium iodide, fusidic acid, fuzlocillin, gabapentin, gabexate, fenetha Zine, fenethylline, fenetradil, fenflumizole, gaboXadol, galantamine, gallamine triethodide, gallopamil, fenfluramine, fenfluthrin, fengabine, fenharmane, fenimide, galosemide, galtifenin, gampeXine, gamolenic acid, feniodium chloride, fenipentol, fenirofibrate, fenisorex, ganciclovir, gangle fene, gapicomine, gapromidine, femme to Zole, fenme tramide, fenobam, fenocinol, gefarnate, gemazocine, gemcadiol, gemeprost, gemfibrozil, fenoctimine, fenofibrate, fenoldopam, fenoprofen, fenoterol, gentamicin, gentian Violet, gepefrine, gepirone, geroquinol, fe noverine, fenoxazoline, fenoxedil, feno Zolone, gestaclone, gestadienol, gestodene, geston.orone caproate, fenpentadiol, femperate, fenipalone, fenipramide, feniprane, gestrinone, giparmen, gitaloxin, gitoformate, glafenine, fen pive rinium bromide, fenprinast, fen proporex, glaziovine, gliamilide, glibornuride, glibutimine, fenprostalene, fenduizone, fenretinide, fenspiride, fentanyl, 25 glicaramide, glicetanile, geroquinol, gestaclone, gestadienol, fentiazac, fenticlor, fenticonazole, fentonium bromide, gestodene, geston.orone caproate, gestrinone, giparmen, fenyripol, fepentolic acid, fepitrizol, fepradinol, feprazone, gitaloxin, gitoformate, glafenine, glaziovine, gliamilide, fepromide, feproSidinine, ferriclate calcium, ferrotrenine, fer glibornuride, glibutimine, glicaramide, glicetanile, rous fumarate, ferrous gluconate, fetoxylate, feXicaine, gliclaZide, glicondamide, glidaZamide, gliflumide, feXinidazole, fezatione, feZolamine, fiacitabine, fibracillin, glimepiride, glipentide, glipizide, gliquidone.glisamuride, filenadol, filipin, fifexide, flamenol, flavamine, flavodic acid, glisindamide, glisolamide, glisoxepide, gloxazone, flavodil, flavoneactic acid, flavoxate, flazalone, flecainide, gloximonam, glucame tacin, glucosamine, glucosulfamide, flerobuterol, fleroxacin, flesinoxan, flestolol, fletazepam, glucosulfone, glucurolactone, glucuronamide, glunicate, floctafenine, flomoxef, flopropione, florantyrone, flordipine, glutamic acid, glutaral, glutarimide, glutaurine, floredil, florfenicol, florifenine, floSequinan, flotrenizine, 35 glutethimide, glyburide, glybuthiazol, glybuzole, glyceryl floverine, floxacillin, floxacrine, floxuridine, fluacizine, mono Ste a rate, glycidyl methacrylate, glycine, fluialamide, fluianisone, fluazacort, flubanilate, flubendazole, glyclopyramide, glybiar.Sol, glycopyrrolate, glycyclamide, flubepride, flucabril, flucetorex, flucindole, fluciprazine, glyhexamide, gly midine, gly octamide, glypinamide, flucloronide, fluconazole, flucrylate, flucytosine, glyprothiazol, glySobuzole, gold thiomalate, gold Sodium fludalanine, fludarabine phosphate, fludazonium chloride, 40 thiosulfate, granisetron, griseofulvin, guabenXan, guacetisal, fludiazepam, fluidorex, fluidoxopone, fludrocortisone acetate, guafe cainol, guaiactamine, guaiapate, guaietolin, flufenamic acid, flufenisal, flufosal, flufylline, fluindarol, guaifene Sin, guaime Sal, guaisteine, guaithylline, fluindione, flumazenil, flumecinol, flume droxone-17 guame cycline, guanabe nZ, guanacline, guanadrel, acetate, flumequine, flumeridone, flumethasone, flumetha guana Zodine, guanazole, guanclofine, guancy dine, Sone pivalate, flumethiazide, flumetramide, flumeXadol, 45 guane thidine, guanfacine, guanisoquin, guanoclor, flume Zapine, fluminorex, flumizole, flumoxonide, guanoctine, guano Xaben Z, guano Xan, guanoxy fen, flunamine, flunarizine, flunidazole, flunisolide, flunisolide hadacidin, halazepam, halazone, halcinonide, halethazole, acetate, flunitrazepan, fluniXin, flunoprost, flunoxaprofen, halocortolone, halofantrine, halofenate, halofuginone, fluocinolone acetonide, fluocinonide, flourcortin butyrate, halometaSone, halonamine, halopemide, halopenium fluocortolone, fluocortolone caproate, fluorescein, 50 chloride, haloperidol, haloperidol decanoate, haloperidone fluores one, fluoroadenosine, 3-fluoroandrostanol, acetate, haloprogesterone, haloprogin, halothane, fluorodopane, fluorohydroxyandrosterone, fluorometholone, haloxazolam, haloxon, halquinols, hedaguinium chloride, fluorometholone acetate, fluorosalan, 6-fluorotestosterone he pronicate, heptabarbital, heptaminol, heptaverine, propionate, fluorouracil, 9-fluoroXotestenololactone, heptolamide, hepzidine, hetacillin, hetaflur, heteronium 9-fluoroXoteStololace tone, fluo tracen, fluoxetine, 55 bromide, hexachlorophene, hexacyclonate, hexacyprone, fluoxymesterone, flu paroxan, flu pentiXol, fluperamide, hexadiline, hexadimethrine bromide, hexafluorenium fluperlapine, fluperolone acetate, fluphenazine, fluphenazine bromide, he Xamethonium bromide, he Xamidine, enanthate, flupimazine, flupirtine, flupranone, fluprazine, hexapradol, hexaprofen, hexapropy mate, heXasonium fluprednidene, fluprednisolone, fluprednisolone Valerate, iodide, heXacarbacholine bromide, hexedine, hexestrol, flu profen, flu profylline, flu produaZone, flu prostenol, 60 heXetidine, heXobarbital, heXobendine, hexocyclium fluguaZone, fluradoline, flurand renoline, flurantel, methylsulfate, heXoprenaline, heXopyrronium bromide, flurazepam, flurbiprofen, fluretofen, flurithromycin, hexylcaine, hexylene glycol, hexylresorcinol, histamine, flurocitabine, flurofamide, flurogestone acetate, flurothyl, histapyrrodine, homarylamine, homatropine, homatropine fluroxene, flusoxolol, fluspiperone, fluspirilene, flutamide, methylbromide, homidium bromide, homochlorcyclizine, flutazolam, flutemazepam, flutiazin, fluticasone propionate, 65 homofenazine, homoharringtonine, homopipramol, flutizenol, flutonidine, flutoprazepam, flutroline, flutropium homosalate, homotestosterone propionate, homprenorphine, bromide, fluvoxamine, flu Zinamide, fluZoperine, folescutol, hopantenic acid, hoquizil, hycanthone, hydracarbazine, US 6,261,537 B1 49 SO hydra la Zine, hydrarga phen, hydrobe nti Zide, isoXSuprine, isradipine, itanoXone, itaZigrel, itraconazole, hydrochlorthiazide, hydrocodone, hydrocortamate, itrocainide, ivermectin bib, ivoqualine, joSamycin, kalinic hydrocortisone, hydrocortisone aceponate, hydrocortisone acid, kalafungin, kanamycin, kebu Zone, keracyanin, acetate, hydrocortisone butyrate, hydrocortisone cypionate, ketamine, ketanserin, ketazocine, ketazolam, kethoxal, hydrocortisone-phosphate, hydrocortisone Succinate, hydro ketipramine, ketobe midone, ketocaine, ketocainol, cortisone Valerate, hydroflumethiazide, hydromadinone, ketoconazole, ketoprofen, ketorfanol, ketorolac, ketotifen, hydromorphinol, hydromorphone, hydroquinone, ketotrexate, khellin, khelloSide, kitasamycin, labetalol, hydroxindasate, hydroxindasol, hydroxyoxocobalamin, lacidipine, lactalfate, lactose, lactulose, lamotrigine, hydroxy amphetamine, hydroxy chloroquine, lamtidine, lanatoside, lapachol, lapinone, lapyrium chloride, hydroxydimethandroStadienone, hydroxydione Succinate, lasalocid, laudexium methyl Sulfate, lauralkonium chloride, hydroxymethylandrostanone, 10-hydroxynorehisterone, laureth, laurixamine, laurocapram, lauroguadine, lauro hydroxypethidine, hydroxyphenamate, hydroxyprocaine, linium acetate, lauryl isoquinolinium, lefetamine, hydroxyprogeSerone, hydroxyprogesterone caproate, leflunomide, leiopyrrole, lemidosul, le nampicillin, hydroxypyridine tart rate, hydroxy Stilb amidine, leniquinsin, lenperone, leptacline, lergotrile, letimide, 7-hydroxyteStololacetone, hydroxytestosterone propionate, 15 letosteine, leucine, leucinocaine, leucocianidol, leucovorin, hydroxytetracaine, hydroxytoluic acid, hydroxyurea, levacecarnine, levallorphan, levamfetamine, levamisole, hydroxy Zine, hymecromone, hyoscyamine, hypericin, lev drop ropiZine, le Visoprenaline, le vlofexidine, ibacitabine, ibafloxacin, ibazocine, ibopamine, ibrotamide, levobunolol, le Vocabastine, levocarnitine, levodopa, ibudilast, ibufenac, ibuprofen, ibuprofen piconol, levofacetoperane, leVofenfluramine, levofuraltadone, ibuproxam, ibuterol, ibuverine, icazepam, icosipiramide, levoglutamide, levomenol, levomethadone, levomethadyl icotidine, idarubicin, idaverine, idazoxan, idebenone, acetate, le Vome thorphan, le Vome tio meprazine, idenast, idoxuridine, idralfidine, idrocilamide, idiropranolol, levomopranol, levomoramide,levonantradol, levonordeprin, ifenprodil, ifosfamide, ifoxetine, ilmofoSine, iloprost, levonorgestrel, levophenacyl morphan, levopropoxyphene, imafen, imanixil, imaZodan, imcarbofoS, ime Xon, levopropylcillin, levopropylhexedrine, levoprotiline, imiclopazine, imidazole Salicylate, imidazopyrazole, imide 25 levorin, leVorphanol, levothyroXine, leVOXadrol, lexofenac, cyl iodine, imidocarb, imidoline, imidu rea, imiloxan, libecillide, libenzapril, lidamidine, lidocaine, lidofenin, iminophendimide, imipenem, imipramine, imipraminoxide, lidoflazine, lifibrate, lilopristone, limaprost, lincomycin, imire Stat, imolamine, imo Xite rol, impacar Zine, lindane, linsidomine, liothyronine, liroldine, lisinopril, impromidine, improSulfan, imuracetam, inaperisone, lisuride, lithium carbonate, lithium citrate, litracen, indacrinone, indalpine, indanazoline, indanidine, indanorex, lividomycin, lixazinone, lobeline, lobendazole, lobenzarit, indapamide, ind atraline, indacainide, indeloxazine, lobuprofen, locicortone, lodaxaprine, lodace/arlodinixil, indenolol, indicine-N-oxide, indigotindisulfonic acid, lodiperone, lodoxamide, lodoxamide ethyl, lofemizole, indobufen, indocate, indocyanine green, indolapril, lofendazam, lofentanil, lofepramine, lofexidine, loflucarban, indolidan, indomethacin, indopanolol, indopine, indoprofen, lombazole, lomefloxacin, lometraline, lome Vactone, indoramin, indorenate, indoxole, indriline, inicarone, 35 lomifylline, lomofungin, lomustine, lonapalene,lonaprofen, inocoterone, inosine, inosine dialdehyde, inositol niacinate, lonazolac, lonidamine, loperamide, loperamide oxide, inproduone, intrazole, intriptyline, iobenzamic acid, iobutic lopirazepam, loprazolam, loprodiol, lorajmine, lorapride, acid, iocarmic acid, iocetamic acid, iodamide, iodecimol, loratadine, lorazepam, lorbamate, lorcainide, lorcinadol, iodetryl, iodipamide, iodixanol, iodoalphionic acid, iodol, lorglumide, lormetazepam, lortalamine, lorZafone, iodophthalein, iodoquinol, iodothiouracil, iodoxamic acid, 40 losindole, loSulazine, lotifazole, lotrifen, lotucaine, ioglicic acid, ioglucol, ioglucomide, ioglunide, ioglycamic lovastatin, loxanast, loxapine, loxiglumide, loxoprofen, acid, iogulamide, iohexol, iodlidonic acid, iolixanic acid, loxtidine, lozilurea, lucanthone, lucartamide, lucimycin, iomeglamic acid, iomeprol, iomorinic acid, iopamidol, lufuradom, lupitidine, luprostiol, luxabendazole, lyapolate iopanoic acid, iopentol, iophendylate, iophenoxic acid, Sodium, lycetamine, lydimycin, lymecycline, lynestrenol, ioprocemic acid, iopromide, iopronic acid, iopydol, 45 ly Sergide, lysine, mabuterol, maduramicin, mafenide, iopydone, ioSarcol, ioSefamic acid, ioSeric acid, iOSimide, mafoprazine, mafosfamide, magnesium citrate, magnesium ioSulamide, iOSumetic acid, iotasul, iotetric acid, iothalamic gluconate, magnesium Salicylate, malathion, malethamer, acid, iotranic acid, iotrizoic acid, iotrolan, iotroXic acid, malic acid, malotilate, manidipine, manganese gluconate, ioVerSol, ioxabrolic acid, ioxaglic acid, ioxitalamic acid, mannitol, mannitol he Xanitrate, mannomustine, ioxotrizoic acid, ioZomic acid, ipexidine, ipodic acid, 50 mannosulfan, manoZodil, maprotiline, maridomycin, ipragratine, ipramidil, ipratropium bromide, iprazochrome, mariptiline, marOXepin, maytansine, maZaticol, mazindol, ipriflavone, iprindole, iprocinodine, iproclozide, iprocrolol, maZipredone, mebanazine, mebendazole, mebenoside, iprofenin, iproheptine, iproniazid, iproidazole, iproplatin, mebeverine, mebeZonium iodide, mebhydrolin, mebiquine, iprotiaZem, iproxamine, ipro Zilamine, ip Salazide, mebolazine, mebrofenin, mebutamate, mebutizide, ipsapirone, iquindamine, irindalone, irloxacin, irolapride, 55 mecamylamine, mecarbinate, mecetronium ethylsulfate, irSogladine, isamfaZone, isamoltan, isamoXole, isaxonine, mechlorethamine, meciadanol, mecinarone, meclizine, is bogrel, isepamicin, isoaminile, isobromindione, meclocycline, meclocycline Sulfosalicylate, meclofenamic isobucaine, isobutamben, isocarboxazid, isoconazole, acid, meclofenoxate, meclonazepam, mecloqualone, isocromil, isoetharine, isofeZolac, isoflupredone acetate, mecloralurea, meclorisone dibutyrate, mecloxamine, isoflurane, isoflurophate, isoleucine, isomazole, isomerol, 60 me cobalamin, mecrylate, mecy Steine, medazepam, iSome tamidium, iSomethadone, isome the ptene, medazomide, medetomidine, medibazine, medifoxamine, isomylamine, isoniazid, isonixin, isopraZone, isoprednidene, medorinone, medorubicin, medrogestone, medronic acid, isoprofen, isoprofamide iodide, isopropicillin, isopropyl medroxalol, medroxyprogestrone, medroxyprogestrone myristate, isopropyl palmitate, isoproterenol, isosorbide, acetate, medrylamine, medrySone, mefeclorazine, mefe isosorbide dinitrate, isosorbide mononitrate, isospalglumic 65 namic acid, mefenidil, mefenidramium metilsulfate, acid, isosulfan blue, isoSulpride, isothipendyl, isotic, mefenorex, mefeSerpine, mefeXamide, mefloquine, isotiquimide, isotretinoin, isoxaprolol, isoxepac, isoxicam, mefruSide, megalomicin, megestrol acetate, meglitinide, US 6,261,537 B1 S1 52 megu cycline, meglumine, meglu tol, meladrazine, metrafazoline, metralindole, metrazifone, metrenperone, melarSonyl, melarSoprol, melengestrol acetate, meletimide, metribolone, metrifonate, metrifudil, metrizamide, metri melinamide, melitracen, melizame, meloxicam, melperone, Zoic acid, metronidazole, meturedepa, mety rapone, melphalan, memantine, memotine, menabitan, menadiol, mety ridine, me tyrosine, mevastatin, me Xafylline, menadiol diphosphate, menadiol disulfate, menadione, me Xa Zolam, me Xenone, mexile tine, mexiproStil, menadione Sodium bisulfite, menatetrenone, menbutone, me Xoprofen, meXre noate, meZacopride, me Zepine, menfe gol, mengly tate, me nitrazepam, me noctone, meZilamine, meZlocillin, mianserin, mibolerone, micinicate, menogaril, menthol, meobentine, meparfynol, mepazine, miconazole, micronomicin, midaflur, midaglizole, me pen Zolate bromide, me peridine, mephene Sin, midalcipran, mid amaline, midazogrel, midazolam, mephenoxalone, mephen termine, mephenyton, midecamycin, midodrine, mifentidine, mifepristone, mephobarbital, mepindolol, mepiprazole, mepiroXol, mifobate, miglitol, mikamycin, millacemide, milenperone, mepitioStane, mepivacaine, mepixanox, mepramidil, millipertine, miloxacin, milrinone, milverine, mimbane, meprednisone, meprobamate, meproscillarin, meproxitol, minaprine, minaXolone, mindolilol, mind operone, me prylcaine, mepta Zinol, me quido X, me quinol, mine pentate, minocromil, minocycline, minoxidil, meguitazine, meralein, meralluride, merbarone, merbromin, 15 mioflazine, mipimazole, mirincamycin, miristalkonium mercaptamine, mercap to me rin, mercaptop urine, chloride, miroprofen, mirosamicin, misonidazole, mercuderamide, mercufenol chloride, mercumatilin, misoprostol, mitindomide, mitobronitol, mitoclomine, mercurobu tol, mergocriptine, merophan, merSalyl, mitoguaZone, mitolactol, mitomycin, mitonafide, mesabolone, meSalamine, meSeclaZone, meSna, mesocarb, mitopodozide, mitoquidone, mitotane, mitotenamine, meso-hexestrol, meSoridazine, mesipire none,meStanolone, mitoxantrone, mito Zolomide, mivacurium chloride, mesterolone, meStranol, meSudipine, me Sulergine, mixidine, misoprostol, mitindomide, mitobronitol, meSulfamide, meSulfen, meSuprine, metabromsalan, mitoclomine, mitoguaZone, mitolactol, mitomycin, metacetamol, metaclazepam, metaglycodol, metahexamide, mitonafide, mitopodo Zide, mitocquidone, mitotane, metamelfalan, metamfa Zone, metamfe pramone, mitotenamine, mitoxantrone, mitoZolomide, mivacurium metampicillin, metanixin, metapramine, metaproterenol, 25 chloride, mixidine, mizoribine, mobecarb, mobenzoxamine, metaraminol, metaterol, metaxalone, metaZamide, metazide, mocimycin, mocliprazine, moclobemide, moctamide, metazocine, metbufen, mete neprost, metergoline, modafinil, modaline, mofebuta Zone, mofloverine, metergotamine, mete Scufylline, mete Scule tol, mofoXime, molfarnate, molina Zone, mollindone, metethoheptazine, metformin, methacholine chloride, molracetam, molsidomine, mometasone furoate, monala methacycline, methadone, methadyl acetate, methallenestril, Zone di Sodium, m one in Sin, monoben Zone, methallibure, methalthiazide, methamphetamine, mo no e than olamine, mo no met a crine, methandriol, methandrostenolone, methaniazide, meth monophosphothiamine, monothioglycerol, monoxerutin, antheline bromide, methaphenilene, metha pyrilene, montire lin, moperone, mopidamol, mopidrala Zine, metha qualone, met harbital, metha Styridone, moprolol, moguizone, morantel, moraZone, morclofone, methazolamide, methdilazine, methenamine, methenolone 35 morfore X, moricizine, morinamide, morniflu mate, acetate, methenolone enanthate, metheptazine, methestrol, morocromen, moroXydine, morpheridine, morphine, methetoin, methicillin, methimazole, methiodal Sodium, morSuximide, motapizone, motrazepam, motretinide, methioguanine, methiomeprazine, methionine, methisaZone, moveltipril, moxadolen, moxalactam, moxaprindine, methitural, methixene, methocarbamol, methohexital, mo Xastine, mo Xaverine, moxazocine, moxe Strol, methopholine, metho Serpidine, methotrexate, 40 moxicoumone, moxipraduine, moxisylyte, moxnidazole, methotrimeprazine, methoxamine, methoXSalen, moxonidine, mupirocin, murabutide, murocainide, methoxyflurane, methoxyphedrine, methoxyphenamine, muZolimine, mycophenolic acid, my fadol, myralact, methoxypromazine, methScopolamine bromide, myrophine, myrtecaine, nabaZenil, nabilone, nabitan, methSuximide, methylclothiazide, N-methyladrealone hcl, naboctate, nabu metone, nadide, nadolol, nadoxolol, methyl alcohol, methylatropine nitrate, methylbenactyzium 45 naepaine, nafamoStat, nafazatrom, nafcaproic acid, nafcillin, bromide, methylbenze thonium, methylchromone, nafenodone, nafenopin, nafetolol, nafimidone, nafiverine, methyldesorphine, methyldihydromorphine, methyldopa, naflocort, nafomine, nafoxadol, nafoxidine, nafronyl, methyldopate, methylene blue, methylphe drine, naftalofoS, naftaZone, naftifine, naftopidil, naftoxate, methylergonovine, methylformamide, methyl nicotinate, nafty pramide, nalbuphine, nalidixic acid, nalmefene, 2-methyl-19-nortestosterone, 2-methyl-11-oxoprogestrone, 50 nalmexone, nalorphine, naltrexone, naminterol, namoxyrate, methyl palmoxirate, methylparaben, methylphendiate, nanaprocin, nandrolone cyclotate, nandrolone decanoate, methylprednisolone, methylprednisolone aceponate, meth nandrolone phen propionate, nanofin, nan tradiol, ylprednisolone acetate, methylprednisolone hemisuccinate, napacitadine, napame Zole, naphazoline, naphthonone, methylprednisolone phosphate, methylprednisolone naprodoxime, naproxen, naproxol, naranol, narasin, Suleptanate, methyl Salicylate, methylstreptonigrin, 55 natamycin, naxagolide, naxaprostene, nealbarbital, 4-methylte Stoster one, 7-methylte Stoster one, nebidra Zine, nebivolol, nebracetam, nedocromil, 17-methyltestosterone, 7-methylteSosterone propionate, nefazodone, ne flumo Zide, ne fopam, nele Zaprine, methylthiono Sine, 16-methylthioproge Stone, neoarsphenamine, neocinchophen, neomycin, neoStigmine methylthiouracil, methynodiol diacetate, methyprylon, bromide, nequinate, neraminol, nerbacadol, neSapidil, methySergide, metiamide, metiapine, metiaZinic acid, 60 neSOsteine, netilmicin, netobimin, neutramycin, neXeridine, metibride, meticrane, metildigoxin, metindizate, metioprim, niacin, niacinamide, nialamide, niaprazine, nibroxane, metioXate, metipirox, metipranolol, metiprenaline, nicafenine, nicainoprol, nicametate, nicarbazin, nicarpidine, metitepine, metizoline, metkephamid, metochalcone, meto nicergoline, niceritrol, niceverine, niclofolan, niclosamide, cinium iodide, metoclopramide, metocurine iodide, nicoboxil, nico clonate, nicocodine, nicocortonide, metofenazate, metogest, metola Zone, metomidate, 65 nicodicodine, nicofibrate, nicofuranose, nicofurate, me topimazine, me topon, me top rine, metoprolol, nicogrelate, nicomol, nicomorphine, nicopholine, metoquizine, metoserpate, metoStilenol, metoxepin, nicorandil, nicothiaZone, nicotinyl alcohol, nicoxamat, US 6,261,537 B1 S3 S4 nictiazem, nictindole, nodroxy Zone, nifedipine, nifenalol, oxybenzone, oxybutynin, oxychlorosene, oxycinchophen, nife naZone, niflumic acid, nifluridide, nifuradene, oxyclozanide, oxycodone, oxydipentonium chloride, nifuraldezOne, nifuralide, nifuratel, nifuratrone, nifurdazil, oxyfedrine, Oxymesterone, oxymetazoline, Oxymetholone, nifuretha Zone, nifurfoline, nifurimide, nifurizone, Oxymorphone, oxypendyl, oxypertine, OxyphenbutaZone, nifurmazole, nifurmerone, nifuroquine, nifuroxazide, oxyphenonium bromide, oxy purinol, oxypyrronium nifuroxime, nifurpipone, nifurpirinol, nifurprazine, bromide, Oxyquinoline, Oxyridazine, oxySonium iodide, nifurcquinazole, nifurSemizone, nifurSol, nifurthiazole, Oxytetracycline, Oxytiocin, OZagrel, Ozolinone, pacrinolol, nifurtimox, nifurtoinol, nifurVidine, nifurzide, niguldipine, pactamycin, padimate, pafenolol, palatrigine, paldimycin, nihydraZone, nikethamide, nileprost, nilprazole, niludipine, palmidrol, palmoxiric acid, pamabrom, pamaquine, nilutamide, nilvadipine, nima Zone, nime Sulide, pamatolol, pamidronic acid, pancuronium bromide, nimetazepam, nimidane, nimodipine, nimorazole, panidazole, panomifene, patenicate, panthenol, pantothenic nimustine, niometacin, niperotidine, nipradillol, niprofaZone, acid, p a nura mine, papa Verine, papa Vero line, niridazole, nisbuterol, nisobamate, niSoldipine, nisoxetine, parachlorophenol, parafluti Zide, paraldehyde, nisterime acetate, nitarSone, nitaZOXanide, nithiamide, paramethadione, paramethasone acetate, paranyline, parap nitracrine, nitrafudam, nitralamine, nitramisole, 15 enzolate bromide, parapropamol, pararosaniline, pararosa nitraduaZone, nitrazepam, nitrefazole, nitrendipine, niline embonate, paraXaZone, parbendazole, parconazole, nitricholine, nitrochlofene, nitrocycline, nitrodan, pareptide, parethoxycaine, pargeverine, pargolol, pargyline, nitrofurantoin, nitrofuraZone, nitroglycerin, nitromerSol, paridocaine, parodilol, paromomycin, paroxetine, nitromide, nitromifene, nitroScanate, nitroSulfathiazole, paroxypropione, parsalmide, partricin, parvaquone, nitroXinil, nitroxoline, nivaZol, nivimeldone, nixylic acid, pasiniazid, paulomycin, paxamate, paZelliptine, paZOxide, nizatidine, nizofenone, noberastine, nocloprost, nocodazole, pcnu, pecilocin, pecocycline, pefloxacin, pelanSerin, nofecainide, nogalamycin, nolinium bromide, nomegestrol, pelretin, pelrinone, pemedolac, pemerid, pemoline, nomelidine, nomifensine, nonabine, nonape rone, pempidine, penamecillin, penbutolol, pendecamaine, nonapyrimine, nonoxynol-4, nonoxynol-9, noracy methadol, penfluridol, penflutizide, pengitoxin, penicillamine, penicil norbolethone, norbudrine, norcloStebol, norcodeine, 25 lin procaine, penicillin, penimepicycline, penimocycline, nordazepam, norde frin, nordinone, norepinephrine, penirolol, penmesterol, penoctonium bromide, penprostene, norethandrolone, norethindrone, norethindrone acetate, pentabamate, pentacynium chloride, pentaerythritol norethynodrel, noreximide, norfenefrine, norfloxacin, nor tetranitrate, pentafluranol, pentagastrin, pentagestrone, floxacin Succinil, norflurane, norgesterone, norgestimate, pental amide, pent a methonium bromide, norge Stomet, norgestrel, norgestrienone, norletimol, pentamethylmelamine, pentamidine, pentamoxane, norle Vorphanol, nor methadone, nor methandrone, pentamustine, pentapiperide, pentapiperium methylsulfate, normorphine, norpipanone, nortestosterone propionate, pentaquine, pentazocine, pentetate calcium triSodium, pen nortetrazepam, nortriptyline, norVinisterone, noSantine, tetic acid, penthienate bromide, penthrichloral, pentiapine noScapine, noSiheptide, novobiocin, noxiptiline, noxytiolin, male ate, pentifylline, pentige tide, pentiSomicin, nuclomedone, nuclotixine, nufenoxole, nuVenzepine, 35 pentisomide, pentizidone, pentobarbital, pentolinium nylestriol, nylidrin, nyStatin, obidoxime, Ocilltide, ocrylate, tartrate, pentomone, pentopril, pentorex, pentosan poly Sul octabenzone, octacaine, octafonium chloride, octamoxin, fate Sodium, pentostatin, pentoxifylline, pentrinitrol, octamylamine, octanoic acid, octapinol, octastine, pentylenetrazole, peplomycin, pepstatin, peraclopone, octaverine, octaZamide, octenidine, octenidine Saccharin, peradoxime, perafensine, per allopride, peraquinsin, Octicizer, Octimibate, octorylene, octodrine, octopamine, 40 perastine, peratizole, perbufylline, perfluamine, Octotiamine, Octoxynol-9, octriptyline, octrizole, ofloxacin, perflunafene, pergolide, perhexilene, pericia Zine, ofornine, oftasceine, Olaflur, olaquindox, oleanomycin, perimetazine, perindopril,perindoprilatperisoxal, perlapine, oletimol, oleyl alcohol, olivomycina, Olmidine, olpimedone, permethrin, perphenazine, persilic acid, petrichloral, olSalazine, oltipraz, olvanil, omeprazole, omidoline, peXantel, phanquone, phenacaine, phenacemide, phenacetin, omoconazole, omonasteine, onapristone, ondansetron, 45 phenact tropinium chloride, phenadoxone, phenaglycodol, ontianil, opiniazide, opipramol, oraZamide, orbutopril, phenamaZoline, phenampromide, phenarSone Sulfoxylate, orconazole, orestrate, Ormetoprim, ornidazole, ornipressin, phena Zo cine, phena Zopyridine, phen carb amide, ornithine, ornoprostil, orotic acid, orotirelin, orpanoxin, phencyclidine, phendimetrazine, phenelZine, pheneridine, orphenadrine, Ortetamine, OSalmid, OSmadizone, otilonium phenesterin, penethicillin, phenformin, phenglutarimide, bromide, otimerate Sodium, Ouabain, Oxabolone cipionate, 50 phenicarbazide, phenindamine, phenindione, pheniprazine, oXabrexine, Oxaceprol, oxacillin, oxadimedine, oxafloZane, pheniramine, phenisonone, phenmetrazine, phenobarbital, Oxaflumazine, OXagrelate, oxalinast, oxaliplatin, OXamarin, phenobutiodil, phenolphtalein, phenolsulfonphthalein, Oxametacin, oxamisole, OXamniquine, Oxanamide, phenomorphan, phenoperidine, phenothiazine, phenothrin, OXandrolone, OXantel, oxapadol, Oxapium iodide, Oxapropa phenoxybenzamine, phenoxypropazine, phenprobamate, nium iodide, oxaprotiline, oxapro Zin, oxarbazole, 55 phen procoumon, phen promethamine, phensuximide, OXatomide, OxaZafone, Oxazepam, oxazidione, Oxazolam, phen termine, phentolamine, phenylalanine, phenyl oXaZorone, oxcarbazepine, oxdralazine, oxeladin, aminosalicylate, phenylbutaZone, phenylrphrine, phenyl Oxendolone, Oxepinac, oxetacillin, oxethazaine, Oxetorone, ethyl alcohol, phenylmercuric acetate, phenylmercuric oxfendazole, Oxfenicine, OXibendazole, OXibetaine, borate, phenylmercuric chloride, phenylmercuric nitrate, Oxiconazole, oxidopamine, oxidronic acid, OXifentorex, 60 phenylmethylbarbituric acid, phenylpropanolamine, oxifungin, OXilorphan, OXimonam, OXindanac, OXiniacic phenylthilone, phenyltoloxamine, phenyramidol, phenytoin, acid, OXiperomide, oxiracetam, oxiramide, oxisopred, phetharbital, pholcodine, pholedrine, phosphoramide OXisuran, OXitefonium bromide, oxitriptan, oxitriptyline, mustard, phoxim, phthalofyne, phthalysulfacetamide, OXitropium bromide, OXmetidine, OXodipine, Oxogestone phthalylsulfame thizole, phthalylsulfathiazole, phenpropionate, oxolamine, OXolinic acid, oxomemazine, 65 physostigmine, phytic acid, phytonadiol diphosphate, oXonazine, oxophenarsine, Oxoprostol, oxpheneridine, phytonadione, pibecarb, pibenzimol, pibecarb, pibenzimol, oXpre noate potassium, OXprenolol, OXtriphylline, piberaline, picafibrate, picartamide, picenadol, picilorex, US 6,261,537 B1 SS S6 piclonidine, piclopastine, picloxydine, picobenzide, propiolactone, propiomazine, propipocaine, propiram, picodralazine, picolamine, piconol, picoperine, picoprazole, propisergide, propiverine, propizepine, propofol, propoXate, picotamide, picotrin diolamine, picumast, pidolic acid, propoxycaine, propoxyphene, propranolol, propyl pifarnine, pilfenate, pifeXole, piflutiXole, pifoXime, docetrizoate, propylene glycol, propylene glycol piketoprofen, pildralazine, pilocarpine, pimoclone, mono Stearate, propyl gallate, propylhexe drine, pimefylline, pimelautde, pimetacin, pimethixene, pimetine, propylio done, propylparaben, propylthiou racil, pimetremide, piminodine, pimobendan, pimondiazole, propyperone, propyphenaZone, propyromazine bromide, pimozide, pinacidil, pinadoline, pinafide, pinaverium produaZone, produinolate, prorenoate potassium, proroXan, bromide, pinazepam, pincainide, pindolol, pinolcaine, proscillaridin, prospidium chloride, prostalene, proSulpride, pino Xepin, pioglita Zone, pipacycline, pip amazine, proSultiamine, proterguride, protheobromine, prothipendyl, pipaperone, pipaZe thate, pipebu Zone, pipe curonium prothixene, protiofate, protionamide, protirelin, protizinic bromide, pipemidic acid, pipenzolate bromide, pipequaline, acid, protokylol, protoveratine, protriptyline, proxazole, piperacetazine, piperacillin, piperamide, piperazine, proXibarbal, proxibutene, proXicromil, proxife Zone, piperazinedione, piperidolate, piperilate, piperocaine, proXorphan, proxyphylline, proZapine, pseudoephedrine, piperoxan, pipery lone, pipobroman, pipocta none, 15 psilocybine, pumiteba, puromycin, pyrabrom, pyran pipofeZine, pipOSulfan, pipotiazine palmiate, pipOXizine, copolymer, pyrantel, pyrathiazine, pyra Zinamide, pipoxolan, pipradimadol, pipradol, pipramadol, pipratecol, pyrazofurin, pyricarbate, pyridarone, pyridofylline, pyri piprinhydrinate, piprocurarium iodide, piprofurol, do Stigmine bromide, pyrido Xine, pyrilamine, piprozolin, piquindone, piquizil, piracetam, pirandamine, pyrimethamine, pyrimitate, pyrinoline, pyrithione Zinc, pirarubicin, piraxelate, piraZmonam, piraZolac, pirbenicillin, pyrithyldione, pyritidium bromide, pyritinol, pyronine, pirbuterol, pirdonium bromide, pirenoXine, piremperone, pyrophenindane, pyrovalerone, pyroxamine, pyrrobutamine, pirenzepine, pirepolol, piretanide, pirfenidone, piribedil, pyrrocaine, pyrroliphene, pyrrolnitrin, pyrvinium chloride, piridicillin, piridocaine, piridoxilate, piridironic acid, pytamine, quadazocine, quadrosilan, quatacaine, quazepam, pirifibrate, pirindazole, pirinixic acid, piriniXil, piriprost, quaZinone, quaZodine, quaZolast, quifenadine, quillifoline, piriqualone, pirisudanol, piritramide, piritrexim, pirlimycin, 25 quinacainol, quinacillin, quinacrine, quinaldine blue, pirlindole, pirmagrel, pirmenol, pirnabine, piroctone, quinapril, quinaprilat, quinaZosin, quinbolone, quincarbate, pirogliride, piroheptine, pirolate, pirolazamide, piromidic quinde camine, quindonium bromide, quindo Xin, acid, piroXantrone hcl, piroXicam, piroXicam cinnamate, quineStradiol, quinestrol, quine thaZone, quinetolate, piroxicillin, piroXimone, pirozadil, pirprofen, pirquinoZol, quine Zamide, quin famide, quinge Stanol acetate, pirralkonium bromide, pirtenidine, pitenodil, pitofenone, quingestrone, quindine, quinine, quinocide, quinpirole, pituxate, pivampicillin, pivenfrine, pivopril, pivoxazepam, quinterenol, quintiofoS, quinuclium bromide, quinupramine, pizotyline, plafibride, plaunotol, pleuromulin, plicamycin, quipazine, quisultazine, race femine, race methionine, podilfen, podophylloxoxin, poldine methylsulfate, racemethorphan, racemetirosine, raclopride, ractopamine, polidocanol, ploymyxin, polythiazide, ponal restat, rafoxanide, ralitoline, raloxifene, ramciclane, ramefenaZone, ponfibrate, p or firomycin, poskine, potassium 35 ramipril, ramiprilat, ramiXotidine, ramno dignin, guaiacolsulfonate, potassium nitrazepate, potassium Sodium ranimustine, ranimycin, ranitidine, ranolazine, rathyronine, tartrate, potassium Sorbate, potassium thiocyanate, practolol, raZinodil, raZobazam, razoxane, reboxetine, recainam, prajmalium, pralido Xime chloride, pramipexole, reclazepam, relomycin, remoxipride, renanolone, rentiapril, pramiracetam, pramiverine, Spramoxime, prampine, prano repirinast, repromicin, reproterol, recimetol, rescinnamine, lium chloride, pranoprofen, pranosal, prasterone, 40 reserpine, resorantel, resorcinol, resorcinol monoacetate, pravastatin, praXadine, prazepam, praZepine, praZiquantel, retelliptine, retinol, revenast, ribavirin, riboflavin, riboflavin praZitone, praZOcillin, praZosin, preclamol, prednazate, 5'-phosphate, riboprine, ribostamycin, ridazolol, ridiflone, predna Zo line, prednicarbate, prednimu Stine, rifabutin, rifamide, rifampin, rifamycin, rifapentine, prednisolamate, prednisolone, prednisolone acetate, pred rifaximin, rilapine, rilmaZafone, rillmenidine, rilopiroX, nisolone hemisuccinate, prednisolone phosphate, predniso 45 riloZarone, rimantadine, rimazolium metilsulfate, rimcazole, lone Steaglate, prednisolone tebutate, prednisone, prednival, rimeXolone, rimiterol, rimoprogin, riodipine, rioprostil, prednylidene, prefenamate, pregnenolone, pregnenolone ripazepam, risocaine, risperidone, ristianol, ristocetin, Succinate, pre mazepam, prenalte rol, pre nisteine, ritanserin, ritiometan, ritodrine, ritropirronium bromide, prenoverine, prenoxdiazine, prenylamine, pretamazium ritroSulfan, robenidine, rocastine, rociverine, rodocaine, iodide, pretiadil, pribecaine, pridefine, prideperone, pridinol, 50 rodorubicin, rofelodine, roflurante, rokitamycin, roletamide, prifelone, pri?inium bromide, prifuroline, prilocaine, rolgamidine, rollicyclidine, rollicyprine, rollipram, primaperone, primacquine, primidolol, primidone, primycin, rolitetracycline, rolodine, rolziracetam, romifenone, prinomide, pristinamycin, prizidilol, proadifen, probarbital, romifidine, ronactolol, ronidazole, ronifibrate, ronipamil, probenecid, probicromil, probucol, procainamide, procaine, ronnel, ropitoin, ropivacaine, ropizine, roquinimex, procarbazine, procaterol, prochlorperazine, procinolol, 55 rosaprostol, rosaramicin, rosaramicin butyrate, rosaramicin procinonide, proclonol, procodiazole, procyclidine, propionate, roSoxacin, rosterolone, rotamicillin, rotoxamine, procymate, prodeconium bromide, prodilidine, prodipine, rotraxate, roXarSone, roXatidine acetate, roXibolone, prodolic acid, profadol, profeXalone, proflavine, roXindole, roXithromycin, roXolonium metilsulfate, proflazepam, progabide, progesterone, proglu metacin, roXoperone, rufloxacin, rutamycin, rutin, ruvaZone, proglumide, proheptazine, proligestone, proline, prolintane, 60 Sabeluzole, Saccharin, Salacetamide, Salafibrate, Salantel, prolonium iodide, promazine, promegestone, promestriene, Salazodine, SalazoSSulfadimedine, SalazoSulfamide, promethazine, promolate, promoxolane, pronetalol, SalazOSulfathiazole, Salethamide, Salfluverine, Salicin, Sali propacetamol, propafenone, propamidine, propanidid, cyl alcohol, Salicylamide, Salicylanilide, Salicylic acid, propanocaine, propantheline bromide, proparacaine, pro Salinazid, Salinomycin, Salmefanol, Salmeterol, Salmisteine, paty 1 nitrate, propa Zolamide, prope n diazole, 65 Salprotoside, Salsalate, Salverine, Sancycline, Sangivamycin, propentofylline, propenzolate, properidine, propetamide, Saperconazole, Sarcolysin, SarmaZenil, Sarmoxicillin, prope tandrol, propicillin, propikacin, propinetidine, Sarpicillin, Saterinone, Satranidazole, Savoxepin, Scarlet red, US 6,261,537 B1 57 58 Scopafungin, Scopolamine, Secla Zone, Secnidazole, ethonium chloride, SuxibuZone, Symclosene, Symetine, Secobarbital, Secoverine, Securinine, Sedecamycin, Synephrine, Syrisingopine, taclamine, tacrine, taglutimide, Segan Serin, Seglitide, Selegiline, Selenium Sulfide, talampicillin, talastine, talbutal, taleranol, tallinolol, Selprazine, Sematilide, Semustine, SepaZonium chloride, talipexole, tallisomycin, talmetacin, talmetoprim, Seperidol, Sequifenadine, Serfibrate, Sergolexole, Serine, talniflumate, talopram, taloSalate, taloximine, talsupram, Sermetacin, Serotonin, Sertaconazole, Sertraline, Setastine, taltrimide, tameridone, tameticillin, tametraline, tamitinol, SetaZindol, Setiptiline, Setoperone, Sevitropium mesilate, tamoxipen, tampramine, tandamine, taprostene, tartaric sevoflurane, Sevopramide, Siagoside, Sibutramine, Siccanin, acid, tasuldine, taurocholic acid, taurolidine, tauromustine, Silandrone, Silibinin, Silicristin, Silidianin, Silver tauroSelcholic acid, taurultam, taxol, taZadolene, taZanolast, Sulfadiazine, Simetride, Simfibrate, SimtraZene, Simvastatin, tazaburate, taZeprofen, tazifylline, taZiprinone, tazolol, Sinefungin, Sintropium bromide, Sisomicin, Sitalidone, tebatizole, tebuduine, teclothiazide, teclozan, tedisamil, sitofibrate, SitogluSide, Sodium benzoate, Sodium dibunate, tefazoline, tefenperate, tefludazine, teflurane, teflutiXol, Sodium ethasulfate, Sodium formaldehyde Sulfoxylate, tegafur, telenZepine, temafloxacin, temaroteine, temazepam, Sodium gentisate, Sodium gualenate, Sodium nitrite, Sodium temefoS, temelastine, temocillin, temodox, temozolomide, nitroprusSide, Sodium oxybate, Sodium phenylacetate, 15 temurtide, tenamfetamine, te nilapine, teniloxazine, Sodium picofoSfate, Sodium picOSulfate, Sodium propionate, tenilsetam, teniposide, tenocyclidine, tenonitro Zole, Sodium Stibocaptate, Sodium Stibogluconate, Sodium tetrade tenoxicam, tenylidone, teopranitol, teoprolol, tepirindole, cyl Sulfate, Sodium thiosulfate, Sofalcone, Solasulfone, tepoxalin, teraZosin, terbinafine, terbucromil, terbufibrol, Solpe cainol, Solypertine, Somantadine, SopitaZine, terbuficin, terbuprol, terbutaline, terciprazine, terconazole, Sopromidine, Soquinolol, Sorbic acid, Sorbinicate, Sorbinil, terfenadine, terfluranol, terguride, terizidone, ternidazole, Sorbitan monolaurate, Sorbitan monooleate, Sorbitan terodiline, terofenamate, teroxalene, teroxirone, terpin monopalmitate, Sorbitan monoStearate, Sorbitan trioleate, hydrate, tertatolol, teSicam, tesimide, testolactone, Sorbitan triStearate, Sorbitol, Sorndipine, Sotalol, Soterenol, testosterone, testosterone cypionate, testosterone enanthate, Spaglumic acid, Sparfosic acid, SparSomycin, Sparteine, testosterone ketolaurate, testosterone phenylacetate, test Spectinomycin, Spiclamine, Spiclomazine, Spiperone, 25 osterone propionate, tetrabarbital, tetrabenazine, tetracaine, Spiradoline, Spiramide, Spiramycin, Spirapril, Spiraprilat, tetrachloroethylene, tetracycline, tetradonium bromide, tet Spire ndolol, Spirgetine, Spirilene, Spirofylline, raethylammonium chloride, tetrahydrozoline, tetramethrin, Spirogermanium, Spiromustine, Spironolactone, Spiroplatin, tetramisole, tetrandrine, tetrantoin, tetrazepam, tetriprofen, Spirorenone, Spirotriazine, SpiroXaSone, SpiroXatrine, tetronasin 5930, tetroquinone, tetroXoprim, tetrydamine, SpiroXepin, Spizofurone, Stallimycin, Stanolone, Stanzolol, texacromil, thalicarpine, thalidomide, thebacon, thebaine, Stearic acid, Stearyl alcohol, Stearylsulfamide, Steffimycin, thenalidine, thenium closylate, thenyldiamine, theobromine, Stenbolone acetate, Stepronin, Stercuronium iodide, theodrenaline, theofibrate, theophylline, thiabendazole, Stevaladil, Stibamine glucoside, Stibophen, Stilbamidine, Stil thiacetarsamide, thialbarbital, thiambutosine, thiamine, bazium iodide, Stilonium iodide, Stirimazole, Stiripentol, thiamiprine, thiamphenicol, thiamylal, thiaZeSim, thiazina Stirocainide, Stirifos, Streptomycin, Streptonico Zid, 35 mium chloride, thiazolsulfone, thiethyperazine, thihexinol Streptonigrin, Streptovarycin, Streptozocin, Strinoline, methylbromide, thimerfonate, thimerosal, thiocarbanidin, Strychnine, Styramate, SubathizOne, Subendazole, Succimer, thiocarzolamide, thiocolchioside, thiofuradene, thioguanine, Succinylcholine chloride, Succinylsulfathiazole, thioguanine alpha-deoxyriboside, thioguanine beta Succisulfone, Suclofenide, Sucralfate, Sucrose octaacetate, deoxyriboside, thioguanosine, thiohexamide, thioinosine, SudeXanox, Sudoxicam, Sufentanil, Sufosfamide, Sufotidine, 40 thiopental, thiopropazate, thioproperazine, thioridazine, Sulazepam, Sulbactam, Sulbactam pivoxil, Sulbenicillin, thiosalan, thiotepa, thiotetrabarbital, thiothixene, thiouracil, Sulbenox, Sulbentine, Sulbutiamine, Sulclamide, Sulconazole, thiphenamil, thiphencillin, thiram, thonzonium bromide, Sulfabenz, Sulfabenzamide, Sulfacarbamide, Sulfacecole, thonzylamine, thozalinone, threonine, thymidine, thymol, Sulfacetamide, Sulfachlorpyridazine, Sulfachrysoidine, thymol iodide, thymopentin, thyromedan, thyropropic acid, Sulfaclomide, Sulfaclorazole, Sulfaclozine, Sulfacytine, 45 tiacrilast, tiadenol, tiafibrate, tiamenidine, tiametonium Sulfadiazine, Sulfadicramide, Sulfadimethoxine, Sulfadoxine, iodide, tiamulin, tianafac, tianeptine, tiapamil, tiapirinol, Sulfaethidole, Sulfaguandide, Sulfaguanole, Sulfalene, tiapride, tiaprofenic acid, tiaprost, tiaramide, tiazofurin, Sulfaloxic acid, SulfamaZone, Sulfamerazine, Sulfameter, tiaZuril, tibalosin, tibenalast Sodium, tibenzate, tibeZonium Sulfame thaZine, Sulfamethizole, Sulfamethoxazole, iodide, tibolone, tibric acid, tibrofan, tic-mustard, ticabeSone Sulfamethoxypyridazine, Sulfamethoxypyridazine acetyl, 50 propionate, ticarbodine, ticarcillin, ticarcillin creSyl, Sulfametomidine, Sulfametrole, Sulfamonomethoxine, ticlatone, ticlopidine, ticrynafen, tidiacic, tiemoium iodide, Sulfamoxole, Sulfanil amide, Sulfanitran, Sulfaperin, tie nocarbine, tienopramine, tienoxolol, tifemoxone, Sulfaphena Zole, Sulfaproxyline, Sulfapyridine, tiflamizole, tiflorex, tifluadom, tiflucarbine, tiformin, tifurac, Sulfaquinoxaline, SulfarSphe namine, SulfaSalazine, tigemonam, tigestol, tigloidine, tilbroquinol, tiletamine, SulfaSomizole, SulfaSuccinamide, Sulfasy mazine, 55 tilidine, tiliquinol, tilisolol, tilmicosin, tilomisole, tillorone, Sulfathiazole, Sulfathiourea, Sulfatolamide, Sulfatroxazole, tilozepine, tilSuprost, timefurone, timegadine, timelotem, Sulfatrozole, Sulfazamet, Sulfinalol, Sulfinpyrazone, Sulfiram, timepidium bromide, timiperone, timobesone acetate, Sulfi So midine, SulfiS oxazole, SulfiS oxazole, timofibrate, timolol, timonacic, timoprazole, tinabinol, Sulfobromophthalein, Sulfonethylmethane, Sulfonmethane, tinazoline, tinidazole, tinisulpride, tinofedrine, tinoridine, Sulfonterol, Sulforidazine, Sulfoxone Sodium, Sullicrinat, 60 tiocarlide, tioclomarol, tioconazole, tioctilate, tiodaZosin, Sulindac, Sulisatin, Sulisobenzone, Sulmarin, Sulmazole, tiodonium chloride, tiomergine, tiomesterone, tioperidone, Sulme pride, Sulinidazole, Sulocarbilate, Suloctidil, tiopinac, tiopronin, tiopropamine, tioSpirone, tiotidine, Sulosemide, Sulotroban, Suloxifen, Sulpiride, Sulprosal, tioxacin, tioXamast, tioxaprofen, tioxidazole, tioxolone, Sulprostone, Sultamicillin, Sulthiame, Sultopride, Sultosilic tipentosin, tipepidine, tipetropium bromide, tipindole, acid, Sultroponium, Sulverapride, Sumacetamol, Sumatriptan, 65 tipredane, tiprenolol, tiprinast, tipropidil, tiproStanide, Sumetizide, Sunagrel, Suncillin, Supidimide, Suproclone, tiprotimod, tiquinamide, tiquizium bromide, tiratricol, Suprofen, Suramin, Suricainide, Suriclone, Suxemerid, Sux tiropramide, tisocromide, tisopurine, tisoquone, tivandizole, US 6,261,537 B1 59 60 tiXadil, tiXanox, tiXocortol pivalate, tiZabrin, tianidine, comycin hc l, Vane prim, Vanillin, Vanitolide, tizolemide, tizoprolic acid, tobramycin, tobuterol, tocainide, Vanyldisulfamide, Vapi.prost, vecuronium bromide, Velna to camphyl, tocofenoxate, tocofibrate, tocopherSolan, crine male ate, Venlafaxine, Veradoline, Veralipride, todralazine, tofenacin, tofetridine, tofisoline, tofisopam, Verapamil, Verazide, Verilopam, Verofylline, Vesnarinone, tolamolol, tolaZamide, tolazoline, tolboxane, tolbutamide, Vetrabutine, Vidarabine, Vidarabine phophate, vigabatrin, tolciclate, toldimfoS, tolfamide, tolfenamic acid, tolgabide, Viloxazine, Viminol, Vinbarbital, vinblastine, Vinburnine, tolimidone, tolindate, toliodium chloride, toliprolol, Vincamine, Vincanol, Vincantril, VincofoS, Vinconate, tolmeSoxide, tolmetin, tolnaftate, tolnapersine, tolnidamine, Vincristine, Vindrburnol, Vindesline, Vindepidine, Vinformide, toloconium metilsulfate, tolonidine, tolonium chloride, toloXatone, toloxychlorinol, tolpadol, tolpentamide, Vinglycinate, Vinorelbine, Vinpocetine, Vinpoline, tolperisone, toliprazole, tolpronine, tolpropamine, Vinrosidine, Vintiamol, Vintriptol, Vinylbital, Vinylether, tolpyrramide, tolduinzole, tolrestat, toltraZuril, tolufazepam, Vinzolidine, Viomycin, Viprostol, Viqualine, Vicquidil, Virgin tolycaine, tomelukast, tomoglumide, tomoxetine, iamycin factors, ViroXime, Visnadine, Visnafylline, Vitamin tomoxiprole, tonazocine, topiramate, toprilidine, e, volazocine, warfarin, Xamoterol, Xanoxic acid, Xanthinol tonazocine, topiramate, toprilidine, topterone, toguizine, 15 niacinate, Xanthiol, Xantifibrate, Xantocillin, Xenalipin, Xena torasemide, toebafylline, toremifene, toSifen, toSufloxacin, Zoic acid, Xenbucin, Xenipentone, Xenthiorate, Xenygloxal, toSulur, toyocamycin, toyomycin, traboxepine, tracazolate, Xeny hexenic acid, Xeny tropium bromide, Xibenolol, tralonide, tramadol, tramaZoline, trandolapril, tranexamic Xibornol, Xilobam, Ximoprofen, Xinidamine, Xinomiline, acid, tranilast, transcainide, trantellinium bromide, Xipamide, Xipranolol, Xorphanol, Xylamidine, Xylazine, tranylcypromine, trapencaine, trapidil, traXanox, trazilitine, Xylocoumarol, Xylometazoline, Xyloxemine, yohimbic acid, traZium esilate, traZodone, traZolopride, treben Zomine, Zabicipril, Zacopride, Zafuleptine, Zaltidine, Zapizolam, trecadrine, treloxinate, trenbolone acetate, trengestone, Zaprinast, Zardaverine, Zenazocine meSylate, Zepastine, trenizine, troSulfan, trepibutone, trepipam, trepirium iodide, Zeranol, Zetidoline, Zidapamide, Zidometacin, Zidovudine, treptilamine, trequensin, trestolone acetate, trethinium Zilantel, Zimeldine, Zimidoben, Zinc acetate, Zinc tosilate, trethocanoic acid, tretinoin, tretoquinol, triacetin, 25 phenolsulfonate, Zinc undecylenate, Zindotrine, Zindoxifene, triafungin, triamcinolone, triamcinolone acetonide, triamci Zinoconazole, Zinterol, ZinviroXime, Zipeprol, Zocainone, nolone acetonide-phosphate, triamcinolone benetonide, tri Zofenopril, Zoficonazole, Zolamine, Zolazepam, Zolenzepine, amcinolone diacetate, triamcinolone furetonide, triamcino Zollertine, Zolimidine, Zoliprofen, Zoloperone, Zolpidem, lone hexacetonide, triampyZine, triamterene, triaZinate, Zome bazam, Zome pirac, Zome tapine, Zonisamide, tria Ziquone, tria Zolam, tribendilol, tribe no Side, Zopiclone, Zorubicin, Zote pine, Zoxazolamine, tribromoethanol, tribromsalan, tribuZone, triacetamide, Zuclomiphene, Zuclophenthixol, Zylofuramine. trichlormethiazide, trichlormethine, trichloroacetic acid, The following non-limitative examples Serve to illustrate trichloroethylene, tricribine phosphate, triclabendazole, the invention. Confirmation of the microparticulate nature of triclacetamol, triclazate, triclobisonicum chloride, products is performed using microscopy as described in triclocarban, triclodaZol, triclofenol, piperazine, triclofoS, 35 WO-A-9607434. Ultrasonic transmission measurements triclofylline, triclonide, triclosan, tricyclamol chloride, tridi may be made using a broadband transducer to indicate heXethyl chloride, trientine, triethylene melamine, microbubble Suspensions giving an increased Sound beam triethylenephosphoramide, trifenagrel, trifeZolac, triflocin, attenuation compared to a Standard. Flow cytometric analy triflubazam, triflumidate, trifluomeprazine, trifluoperazine, sis of products can be used to confirm attachment of mac triflu peridol, triflu promazine, trifluridine, triflusal, 40 romolecules thereto. The ability of targeted microbubbles to trigeVolol, trihexyphenidyl, triletide, triloStane, trimaZosin, bind Specifically to cells expressing a target may be Studied trimebutine, trime caine, trime do Xime bromide, in vitro by microscopy and/or using a flow chamber con trimeperidine, trimeprazine, trimetazidine, trimethadione, taining immobilised cells, for example employing a popu trimethamide, trimethaphan camsylate, trimethidinium lation of cells expressing the target Structure and a further metho Sulfate, trime thobe nZamide, trimethoprim, 45 population of cells not expressing the target. Radioactive, trimetozine, trimetrexate, trime Xiline, trimipramine, fluorescent or enzyme-labelled Streptavidin/avidin may be trimoprostil, trimoxamine, trioxifene, trioxSalen, tripamide, used to analyse biotin attachment. triparanol, tripelennamine, tripotassium dicitratobismuthate, triprolidine, tritioZine, tritoqualine, trityl cysteine, trixolane, EXAMPLE 1. trizoxime, trocimine, troclosene potassium, trofosfamide, 50 troleandomycin, trolnitrate, tromantadine, tromethamine, Adhesion of poly-L-lysine-coated Phosphatidylserine tropabazate, tropanserin, tropapride, tropatepine, tropen encapsulated Microbubbles to Endothelial Cells Ziline bromide, tropicamide, tropigline, tropiprine, Poly-L-lysine (8 mg) having a molecular weight of 115 tropodifene, trospectomycin, troSpium chloride, troXerutin, kDa was dissolved in water (400 ul). Freshly redispersed troXipide, troXolamide, troxonium tosilate, troxypyrrolium 55 microbubbles of phosphatidylserine-encapsulated perfluo tosilate, troxypyrrolium tosilate, truXicurium iodide, truXi robutane (40 ul) were incubated in either water (400 ul) or picurium iodide, tryparsamide, tryptophan, tryptophane the poly-L-lysine Solution for 15 minutes at room tempera mustard, tuaminoheptane, tubercidine, tubocurarine ture. Zeta potential measurements confirmed that the poly chloride, tubulozole, tuclazepam, tulobutrol, tuvatidine, L-lysine-coated microbubbles were positively charged while tybamate, tylocrebin, tylosin, tyramine, tyropanic acid, 60 the uncoated bubbles were negatively charged. A cell adhe tyrosine, ubenimex, ubidecarenone, ubisindine, ufenamate, Sion Study using human endothelial cells grown in culture ufiprazole, uldazepam, ulobetasol, undecoylium chloride, dishes was performed with the above-described undecyclenic acid, uracil mustard, urapidil, urea, uredepa, microbubbles, the uncoated microbubbles being used as a uredofos, urefibrate, urethane, uridine, urSodeoxycholic control. Microscopy of the endothelial cells after incubation acid, urSucholic acid, Vadocaine, Valconazole, Valdetamide, 65 showed a much increased number of poly-L-lysine-coated Valdipromide, Valine, Valnoctamide, Valofane, Valperinol, microbubbles adhering to endothelial cells in comparison to Valproate pivoxil, Valproic acid, Valpromide, Valtrate, van the uncoated microbubbles. US 6,261,537 B1 61 62 EXAMPLE 2 ambient temperature. The dispersion (0.8 ml) is transferred Gas-filled Microbubbles Comprising Phosphatidylserine to a vial (1 ml) and the head space is flushed with perfluo and RGDC-Mal-PEGo-DSPE (SEQ ID NO:1) robutane. The Vial is Shaken in a cap-mixer for 45 seconds, a) Synthesis of Boc-NH-PEGoo-DSPE (t-butyl carbam whereafter the Sample is put on a roller table. After cen a te poly (ethylene glycol) trifugation the infranatant is exchanged with 0.1 M Sodium distearoylphosphatidylethanolamine) phosphate buffer having a pH of 7.5. RGDC-Mal-PEGo DSPE (distearoylphosphatidylethanolamine) (31 mg, DSPE (SEQID NO: 1) dissolved in 0.1 M sodium phosphate Sygena Inc.) was added to a solution of Boc-NH-PEGoo buffer having a pH of 7.5 is added to the washed SC (t-butyl carbamate poly(ethylene glycol)-Succinimidyl microbubbles, which are then placed on the roller table. The carbonate) (150 mg) in chloroform (2 ml), followed by Washing procedure is repeated following incorporation of triethylamine (33 ul). The mixture formed a clear solution the RGDC-Mal-PEGo-DSPE (SEQ ID NO:1) into the after stirring at 41 C. for 10 minutes. The solvent was rotary microbubble membranes. evaporated and the residue taken up in acetonitrile (5 ml). EXAMPLE 3 The thus-obtained dispersion was cooled to 4 C. and Gas-filled Microbubbles Encapsulated with centrifuged, whereafter the Solution was separated from the 15 Phosphatidylserine, Phosphatidylcholine and biotin undissolved material and evaporated to dryneSS. The Struc amidocaproate-PEGoo-Ala-cholesterol ture of the resulting product was confirmed by NMR. a) Synthesis of Z-Ala-cholesterol (3-O-(carbobenzyloxy b) Synthesis of HN-PEGoo-DSPE (amino-poly L-alanyl)cholesterol) (ethylene glycol)-distearoylphosphatidylethanolamine) Cholesterol (4 mmol), Z-alanine (5 mmol) and dimethy Boc-NH-PEGo-DSPE (167 mg) was stirred in 4 M laminopy ridine (4 mmol) were dissolved in hydrochloric acid in dioxane (5 ml) for 2.5 hours at ambient dimethylformamide/tetrahydrofuran (20 ml+5 ml) and dicy temperature. The Solvent was removed by rotary evapora clohexylcarbodiimide was added. The reaction mixture was tion and the residue was taken up in chloroform (1.5 ml) and Stirred at ambient temperature overnight. Dicyclohexylurea washed with water (2x1.5 ml). The organic phase was was filtered off and the solvent was rotary evaporated. The removed by rotary evaporation. TLC (chloroform/methanol/ 25 residue was taken up in chloroform, undissolved dicyclo water 13:5:0.8) gave the title product with Rf=0.6; the hexylurea was filtered off and the solvent was removed by Structure of the product, which was ninhydrin positive, was rotary evaporation. The residue was placed on a column of confirmed by NMR. Silica gel, and Z-Ala-cholesterol was eluted with toluene/ c) Synthesis of Mal-PEGo-D SPE petroleum ether (20:2) followed by toluene/diethyl ether (3-male imidopropio nate poly (ethylene glycol) (20:2). The fractions containing the title compound were distearoylphosphatidylethanolamine) combined and the Solvent was removed by rotary evapora A Solution of N-Succinimidyl-3-maleimidopropionate tion. The structure of the product was confirmed by NMR. (5.6 mg, 0.018 mmol) in tetrahydrofuran (0.2 ml) is added b) Synthesis of Ala-cholesterol (3-O-(L-alanyl)- to HN-PEGoo-DSPE (65 mg, 0.012 mmol) dissolved in cholesterol) tetrahydrofuran (1 ml) and 0.1 M sodium phosphate buffer 35 Z-Ala-cholesterol (0.48 mmol) is placed in tetrahydrofu pH 7.5 (2 ml). The reaction mixture is heated to 30° C. and ran (20 ml) and glacial acetic acid (3 ml) and hydrogenated the reaction is followed to completion by TLC, whereafter in the presence of 5% palladium on charcoal for 2 hours. The the Solvent is evaporated. reaction mixture is filtered and concentrated in vacuo. d) Synthesis of RGDC-Mal-PEGo-DSPE (SEO ID c) Synthesis of Boc-NH-PEGoo-Ala-cholesterol NO: 1) Mal-PEG-DSPE (0.010 mmol) in 0.1 M sodium 40 Ala-cholesterol is added to a solution of Boc-NH phosphate buffer having a pH of 7.5 is added to the peptide PEGoo-SC (t-butyl carbamate poly(ethylene glycol)- RGDC (SEQ ID NO: 1) (0.010 mmol). The reaction mixture succinimidyl carbonate) in chloroform, followed by triethy is heated to 37 C. if necessary and the reaction is followed lamine. The suspension is stirred at 41 C. for 10 minutes. by TLC to completion, whereafter the solvent is removed. The crude product is purified by chromatography. e) Preparation of Gas-filled Microbubbles Encapsulated 45 d) Synthesis of HN-PEGoo-Ala-cholesterol by Phosphatidylserine and RGDC-Mal-PEGo-DSPE Boc-NH-PEGoo-Ala-cholesterol is stirred in 4 M hydro (SEO ID NO:1) chloric acid in dioxane for 2.5 hours at ambient temperature. To a mixture (5 mg) of phosphatidylserine (90-99.9 mol The solvent is removed by rotary evaporation and the %) and Mal-PEG-DSPE (10-0.1 mol %) is added 5% residue is taken up in chloroform and washed with water. propylene glycol-glycerol in water (1 ml). The dispersion is 50 The organic phase is rotary evaporated to dryneSS. The crude heated to not more than 80 C. for 5 minutes and then cooled product may be purified by chromatography. to ambient temperature. The dispersion (0.8 ml) is then e) Synthesis of biotinamidocaproate-PEGoo-Ala transferred to a vial (1 ml) and the head space is flushed with cholesterol perfluorobutane. The vial is shaken in a cap-mixer for 45 A Solution of biotinamidocaproate N-hydroxySuccinimide Seconds, whereafter the Sample is put on a roller table. After 55 ester in tetrahydrofuran is added to HN-PEGoo-Ala centrifugation the infranatant is exchanged with 0.1 M cholesterol dissolved in tetrahydrofuran and 0.1 M sodium Sodium phosphate buffer having a pH of 7.5. The peptide phosphate buffer having a pH of 7.5 (2 ml). The reaction RGDC (SEQ ID NO:1), dissolved in 0.1 M sodium phos mixture is heated to 30° C. and the reaction is followed to phate buffer having a pH of 7.5, is added to the washed completion by TLC, whereafter the solvent is evaporated. microbubbles, which are placed on the roller table. The 60 f) Preparation of Gas-filled Microbubbles Encapsulated Washing procedure is then repeated. with Phosphatidylserine, Phosphatidylcholine and f) Alternative Preparation of Gas-filled Microbubbles biotinamidocaproate-PEGoo-Ala-cholesterol Encapsulated by Phosphatidylserine and RGDC-Mal To a mixture (5 mg) of phosphatidylserine and phosphati PEG-DSPE (SEO ID NO:1) dylcho line (in total 90-99.9 mol %) and To phosphatidylserine (5 mg) is added 5% propylene 65 biotinamidocaproate-PEGoo-Ala-cholesterol (10-0.1 mol glycol-glycerol in water (1 ml). The dispersion is heated to %) is added 5% propylene glycol-glycerol in water (1 ml). not more than 80 C. for 5 minutes and then cooled to The dispersion is heated to not more than 80 C. for 5 US 6,261,537 B1 63 64 minutes and then cooled to ambient temperature. The dis dispersion (0.8 ml) is transferred to a vial (1 ml) and the head persion (0.8 ml) is then transferred to a vial (1 ml) and the space is flushed with perfluorobutane. The vial is shaken in head space is flushed with perfluorobutane. The vial is a cap-mixer for 45 Seconds, whereafter the Sample is put on Shaken in a cap-mixer for 45 seconds, whereafter the Sample a roller table. After centrifugation the infranatant is is put on a roller table. After centrifugation the infranatant is eXchanged with an appropriate buffer and coupling of the eXchanged with water and the Washing is repeated. thiolated antibody to the microbubbles is performed, e.g. as g) Alternative Preparation of Gas-filled Microbubbles described by Goundalkar, A., Ghose, T. and Mezei, M. in J. Encapsulated with Phosphatidylserine Phosphatidylcholine Pharm. Pharmacol. (1984) 36 465–66 or Hansen, C. B. et and biotinamidocaproate-PEGoo-Ala-cholesterol al.(1995) Biochim. Biophys. Acta 1239 133–144. The To a mixture (5 mg) of phosphatidylserine and phosphati microbubbles are then placed on a roller table for several dylcholine is added 5% propylene glycol-glycerol in water hours and are washed. Flow cytometric analysis of the (1 ml). The dispersion is heated to not more than 80° C. for resulting microbubbles (employing a fluorescently labeled 5 minutes and then cooled to ambient temperature. The Secondary antibody) is used to confirm attachment of the dispersion (0.8 ml) is then transferred to a vial (1 ml) and the anti-CD34 antibody to the bubbles. The ability of the head space is flushed with perfluorobutane. The vial is 15 bubbles to bind specifically to CD34-expressing cells is Shaken in a cap-mixer for 45 seconds, whereafter the Sample Studied by microScopy employing one population of cells is put on a roller table. After centrifugation the infranatant is expressing CD34 and one population that do not express eXchanged with water. Biotinamidocaproate-PEGoo-Ala CD34. cholesterol dissolved in water is added to the washed microbubbles, which are placed on a roller table for several EXAMPLE 6 hours. The Washing procedure is repeated following incor Biotin Attached to Gas-filled Microbubbles poration of the biotinamidocaproate-PEGoo-Ala Biotin may be attached to microbubbles in many different cholesterol into the microbubble membranes. ways, e.g. in a similar way to that described by Corley, P. and Loughrey, H. C. in (1994) Biochim. Biophys. Acta 1195, EXAMPLE 4 149-156. The resulting bubbles are analysed by flow Gas-filled Microbubbles Comprising Phosphatidylserine, 25 cytometry, e.g. by employing fluorescent Streptavidin to Phosphatidylcholine, biotin-amidocaproate-PEGoo-Ala detect attachment of biotin to the bubbles. Alternatively Cholesterol and Drug-cholesterol radioactive or enzyme-labelled Streptavidin/avidin is used to a) Synthesis of Drug-cholesterol analyse biotin attachment. Cholesterol (4 mmol), a drug having an acid group and dimethylaminopyridine (4 mmol) are dissolved in EXAMPLE 7 dimethylformamide/tetrahydrofuran (20 ml+5 ml) and dicy Gas-filled Microbubbles Encapsulated with Distearoylphos clohexylcarbodiimide is added. The reaction mixture is phatidylserine and biotin-DPPE Stirred at ambient temperature overnight. Dicyclohexylurea To distearoylphosphatidylserine (DSPS) (22.6 mg) was is filtered off and the solvent is rotary evaporated. The title added 4% propylene glycol-glycerol in water (4 ml). The compound is purified by chromatography. 35 dispersion was heated to not more than 80 C. for five b) Preparation of Gas-filled Microbubbles Encapsulated minutes and then cooled to ambient temperature. An acque with Phosphatidylserine, Phosphatidylcholine, ous dispersion of biotin-DPPE (1.5 mg) in 4% propylene biotinamidocaproate-PEGoo-Ala-cholesterol and Drug glycol-glycerol (1 ml) was added and the sample was put on cholesterol a roller table for 1-2 hours. The suspension was filled into To a mixture (5 mg) of phosphatidylserine and phosphati 40 Vials and the head Spaces were flushed with perfluorobutane. dylcho line (in total 90-99.9 mol %) and The vials were shaken for 45 seconds, whereafter they were biotinamidocaproate-PEGoo-Ala-cholesterol (prepared as put on a roller table. After centrifugation for 7 minutes the in Example 3) and drug-cholesterol (in total 10-0.1 mol%) infranatant was exchanged with water and the Washing was is added 5% propylene glycol-glycerol in water (1 ml). The repeated twice. Normal phase HPLC with an Evaporative dispersion is heated to not more than 80 C. for 5 minutes 45 Light Scattering Detector confirmed that the membranes of and then cooled to ambient temperature. The dispersion (0.8 the microbubbles contained 4 mol % biotin-DPPE. The ml) is transferred to a vial (1 ml) and the head space is mean particle diameter of the microbubbles was 4 um flushed with perfluorobutane. The vial is shaken in a cap measured by Coulter Counter. Ultrasound transmission mea mixer for 45 Seconds whereafter the Sample is put on a roller surements using a 3.5 MHz broadband transducer showed table. After centrifugation the infranatant is exchanged with 50 that a particle dispersion of <2 mg/ml gave a Sound beam water and the Washing is repeated. attenuation higher than 5 dB/cm. EXAMPLE 5 EXAMPLE 8 Gas-filled Microbubbles Encapsulated with Phosphati Gas-filled Microbubbles Encapsulated with Phosphati dylserine and thiolated-anti-CD34-Mal-PEGo-DSPE 55 dylserine and Biotinylated Antibody Non-covalently Bound a) Preparation of Thiolated anti-CD34 Antibodies to streptavidin-Succ-PEG-DSPE Thiolation of anti-CD34 antibodies may be effected as a) Synthesis of Succ-PEGoo-DSPE described by Hansen, C. B. et al.(1995) Biochim. BiophyS. NH-PEGoo-DSPE (prepared as in Example 2) is car Acta 1239, 133-144. boxylated using Succinic anhydride, e.g. by a similar method b) Preparation of Gas-filled Microbubbles Encapsulated 60 to that described by Nayar, R. and Schroit, A. J. in Bio with Phosphatidylserine and thiolated-anti-CD34-Mal chemistry (1985) 24, 5967-71. PEG-DSPE b) Preparation of Gas-filled Microbubbles Encapsulated To a mixture (5 mg) of phosphatidylserine (90-99.9 mol with Phosphatidylserine and Succ-PEG-DSPE %) and Mal-PEGo-DSPE (10-0.1 mol %, prepared as in To a mixture (5 mg) of phosphatidylserine (90-99.9 mol Example 2) is added 5% propylene glycol-glycerol in water 65 %) and Succ-PEGo-DSPE (10-0.1 mol %) is added 5% (1 ml). The dispersion is heated to not more than 80° C. for propylene glycol-glycerol in water (1 ml). The dispersion is 5 minutes and then cooled to ambient temperature. The heated to not more than 80 C. for 5 minutes and then US 6,261,537 B1 65 66 coooled to ambient temperature. The dispersion (0.8 ml) is Microbubbles from Example 9(c) are incubated in a transferred to a vial (1 ml) and the head space is flushed with Solution containing a biotinylated oligonucleotide. The perfluorobutane. The vial is shaken in a cap-mixer for 45 oligonucleotide-coated bubbles are washed as described Seconds, whereafter the Sample is put on a roller table. After above. Binding of the oligonucleotide to the bubbles is centrifugation the infranatant is exchanged with water and 5 detected e.g. by using fluorescent-labeled oligonucleotides the Washing is repeated. Alternatively the microbubbles may for attachment to the bubbles, or by hybridising the attached be prepared as described in Example 20f). oligonucleotide to a labeled (fluorescence or radioactivity) c) Coupling of Streptavidin to Gas-filled Microbubbles complementary oligonucleotide. The functionality of the Encapsulated with Phosphatidylserine and Succ-PEGoo DSPE oligonucleotide-carrying microbubbles is analysed, e.g. by Streptavidin is covalently bound to Succ-PEGoo-DSPE hybridising the bubbles with immobilized DNA-containing in the microbubble membranes by Standard coupling meth Sequences complementary to the attached oligonucleotide. ods using a water-Soluble carbodiimide. The Sample is AS examples, an oligonucleotide complementary to riboso placed on a roller table during the reaction. After centrifu mal DNA (of which there are many copies per haploid gation the infranatant is exchanged with water and the genome) and an oligonucleotide complementary to an onco Washing is repeated. The functionality of the attached 15 gene (e.g. ras of which there is one copy per haploid Streptavidin is analysed by binding, e.g. to fluorescently genome) may be used. labeled biotin, biotinylated antibodies (detected with a fluo rescently labeled Secondary antibody) or biotinylated and EXAMPLE 10 fluorescence- or radioactively-labeled oligonucleotides. Gas-filled Microbubbles Encapsulated with Phosphati Analysis is performed by fluorescence microScopy or Scin dylserine and folate-PEG-Succ-DSPE tillation counting. a) Preparation of folate-PEG-Succ-DSPE d) Preparation of Gas-filled Microbubbles Encapsulated Folate-PEG-Succ-DSPE is synthesised as described by with hosphatidylserine and Biotin Non-covalently Bound to Lee, R. J. and Low, P. S. in (1995) Biochimica. Biophysica. streptavidin-Succ-PEGo-DSPE Acta 1233, 134-144. Microbubbles from Example 8(c) are incubated in a 25 b) Preparation of Gas-filled Microbubbles Encapsulated Solution containing biotinylated vectors, e.g. biotinylated with Phosphatidylserine and folate-PEG-Succ-DSPE antibodies. The vector-coated microbubbles are washed as To a mixture (5 mg) of phosphatidylserine (90-99.9 mol described above. %) and folate-PEG-DSPE (10-0.1 mol %) is added 5% EXAMPLE 9 propylene glycol-glycerol in water (1 ml). The dispersion is Gas-filled Microbubbles Encapsulated with Phosphati heated to not more than 80 C. for 5 minutes and is then dylserine and Biotinylated Oligonucleotide Non-covalently cooled to ambient temperature. The dispersion (0.8 ml) is Bound to streptavidin-Succ-PEG-DSPE transferred to a vial (1 ml) and the head space is flushed with a) Synthesis of Succ-PEG,00-DSPE perfluorobutane. The vial is shaken in a cap-mixer for 45 NH-PEGo-DSPE (prepared as in Example 2) is car Seconds, whereafter the sample is put on a roller table. After boxylated using Succinic anhydride, e.g. by a similar method 35 centrifugation the infranatant is exchanged with water and to that described by Nayar, R. and Schroit, A. J. in Bio the Washing is repeated. Alternatively the microbubbles are chemistry (1985) 24, 5967-71. prepared as described in Example 20e) or 20f). Analysis of b) Preparation of Gas-filled Microbubbles Encapsulated folate attachment may for example be done by microscopic with Phosphatidylserine and Succ-PEGo-DSPE study of the binding of the folate-containing microbubbles to To a mixture (5 mg) of phosphatidylserine (90-99.9 mol cells expressing different levels of folate receptors. %) and Succ-PEGo-DSPE (10–0.1 mol%) is added 5% 40 propylene glycol-glycerol in water (1 ml). The dispersion is EXAMPLE 11 heated to not more than 80 C. for 5 minutes and then cooled Gas-filled Microbubbles Encapsulated with Phosphati to ambient temperature. The dispersion (0.8 ml) is trans dylserine and thiolated-anti-CD34-Mal-PEGoo-DSPE, ferred to a vial (1 ml) and the head space is flushed with thiolated-anti-ICAM-1-Mal-PEGo-DSPE and thiolated perfluorobutane. The vial is shaken in a cap-mixer for 45 45 anti-E-Selectin-Mal-PEGoo-DSPE Seconds, whereafter the Sample is put on a roller table. After a) Preparation of Thiolated-anti-CD34 Antibodies centrifugation the infranatant is exchanged with water and Thiolation of anti-CD34 antibodies may be effected as the Washing is repeated. Alternatively the microbubbles may described by Hansen, C. B. et al. in (1995) Biochim. be prepared as described in Example 20f). Biophys. Acta 1239, 133-144. c) Coupling of Streptavidin to Gas-filled Microbubbles 50 b) Preparation of Thiolated-anti-ICAM-1 Antibodies Encapsulated with Phosphatidylserine and Succ-PEGoo Thiolation of anti-ICAM-1 antibodies may be effected as DSPE described by Hansen, C. B. et al. in (1995) Biochim. Streptavidin is covalently bound to Succ-PEGo-DSPE Biophys. Acta 1239, 133-144. in the microbubble membraneSS by Standard coupling meth ods using a water-Soluble carbodiimide. The Sample is c) Preparation of thiolated-anti-E-selectin Antibodies placed on a roller table during the reaction. After centrifu 55 Thiolation of anti-E-selectin antibodies may be effected as gation the infranatant is exchanged with water and the described by Hansen, C. B. et al. in (1995) Biochim. Washing is repeated. The functionality of the attached Biophys. Acta 1239, 133-144. Streptavidin is analyzed by binding, e.g. to fluorescently d) Preparation of Gas-filled Microbubbles Encapsulated labeled biotin, biotinylated antibodies (detected with a fluo with Phosphatidylserine and thiolated-anti-CD34-Mal rescently labeled Secondary antibody) or biotinylated and 60 PEGoo-DSPE, thiolated-anti-ICAM-1-Mal-PEGoo fluorescence- or radioactively-labeled oligonucleotides. DSPE, thiolated-anti-E-selectin-Mal-PEGo-DSPE Analysis is performed by fluorescence microScopy or Scin To a mixture (5 mg) of phosphatidylserine (90-99.9 mol tillation counting. %) and Mal-PEG-DSPE (10-0.1 mol %, prepared as in d) Preparation of Gas-filled Microbubbles Encapsulated Example 2) is added 5% propylene glycol-glycerol in water with Phosphatidylserine and a Biotinylated Oligonucleotide 65 (1 ml). The dispersion is heated to not more than 80° C. for Non-covalently Bound to Siotreptavidin-Succ-PEGoo 5 minutes and is then cooled to ambient temperature. The DSPE dispersion (0.8 ml) is transferred to a vial (1 ml) and the head US 6,261,537 B1 67 68 space is flushed with perfluorobutane. The vial is shaken in b) Preparation of Microbubble Dispersion a cap-mixer for 45 Seconds, whereafter the Sample is put on Monolayer-encapsulated microbubbles containing per a roller table. After centrifugation the infranatant is fluorobutane are made from a mixture of 90% phosphati eXchanged with an appropriate buffer, and coupling of the dylserine and 10% (DC-chol) by weighing DSPS (4.5 mg) antibodies from Example 11(a), 11(b) and 11(c) to the and (DC-chol) (0.5 mg) into a 2 ml vial. 0.8 ml propylene microbubbles is performed, e.g. as described by Goundalkar, glycol/glycerol (4%) in water was added. The Solution was A., Ghose, T. and Mezei, M. in J. Pharm. Pharmacol. (1984) heated at 80 C. for 5 minutes and shaken. The solution was 36, 465-466 or by Hansen, C. B. et al. in (1995) Biochim. then cooled to ambient temperature and the headspace was Biophys. Acta 1239, 133-144. The microbubbles are placed flushed with perfluorobutane. The vial was shaken on a on a roller table for several hours and are then washed. cap-mixer at 4450 oscillations/minute for 45 seconds and put on a roller table. The Sample was washed by centrifuging EXAMPLE 12 at 2000 rpm for 5 minutes. The infranatant was removed by The Peptide FNFRLKAGOKIRFGAAAWEPPRARI (SEQ a Syringe and distilled water was added to the same Volume. ID NO:2) Attached to Gas-filled Microbubbles Encapsulated The headspace was again flushed with perfluorobutane and with Phosphatidylserine 15 the Sample was kept on a roller table until a homogeneous The peptide FNFRLKAGOKIRFGAAAWEPPRARI appearance was obtained. The Washing procedure was (SEQID NO:2), comprising phosphatidylserine-binding and repeated again. heparin-binding Sections, is Synthesised. The peptide is added to preformed phosphatidylserine-encapsulated per EXAMPLE 1.5 fluorobutane microbubbles and thoroughly mixed. Gas-filled Microbubbles Encapsulated with Phosphati EXAMPLE 13 dylserine and WEPPRARI-PE (SEQ ID NO:3) Fibronectin Covalently Bound to Gas-filled Microbubbles Phosphatidylethanolamine (PE) is reacted with an Encapsulated with Phosphatidylserine and Phosphatidyle e quimolar a mount of the cro SS linker thanolamine N-hydroxysuccinimidyl-2,3-dibromopropionate in a 1:1 a) Microbubbles Preparation DSPS (25 mg) and DSPE 25 mixture of dioxane and 0.02 M HEPES buffer, pH 8.0. (5.0 mg) were weighed into a clean vial and 5 ml of a Following incubation for 2 hours on ice, an equimolar Solution of 1.4% propylene glycol/2.4% glycerol was added. amount of the heparin-binding peptide WEPPRARI (SEQ The mixture was warmed to 80° C. for 5 minutes. The ID NO:3) is added, the pH is brought to 9 by the addition of 0.2 M disodium tetraborate, and the incubation is continued Sample was cooled to room temperature and the head Space for 2 hours at room temperature. The reaction product is was flushed with perfluorobutane gas. The vials were shaken purified by chromatography. Monolayer-encapsulated in a cap mixer for 45 seconds and the microbubbles were microbubbles containing perfluorobutane are made from a twice washed with distilled water then resuspended in 0.1M mixture of 80–95% phosphatidylserine (PS) and 5-20% of Sodium borate buffer, pH 9. peptide-substituted PE. b) Modification of Fibronectin 35 Fibronectin (1.0 mg) in 5 ml 0.01 M Hepes buffer, pH 8, EXAMPLE 16 was added to 0.1 mmol of the crosslinker SDBP. The mixture was incubated on ice for 2 hours. Gas-filled Microbubbles Encapsulated with Phosphati c) Microbubble Modification. dylserine and Inactivated Human thrombin-Succ-PEGoo To the protein solution from (b) was added the DSPE 40 a) Inactivation of Human Thrombin microbubble Suspension from (a) and incubation was Human thrombin was inactivated by incubation with a allowed to proceed for 2 hours at room temperature on a 20% molar excess of D-Phe-L-Pro-L-Arg-chloromethyl roller table. Unreacted material was removed by allowing the microbubbles to float and then replacing the buffer with ketone in 0.05 M HEPES buffer, pH 8.0, at 37° C. for 30 0.1 M sodium borate buffer, pH 9. This process was repeated minutes. three times. 45 b) Preparation of Gas-filled Microbubbles Encapsulated d) In Vitro Analysis. with Phosphatidylserine and Succ-PEG-DSPE The microbubbles were tested in the in vitro assay To a mixture (5 mg) of phosphatidylserine (90-99.9 mol detailed in Example 21. A gradual accumulation of %) and Succ-PEGoo-DSPE (10-0.1 mol %, prepared as in microbubbles binding to the cells was observed. Example 9(a)) was added 5% propylene glycol-glycerol in 50 water (1 ml). The dispersion was heated to not more than 80 EXAMPLE 1.4 C. for 5 minutes and was then cooled to ambient tempera Gas-filled Microbubbles Encapsulated with ture. The dispersion (0.8 ml) was transferred to a vial (1 ml) Phosphatidylserine, and 3B-N-(N',N'- and the head space was flushed with perfluorobutane. The dimethylaminoethane)carbamoylcholesterol Vial was Shaken in a cap-mixer for 45 Seconds, whereafter a) Synthesis of 3 B-N-(N',N'-dimethylaminoethane) 55 the Sample was put on a roller table. After centrifugation the carbamoylcholesterol (DC-chol) (Farhood, H., Gao, X, infranatant was exchanged with water and the Washing was Barsoum, J. and Huang, L., Anal. Biochem. 225, 89-93 repeated. Alternatively the microbubbles may be prepared as (1995)) described in Example 2(f). To a stirred solution of 2-dimethylaminoethylamine c) Preparation of Gas-filled Microbubbles Encapsulated (19.40 mg, 24:1, 0.22 mmol) and triethylamine (310 ul, 2.23 60 with Phosphatidylserine and Inactivated Human thrombin mmol) in dichloromethane (3 ml) at room temperature was Succ-PEG-DSPE slowly added a solution of cholesteryl chloroformate (100 Inactivated human thrombin was covalently bound to mg, 0.22 mmol) in 1,4-dioxane. When the reaction was Succ-PEG-DSPE in the microbubbles from Example completed, the mixture was evaporated to dryneSS and the 16(b) by Standard coupling methods using a water-Soluble residue was purified by flash chromatography (CHCl/ 65 carbodiimide. The Sample was placed on a roller table MeOH, 4:1). A white solid was obtained, yield 105 mg during the reaction. After centrifugation the infranatant was (95%). The structure was verified by NMR and MALDI. eXchanged with water and the Washing was repeated. US 6,261,537 B1 69 70 EXAMPLE 1.7 to not more than 80 C. for 5 minutes and is then cooled to Gas-filled Microbubbles Having Methotrexate and Prodrug ambient temperature. The dispersion (0.8 ml) is transferred activating Enzyme Attached to a vial (1 ml) and the head space is flushed with perfluo a) Methotrexate Attached via a Peptide Linker to Gas robutane. The Vial is Shaken in a cap-mixer for 45 seconds, filled Micrububbles whereafter the Sample is put on a roller table. After cen Methods for attaching aminoacids to the anticancer drug trifugation the infranatant is exchanged with an approperiate methotrexate (MTX) are well described in the literature (see buffer, and coupling of the antibody to the microbubble is e.g. Huennekens, F. M. (1994), TIBTECH 12, 234-239 and performed, e.g. as described by Goundalkar, A., Ghose, T. references therein). Instead of a single amino acid a peptide and Mezei, M. in J. Pharm. Pharmacol. (1984)36 465-466 may be attached to MTX using the same technology. Such or by Hansen, C. B. et al. in (1995) Biochim. Biophys. Acta a peptide may constitute a linker for the attachment of MTX 1239 133-144. The microbubbles are placed on a roller table to the Surface of microbubbles. One class of Such linkers for Several hours and are then washed. comprises peptides of the general structure (MTX)-F-K/R- X-R-Z-C where X is any amino acid and Z is a hydrophobic EXAMPLE 1.9 amino acid. A specific example of Such a linker is (MTX)- Gas-filled Microbubbles Encapsulated with F-K-L-R-L-C (SEQ ID NO:4). The SH- group in the Cys 15 Phosphatidylserine, thiolated-anti-CEA-Mal-PEGoo residue is employed for attachment of the MTX-peptide to DSPE and the Anticancer Prodrug N-trifluoroacetyl the microbubbles (e.g. composed of phosphatidylserine and adriamycin-14-Valerate Mal-PEG-DSPE) using standard technology, e.g. as in a) Preparation of Thiolated anti-CEA Antibodies Example 2. A linker of this kind is expected to be cleaved by Thiolation of anti-CEA antibodies may be effected as the enzyme cathepsin B which often is Selectively overex described by Hansen, C. B. et al. in (1995) Biochim. pressed outside and on the Surface of tumour cells (Panchal, Biophys. Acta 1239 133-144. R. G. et al. (1996), Nat. Biotechnol. 14, 852-856). Thus, the b) Preparation of Gas-filled Microbubbles Encapsulated potential prodrug (MTX)-F-K/R-X-R would be liberated with Phosphatidylserine, thiolated-anti-CEA-Mal-PEGoo Selectively in tumours. This prodrug can further be activated DSPE and the Anticancer Prodrug N-trifluoroacetyl to the active drug MTX by the action of carboxypeptidases, 25 adriamycin-14-Valerate either present endogeneously in the tumour or targeted to the To a mixture (5 mg) of phosphatidylserine (90-99.9 mol tumour e.g. by tumour-associated antibodies (see below). %), Mal-PEGo-DSPE (10-0.1 mol %, prepared as in b) Prodrug-activating Enzyme Covalently Attached to the Example 2) and the anticancer prodrug N-trifluoroacetyl Surface of Gas-filled Microbubbles adriamycin-14-valerate (Mori, A. et al. (1993) Pharm. Res. An example of a prodrug-activating enzyme is carbox 10, 507–514), is added 5% propylene glycol-glycerol in ypeptidase A (CPA), which may be conjugated to the Surface water (1 ml). The dispersion is heated to not more than 80 of microbubbles encapsulated by, for example, a mixture of C. for 5 minutes and is then cooled to ambient temperature. phosphatidylserine and phosphatidylethanolamine, e.g. by The dispersion (0.8 ml) is transferred to a vial (1 ml) and the using a 3400 Da poly(ethylene glycol) chain bearing an head space is flushed with perfluorobutane. The vial is N-hydroxysuccinimide group at both ends (Perron, M.J. and 35 Shaken in a cap-mixer for 45 seconds, whereafter the Sample Page, M., Br. J. Cancer 73,281-287); the microbubbles may is put on a roller table. After centrifugation the infranatant is be prepared by standard methods. Microbubbles containing eXchanged with an appropriate buffer, and coupling of the CPA may be targeted to areas of pathology by incorporating antibody to the microbubble is performed, e.g. as described a Suitable targeting vector in the CPA-containing bubbles. by Goundalkar, A., Ghose, T. and Mezei, M. in J. Pharm. Alternatively CPA may be attached directly to a vector (e.g. 40 Pharmacol. (1984) 36 465–66 or by Hansen, C. B. et al. in an antibody), for example by the method as described above. (1995) Biochim. Biophys. Acta 1239 133-144. The In this latter case the CPA-vector conjugate will be attached microbubbles are placed on a roller table for several hours to the Surface of the microbubbles as described in Hansen, and are then washed. EXAMPLE 2.0 C. B. et al. (1995) Biochim. Biophys. Acta 1239 133-144. 45 Examples of the many possible prodrug-enzyme pairs are Method of Use described in e.g. Huennekens, F. M. (1994) TIBTECH 12, An agent comprising phosphatidylserine-encapsulated 234-239. microbubbles having inactivated human thrombin-Succ PEGoo-DSPE incorporated into the encapsulating mem EXAMPLE 1.8 brane is lyophilised from 0.01 M phosphate buffer, pH 7.4. Gas-filled Microbubbles Encapsulated with 50 Phosphatidylserine, thiolated-anti-CEA-Mal-PEGoo The product is redispersed in Sterile water and injected DSPE and the Anticancer Prodrug. 3',5'-O-dipamitoyl-5- intravenously into a patient with Suspected venous throm fluoro-2'-deoxyuridine bosis in a leg vein. The leg is examined by Standard ultrasound techniques. The thrombus is located by increased a) Preparation of Thiolated anti-CEA Antibodies contrast as compared with Surrounding tissue. Thiolation of anti-CEA antibodies may be effected as 55 described by Hansen, C. B. et al. in (1995) Biochim. EXAMPLE 21 Biophys. Acta 1239, 133-144. Preparation and Biological Evaluation of Gas-containing b) Preparation of Gas-filled Microbubbles Encapsulated Microbubbles of DSPS doped with a Lipopeptide Com with Phosphatidylserine, thiolated-anti-CEA-Mal-PEGoo prising a Heparin Sulphate Binding Peptide (KRKR) (SEQ DSPE and the Anticancer Prodrug. 3',5'-O-dipamitoyl-5- 60 ID NO:5) and a Fibronectin Peptide (WOPPRARI) (SEQ ID fluoro-2'-deoxyuridine NO:6) To a mixture (5 mg) of phosphatidylserine (90-99.9 mol This example is directed at the preparation of targeted %), Mal-PEG-DSPE (10-0.1 mol %, prepared as in microbubbles comprising multiple peptidic vectors arranged Example 2) and the anticancer prodrug 3',5'-O-dipamitoyl in a linear Sequence. 5-fluoro-2'-deoxyuridine (Mori, A. et al. (1995) Cancer 65 a) Synthesis of a Lipopeptide Consisting of a Heparin Chemother: Pharmacol. 35, 447-456) is added 5% propy Sulphate Binding Peptide (KRKR) (SEQ ID NO:5) and lene glycol-glycerol in water (1 ml). The dispersion is heated Fibronectin Peptide (WOPPRARI) (SEQ ID NO:6)

US 6,261,537 B1 73 74 The lipopeptide was synthesised on an ABI 433A auto chamber and back to the reservoir using a peristaltic pump. matic peptide Synthesiser Starting with Fmoc-Ile-Wang resin The flow rate was adjusted to Simulate physiologically on a 0.1 mmol Scale using 1 mmolamino acid cartridges. All amino acids and palmitic acid were preactivated using relevant shear rates. The flow chamber was placed under a HBTU before coupling. The simultaneous removal of pep microScope and the interaction between the microbubbles tide from the resin and Side-chain protecting groups was and cells was viewed directly. A camera mounted on the carried out in TFA containing 5% phenol, 5% EDT, 5% microScope was connected to a colour Video printer and a anisole and 5% HO for 2 hours, giving a crude product monitor. A gradual accumulation of microbubbles on the yield of 150 mg. Purification by preparative HPLC of a 40 cells took place at a rate dependent on the flow rate. On mg aliquot of crude material was carried out using a gradient further increasing the flow rate, cells Started to become of 70 to 100% B over 40 minutes (A=0.1% TFA/water and B=MeOH) at a flow rate of 9 ml/min. After lyophilisation, detached from the coverslip, but the microbubbles remained 16 mg of pure material were obtained (analytical HPLC, bound to the cells. Control bubbles not carrying the vector gradient 70–100% B where B=MeOH, A=0.01% TFA/wa did not adhere to the endothelial cells and disappeared from ter: detection-UV 260 and fluorescence, Exso, Ems0 the chamber under minimal flow conditions. product retention time=19.44 minutes). Further product 15 d) In Vivo Experiment in Dog characterisation was carried out using MALDI maSS Spec trometry: expected M+H at 2198, found at 2199. Case 1) b) Preparation of Gas-filled Microbubbles of DSPS A 22 kg mongrel dog was anaesthetised with pentobar doped with a Multiple-Specific Lipopeptide Consisting of bital and mechanically ventilated. The chest was opened by a Heparin Sulphate Binding Peptide (KRKR) (SEQ ID a midline Sternotomy, the anterior pericardium was removed, and a 30 mm gelled Silicone rubber spacer was NO:5) and Fibronectin Peptide (WOPPRARI) (SEQ ID inserted between the heart and a P5-3 transducer of an ATL NO:6) HDI-3000 ultrasound Scanner. The scanner was set for DSPS (4.5 mg) and lipopeptide from (a) (0.5 mg) were intermittent Short axis imaging once in each end-Systole by weighed into each of two vials and 0.8 ml of a solution of 25 1.4% propylene glycol/2.4% glycerol was added to each delayed EGC triggering. A net Volume of 2 ml of vial. The mixtures were warmed to 80 C. for 5 minutes microbubbles from (b) was injected as a rapid intravenous (vials shaken during warming). The samples were cooled to bolus, 3 Seconds later, the imaged right ventricle was seen to room temperature and the head Spaces flushed with perfluo contain contrast material, and another 3 Seconds later the left robutane gas. The Vials were Shaken in a cap mixer for 45 Ventricle was also filled and a transient attenuation shadow seconds and rolled overnight. The resulting microbubbles which obscured the view of the posterior parts of the left were washed Several times with deionised water and analy Ventricle was observed. Substantial increases in brightness sed by Coulter counter size: 1-3 micron (87%), 3-5 micron were seen in the myocardium and, when the attenuation (11.5%) and acoustic attenuation (frequency at maximum shadow subsided, in the portions of the heart distal to the left attenuation: 3.5 MHz). 35 Ventricle. After passage of the inital bolus, the ultrasound The microbubbles were stable at 120 mm Hg. MALDI Scanner was Set to continuous, high frame rate, high output mass spectral analysis was used to confirm incorporation of power imaging, a procedure known to cause destruction of lipopeptide into DSPS microbubbles as follows: ca. ultrasound contrast agent microbubbles in the imaged tissue 0.05-0.1 ml of microbubble suspension was transferred to a 40 regions. After a few Seconds, the Scanner was adjusted back clean vial and 0.05-0.1 ml methanol was added. The Sus to its initial Setting. The myocardium was then darker, and pension was Sonicated for 30 Seconds and the Solution was closer to the baseline value. Moving the imaged slice to a analysed by MALDI MS. Positive mode gave M+H at 2200 new position resulted in re-appearance of contrast effects, (expected for lipopeptide, 2198). moving the slice back to the initial position again resulted in c) In Vitro Study of Gas-filled Microbubbles of DSPS 45 a tissue brightness close to baseline. doped with a Multiple-Specific Lipopeptide Consisting of a Heparin Sulphate-binding Peptide (KRKR) (SEQ ID Case 2) comparative NO:5) and Fibronectin Peptide (WOPPRARI) (SEQ ID A net volume of 2 ml microbubbles prepared in an NO:6): Binding to Endothelial Cells Under Flow Conditions identical manner to (b) above with the exception that no The human endothelial cell line ECV 304, derived from a 50 lipopeptide was included in the preparation was injected, normal umbilical cord (ATCC CRL-1998) was cultured in using the same imaging procedure as above. The myocardial 260 mL Nunc culture flasks (chutney 153732) in RPMI 1640 echo enhancement was far less intense and of Shorter medium to which L-glutamine (200 mM), penicillin/strep duration than that observed in Case 1. At the completion of tomycin (10,000 U/ml and 10,000 ug/ml) and 10% fetal 55 the left ventricular attenuation phase, there was also almost bovine serum were added. The cells were Subcultured with complete loSS of myocardial contrast effects, and the myo a split ratio of 1:5 to 1:7 when reaching confluence. Cover cardial echo increases in the posterior part of the left glasses, 22 mm in diameter, were Sterilised and placed on the ventricle noted in Case 1 were not observed. bottom of 12 well culture plates, whereafter cells in 0.5 ml 60 EXAMPLE 22 complete medium with Serum were added above the plates. Preparation of Gas-filled Microbubbles Encapsuled with When the cells reached confluence the coverslips were DSPS Comprising Thiolated anti-CD34-MAL-PEG-PE placed in a custom-made flow chamber consisting of a a) Preparation of Gas-filled Microbubbles Encapsuled groove carved into a glass plate upon which the cover Slip with DSPS and PE-PEGo-Mal with cells was placed, with the cells facing the groove, So as 65 DSPS (4.5 mg, 3.9 mmol) and PE-PEG-Mal from to form a flow channel. Microbubbles prepared as in (b) Example 50 (0.5 mg) were weighed into a clean vial and 1 were passed from a reservoir held at 37 C. through the flow ml of a Solution of 1.4% propylene glycol/2.4% glycerol was US 6,261,537 B1 75 76 added. The mixture was warmed to 80 C. for 5 minutes then b) Thiolation of anti-CD62 and anti-ICAM-1 Antibodies filtered through a 4.5 micron filter. The sample was cooled To 0.3 mg each of anti-CD62 and anti-ICAM-1 antibodies to room temperature and the head Space was flushed with dissolved in PBS buffer (pH 7, 0.5 ml) was added Traut’s perfluorbutane gas. The Vials were Shaken in a cap mixer for reagent and the Solutions were Stirred at room temperature 45 seconds and the resulting microbubbles were washed for 1 hour. ExceSS reagent was separated from the modified three times with distilled water. protein on a NAP-5 column. b) Thiolation of anti-CD34 Antibodies c) Conjugation of Thiolated anti-CD62 and anti-ICAM-1 To 0.3 mg of anti-CD34 antibody dissolved in 0.5 ml Antibodies to Gas-filled Microbubbles Encapsulated with phosphate buffered saline (PBS), pH7, was added 0.3 mg DSPS and DSPE-PEGo-Mal 0.5 ml of the mixed thiolated antibody preparation from Traut's reagent and the Solution was stirred at room tem (b) was added to an aliquot of microbubbles from (a) and the perature for 1 hour. ExceSS reagent was separated from the conjugation reaction was allowed to proceed for 30 minutes modified protein on a NAP-5 column. on a roller table. Following centrifugation at 2000 rpm for c) Conjugation of Thiolated anti-CD34 Antibody to Gas 5 minutes, the infranatant was removed. The microbubbles filled Microbubbles Encapsuled with DSPS and Comprising 15 were washed a further three times with water. DSPE-PEG-MAL The PEG spacer length may be varied to include longer 0.5 ml of the thiolated antibody praparation from (b) was (e.g. PEGaloo and PEGsooo) or shorter (e.g. PEGoo or added to an aliquot of microbubbles from (a) and the PEGsoo) chains. Addition of a third antibody Such as conjugation reaction was allowed to proceed for 30 minutes thiolated-anti-CD34 is also possible. on a roller table. Following centifugation at 2000 rpm for 5 minutes the infranatant was removed. The microbubbles EXAMPLE 26 were washed a further three times with water. Targeted Gas-filled Microbubbles Comprising DSPS Coated d) Detection of the Antibody Encapsulated in the Non-covalently with Polylysine and a Fusion Peptide Com Microbubbles Using a FITC-conjugated Secondary Anti prising a PS-binding Component and a Fibronectin Peptide bod 25 Sequence FNFRLKAGOKIRFGGGGWOPPRAI (SEQ ID the microbubble suspension from (c) was added 0.025 NO:8) mL FITC-conjugated goat-anti-mouse antibody. The mix a) Synthesis of PS-binding/fibronectin Fragment Fusion Peptide FNFRLKAGOKIRFGGGGWOPPRAI (SEQ ID ture was incubated in the dark at room temperature for 30 NO:8) minutes on a roller table and was then centrifuged at 2000 The peptide was synthesised on an ABI 433A automatic rpm for 5 minutes. The infranatant was then removed and the peptide Synthesiser Starting with Fmoc-Ile-Wang resin on a microbubbles were washed a further three times with water. 0.1 mmol Scale using 1 mmol amino acid cartridges. All Flow cytometric analysis of the microbubble Suspension amino acids were preactivated using HBTU before coupling. showed that 98% of the population was fluorescent. The Simultaneous removal of peptide from the resin and 35 Side-chain protecting groups was carried out in TFA con EXAMPLE 23 taining 5% phenol, 5% EDT and 5% HO for 2 hours, giving Preparation of Gas-filled Microbubbles Encapsuled with a crude product yield of 302 mg. Purification by preparative DSPS Comprising Thiolated anti-CD62-MAL-PEG-PE HPLC of a 25 mg aliquot of crude material was carried out An identical procedure to that described in Example 22 using a gradient of 20 to 40% B over 40 minutes (A=0.1% was used to prepare microbubbles comprising anti-CD62 40 TFA/water and B=0.1%TFA/acetonitrile) at a flow rate of 9 antibodies. ml/min. After lyophilisation 10 mg of pure material was EXAMPLE 24 obtained (analytical HPLC, gradient 20 to 50% B where Preparation of Gas-filled Microbubbles Encapsuled with B=0.1% TFA/acetonitrile, A=0.01% TFA/water: detection DSPS Comprising Thiolated anti-ICAM-1-MAL-PEGooo UV 214 and 260 nm product retention time=12.4 minutes). PE 45 Further product characterization was carried out using An identical procedure to that described in Example 22 MALDI mass spectrometry: expected M+H at 2856, found was used to prepare microbubbles comprising anti-ICAM-1 at 2866. antibodies. b) Preparation of Gas-filled Microbubbles Comprising DSPS Coated Non-covalently with Polylysine and the EXAMPLE 25 50 PS-binding/fibronectin Fragment Fusion Peptide FNFRLK Preparation of Gas-filled Microbubbles Encapsulated with AGOKIRFGGGGWOPPRAI (SEQ ID NO:8) DSPS and Thiolated anti-CD62-Mal-PEG co-PE and DSPS (5 mg) was weighed into a clean vial along with thiolated-anti-ICAM-1-Mal-PEG-PE poly-L-lysine (0.2 mg) and peptide from (a) above (0.2 mg). This example is directed to the preparation of To the vial was added 1.0 ml of a solution of 1.4% propylene microbubbles comprising multiple antibody vectors for tar 55 glycol/2.4% glycerol. The mixture was warmed to 80 C. for geted ultrasound imaging. 5 minutes. The Sample was cooled to room temperature and a) Preparation of Gas-filled Microbubbles Encapsulated the head Space was flushed with perfluorobutane gas. The with DSPS and PE-PEG-Mal Vials were shaken in a cap mixer for 45 Seconds and the DSPS (4.5 mg) and PE-PEGooo-Mal from Example 2 (a) resulting microbubbles were centrifuged at 1000 rpm for 3 (0.5 mg) were weighed into a clean vial and 1 ml of a 60 minutes. Following extensive washing with water, PBS and Solution of 1.4% propylene glycol/2.4% glycerol was added. water, the final Solution was examined for polylysine and The mixture was warmed to 80 C. for 5 minutes and then peptide content using MALDI MS. No polypeptide material filtered through a 4.5 micron filter. The sample was cooled was observed in the final wash solution. Acetonitrile (0.5 ml) to room temperature and the head Space was flushed with was then added and the microbubbles were destroyed by perfluorobutane gas. The Vials were Shaken in a cap mixer 65 Sonication. Analysis of the resulting Solution for polylysine for 45 seconds and the microbubbles were washed three and PS-binding/fibronectin fusion peptide was then carried times with distilled water. out using MALDI MS. The results were as follows: US 6,261,537 B1 77 78 This peptide was Synthesised and purified using similar protocols to those described in (b) above. The pure product was characterised by HPLC and MALDI MS. MALDI expected MALDI found d) Preparation of Multiple-specific Gas-filled Poly-L-lysine 786,914, 790,919, Microbubbles Encapsulated with Phosphatidylserine and 1042, 1170 1048, 1177 biotin-PEG-b-Alanine Cholesterol DSPS-binding peptide 2856 2866 DSPS (4.5 mg) and biotin-PEGoo-b-alanine cholesterol from (a) (0.5 mg) were weighed into a vial and 0.8 ml of a The spacer element contained within the PS-binding/ Solution of 1.4% propylene glycol/2.4% glycerol was added. fibronectin fusion peptide (-GGG-) may also be replaced The mixture was warmed to 80° C. for 5 minutes (vials with other spacers Such as PEG or polyalanine (-AAA-). Shaken during warming). The sample was cooled to room A form of pre-targeting may also be employed, whereby the temperature and the head Space was flushed with perfluo DSPS-binding/fibronectin fragment fusion peptide is firstly robutane gas. The Vial was Shaken in a cap-mixer for 45 seconds and the vial was rolled overnight. The microbubble allowed to associate with cells via fibronectin peptide 15 Suspension was washed Several times with deionised water binding, followed by administration of PS microbubbles and analysed by Coulter counter and acoustic attenuation. which then bind to the PS-binding peptide. e) Conjugation with Fluorescein-labelled Streptavidin and EXAMPLE 27 Biotinylated Peptides from (b) and (c) Gas-filled Microbubbles Encapsulated with Phosphati To the microbubble preparation from (d) was added dylserine and biotin-PEG-alanyl-cholesterol and Functiona fluorescein-conjugated Streptavidin (0.2 mg) dissolved in lised with Streptavidin/biotinylendothelin-1 Peptide (biotin PBS (1 ml). The bubbles were placed on a roller table for 3 D-Trp-Leu-Asp-Ile-Ile-Trp.OH) (SEQ ID NO:9) and hours at room temperature. Following extensive Washing biotinyl-fibrin-anti-polymerant Peptide (biotin with water and analysis by fluorescence microscopy, the GPRPPERHOS.NH) (SEQ ID NO:10) 25 microbubbles were incubated in 1 ml of PBS containing This example is directed at the preparation of targeted biotinyl-endothelin-1 peptide (0.5 mg) and biotinyl-fibrin ultrasound microbubbles whereby streptavidin is used as a anti-polymerant peptide (0.5 mg) from (b) and (c) respec linker between biotinylated reporter(s) and vector(s). tively for 2 hours. Extensive washing of the microbubbles a) Synthesis of biotin-PEGoo-b-Alanine Cholesterol was performed to remove unconjugated peptide. To a solution of cholesteryl-b-alanine hydrochloride (as EXAMPLE 28 described in Example 59) (15 mg, 0.03 mmol) in 3 ml Gas-filled Microbubbles Encapsulated with Phosphati chloroform/wet methanol (2.6:1) was added triethylamine dylserine and biotin-DPPE Used to Prepare a Streptavidin (42 ml, 0.30 mmol). The mixture was stired for 10 minutes 'sandwich with a Mixture of biotinyl-endothelin-1 Peptide at room temperature and a solution of biotin-PEGo-NHS (biotin-D-Trp-Leu-Asp-Ile-Ile-Trp.OH) (SEQ ID NO:9) and (100 mg, 0.03 mmol) in 1,4-dioxane (1 ml) was added 35 biotinyl-fibrin-anti-polymerant Peptide (biotin dropwise. After Stirring at room temperature for 3 hours, the GPRPPERHOS.NH) (SEQ ID NO:10) mixture was evaporated to dryneSS and the residue purified a) Preparation of Biotin-containing Microbubbles by flash chromatography to give white crystals, yield 102 To a mixture of phosphatidylserine (5 mg) and biotin mg (89%). The structure was verified by MALDI-MS and DPPE (0.6 mg) in a clean vial was added 5% propylene NMR. 40 glycol-glycerol in water (1 ml). The dispersion was heated b) Synthesis of Biotinylated endothelin-1 Peptide (biotin to 80 C. for 5 minutes and then cooled to ambient tem D-Trp-Leu-Asp-Ile-Ile-Trp.OH) (SEQ ID NO:9) perature. The head space was then flushed with perfluorobu The peptide was synthesised on a ABI 433A automatic tane and the Vial was shaken in a cap-mixer for 45 seconds. peptide synthesiser starting with Fmoc-Trp.(Boc)-Wang After centrifugation the infranatant was removed and the resin on a 0.1 mmol Scale using 1 mmol amino acid 45 microbubbles were washed extensively with water. cartridges. All amino acids were preactivated using HBTU b) Conjugation of Gas-filled Microbubbles Encapsulated before coupling. The Simultaneous removal of peptide from with Phosphatidylserine and Biotin-DPPE with Streptavidin the resin and Side-chain protecting groups was carried out in TFA containing 5% anisole and 5% HO for 2 hours giving and a Mixture of biotinyl-endothelin-1 (biotin-D-Trp-Leu a crude product yield of 75 mg. Purification by preparative 50 Asp-Ile-Ile-Trp.OH) (SEQ ID NO:9) and biotinyl-fibrin HPLC of a 20 mg aliquot of crude material was carried out anti-polymerant Peptide (biotin-GPRPPERHOS.NH) (SEQ using a gradient of 30 to 80% B over 40 minutes (A=0.1% ID NO:10) TFA/water and B=0.1% TFA/acetonitrile) and a flow rate of The procedure detailed in Example 27 was followed. 9 ml/min. After lyophilisation of the pure fractions 2 mg of pure material was obtained (analytical HPLC, gradient 55 EXAMPLE 29 30–80% B where B=0.1% TFA/acetonitrile, A=0.01% TFA/ PFB Gas-containing Microbubbles of DSPS Functionalised water: detection-UV 214 nm product retention time= with Heparin Sulphate Binding Peptide/Fibronectin Peptide/ 12.6 minutes). Further product characterization was carried RGD Peptide and Fluorescein. out using MALDI mass spectrometry: expected M-H at a) Synthesis of a Lipopeptide Containing the RGD 1077, found at 1077. 60 Sequence and a Fluorescein Reporter Group: Dipalmitoyl c) Synthesis of biotinyl-fibrin-anti-polymerant Peptide Lys-Lys-Lys-Lysacetyl-Arg-Gly-Asp-Lys(fluorescein) (biotin-GPRPPERHOS.NH)(SEQ ID NO:10) Gly.OH (SEQ ID NO:11)

US 6,261,537 B1 81 82 The lipopeptide was Synthesised as described in Example glycol/2.4% glycerol was added to each vial. The mixtures 21(a) using commercially available amino acids and poly were warmed to 80° C. for 5 minutes (vials shaken during mers. The lipopeptide was cleaved from the resin in TFA warming). The samples were cooled to room temperature containing 5% water, 5% phenol and 5% EDT for 2 hours. and the head Spaces were flushed with perfluorobutane gas. Following evaporation in vacuo the crude product was 5 The Vials were Shaken in a cap mixer for 45 Seconds and then precipitated and triturated with diethyl ether. Purification by rolled overnight. The microbubbles so obtained were preparative HPLC of a 40 mg aliquot of crude material was washed Several times with deionised water and analysed by carried out using a gradient of 60 to 100% B over 40 minutes MALDI mass spectrometry as described in Example 21(b). (A=0.1%TFA/water and B=0.1%TFA/acetonitrile) at a flow The microbubbles were investigated by microscopy and rate of 9 ml/min. After lyophilisation 10 mg of pure material were Seen to have a range of sizes between 1 and 5 microns. (analytical HPLC, gradient 60–100% B where B=0.1% Furthermore the microbubbles were fluorescent. TFA/acetonitrile, A=0.01% TFA/water: detection-UV 260 product retention time=20–22 minutes). Further product EXAMPLE 30 characterisation was carried out using MALDI maSS Spec 15 Gas-filled Microbubbles Comprising DSPS Covalently trometry: expected M+H at 1922, found at 1920. Modified with CD71 FITC-labelled anti-transferrin Recep tor Antibody and doped with a Lipopeptide with Affinity b) Synthesis of a Lipopeptide Containing a Heparin for Endothelial Cells Sulphate-binding Sequence and a Fibronectin Peptide This example is directed at the preparation of multiple Synthesis and purification were carried out as described in vector targeted ultrasound agents. Example 21 (a). a) Synthesis of an Endothelial Cell Binding Lipopeptide: c) Preparation of Multiple-specific Gas-filled 2-n-hexadecylstearyl-Lys-Leu-Ala-Leu-Lys-Leu-Ala-Leu Microbubbles of DSPS Functionalised with a Heparin Sul Lys-Ala-Leu-Lys-Ala-Ala-Leu-Lys-Leu-Ala-NH. (SEQ ID phate-binding Peptide, a Fibronectin Peptide, acetyl-RGD 25 NO:12) Peptide and Fluorescein The lipopeptide shown below was synthesised on a ABI DSPS (4 mg., 3.9 mmol), lipopeptide from (a) (0.5 mg, 0.2 433A automatic peptide Synthesiser Starting with a Rink mmol) and lipopeptide from (b) (0.5 mg) were weighed into amide resin on a 0.1 mmol Scale using 1 mmol amino acid each of two vials and 0.8 ml of a solution of 1.4% propylene cartridges.

US 6,261,537 B1 85 86 All amino acids and 2-m-hexadecylstearic acid were pre FITC-labelled CD71 anti-transferrin receptor Ab (100 activated using HBTU before coupling. The simultaneous mg/ml in PBS, 0.7 ml) was reacted with Traut's reagent (0.9 removal of peptide from the resin and Side-chain protecting mg) at room temperature for 1 hour. Excess reagent was groups was carried out in TFA containing 5% EDT and 5% separated from modified protein on a NAP-5 column. HO for 2 hours, giving a crude product yield of 150 mg. d) Conlugation of Thiolated FITC-labelled anti-transfer Purification by preparative HPLC of a 40 mg aliquot of rin Receptor Antibody to Gas-filled Microbubbles Compris crude material was carried out using a gradient of 90 to ing DSPS "doped with an Endothelial Cell-binding 100% B over 50 minutes (A=0.1% TFA/water and Lipopeptide and DSPE-PEGo-Mal B=MeOH) at a flow rate of 9 ml/min. After lyophilisation, A0.5 ml aliquot of the protein fraction (2 ml in total) from 10 mg of pure material was obtained (analytical HPLC, (c) above was added to the microbubbles from (b) and the gradient 90–100% B where B=MeOH, A=0.01% TFA/wa conjugation reaction was allowed to proceed for 10 minutes ter: detection-UV 214 nm product retention time=23 on a roller table. Following centrifugation at 1000 rpm for minutes). Further product characterisation was carried out 15 3 minutes the protein Solution was removed and the conju using MALDI mass spectrometry: expected M--H at 2369, gation repeated twice more with 1 ml and 0.5 ml aliquots of found at 2373. protein solution respectively. The bubbles were then washed b) Preparation of Gas-filled Microbubbles Comprising four times in distilled water and a Sample analysed for the DSPS doped with a Endothelial Cell-binding Lipopeptide presence of antibody by flow cytometry and microScopy. A and PE-PEGooo-Mal fluorescent population of >92% was observed (see FIG. 1). DSPS (4.5 mg) and lipopeptide from (a) (0.5 mg) along Incorporation of lipopeptide into the microbubbles was with PE-PEGo-Mal from Example 50 (0.5 mg) were confirmed by MALDI mass spectrometry as described in weighed into a clean vial and 1 ml of a solution of 1.4% Example 21 (b). propylene glycol/2.4% glycerol was added. The mixture was 25 warmed to 80 C. for 5 minutes and then filtered through a EXAMPLE 31 4.5 micron filter. The Sample was cooled to room tempera Gas-filled Microbubbles Comprising DSPS, a Lipopeptide ture and the head Space was flushed with perfluorobutane for Endothelial Cell Targeting and a Captopril-containing gas. The Vial was shaken in a cap mixer for 45 seconds and Molecule the resulting microbubbles were washed three times with This example is directed to the preparation of ultrasound distilled water. agents for combined targeting and therapeutic applications. c) Thiolation of FITC-labelled anti-transferrin Receptor a) Synthesis of a Lipopeptide Functionalised with Cap Antibody topril

US 6,261,537 B1 89 90 The Structure shown above was Synthesised using a preparative liquid chromatography using a gradient of 70 to manual nitrogen bubbler apparatus Starting with Fmoc 100% B over 60 minutes (A=0.1% TFA/water and B=0.1% protected Rink Amide MBHA resin on a 0.125 mmol scale. TFA/acetonitrile) at a flow rate of 10 ml/min. After lyophi Coupling was carried out using standard TBTU/HOBt/DIEA 5 lisation a yield of 2 mg of pure material was obtained protocols. Bromoacetic acid was coupled through the Side (analytical HPLC, gradient 70–100% B over 20 minutes, chain of Lys as a Symmetrical anhydride using DIC preac A=0.1% TFA/water and B=0.1% TFA/acetonitrile, flow rate tivation. Captopril dissolved in DMF was introduced on the 1 ml/min., detection UV 214 nm, retention time 26 minutes). solid-phase using DBU as base. Simultaneous removal of Further characterisation was carried out using MALDI maSS the peptide from the resin and deprotection of Side-chain Spectrometry, giving M--H at 1265 as expected. protecting groups was carried out in TFA containing 5% b) Synthesis of a Lipopeptide with Affinity for Endothelial EDT, 5% water and 5% ethyl methyl sulphide for 2 hours. Cells: Dipalmitoyl-Lys-Lys-Lys-Aca-Ile-Arg-Arg-Val-Ala An aliquot of 10 mg of the crude material was purified by Arg-Pro-Pro-Leu-NH. (SEQ ID NO:14)

US 6,261,537 B1 93 94 The lipopeptide was synthesised on a ABI 433A auto EXAMPLE 32 matic peptide Synthesiser Starting with Rink amide resin on Preparation of Gas-filled Microbubbles Comprising DSPS a 0.1 mmol Scale using 1 mmol amino acid cartridges. All Loaded with a Lipopeptide Comprising a Helical Peptide amino acids and palmitic acid were preactivated using with Affinity for Cell Membranes and the Peptide Antibiotic HBTU before coupling. The simultaneous removal of pep Polymixin B Sulphate tide from the resin and Side-chain protecting groups was This example is directed to the preparation of targeted carried out in TFA containing 5% phenol, 5% EDT and 5% microbubbles comprising multiple peptidic vectors having a HO for 2 hours, giving a crude product yield of 160 mg. combined targeting and therapeutic application. Purification by preparative HPLC of a 35 mg aliquot of a) Synthesis of a Lipopeptide Comprising a Helical Pep crude material was carried out using a gradient of 70 to tide with Affinity for Cell Membranes: hexadecylstearyl 100% B over 40 minutes (A=0.1% TFA/water and Lys-Leu-Ala-Leu-Lys-Leu-Ala-Leu-Lys-Ala-Leu-Lys-Ala B=MeOH) at a flow rate of 9 ml/min. After lyophilisation, Ala-Leu-Lys-Leu-Ala-NH. (SEQ ID NO:12) 20 mg of pure material was obtained (analytical HPLC, This is prepared as described in Example 30(a). gradient 70–100% B where B=MeOH, A=0.01% TFA/wa 15 b) Preparation of Multiple-specific Gas-filled ter: detection-UV 214 and 260 nm product retention Microbubbles time=16 minutes). Further product characterisation was car DSPS (5.0 mg), lipopeptide from (a)(0.3 mg) and poly ried out using MALDI mass spectrometry: expected M--H at mixin B Sulphate (0.5 mg) were weighed into a clean Vial 2050, found at 2055. and 1.0 ml of a solution of 1.4% propylene glycol/2.4% c) Preparation of Gas-filled Microbubbles Comprising glycerol was added. The mixture was Sonicated for 3-5 DSPS, a Lipopeptide for Endothelial Cell Targeting and a minutes, warmed to 80 C. for 5 minutes and then filtered Captopril-containing Molecule for Drug Delivery through a 4.5 micron filter. The mixture was cooled to room DSPS (4.5 mg), product from (a) (0.5 mg) and product 25 temperature and the head Space was flushed with perfluo from (b) (0.5 mg) were weighed into a vial and 1.0 ml of a robutane gas. The Vial was Shaken in a cap-mixer for 45 Solution of 1.4% propylene glycol/2.4% glycerol was added. Seconds and the resulting microbubbles were centrifuged at The mixture was warmed to 80° C. for 5 minutes (vial 1000 rpm for 3 minutes. The microbubbles were washed Shaken during warming). The sample was cooled to room with water until no polymixin B Sulphate or lipopeptide temperature and the head Space was flushed with perfluo could be detected in the infranatant by MALDI-MS. Micros robutane gas. The Vial was firstly shaken in a cap-mixer for copy showed that the size distribution of the bubble popu 45 seconds then rolled for 1 hour, whereafter the contents lation was in the desired range of 1-8 micron. To the washed were extensively washed with deionised water. No detect bubbles (ca. 0.2 ml) was added methanol (0.5 ml), and the able level of starting material was found in the final wash 35 mixture was placed in a Sonicator bath for 2 minutes. The solution as evidenced by MALDI MS. MALDI mass spec resulting clear Solution, on analysis by MALDI-MS, was tral analysis was used to confirm incorporation of the found to contain both lipopeptide and polymixin B Sulphate products from (a) and (b) into the microbubbles as described (expected 1203, found 1207). in Example 21(b). d) In Vitro Study of Gas-filled Microbubbles Comprising 40 EXAMPLE 33 DSPS, a Lipopepitcle for Endothelial Cell Targeting and a Preparation of Gas-filled Microbubbles Comprising DSPS Captopril-containing Molecule for Therapeutic Applications doped with a Lipopeptide Comprising a IL-1 Receptor The in vitro assay decribed in Example 21(c) was used to binding Sequence and Modified with a Branched Structure Containing the Drug Methotrexate examine cell binding under flow conditions. A gradual 45 accumulation of microbubbles on the cells took place, This example is directed to the preparation of targeted depending on the flow rate. On further increasing the flow microbubbles comprising multiple vectors for targeted/ rate cells Started to become detached from the coverSlip, but therapeutic applications. the microbubbles remained bound to the cells. Control a) Synthesis of a Lipopeptide Comprising an Interleukin-1 microbubbles not carrying the vector did not adhere to the 50 Receptor-binding Peptide: Dipalmitoyl-Lys-Gly-Asp-Trp endothelial cells and disappeared from the chamber under Asp-Gln-Phe-Gly-Leu-Trp-Arg-Gly-Ala-Ala.OH (SEQ ID minimal flow conditions. NO:15)

US 6,261,537 B1 97 98 The lipopeptide was synthesised on a ABI 433A auto Example 64(a) (0.5 mg) and lipopeptide from (a) (0.2 mg) matic peptide Synthesiser Starting with Fmoc-Ala-Wang were weighed into a clean vial and 1.0 ml of a Solution of resin on a 0.1 mmol Scale using 1 mmol amino acid 1.4% propylene glycol/2.4% glycerol was added. The mix cartridges. ture was Sonicated for 3-5 minsutes, warmed to 80° C. for All amino acids and palmitic acid were preactivated using 5 minutes and then filtered through a 4.5 micron filter. The HBTU before coupling. The simultaneous removal of mixture was cooled to room temperature and the head Space lipopeptide from the resin and Side-chain protecting groups was flushed with perfluorobutane gas. The Vial was Shaken was carried out in TFA containing 5% HO, 5% anisole, 5% in a cap mixer for 45 Seconds and the resulting microbubbles phenol and 5% EDT for 2 hours, giving a crude product were centrifuged at 1000 rpm for 3 minutes, whereafter the yield of 150 mg. Purification by preparative HPLC of a 30 infranatant was discarded. mg aliquot of crude material was carried out using a gradient d) Conjugation of Methotrexate Branched Structure to of 90 to 100% B over 40 minutes (A=0.1% TFA/water and Thiolated Microbubbles B=MeOH) at a flow rate of 9 milmin. After lyophilisation, 4 The methotrexate structure from (b) above (0.5 mg) was mg of pure material was obtained (analytical HPLC, gradi 15 dissolved in PBS, pH 8.0. The solution was then added to the ent 90–100% Bover 20 minutes where B=MeOH, A=0.01% thiol-containing microbubbles from (c) and disulphide bond TFA/water: detection-UV 214 nm product retention formation was allowed to proceed for 16 hours. Following time=23 minutes). Further product characterisation was car extensive washing with PBS and water the bubbles were ried out using MALDI mass spectrometry: expected M--H at analysed by microscopy and MALDI MS. 2083, found at 2088. The disulphide bond linking the methotrexate structure to b) Synthesis of a Branched Methotrexate Core Structure the microbubbles may be reduced in vivo to liberate the free Containing a Thiol Moiety drug molecule, So that Such microbubbles in combination

HN N N COOH

N 2 N YN N2 O H H NH2 N Null N H N-- O O HN N N COOH COOH O H YN 2 N N N N O HN COOH H NH2 N N O Null N r H O SH O

COOH

The methotrexate structure was synthesised on an ABI with a tumour Specific vector comprise a drug delivery 433A automatic peptide Synthesiser Starting with Fmoc System. A physiologically acceptable reducing agent Such as glutathione may be used to bring about drug release. Cys(Trt) Tentagel resin on a 0.1 mmol scale. The simulta 50 neous removal of product from the resin and deprotection of EXAMPLE 34 protecting groups was carried out in TFA containing 5% Preparation of Gas-filled Microbubbles Coated with Poly EDT and 5% HO for 2 hours, giving a crude product yield L-lysine Complexed to Fluorescein-labeled DNA Fragments of 160 mg. Purification by preparative HPLC of a 30 mg from Plasmid pBR322 aliquot of crude material was carried out using a gradient of 55 This example is directed to the preparation of 10 to 30% B over 40 minutes (A=0.1% TFA/water and microbubbles for gene therapy/anti-Sense applications. Spe B=0.1%TFA/acetonitrile) and a flow rate of 9 ml/min. After cific targeting may be achieved by further doping of lyophilisation of the pure fractions, 9 mg of pure material microbubble membranes with vector-modified lipid struc was obtained (analytical HPLC, gradient 5-50% B where tures as described in Example 21. B=0.1% TFA/acetonitrile, A=0.01% TFA/water: detection a) Preparation of DSPS-encapsulated Gas-filled UV 214 nm-product retention time=9.5 minutes). Further Microbubbles product characterisation was carried out using MALDI maSS DSPS (4.5 mg) was weighed into a clean vial. 1.0 ml of spectrometry: expected M--H at 1523, found at 1523. a Solution of 1.4% propylene glycol/2.4% glycerol was c) Preparation of Multiple-specific Gas-filled 65 added and the mixture was Sonicated for 2 minutes and then Microbubbles warmed to 80° C. for 5 minutes. Immediately following DSPS (4.5 mg), thiol-containing lipopeptide from warming the Solution was filtered through a 4 micron filter. US 6,261,537 B1 99 100 The Sample was cooled to room temperature and the head Suspension from (a) above. After 1 hour microscopy was Space was flushed with perfluorobutane gas. The Vial was used to show that the bubbles were fluorescent, confirming Shaken in a cap mixer for 45 Seconds. The resulting the presence of DNA. microbubbles were then washed once with deionised water and the infranatant was discarded. The microbubbles were EXAMPLE 35 then resuspended in 0.5 ml water. Preparation of Gas-filled Microbubbles Containing a b) Preparation of poly-L-lysine/DNA Complex and Load Branched Core Peptide Comprising a Dabsylated ing of DSPS-encapsulated Microbubbles atherosclerotic Plaque-binding Sequence and RGDS To 1 mg of poly-L-lysine (70-150 kD) in a clean vial was This example is directed to the preparation of added 0.1 ml of a fluorescein-labeled digest of plasmid microbubbles having a thiol group on the Surface for modi pBR322 dissolved in TE buffer (10 mM tris-HCl, pH8). The fication with thiol-containing vectors for targeting/drug solution was made up to a total of 0.6 ml by addition of delivery and drug release. water and the pH was adjusted to 8. Complexing was a) Synthesis of the Branched Peptide Dabsyl-Tyr-Arg allowed to proceed for 1 hour, after which 0.05 mL of the 15 Ala-Leu-Val-Asp-Thr-leu-Lys-Lys (NH-Arg-Gly-Asp polylysine-DNA solution was added to the microbubble Ser)-Gly-Cys.OH (SEQ ID NO:16)

US 6,261,537 B1 103 104 The peptide was synthesised on an ABI 433A automatic b) Binding of Fluorescein-conjugated Streptavidin to peptide Synthesiser Starting with Fmoc-Cys(Trt)-Tentagel Gas-filled Microbubbles resin on a 0.1 mmol Scale using 1 mmol amino acid Gas-filled microbubbles were prepared by mixing DSPS cartridges. All amino acids were preactivated using HBTU and biotin-PEGoo-acyl-phosphatidylethanolamine as before coupling. The Simultaneous removal of peptide from described in previous examples. The microbubble Suspen the resin and Side-chain protecting groups was carried out in Sion was divided into 0.2 ml aliquots and fluorescein TFA containing 5% phenol, 5% EDT and 5% HO for 2 conjugated Streptavidin was added as shown in the table hours, giving a crude product yield of 160 mg. Purification below. The samples were incubated on a roller table for 15 by preparative HPLC of a 30 mg aliquot of crude material or 30 minutes at ambient temperature before removal of was carried out using a gradient of 10 to 60% B over 40 excess protein by washing in PBS. The samples were minutes (where A=0.1% TFA/water and B=acetonitrile) at a analysed by flow cytometry and Coulter Counter. The results flow rate of 9 ml/min. After lyophilisation, 2.5 mg of pure are Summarized in the table below. material was obtained (analytical HPLC, gradient 10-50% B over 20 minutes where B=0.1% TFA/acetonitrile and 15 A=0.01% TFA/water: detection-UV 214 and 435 nim-product retention time=21 minutes). Further product Results: characterisation was carried out using MALDI maSS Spec Added Particle Streptavidin Incubation % median trometry: expected M+H at 2070, found at 2073. Aliquot (mg/200:1 time (amb. Fluorescent diameter b) Preparation of Thiol-containing Gas-filled O. sample) temp.) particles (microns) Microbubbles 1. O 2.O 2 O 12 (foam) These were prepared as described in Example 64(a). 3 O.2 30 min 7.8 3.9 c) Oxidative Coupling of Thiolated Microbubbles with 25 (3 x 10 mmol) Multiple-specific Peptide via Disulphide Bond Formation 4 2 30 min 26.2 4.2 (3 x 10 mmol) The infranatant from the microbubbles from (b) above 5 1O 15 min 30.5 la was discarded and replaced with a Solution of dabsyl-peptide (1.5 x 107 mmol) 6 2O 30 min 97.9 5.2 from (a) (1 mg) in 0.7 ml dilute ammonia solution (pH 8). (3 x 107 mmol) To this was added 0.2 ml of a Stock Solution containing 6 mg 7 40 15 min 96.7 5.1 (6 x 107 mmol) of potassium ferricyanate dissolved in 2 ml of water. The 8 DSPS 20 15 min O6 3.7 vial was placed on a roller table and thiol oxidation allowed control (3 x 107 mmol) to proceed for 2 hours. The bubbles were then washed extensively with water until the infranatant was free of the 35 c) Conjugation of Streptavin-coated Microbubbles with dabsyl-peptide as evidenced by HPLC and MALDI MS. the Oligo nucleotide biotin Detection of microbubble-bound peptide was carried out by GAAAGGTAGTGGGGTCGTGTGCCGG (SEQ ID reduction of the disulphide bond using the water souble NO:17) and Biotinylated fibrin-anti-polymerant Peptide reducing agent tris-(2-carboxyethyl)-phosphine. Following biotin-GPRPPERHOS (SEQ ID NO:10) reduction, the infranatant was found to contain free dabsyl 40 The particles from aliquot no. 6 above were centrifuged peptide as evidenced by HPLC and MALDI MS. and the Supernatant was replaced with 1 ml PBS buffer, pH Other physiologically acceptable reducing agents Such as 7.5, containing O2 mg of biotin reduced glutathione may also be useful for initiating release. GAAAGGTAGTGGGGTCGTGTGCCGG (SEQ ID 45 EXAMPLE 36 NO:17) and 0.2 mg of biotin-GPRPPERHQS (SEQ ID Preparation of Gas-filled Microbubbles Encapsulated with NO:10) (prepared as in Example 27(b) and (c)). After DSPS and biotin-PEG-acyl-phosphatidylethanolamine incubation for 24 hours the particles were washed exten and Functionalised with Streptavidin Oligonucleotide sively with PBS and water. Other biotinylated vectors or therapeutic agents may be biotin-GAAAGGTAGTGGGGTCGTGTGCCGG (SEQ ID 50 NO:17) and Biotinylated fibrin-anti-polymerant Peptide conjugated to Streptavidin- or avidin-coated microbubbles (Biotin-GPRPPERHOS.NH)(SEQ ID NO:10) using this procedure. a) Synthesis of biotin-PEG-acyl-phosphatidyl Etha EXAMPLE 37 nolamine Preparation of Gas-filled Microbubbles Encapsulated with A mixture of dipalmitoyl phosphatidyl ethanolamine, 55 DSPS and Functionalised with a Thrombi-targeting (21.00 mg, 0.03 mmol), biotin-PEG-CO-NHS, (100 mg, Lipopeptide and the Thrombolytic Enzyme Tissue Plasmi 0.03 mmol) and triethylamine (42 ul, 0.30 mmol) in a nogen Activator solution of chloroform/methanol (3:1) was stirred at room This example is directed at the preparation of thrombus temperature for 2 hours. After evaporation of the Solvents targeted ultrasound contrast agents comprising a therapeutic under reduced pressure, the residue was flash chromato 60 thromolytic agent. graphed (methylene chloride/methanol/water, 40:8:1). The a) Synthesis of a Lipopeptide with Affinity for Thrombi product was obtained as a yellow gum (112 mg, 94%), and (Dipalmitoyl-Lys-Asn-Asp-Gly-Asp-Phe-Glu-Glu-Ile-Pro structure was verified by NMR and MALDI-MS. Glu-Glu-Tyr-Leu-Gln-NH) (SEQ ID NO:18)

US 6,261,537 B1 107 108 The lipopeptide was synthesised on an ABI 433 A auto 2.4% glycerol and the mixture was Sonicated for 2 minutes matic peptide Synthesiser Starting with Rink amide resin on and then warmed to 80° C. for 5 minutes. Immediately a 0.1 mmol Scale using 1 mmol amino acid cartridges. All following warming, the Solution was filtered through a 4 amino acids and palmitic acid were preactivated using micron filter. The Sample was cooled to room temperature HBTU before coupling. The simultaneous removal of pep and the head Space flushed with perfluorobutane gas. The tide from the resin and Side-chain protecting groups was Vial was shaken in a cap mixer for 45 Seconds and the carried out in TFA containing 5% phenol, 5% EDT, 5% resulting microbubbles were washed twice with deionised aniSole and 5% H2O for 2 hours, giving a crude product water. The infranatant was discarded and replaced with a 1 yield of 80 mg. Purification by preparative HPLC of a 20 mg ml aliquot of the protein solution from (b) above. The aliquot of the crude material was carried out. After lyophi conjugation reaction was allowed to proceed for 1 hour. The lisation, 6 mg of pure material was obtained. The product microbubbles were centrifuged and the infranatant was was characterised by MALDI mass spectrometry and ana exchanged with a further 1 ml of protein solution. The lytical HPLC. incubation Step was repeated until all protein Solution was b) Modification of Tissue Plasminogen Activator with 15 used up. The microbubbles were then washed extensively Sulpho-SMPB with water and analysed by Coulter counter. The A Solution of 0.1 ml of ammonim carbonate buffer con microbubbles were tested in the flow chamber assay taining 0.1 mg oft-PA was made up to 0.2 ml by the addition described in Example 21(c). Microbubbles modified with of water. To this solution was added 0.4 mg of Sulpho protein were found to bind in higher numbers than those SMPB (dissolved in 0.05 ml DMSO. The protein solution comprising either lipopeptide/DSPS or DSPS alone. was left Standing at room temperature for 45 minutes, The targeting/therapeutic/ultrasound activities of these whereafter purification was carried out on a Superdex 200 microbubbles be evaluated in models of both in vitro and in column. The product was eluted in PBS and the modified Vivo thrombogenisis. protein fraction was collected. 25 EXAMPLE 38 c) Preparation of Gas-filled Microbubbles Encapsulated Preparation of Gas-filled Microbubbles Comprising DSPS with DSPS/thrombi-binding Lipopeptide and Thiol-contain Loaded with a Lipopeptide Comprising a Helical Peptide ing Lipoeptide and Conjugation of Modified Tissue Plasmi with Affinity for Cell Membranes nogen Activator This example is directed to the preparation of targeted DSPS (5.0 mg) was weighed into a clean vial along with microbubbles comprising a peptidic vector for targeting of 0.5 mg of the lipopeptide from (a) and 0.5 mg of the cell membrane Structures. thiol-containing lipopeptide from Example 64(a). To this a) Synthesis of a Lipopeptide Comprising a Helical Pep was added 1.0 ml of a solution of 1.4% propylene glycol/ tide with Affinity for Cell Membranes (SEQ ID NO:12)

US 6,261,537 B1 111 112 The lipopeptide was synthesised on an ABI 433A auto resin on a 0.1 mmol Scale using immol amino acid car matic peptide Synthesiser Starting with Rink amide resin on tridges. All amino acids and palmitic acid were preactivated a 0.2 mmol Scale using 1 mmol amino acid cartridges. All using HBTU before coupling. The simultaneous removal of amino acids and 2-m-hexadecylstearic acid were preacti peptide from the resin and Side-chain protecting groups was vated using HBTU before coupling. The simultaneous carried out in TFA containing 5% phenol, 5% EDT, 5% removal of lipopeptide from the resin and Side-chain pro anisole and 5% HO for 2 hours, giving a crude product tecting groups was carried out in TFA containing 5% HO yield of 150 mg. Purification by preparative HPLC of a 40 for 2 hours, giving a crude product yield of 520 mg. mg aliqout of crude material was carred out using a gradient Purification by preparative HPLC of a 30 mg aliqout of of 70 to 100% B over 40 minutes (A=0.1% TFA/water and crude material was carried out using a gradient of 90 to B=MeOH) at a flow rate of 9 ml/min. After lyophilisation. 100% B over 40 minutes (A=0.1% TFA/water and 14 mg of pure material (analytical HPLC, gradient 70–100% B=MeOH) at a flow rate of 9 ml/min. After lyophilisation, B where B=MeOH, A=0.01% TFA/water: detection-UV 10 mg of pure material was obtained (analytical HPLC, 260 and fluorescence, Ex280, Em350 product retention gradient 90–100% B over 20 minutes where B=MeOH, 15 time=22 minutes). Further product characterisation was car A=0.01% TFA/water: detection-UV 214 nm product ried out using MALDI mass spectrometry: expected M--H at retention time=23 minutes). Further product characterisation 1478, found at 1471. was carried out using MALDI mass spectrometry: expected b) Preparation of Gas-filled Microbubbles Comprising M+H at 2369, found at 2375. DSPS "doped with the Biotinylated Lipopeptide Sequence b) Preparation of Gas-filled Microbubbles from (a) DSPS (4.5 mg) and lipopeptide from (a)(0.5 mg) were DSPS (4.5 mg) and lipopeptide from (a) (0.5 mg, 0.2 weighed into a clean vial and 1.0 ml of a solution of 1.4% mmol) were weighed into each of two vials, and 0.8 ml of propylene glycol/2.4% glycerol was added. The mixture was a Solution of 1.4% propylene glycol/2.4% glycerol was Sonicated for 3-5 minutes, warmed to 80 C. for 5 minutes 25 added to each vial. The mixtures were warmed to 80 C. for and then filtered through a 4.5 mm filter. The mixture was 5 minutes (vials shaken during warming). The samples were cooled to room temperature and the head Space was flushed cooled to room temperature and the head Spaces were with perfluorobutane gas. The vial was shaken in a cap mixer flushed with perfluorobutane gas. The vials were shaken in for 45 seconds and the resulting microbubbles were centri a cap mixer for 45 Seconds and then rolled overnight. The fuged at 1000 rpm for 3 minutes. The microbubbles were resulting microbubbles were washed several times with then washed with water until no lipopeptide could be deionised water and analysed by Coulter counter and acous detected by MALDI-MS. Coulter counter, acoustic attenu tic attenuation. MALDI mass spectral analysis was used to ation and pressure Stability Studies were performed. To an confirm incorporation of lipopeptide into DSPS aliquot of the washed bubbles (ca. 0.2 ml) was added 35 microbubbles as follows: ca. 50-100 ml of microbubbles methanol (0.5 ml), and the mixture was placed in a Sonicator were transferred to a clean vial and 50-100 ml water were bath for 2 minutes. The resulting clear Solution, on analysis added. The mixture was Sonicated for 30 seconds and by MALDI-MS, was found to contain the lipopeptide. spotted onto a clean target disc (1 ml+0.5 ml ACH matrix). 40 Positive mode gave M+H at 1474, expected for lipopeptide c) In Vitro and in vivo Tests at 1478. The microbubbles had similar characteristics in vitro and in vivo as was found for the microbubbles made in Example EXAMPLE 40 21. Preparation of Multiple-specific Gas-filled Microbubbles 45 EXAMPLE 39 Comprising DSPS Loaded with a Lipopeptide Comprising a Gas-filled Microbubbles Encapsulated with Phosphati Non-bioactive interleukin-1 Receptor-binding Peptide dylserine and a Biotinylated Lipopeptide This example is directed to the preparation of targeted a) Synthesis of Lipopeptide dipalmitoyl-lysinyl microbubbles comprising a non-bioactive peptidic vector for tryptophanyl-lysinyl-lysinyl-lysinyl(biotinyl)-glycine (SEQ 50 targeting at the IL-1 recptor which does not induce Signal ID NO:19) tranduction or prevent IL-1 binding. The lipopeptide was synthesised on an ABI 433A auto a) Synthesis of a Lipopeptide Comprising a Non-bioactive matic peptide Synthesiser Starting with Fmoc-Gly-Wang Interleukin-1 Receptor-binding Peptide (SEQ ID NO:15)

US 6,261,537 B1 115 116 The lipopeptide was synthesised on an ABI 433A auto headspace was flushed with Sulphur hexafluoride gas. The matic peptide Synthesiser Starting with Fmoc-Ala-Wang Vial was shaken on a cap-mixer for 45 Seconds and placed resin on a 0.1 mmol Scale using 1 mmol amino acid on a roller table for 5 minutes. The Sample was centrifuged cartridges. All amino acids and palmitic acid were preacti at 2000 rpm for 5 minutes and the infranatant was removed vated using HBTU before coupling. The simultaneous and replaced with distilled water. The headspace was again removal of lipopeptide from the resin and Side-chain pro flushed with Sulphur hexafluoride and the Sample was kept tecting groups was carried out in TFA containing 5% HO, on a roller table until a homogenous appearance was 5% anisole, 5% phenol and 5% EDT for 2 hours, giving a obtained. The Washing procedure was repeated. crude product yield of 150 mg. Purification by preparative The resulting ultrasound contrast agent was confirmed by HPLC of a 30 mg aliquot of crude material was carried out Coulter counter, acoustic attenuation measurements and using a gradient of 90 to 100% B over 40 minutes (A=0.1% resistance to external pressure. TFA/water and B=MeOH) at a flow rate of 9 ml/min. After lyophilisation, 4 mg of pure material was obtained (analyti EXAMPLE 43 cal HPLC, gradient 90–100% B over 20 minutes where Preparation of Gas-filled Microbubbles Comprising DSPG B=MeOH, A=0.01% TFA/water: detection-UV 214 15 and Endothelial Cell-binding Lipopeptide for Targeted nim-product retention time=23 minutes). Further product Ultrasound Imaging characterisation was carried out using MALDI maSS Spec To 0.8 ml of a solution containing DSPG (5 mg/ml) in trometry: expected M+H at 2083, found at 2088. propylene glycol/glycerol (4% in water) was added 0.5 mg of the lipopeptide from Example 31(b). The mixture was b) Preparation of Gas-filled Microbubbles heated to 80° C. for 5 minutes and shaken. The solution was DSPS (4.5 mg) and lipopeptide from (a) (0.5 mg) were then cooled to ambient temperature and the headspace was weighed into a clean vial and 1.0 ml of a solution of 1.4% flushed with perfluorobutane. The vial was shaken on a propylene glycol/2.4% glycerol was added. The mixture was cap-mixer for 45 Seconds and placed on a roller table for 5 Sonicated for 3-5 mins, warmed to 80 C. for 5 minutes and minutes. The sample was centrifuged at 2000 rpm for 5 then filtered through a 4.5 micron filter. The mixture was 25 minutes and the infranatant was removed and replaced with cooled to room temperature and the head Space was flushed distilled water. The headspace was again flushed with per with perfluorobutane gas. The Vials were shaken in a cap fluorobutane and the Sample was kept on a roller table until mixer for 45 seconds and the resulting microbubbles were a homogenous appearance was obtained. The Washing pro centrifuged at 1000 rpm for 3 minutes. The microbubbles cedure was repeated. The resulting ultrasound contrast agent were then washed with water until no lipopeptide could be was characterised by Coulter counter analysis, acoustic detected by MALDI-MS. To the washed microbubbles (ca. attenuation measurements and resistance to external pres 0.2 ml) was added methanol (0.5 ml), and the mixture was sure. The microbubbles were tested in the in vitro assay as placed in a Sonicator bath for 2 minutes. The resulting clear detailed in Example 21: a gradual accumulation of solution, on analysis by MALDI-MS, was found to contain lipopeptide (expected 2083, found 2088). microbubbles binding to the cells was observed. 35 EXAMPLE 44 EXAMPLE 41 Preparation of Perfluoropropane-filled Microbubbles Com Preparation of Perfluoropropane-filled Microbubbles Com prising DSPG and Endothelial Cell Binding Lipopeptide for prising DSPC, DSPS and Endothelial Cell-binding Lipopep Targeted Ultrasound Imaging tide for Targeted Ultrasound Imaging To 0.8 ml of a solution containing DSPG (5mg/ml) in To 0.8 ml of a solution containing DSPC:DSPS (3:1) 40 propylene glycol/glycerol (4% in water) was added 0.5 mg (5mg/ml) in propylene glycol/glycerol (4% in water) was of the lipopeptide from Example 31(b). The mixture was added 0.5 mg of the lipopeptide from Example 31(b). The heated to 80° C. for 5 minutes and then shaken. The Solution mixture was heated to 80° C. for 5 minutes and shaken. The was then cooled to ambient temperature and the headspace Solution was then cooled to ambient temperature and the was flushed with perfluoropropane. The Vial was shaken on headspace was flushed with perfluoropropane. The Vial was 45 a cap-mixer for 45 Seconds and placed on a roller table for Shaken on a cap-mixer for 45 Seconds and placed on a roller 5 minutes. The sample was centrifuged at 2000 rpm for 5 table for 5 minutes. The sample was centrifuged at 2000 rpm minutes and the infranatant was removed and replaced with for 5 minutes and the infranatant was removed and replaced distilled water. The headspace was again flushed with per with distilled water. The headspace was again flushed with fluorobutane and the Sample was kept on a roller table until perfluoropropane and the Sample was kept on a roller table 50 a homogeneous appearance was obtained. The Washing until a homogeneous appearance was obtained. The Washing procedure was repeated. The resulting ultrasound contrast procedure was repeated. The resulting ultrasound contrast agent was characterised by Coulter counter analysis, acous agent was characterised by Coulter counter analysis, acous tic attenuation measurements and resistance to external tic attenuation measurements and resistance to external pressure. The microbubbles were tested in the in vitro assay pressure. The microbubbles were tested in the in vitro assay 55 as detailed in Example 21: a gradual accumulation of as detailed in Example 21. A gradual accumulation of microbubbles binding to the cells was observed. microbubbles binding to the cells was observed. EXAMPLE 45 EXAMPLE 42 Preparation of Sulphur Hexafluoride-containing Preparation of Sulphur Hexafluoride-containing 60 Microbubbles Comprising DSPG and Endothelial Cell Microbubbles Comprising DSPC, DSPS and Endothelial binding Lipopeptide for Targeted Ultrasound Imaging Cell-binding Lipopeptide for Targeted Ultrasound Imaging To 0.8 ml of a solution containing DSPG (5 mg/ml) in To 0.8 ml of a solution containing DSPC:DSPS (3:1) (5 propylene glycol/glycerol (4% in water) was added 0.5 mg mg/ml) in propylene glycol/glycerol (4% in water) was of the lipopeptide from Example 31(b). The mixture was added 0.5 mg of the lipopeptide from Example 31(b). The 65 heated to 80° C. for 5 minutes and shaken. The solution was mixture was heated to 80° C. for 5 minutes and shaken. The then cooled to ambient temperature and the headspace was Solution was then cooled to ambient temperature and the flushed with Sulphur hexafluoride gas. The vial was shaken US 6,261,537 B1 117 118 on a cap-mixer for 45 Seconds and placed on a roller table The lipid structure shown above was Synthesised on an for 5 minutes. The sample was centrifuged at 2000 rpm for ABI 433A automatic peptide synthesiser starting with Fmoc 5 minutes and the infranatant was removed and replaced Cys(Trt)-Wang resin on a 0.25 mmol scale using 1 mmol with distilled water. The headspace was again flushed with amino acid cartridges. All amino acids and palmitic acid Sulphur hexafluoride and the sample was kept on a roller were preactivated using HBTU coupling chemistry. The table until a homogeneous appearance was obtained. The Washing procedure was repeated. The resulting ultrasound Simultaneous removal of peptide from the resin and depro contrast agent was characterised by Coulter counter tection of Side-chain protecting groups was carried out in analysis, acoustic attenuation measurements and resistance TFA containing 5% EDT and 5% HO for 2 hours, giving a to external pressure. crude product yield of 250 mg. Purification by preparative HPLC of a 40 mg aliquot of crude material was carried out EXAMPLE 46 using a gradient of 90 to 100% B over 50 minutes (A=0.1% Targeted Gas-filled Microbubbles Comprising DSPS Coated TFA/water and B=MeOH) at a flow rate of 9 ml/min. After Non-covalently with Polylysine lyophilisation, 24 mg of pure material was obtained DSPS (5 mg) was weighed into a clean vial along with 15 poly-L-lysine (0.2 mg). To the vial was added 1.0 ml of a (analytical HPLC, gradient 70–100% B where B=0.1% solution of 1.4% propylene glycol/2.4% glycerol. The mix TFA/acetonitrile, A=0.01% TFA/water: detection-UV 214 ture was warmed to 80° C. for 5 minutes. The sample was nim-product retention time=23 minutes). Further product cooled to room temperature and the head Space flushed with characterisation was carried out using MALDI maSS Spec perfluorobutane gas. The Vial was shaken in a cap mixer for trometry: expected M+H at 1096, found at 1099. 45 Seconds and the resulting microbubbles were centrifuged b) Preparation of Gas-filled Microbubbles Comprising at 1000 rpm for 3 minutes. Following extensive washing DSPS "doped with a Thiol-containing Lipid Structure with water, PBS and water, the final Solution was examined DSPS (4.5 mg) and the lipid structure from (a) above (0.5 for polylysine content using MALDI MS. No polypeptide mg, 0.4 mmol) were weighed into a clean vial and 0.8 ml of material was observed in the final wash Solution. Acetoni 25 a Solution containing 1.4% propylene glycol/2.4% glycerol trile (0.5 ml) was then added and the microbubbles were in water was added. The mixture was warmed to 80 C. for Sonicated until all bubbles had burst. Analysis of the result 5 minutes (vial Shaken during warming) and filtered while ing Solution for polylysine was again carried out using still hot through a 40 mm filter. The sample was cooled to MALDI MS. The results were as follows: room temperature and the head Space was flushed with perfluorobutane gas. The Vial was shaken in a cap mixer for 45 seconds and then placed on roller table overnight. The MALDI expected MALDI found resulting microbubbles were washed several times with Poly-L-lysine 786,914, 1042, 117O 790,919, 1048, 1177 deionised water and analysed for thiol group incorporation 35 using Ellmans Reagent.

EXAMPLE 48 EXAMPLE 47 Preparation of Functionalised Gas-filled Microbubbles for Preparation of Gas-filled Microbubbles Comprising DSPS Targeted Ultrasound Imaging (SEQ ID NO:20) Doped with a Thrombus-binding Lipopeptide This example is directed to the preparation of 40 a) Synthesis of a Lipopeptide with Affinity for Thrombi microbubbles having a reactive group on the Surface for (Dipalmitoyl-Lys-Asn-Asp-Gly-Asp-Phe-Glu-Glu-Ile-Pro non-specific targeting, principally utilising disulphide Glu-Glu-Tyr-Leu-Gln-NH) (SEQ ID NO:18) eXchange reactions to effect binding to a multiplicity of cellular targets. a) Synthesis of a Thiol-functionalised Lipid Molecule 45 (SEQ ID NO:20) ~~~~ O

O O --~~~~ Y. W. Ya Y Yo Y YO O H E

US 6,261,537 B1 121 122 The lipopeptide was synthesised on an ABI 433 A auto nim-product retention time=23 minutes). Further product matic peptide Synthesiser Starting with Rink amide resin on characterisation was carried out using MALDI maSS Spec a 0.1 mmol Scale using 1 mmol amino acid cartridges. All trometry: expected M+H at 1096, found at 1099. amino acids and palmitic acid were preactivated using b) Preparation of Gas-filled Microbubbles Comprising HBTU before coupling. The simultaneous removal of pep 5 DSPS "doped with a Thiol-containing Lipid Structure tide from the resin and Side-chain protecting groups was DSPS (4.5 mg) and lipid structure from (a) above (0.5 mg, carried out in TFA containing 5% phenol, 5% EDT, 5% 0.4 mmol) were weighed into a clean vial and 0.8 ml of a aniSole and 5% H2O for 2 hours, giving a crude product Solution of 1.4% propylene glycol/2.4% glycerol was added. yield of 80 mg. Purification by preparative HPLC of a 20 mg The mixture was warmed to 80° C. for 5 minutes (vial aliquot of the crude material was carried out. After lyophi Shaken during warming) and filtered while still hot through lisation, 6 mg of pure material were obtained. The product a 40 mm filter. The Sample was cooled to room temperature was characterised by MALDI mass spectrometry and ana and the head Space was flushed with perfluorobutane gas. lytical HPLC. The Vial was shaken in a cap mixer for 45 Seconds and then b) Preparation of Thromi-targeting Ultrasound placed on roller table overnight. The resulting microbubbles Microbubbles 15 were washed Several times with deionised water and analy DSPS (4.5 mg) and lipopeptide from (a) (1.0 mg) were Sed for thiol group incorporation using Ellmans Reagent. weighed into a vial and 0.8 ml of a solution of 1.4% c) Modification of Transferrin with fluorescein-NHS and propylene glycol/2.4% glycerol was added. The mixture was Sulpho-SMPB warmed to 80 C. for 5 minutes and then filtered through a To 4 mg of transferrin (Holo, human) in PBS (1 ml) was 4 micron filter. After cooling to room temperature the head added 0.5 ml DMSO solution containing 1 mg Sulpho Space was flushed with perfluorobutane gas. The Vial was SMPB and 0.5 mg fluorescein-NHS. The mixture was stirred Shaken in a cap mixer for 45 Seconds and the resulting for 45 minutes at room temperature and then passed through microbubbles were washed extensively with deionised a Sephadex 200 column using PBS as eluent. The protein water. The microbubbles were characterised by microscopy fraction was collected and Stored at 4 C. prior to use. and Coulter counter analysis. MALDI-MS was used to 25 d) Microbubble Conjugation with Transferrin confirm the presence of lipopeptide as described in previous To the thiol-containing microbubbles from (b) was added examples. 1 ml of the modified transferrin protein solution from (c). After adjusting the pH of the Solution to 9 the conjugation EXAMPLE 49 reaction was allowed to proceed for 2 hours at room tem Preparation of Transferrin-coated Gas-filled Microbubbles perature. Following extensive Washing with deionised water for Targeted Ultrasound Imaging the microbubbles were analysed by Coulter counter (97% a) Synthesis of a Thiol-functionalised Lipid Molecule between 1 and 5 mm) and fluorescence microscopy (highly (SEQ ID NO:20) fluorescent microbubbles).

O

--~~~~ H NH2

S O O H H N N sus N N--- N OH H H H - O O O

The lipid structure shown above was Synthesised on an EXAMPLE 50 ABI 433A automatic peptide synthesiser starting with Fmoc Gas-filled Microbubbles Comprising DSPS Incorporating Cys(Trt)-Wang resin on a 0.25 mmol scale using 1 mmol 55 PE-PEGooo-Mal Conjugated to Thiolated Trypsin Fluores amino acid cartridges. All amino acids and palmitic acid CC were preactivated using HBTU before coupling. The simul a) Synthesis of Boc-NH-PEGooo-DSPE (t-butyl carbam a te poly (ethylene glycol) taneous removal of peptide from the resin and deprotection distearoylphosphatidylethanolamine) of Side-chain protecting groups was carried out in TFA DSPE (31 mg) was added to a solution of Boc-NH containing 5% EDT and 5% HO for 2 hours, giving a crude 60 PEGooo-SC (150 mg) in chloroform (2 ml), followed by product yield of 250 mg. Purification by preparative HPLC triethylamine (33 ul). The mixture was stirred at 41° C. for of a 40 mg aliquot of crude material was carried out using 10 minutes until the starting material had dissolved. The a gradient of 90 to 100% B over 50 minutes (A=0.1% Solvent was rotary evaporated and the residue was taken up TFA/water and B=MeOH) at a flow rate of 9 ml/min. After in acetonitrile (5 ml). The resulting dispersion was cooled to lyophilisation, 24 mg of pure material was obtained 65 4 C. and centrifuged, whereafter the solution was filtered (analytical HPLC, gradient 70–100% B where B=0.1% and evaporated to dryneSS. The Structure of the resulting TFA/acetonitrile, A=0.01% TFA/water: detection-UV 214 product was confirmed by NMR. US 6,261,537 B1 123 124 b) Synthesis of HN-PEGooo-DSPE (amino-poly To the protein fraction from (e) was added 1 mg of Traut’s (ethylene glycol)-distearoylphosphatidylethanolamine) reagent and the mixture Stirred at room temperature for a Boc-NH-PEGooo-DSPE (167 mg) was stirred in 4 M further 1 hour. 4 ml of the Trauts-modified product was then hydrochloric acid in dioxane (5 ml) for 2.5 hours at ambient charged on a SephadeX 200 column and the product was temperature. The Solvent was removed by rotary evapora eluted with PBS. The protein fraction containing maximum tion and the residue was taken up in chloroform (1.5 ml) and washed with water (2x1.5 ml). The organic phase was fluorescent intensity was collected in a total Volume of 6 ml. evaporated in vacuo. TLC analysis (chloroform/methanol/ g) Conjugation of Microbubbles with Thiolated, water 13:5:0.8) gave a single ninhydrin positive spot with Fluorescein-labelled Trypsin Rf=0.6; confirmation of the structure was obtained by NMR. Microbubbles from (d) were incubated on a roller table in c) Synthesis of Mal - PEG ooo-DSPE 1 ml of protein Solution from (f) above. The conjugation was (3-male imidopropio nate poly (ethylene glycol) allowed to proceed at pH 7.3–7.8 for 10 minutes before distearoylphosphatidylethanolamine) centrifugation and removal of the infranatant. The process A Solution of N-Succinimidyl-3-maleimidopropionate was repeated a further three times, after which the bubbles (5.6 mg, 0.018 mmol) in tetrahydrofuran (0.2 ml) was added 15 were washed four times with water to remove unconjugated to HN-PEG--DSPE (65 mg, 0.012 mmol) dissolved in protein. tetrahydrofuran (1 ml) and 0.1 M sodium phosphate buffer D. Bubbles contained active enzyme as evidenced by the pH 7.5 (2 ml). The mixture was warmed to 30° C. and the cleavage of an Arg-pNA derivative in PBS. reaction was followed to completion by TLC, whereafter the E. Analysis of the bubbles by Coulter and measurement of Solvent was removed in vacuo. The title material was echogenicity was carried out. purified on a flash silica column using 80:20 chloroform Bubbles were pressure stable (see FIG. 2) :methanol as eluent. The Structure of the pure product was confirmed by NMR and mass spectrometry. d) Preparation of Gas-filled Microbubbles of DSPS 25 doped with PE-PEGooo-Mal FEK-O22-O15 Total O.83 DSPS (4.5 mg) and PE-PEG-Mal from (c) above (0.5 concentration mg) were weighed into a clean vial and 1 ml of a Solution Diameter 1-3 mm 40 of 1.4% propylene glycol/2.4% glycerol was added. The Diameter 3-5 mm 28 mixture was warmed to 80 C. for 5 minutes and then Diameter 5-7 mm 13 Freq of max Atten. 3.3 filtered through a 4.5 mm filter. The sample was cooled to Atten at 2. Mhz. 4.9 room temperature and the head space was flushed with Atten at 3.5 Mhz. 7.8 perfluorobutane gas. The Vial was shaken in a cap mixer for Atten at 5.0 MHz, 7.2 45 seconds and the resulting microbubbles were washed 35 three times with distilled water. EXAMPLE 51 e) Preparation of Fluorescein-labelled Trypsin Gas-filled Microbubbles Comprising DSPS and a Captopril To 5 mg of trypsin in PBS (1 ml) was added 0.2 ml DMSO containing Molecule for Diagnostic and Therapeutic Appli solution containing 1 mg of fluorescein-NHS. The mixture cations was stirred for 45 minutes at room temperature. A SephadeX 40 a) Synthesis of a Lipopeptide Functionalised with Cap 200 column was then charged with the modified protein topril (SEQ ID NO:13)

O

NH2

O O O H H N N --~~~~ N N NH2 H E H E O

N O E y mixture and product was eluted at a flow rate of 1 ml/min The structure shown above was synthesised by the manual using PBS. The protein fraction (5 ml) was collected and “bubbler method starting with Fmoc-protected Rink Amide stored at 4 C. 65 MBHA resin on a 0.125 mmol scale. Coupling was carried out using standard TBTU/HOBt/DIEA protocol. Bromoace f) Preparation of Thiolated, Fluorescein-labelled Trypsin tic acid was coupled through the Side-chain of Lys as a US 6,261,537 B1 125 126 Symmetrical anhydride using DIC preactivation. Captopril distilled off (rotavapor). The residue was taken up in ethyl dissolved in DMF was introduced on the Solid phase using acetate, washed with brine and dried (NaSO). The solution DBU as base. Simultaneous removal of the peptide from the was filtered and concentrated. The dark residue was chro resin and deprotection of Side-chain protecting groups was matographed (silica, hexane/ethyl acetate 7:3) to give 2.25g carried out in TFA containing 5% EDT, 5% water and 5% (34%) of a colourless oil. "H (300 MHz) and 'C NMR (75 ethyl methylsulphide for 2 hours. An aliquot of 10 mg of the MHz) spectra were in accordance with the structure. crude material was purified by preparative liquid chroma ii) Synthesis of methyl 4-2-hydroxy-3-(1-methylethyl)- tography using a gradient of 70 to 100% B over 60 minutes aminopropoxyphenylacetate (A=0.1%TFA/water and B=0.1%TFA/acetonitrile) at a flow A mixture of methyl 4-(2,3-epoxy) propoxy rate of 10 ml/min. After lyophilisation, a yield of 2 mg of phenylacetate (2.00 g, 9.00 mmol), isopropylamine (23 ml, pure material was obtained (analytical HPLC, gradient 0.27 mol) and water (1.35 ml, 74.7 mmol) was stirred at 70–100% B over 20 minutes, A=0.1% TFA/water and room temperature overnight. The reaction mixture was con B=0.1% TFA/acetonitrile, flow rate 1 ml/min, detection UV centrated (rotavapor) and the oily residue was dissolved in 15 chloroform and dried (NaSO). Filtration and concentration 214 nm, retention time 26 minutes). Further characterisation gave quantitative yield of a yellow oil that was used in the was carried out using MALDI mass spectrometry, giving next Step without further purification. The Structure was M+H at 1265 as expected. verified by H and 3C NMR analysis. b) Preparation of Gas-filled Microbubbles Comprising iii) Synthesis of 4-2-hydroxy-3-(1-methylethyl)-amino DSPS and a Compound Containing Captopril propoxyphenylacetic acid hydrochloride A solution of 1.4% propylene glycol/2.4% glycerol (1.0 A solution of methyl 4-2-hydroxy-3-(1-methylethyl)- ml) was added to a mixture of DSPS (4.5 mg) and product aminopropoxyphenylacetate (563 mg, 2.00 mmol) in 6M from (a) (0.5 mg) in a vial. The mixture was sonicated for hydrochloric acid (15 ml) was heated at 100° C. for 4 hours. 5 minutes and then warmed to 80°C. for 5 minutes (vial was The reaction mixture was concentrated (rotavapor) and the Shaken during warming). The vial was then cooled and the 25 residue was taken up in water and lyophilised. "H and 'C head Space was flushed with perfluorobutane gas. The Vial NMR spectra were in accordance with the strucure and was shaken in a cap mixer for 45 Seconds and the resulting MALDI mass spectrometry gave a M+H at 268 as expected. microbubbles were extensively washed with deionised iv) Synthesis of N-Boc-4-2-hydroxy-3-(1-methylethyl)- water. MALDI mass spectrometry showed no detectable aminopropoxyphenylacetic acid level of compound from (a) in the final wash solution. A solution of the 4-2-hydroxy-3-(1-methylethyl)- Incorporation of captopril-containing lipopeptide into the aminopropoxyphenylacetic acid hydrochloride (2.0 mmol) microbubbles was confirmed by MALDI-MS as follows: ca. in water (2 ml) was added to a solution of sodium bicar 50 ul of microbubbles were transferred to a clean vial bonate (0.60 g, 7.2 mmol) in water/dioxane (2:1, 15 ml). A containing ca. 100 ul of 90% methanol. The mixture was 35 solution of di-tert-butyl dicarbonate (0.48 g, 2.2 mmol) in Sonicated for 30 seconds and analysed by MALDI mass dioxane (5 ml) was added. Progress of the reaction was Spectrometry, giving a M--H peak corresponding to lipopep monitored by TLC analysis (silica, CHCl/MeOH/AcOH tide from (a). 85:10:5), and portions of di-tert-butyl dicarbonate were EXAMPLE 52 40 added until conversion was complete. The reaction mixture Gas-filled Microbubbles Comprising DSPS and a Vector was poured onto water Saturated with potassium hydrogen with Affinity for Adrenergic Receptors for Diagnostic and Sulphate and organic material was extracted into ethyl Therapeutic Applications acetate. The organic phase was washed with water and brine, a) Synthesis of a Protected Atenolol Derivative Suitable dried (Na2SO) and filtered to give 0.6 g of crude material. for Solid Phase Coupling 45 The product was purified by chromatography (Silica, CHCl/ i) Synthesis of methyl 4-(2,3-epoxy)propoxy MeOH/AcOH 85:10:5). The solution was concentrated and phenylacetate the residue was taken up in glacial acetic acid and lyophi A mixture of methyl 4-hydroxyphenylacetate (4.98 g, lised. Yield 415 mg (56%), white solid. The structure was 0.030 mol), epichlorohydrin (23.5 ml, 0.30 mol) and pyri 50 confirmed by H and 'C NMR analysis. dine (121 ul, 1.5 mmol) was stirred at 85°C. for 2 hours. The b) Synthesis of a Lipopeptide Functionalised with reaction mixture was cooled and exceSS epichlorohydrin was Atenolol (SEQ ID NO:21) US 6,261,537 B1 127 128

O

--~~~~ H NH2

O O O H H N N N N NH2 H E H O l O NH2 O--l

The structure shown above was synthesised by the manual flushed with perfluorobutane gas and the Vial was Shaken in bubbler method starting with Fmoc-protected Rink Amide a cap mixer for 45 Seconds, whereafter the contents were MBHA resin on a 0.125 mmol scale, using the compound extensively washed with deionised water. MALDI mass from (a). Coupling was carried out using standard TBTU/ 25 Spectrometry showed no detectable level of compound from HOBt/DIEA protocols. Simultaneous removal of the peptide (b) in the final wash solution. Incorporation of atenolol from the resin and deprotection of Side-chain protecting containing lipopeptide into the microbubbles was confirmed groups was carried out in TFA containing 5% EDT and 5% by MALDI-MS as follows: ca. 50 ul of microbubbles were water for 2 hours. Crude material was precipitated from transferred to a clean vial containing ca. 100 ul of 90% ether and purified by preparative liquid chromatography methanol. The mixture was Sonicated for 30 seconds and using a gradient of 70 to 100% B over 60 minutes (A=0.1% analysed by MALDI-MS (ACH-matrix), giving a M+H peak TFA/water and B=0.1% TFA/acetonitrile) at a flow rate of at 1259 corresponding to lipopeptide (b). 10 ml/min. After lyophilisation, a yield of 38 mg of pure d) In Vitro Analysis material was obtained (analytical HPLC, gradient 70–100% 35 The microbubbles were tested in the in vitro assay as B over 20 minutes, A=0.1% TFA/water and B=0.1% TFA/ detailed in Example 21. A gradual accumulation of acetonitrile, flow rate 1 ml/minute, detection UV 214 nm, microbubbles binding to the cells was observed. retention time 25 minutes). Further characterisation was carried out using MALDI mass spectrometry (ACH matrix), EXAMPLE 53 40 giving M+H at 1258, expected 1257. Gas-filled Microbubbles Comprising DSPS and a Lipopep c) Preparation of Gas-filled Microbubbles Comprising tide Consisting of a Heparin Sulphate-binding Peptide DSPS and a Lipopeptide Containing Atenolol (KRKR) (SEQ ID NO:5) and a Fibronectin Peptide A solution of 1.4% propylene glycol/2.4% glycerol (1.0 (WOPPRARI) (SEQ ID NO:6) for Targeting and a Lipopep ml) was added to a mixture of DSPS (4.5 mg) and product 45 tide Containing Atenolol for Therapeutic Application from (b) (0.5 mg) in a vial. The mixture was sonicated for a) Synthesis of a Lipopeptide Consisting of a Heparin 5 minutes, heated at 80° C. for 5 minutes (vial was shaken Sulphate-binding Peptide (KRKR) (SEQ ID NO:5) and a during warming) and then cooled. The head space was Fibronectin Peptide (WOPPRARI) (SEQ ID NO:6)

US 6,261,537 B1 131 132 The lipopeptide was synthesised on an ABI 433A auto A solution of methyl 4-2-hydroxy-3-(1-methylethyl)- matic peptide Synthesiser Starting with Fmoc-Ile-Wang resin aminopropoxyphenylacetate (563 mg, 2.00 mmol) in 6M on a 0.1 mmol Scale using 1 mmolamino acid cartridges. All hydrochloric acid (15 ml) was heated at 100° C. for 4 hours. amino acids and palmitic acid were preactivated using HBTU before coupling. The simultaneous removal of pep The reaction mixture was concentrated (rotavapor) and the tide from the resin and Side-chain protecting groups was residue was taken up in water and lyophilised. H and 'C carried out in TFA containing 5% phenol, 5% EDT, 5% NMR spectra were in accordance with the strucure and anisole and 5% HO for 2 hours, giving a crude product MALDI mass spectrometry gave a M+H at 268 as expected. yield of 150 mg. Purification by preparative HPLC of a 40 iv) Synthesis of N-Boc-4-2-hydroxy-3-(1-methylethyl)- mg aliquot of crude material was carried out using a gradient aminopropoxyphenylacetic acid of 70 to 100% B over 40 minutes (A=0.1% TFA/water and A solution of the 4-2-hydroxy-3-(1-methylethyl)- B=MeOH) at a flow rate of 9 ml/min. After lyophilisation, 16 mg of pure material was obtained (analytical HPLC, aminopropoxyphenylacetic acid hydrochloride (2.0 mmol) gradient 70–100% B where B=MeOH, A=0.01% TFA/wa in water (2 ml) was added to a Solution of Sodium bicar ter: detection-UV 260 and fluorescence, EX280, Em350 bonate (0.60 g, 7.2 mmol) in water/dioxane (2:1, 15 ml). A product retention time=19.44 minutes). Further product 15 solution of di-tert-butyl dicarbonate (0.48 g, 2.2 mmol) in characterisation was carried out using MALDI maSS Spec dioxane (5 ml) was added. Progress of the reaction was trometry: expected M+H at 2198, found at 2199. monitored by TLC analysis (silica, CHCl/MeOH/AcOH b) Synthesis of a Protected Atenolol Derivative Suitable 85:10:5), and portions of di-tert-butyl dicarbonate were for Solid Phase Coupling added until conversion was complete. The reaction mixture i) Synthesis of methyl 4-(2,3-epoxy)propoxyphenylac was poured onto water Saturated with potassium hydrogen etate Sulphate and organic material was extracted into ethyl A mixture of methyl 4-hydroxyphenylacetate (4.98 g, acetate. The organic phase was washed with water and brine, 0.030 mol), epichlorohydrin (23.5 ml, 0.30 mol) and pyri dried (Na2SO) and filtered to give 0.6 g of crude material. dine (121 ul, 1.5 mmol) was stirred at 85°C. for 2 hours. The The product was purified by chromatography (Silica, CHCl/ reaction mixture was cooled, and exceSS epichlorohydrin 25 MeOH/AcOH 85:10:5). The solution was concentrated and was distilled off (rotavapor). The residue was taken up in the residue was taken up in glacial acetic acid and lyophi ethyl acetate, washed with brine and dried (Na2SO). The lised. Yield 415 mg (56%), white solid. The structure was Solution was filtered and concentrated. The dark residue was confirmed by H and 'C NMR analysis. chromatographed (silica, hexane/ethyl acetate 7:3) to give c) Synthesis of a Lipopeptide Functionalised with 2.25 g (34%) of a colourless oil. "H (300 MHz) and 13C Atenolol (SEQ ID NO:21)

O

NH2

O O O H H N N N N NH2 H O

NH2 HN

H O-lOH

NMR (75 MHz) spectra were in accordance with the struc The structure shown above was synthesised by the manual ture. bubbler method starting with Fmoc-protected Rink Amide ii) Synthesis of methyl 4-2-hydroxy-3-(1-methylethyl)- MBHA resin on a 0.125 mmol Scale, using appropriate aminopropoxyphenylacetate 55 amino acids, palmitic acid and the compound from (a). Coupling was carried out using standard TBTU/HOBt/DIEA A mixture of methyl 4-(2,3-epoxy)propoxyphenylac protocols. Simultaneous removal of the peptide from the etate (2.00 g, 9.00 mmol), isopropylamine (23 ml, 0.27 mol) resin and deprotection of Side-chain protecting groups was and water (1.35 ml, 74.7 mmol) was stirred at room tem carried out in TFA containing 5% EDT and 5% water for 2 perature overnight. The reaction mixture was concentrated 60 hours. Crude material was precipitated from ether and (rotavapor) and the oily residue was dissolved in chloroform purified by preparative liquid chromatography using a gra and dried (NaSO). Filtration and concentration gave quan dient of 70 to 100% B over 60 minutes (A=0.1% TFA/water titative yield of a yellow oil that was used in the next step and B=0.1% TFA/acetonitrile) at a flow rate of 10 ml/min. without further purification. The structure was verified by H After lyophilisation, a yield of 38 mg of pure material was and 'C NMR analysis. 65 obtained (analytical HPLC, gradient 70–100% B over 20 iii) Synthesis of 4-2-hydroxy-3-(1-methylethyl)-amino minutes, A=0.1% TFA/water and B=0.1% TFA/acetonitrile, propoxyphenylacetic acid hydrochloride flow rate 1 ml/minute, detection UV 214 nm, retention time US 6,261,537 B1 133 134 25 minutes). Further characterisation was carried out using iv) Synthesis of N-Boc-4-2-hydroxy-3-(1-methyl-ethyl) MALDI mass spectrometry (ACH matrix), giving M+H at aminopropoxyphenylacetic acid 1258, expected 1257. A solution of the 4-2-hydroxy-3-(1-methyl-ethyl) d) Preparation of Gas-filled Microbubbles Comprising aminopropoxyphenylacetic acid hydrochloride (2.0 mmol) DSPS and a Lipopeptide Consisting of a Heparin Sulphate in water (2 ml) was added to a Solution of Sodium bicar binding Peptide (KRKR) (SEQ ID NO:5), a Fibronectin bonate (0.60 g, 7.2 mmol) in water/dioxane (2:1, 15 ml). A Peptide (WOPPRARI) (SEQ ID NO:6) and a Lipopeptide solution of di-tert-butyl dicarbonate (0.48 g, 2.2 mmol) in Containing Atenolol dioxane (5 ml) was added. Progress of the reaction was A solution of 1.4% propylene glycol/2.4% glycerol (1.0 monitored by TLC analysis (silica, CHCl/MeOH/AcOH ml) was added to a mixture of DSPS (5.0 mg), product from 85:10:5), and portions of di-tert-butyl dicarbonate were (a) (0.5 mg) and product from (c) (0.5 mg) in a vial. The added until conversion was complete. The reaction mixture mixture was Sonicated for 5 minutes and then heated at 80 was poured onto water Saturated with potassium hydrogen C. for 5 minutes (vial was shaken during warming). The Sulphate and organic material was extracted into ethyl Solution was filtered and cooled. The head Space was flushed acetate. The organic phase was washed with water and brine, with perfluorobutane gas and the vial was shaken in a cap 15 dried (Na2SO) and filtered to give 0.6 g of crude material. mixer for 45 Seconds, whereafter the contents were exten The product was purified by chromatography (Silica, CHCl/ sively washed with deionised water. Incorporation of MeOH/AcOH 85:10:5). The solution was concentrated and atenolol-containing lipopeptide into the microbubbles was the residue was taken up in glacial acetic acid and lyophi confirmed by MALDI-MS as follows: ca. 50 ul of lised. Yield 415 mg (56%), white solid. The structure was microbubbles were transferred to a clean vial containing ca. confirmed by H and 'C NMR analysis. 100 ul of 90% methanol. The mixture was Sonicated for 30 v) Synthesis of N'-Boc, N-hexadecyl-4-2-hydroxy-3-(1- seconds and analysed by MALDI-MS (ACH matrix), giving methylethyl)aminopropoxyphenylacetamide two M--H peaks at 2202 and 1259, corresponding to lipopep A solution of N-Boc-4-2-hydroxy-3-(1-methylethyl)- tide (a) and to lipopeptide (c) respectively. aminopropoxyphenylacetic acid (92 mg, 0.25 mmol) and e) In Vitro Analysis 25 hexadecylamine (60 mg, 0.25 mmol) in DMF (5 ml) was cooled to 0° C. HOBt (39 mg, 0.25 mmol) and N-(3- The microbubbles were tested in the in vitro assay as dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride detailed in example 21. A gradual accumulation of (water soluble carbodiimide) (48 mg, 0.25 mmol) were microbubbles binding to the cells was observed. added. The reaction mixture was stirred at 0° C. for 1 hour EXAMPLE 54 and then at room temperature overnight. The reaction mix Gas-filled Microbubbles Comprising DSPS and a Lipophilic ture was poured onto water (25 ml) containing Sodium Derivative of Atenolol with Affinity for Adrenergic Recep carbonate (2.5 g) and Sodium chloride (4.0 g). Precipitated tors for Diagnostic and Therapeutic Applications material was filtered off, washed with water and taken up in a) Synthesis of N-hexadecyl-4-2-hydroxy-3-(1-methyl chloroform. The chloroform phase was washed with 5% ethyl)aminopropoxyphenylacetamide 35 sodium carbonate and water and dried (NaSO). The solu i) Synthesis of methyl 4-(2,3-epoxy)propoxy tion was filtered and concentrated to give 150 mg of yellow phenylacetate white crude material. The product was purified by column A mixture of methyl 4-hydroxyphenylacetate (4.98 g, chromatography (silica, chloroform/methanol 95.5) to give 0.030 mol), epichlorohydrin (23.5 ml, 0.30 mol) and pyri 118 mg (80%) of white material. The structure was verified dine (121 ul, 1.5 mmol) was stirred at 85°C. for 2 hours. The 40 by H (500 MHz) and C (125 MHz) NMR. The product reaction mixture was cooled and exceSS epichlorohydrin was was further characterised by MALDI mass spectrometry, distilled off (rotavapor). The residue was taken up in ethyl giving a M+Na peak at 614 as expected. acetate, washed with brine and dried (Na2SO). The solution vi) Synthesis of N-hexadecyl-4-2-hydroxy-3-(1-methyl was filtered and concentrated. The dark residue was chro ethyl)aminopropoxyphenylacetamide matographed (silica, hexane/ethyl acetate 7:3) to give 2.25g 45 To a solution of N'-Boc-N-hexadecyl-4-2-hydroxy-3-(1- (34%) of a colourless oil. "H (300 MHz) and 'C NMR (75 methyl-ethyl)aminopropoxyphenylacetamide (10 mg) in MHz) spectra were in accordance with the structure. dichloromethane (9 ml) was added trifluoroacetic acid (1 ii) Synthesis of methyl 4-2-hydroxy-3-(1-methyl-ethyl) ml). The reaction mixture was stirred for 2 hours at room aminopropoxyphenylacetate temperature. TLC (silica, chloroform/methanol 95:5) A mixture of methyl 4-(2,3-epoxy) propoxy 50 showed complete conversion of Starting material. Solvents phenylacetate (2.00 g, 9.00 mmol), isopropylamine (23 ml, were evaporated off and the residue was taken up in water/ 0.27 mol) and water (1.35 ml, 74.7 mmol) was stirred at acetonitrile and lyophilised to give a quantitative yield of room temperature overnight. The reaction mixture was con white solid material. The structure was verified by "H (500 centrated (rotavapor) and the oily residue was dissolved in MHz) and 'C (125 MHz) NMR analysis and further char chloroform and dried (Na2SO). Filtration and concentration 55 acterised by MALDI mass spectrometry, giving M--H at 492 gave quantitative yield of a yellow oil that was used in the and M+Na at 514 as expected. next Step without further purification. The Structure was b) Preparation of Gas-filled Microbubbles Comprising verified by H and 'C NMR analysis. DSPS and N-hexadecyl-4-2-hydroxy-3-(1-methylethyl)- iii) Synthesis of 4-2-hydroxy-3-(1-methyl-ethyl)amino aminopropoxyphenylacetamide for Diagnostic and Thera propoxyphenylacetic acid hydrochloride 60 peutic Applications A solution of methyl 4-2-hydroxy-3-(1-methyl-ethyl) A solution of 1.4% propylene glycol/2.4% glycerol (1.0 aminopropoxyphenylacetate (563 mg, 2.00 mmol) in 6M ml) was added to a mixture of DSPS (4.5 mg) and hydrochloric acid (15 ml) was heated at 100° C. for 4 hours. N-hexadecyl-4-2-hydroxy-3-(1-methylethyl)-amino The reaction mixture was concentrated (rotavapor) and the propoxyphenylacetamide (0.5 mg) in a vial. The mixture residue was taken up in water and lyophilised. "H and 'C 65 was Sonicated for 5 minutes and then heated at 80 C. for 5 NMR spectra were in accordance with the strucure and minutes (vial was shaken during warming). The Solution was MALDI mass spectrometry gave a M+H at 268 as expected. filtered and cooled. The head space was flushed with per US 6,261,537 B1 135 136 fluorobutane gas and the Vial was shaken in a cap mixer for ing to the structure at 1435, expected 1430. The material was 45 Seconds, whereafter the contents were extensively further characterised by analytical HPLC, gradient 70-100% washed with deionised water. Incorporation of compound B over 20 minutes, A=0.1% TFA/water and B=0.1% TFA/ from (a) into the microbubbles was confirmed by MALDI acetonitrile, flow rate 1.0 ml/minute, giving a product peak MS as follows; ca. 50 ul of microbubbles were transferred 5 with retention time 27 minutes detected at UV 368 nm. to a clean vial containing ca. 100 ul of 90% methanol. The b) Preparation of Gas-filled Microbubbles Comprising mixture was Sonicated for 30 Seconds and analysed by DSPS and a Lipopeptide Containing Folic Acid MALDI-MS, giving a M+H peak at 492 corresponding to A solution of 1.4% propylene glycol/2.4% glycerol (1.0 N-hexadecyl-4-2-hydroxy-3-(1-methylethyl)amino ml) was added to a mixture of DSPS (4.5 mg) and product propoxyphenylacetamide. from (a) (0.5 mg) in a vial. Dilute ammonia (to pH 8) and DMSO (40 ul) were added and the mixture was sonicated for EXAMPLE 55 5 minutes and then heated at 80° C. for 5 minutes (vial was Gas-filled Microbubbles Encapsulated with DSPS and a Shaken during warming). The Solution was filtered and Compound Containing Folic Acid for Diagnostic Applica cooled. The head space was flushed with perfluorobutane tions gas and the vial was Shaken in a cap mixer for 45 seconds, a) Synthesis of a Lipopeptide Containing Folic Acid whereafter the contents were extensively washed with deio

(SEQ ID NO:22) ~~~~ O

Null H

NH2 HN

The structure shown above was synthesised by the manual bubbler method starting with Fmoc-protected Rink Amide MBHA resin on a 0.125 mmol Scale, using appropriate 60 nised water. Incorporation of structure from (a) into the amino acids, palmitic acid and folic acid. Coupling was carried out using standard TBTU/HOBt/DIEA protocols. bubbles was confirmed by MALDI-MS as follows: ca. 50 ul Simultaneous removal of the peptide from the resin and of microbubbles were transferred to a clean vial containing deprotection of Side-chain protecting groups was carried out ca. 100 ul of 90% methanol. The mixture was Sonicated for in TFA containing 5% EDT and 5% water for 2 hours. Crude 65 30 seconds and analysed by MALDI-MS (ACH matrix), material was precipitated from ether and analysed by giving a M-H peak at 1238 corresponding to Structure from MALDI mass spectrometry, giving a M--H peak correspond (a). US 6,261,537 B1 137 138 c) In Vitro Analysis A mixture of methyl 4-hydroxyphenylacetate (4.98 g, The microbubbles were tested in the in vitro assay as 0.030 mol), epichlorohydrin (23.5 ml, 0.30 mol) and pyri detailed in Example 21. A gradual accumulation of dine (121 ul, 1.5 mmol) was stirred at 85°C. for 2 hours. The microbubbles binding to the cells was observed. reaction mixture was cooled and exceSS epichlorohydrin was EXAMPLE 56 distilled off (rotavapor). The residue was taken up in ethyl Gas-filled Microbubbles Comprising DSPS and a Choles acetate, washed with brine and dried (NaSO). The solution terol Ester of Chlorambucil for Diagnostic and Therapeutic was filtered and concentrated. The dark residue was chro Applications matographed (silica, hexane/ethyl acetate 7:3) to give 2.25g a) Synthesis of Cholesterol 4-4-bis(2-chloroethyl) (34%) of a colourless oil. "H (300 MHz) and 'C NMR (75 aminophenylbutanoate MHz) spectra were in accordance with the structure. DIC (170 ul, 1.10 mmol) was added to a solution of ii) Synthesis of methyl 4-2-hydroxy-3-(1-methylethyl) chlorambucil (669 mg, 2.20 mmol) in dry dichloromethane aminopropoxyphenylacetate (15 ml). The mixture was stirred at room temperature for 0.5 15 hour and added to a solution of cholesterol (387 mg, 1.00 A mixture of methyl 4-(2,3-epoxy) propoxy mmol) and DMAP (122 mg, 1.00 mmol) in dichloromethane phenylacetate (2.00 g, 9.00 mmol), isopropylamine (23 ml, (10 ml). The reaction mixture was stirred overnight and then 0.27 mol) and water (1.35 ml, 74.7 mmol) was stirred at poured onto 5% sodium bicarbonate. The phases were room temperature overnight. The reaction mixture was con Separated and the organic phase was washed with brine and centrated (rotavapor) and the oily residue was dissolved in dried (MgSO). The solution was filtered and concentrated chloroform and dried (NaSO). Filtration and concentration and the product was purified by column chromatography gave quantitative yield of a yellow oil that was used in the (silica, chloroform) to give 560 mg (83%)of colouless oil. next Step without further purification. The Structure was The product was characterised by MALDI mass verified by H and 'C NMR analysis. Spectrometry, giving M-H at 674 as expected. Further 25 iii) Synthesis of 4-2-hydroxy-3-(1-methylethyl)amino characterisation was carried out using H (500 MHz) and propoxyphenylacetic acid hydrochloride 'C (125 MHz) NMR analysis, giving spectra in accordance A solution of methyl 4-2-hydroxy-3-(1-methylethyl) with the structure. aminopropoxyphenylacetate (563 mg, 2.00 mmol) in 6M b) Preparation of Gas-filled Microbubbles Comprising hydrochloric acid (15 ml) was heated at 100° C. for 4 hours. DSPS and a Cholesterol Ester of Chlorambucil for Diag The reaction mixture was concentrated (rotavapor) and the nostic and/or Therapeutic Applications residue was taken up in water and lyophilised. "H and 'C A solution of 1.4% propylene glycol/2.4% glycerol (1.0 NMR spectra were in accordance with the structure and ml) was added to a mixture of DSPS (4.5 mg) and product MALDI mass spectrometry gave a M+H at 268 as expected. from (a) (0.5 mg) in a vial. The mixture was sonicated for 35 iv) Synthesis of N-Boc-4-2-hydroxy-3-(1-methylethyl) 5 minutes and then heated at 80° C. for 5 minutes (vial was aminopropoxyphenylacetic acid Shaken during warming) and cooled. The head space was A solution of the 4-2-hydroxy-3-(1-methyl-ethyl) flushed with perfluorobutane gas and the Vial was Shaken in aminopropoxyphenylacetic acid hydrochloride (2.0 mmol) a cap mixer for 45 Seconds, whereafter the contents were 40 in water (2 ml) was added to a Solution of Sodium bicar extensively washed with deionised water. MALDI mass bonate (0.60 g, 7.2 mmol) in water/dioxane (2:1, 15 ml). A Spectrometry showed no detectable level of compound from solution of di-tert-butyl dicarbonate (0.48 g, 2.2 mmol) in (a) in the final wash Solution. Incorporation of chlorambucil dioxane (5 ml) was added. Progress of the reaction was cholesteryl ester into the bubbles was confirmed by MALDI monitored by TLC analysis (silica, CHCl/MeOH/AcOH MS as follows: ca. 50 All of microbubbles were transferred 45 85:10:5), and portions of di-tert-butyl dicarbonate were to a clean vial containing ca. 100 ul of 90% methanol. The added until conversion was complete. The reaction mixture mixture was Sonicated for 30 Seconds and analysed by was poured onto water Saturated with potassium hydrogen MALDI-MS, giving a M+H peak at 668 corresponding to Sulphate and organic material was extracted into ethyl Structure from (a). 50 acetate. The organic phase was washed with water and brine, EXAMPLE 57 dried (Na2SO) and filtered to give 0.6 g of crude material. Gas-filled Microbubbles Comprising DSPS and a Lipopep The product was purified by chromatography (Silica, CHCl/ tide Containing Atenolol and a Cholesterol Derivative of MeOH/AcOH 85:10:5). The solution was concentrated and Chlorambucil for Diagnostic and Therapeutic Applications 55 the residue was taken up in glacial acetic acid and lyophi a) Synthesis of a Protected Atenolol Derivative Suitable lised. Yield 415 mg (56%), white solid. The structure was for Solid Phase Coupling confirmed by H and 'C NMR analysis. i) Synthesis of methyl 4-(2,3-epoxy)propoxy b) Synthesis of a Lipopeptide Functionalised with phenylacetate Atenolol (SEQ ID NO:21) US 6,261,537 B1 139 140

O

~s NH2

O O H N N NH2 - O O-l

The structure shown above was synthesised by the manual pounds (b) and (c) into the microbubbles was confirmed by bubbler method starting with Fmoc-protected Rink Amide MALDI-MS as follows: ca. 50 ul of microbubbles were MBHA resin on a 0.125 mmol Scale, using appropriate transferred to a clean vial containing ca. 100 ul of 90% amino acids, palmitic acid and the compound from (a). methanol. The mixture was Sonicated for 30 seconds and Coupling was carried out using standard TBTU/HOBt/DIEA 25 analysed by MALDI-MS (ACH-matrix), giving a M+H peak protocols. Simultaneous removal of the peptide from the corresponding to lipopeptide (b) and cholesteryl ester (c). resin and deprotection of Side-chain protecting groups was e) In Vitro Analysis carried out in TFA containing 5% EDT and 5% water for 2 The microbubbles were tested in the in vitro assay as hours. Crude material was precipitated from ether and detailed in Example 21. A gradual accumulation of purified by preparative liquid chromatography using a gra microbubbles binding to the cells was observed. dient of 70 to 100% B over 60 minutes (A=0.1% TFA/water and B=0.1% TFA/acetonitrile) at a flow rate of 10 ml/min. EXAMPLE 58 After lyophilisation, a yield of 38 mg of pure material was Gas-filed Microbubbles Comprising DSPS and a Lipopep obtained (analytical HPLC, gradient 70–100% B over 20 tide Containing Atenolol for Cell Targeting and a Lipophilic minutes, A=0.1% TFA/water and B=0.1% TFA/acetonitrile, 35 Thiol Ester of Captopril for Therapeutic Use flow rate 1 ml/minute, detection UV 214 nm, retention time a) Synthesis of a Protected Atenolol Derivative Suitable 25 minutes). Further characterisation was carried out using for Solid Phase Coupling MALDI mass spectrometry (ACH matrix), giving M+H at i) Synthesis of methyl 4-(2,3-epoxy)propoxy 1258, expected 1257. phenylacetate c) Synthesis of Cholesterol 4-4-bis(2-chloroethyl) A mixture of methyl 4-hydroxyphenylacetate (4.98 g, aminophenylbutanoate 40 0.030 mol), epichlorohydrin (23.5 ml, 0.30 mol) and pyri DIC (170 ul, 1.10 mmol) was added to a solution of dine (121 ul, 1.5 mmol) was stirred at 85°C. for 2 hours. The chlorambucil (669 mg, 2.20 mmol) in dry dichloromethane reaction mixture was cooled and exceSS epichlorohydrin was (15 ml). The mixture was stirred at room temperature for 0.5 distilled off (rotavapor). The residue was taken up in ethyl hour and added to a solution of cholesterol (387 mg, 1.00 acetate, washed with brine and dried (NaSO). The solution mmol) and DMAP (122 mg, 1.00 mmol) in dichloromethane 45 was filtered and concentrated. The dark residue was chro (10 ml). The reaction mixture was stirred overnight and then matographed (silica, hexane/ethyl acetate 7:3) to give 2.25g poured onto 5% sodium bicarbonate. The phases were (34%) of a colourless oil. "H (300 MHz) and 3C NMR (75 Separated and the organic phase was washed with brine and MHz) spectra were in accordance with the structure. dried (MgSO). The solution was filtered and concentrated ii) Synthesis of methyl 4-2-hydroxy-3-(1-methyl-ethyl) and the product was purified by column chromatography 50 aminopropoxyphenylacetate (silica, chloroform) to give 560 mg (83%) of colouless oil. A mixture of methyl 4-(2,3-epoxy) propoxy The product was characterised by MALDI mass phenylacetate (2.00 g, 9.00 mmol), isopropylamine (23 ml, Spectrometry, giving M-H at 674 as expected. Further 0.27 mol) and water (1.35 ml, 74.7 mmol) was stirred at characterisation was carried out using H (500 MHz) and room temperature overnight. The reaction mixture was con 'C (125 MHz) NMR analysis, giving spectra in accordance 55 centrated (rotavapor) and the oily residue was dissolved in with the structure. chloroform and dried (NaSO). Filtration and concentration d) Preparation of Gas-filled Microbubbles Comprising gave quantitative yield of a yellow oil that was used in the DSPS and a Lipopeptide Containing Atenolol and a Cho next Step without further purification. The Structure was lesterol Ester of Chloambucil verified by H and 'C NMR analysis. A solution of 1.4% propylene glycol/2.4% glycerol (1.0 iii) Synthesis of 4-2-hydroxy-3-(1-methyl-ethyl)amino ml) was added to a mixture of DSPS (5.0 mg), product from 60 propoxyphenylacetic acid hydrochloride (b) (0.5 mg) and product from (c) (0.5 mg) in a vial. The A solution of methyl 4-2-hydroxy-3-(1-methyl-ethyl) mixture was Sonicated for 5 minutes and then warmed to 80 aminopropoxyphenylacetate (563 mg, 2.00 mmol) in 6M C. for 5 minutes (vial was shaken during warming). The hydrochloric acid (15 ml) was heated at 100° C. for 4 hours. Solution was filtered and cooled. The head Space was flushed The reaction mixture was concentrated (rotavapor) and the with perfluorobutane gas and the vial was shaken in a cap 65 residue was taken up in water and lyophilised. H and 'C mixer for 45 Seconds, whereafter the contents were exten NMR spectra were in accordance with the strucure and Sively washed with deionised water. Incorporation of com MALDI mass spectrometry gave a M+H at 268 as expected. US 6,261,537 B1 141 142 iv) Synthesis of N-Boc-4-2-hydroxy-3-(1-methyl-ethyl) were separated and the organic phase was washed with water aminopropoxyphenylacetic acid and brine and dried (MgSO). After filtration and A solution of the 4-2-hydroxy-3-(1-methyl-ethyl) concentration, the crude material was chromatographed aminopropoxyphenylacetic acid hydrochloride (2.0 mmol) (silica, chloroform/methanol/acetic acid 95:4:1). The prod in water (2 ml) was added to a Solution of Sodium bicar uct was lyophilised from a acetonitrile/water/ethanol mix bonate (0.60 g, 7.2 mmol) in water/dioxane (2:1, 15 ml). A ture. Yield 137 mg (49%) of off-white solid. The structure solution of di-tert-butyl dicarbonate (0.48 g, 2.2 mmol) in was verified by H (500 MHz) and 'C (125 MHz) NMR dioxane (5 ml) was added. Progress of the reaction was Spectroscopy. Further characterisation was carried out using monitored by TLC analysis (silica, CHCl/MeOH/AcOH MALDI mass spectrometry, giving a M--Na peak in positive 85:10:5), and portions of di-tert-butyl dicarbonate were mode at m/z 584. added until conversion was complete. The reaction mixture d) Preparation of Gas-filled Microbubbles Comprising was poured onto water Saturated with potassium hydrogen DSPS and a Lipopeptide Containing Atenolol for Cell Sulphate and organic material was extracted into ethyl Targeting and a Lipophilic Thiol Ester of Captopril for acetate. The organic phase was washed with water and brine, Therapeutic Use dried (Na2SO) and filtered to give 0.6 g of crude material. A solution of 1.4% propylene glycol/2.4% glycerol (1.0 The product was purified by chromatography (Silica, CHCl/ 15 ml) was added to a mixture of DSPS (5.0 mg) and products MeOH/AcOH 85:10:5). The solution was concentrated and from (b) (0.5 mg) and (c) (0.5 mg) in a vial. The mixture was the residue was taken up in glacial acetic acid and lyophi Sonicated for 5 minutes and then heated at 80° C. for 5 lised. Yield 415 mg (56%), white solid. The structure was minutes (vial was shaken during warming) and cooled. Head confirmed by H and 'C NMR analysis. Space was flushed with perfluorobutane gas and the vial was b) Synthesis of a Lipopeptide Functionalised with Shaken in a cap mixer for 45 Seconds followed by extensive Atenolol (SEQ ID NO:21) washing with deionised water. MALDI mass spectrometry

O

O O O H H N N --~~~~ N N H H O O NH2 O--l

The structure shown above was synthesised by the manual showed no detectable level of compound from (b) or (c) in bubbler method starting with Fmoc-protected Rink Amide the final wash Solution. Incorporation of compounds from MBHA resin on a 0.125 mmol Scale, using appropriate 45 (b) and (c) into the microbubbles was confirmed by MALDI amino acids, palmitic acid and the compound from (a). MS as follows: ca. 50 ul of microbubbles were transferred Coupling was carried out using standard TBTU/HOBt/DIEA to a clean vial containing ca. 100 ul of 90% methanol. The protocols. Simultaneous removal of the peptide from the mixture was Sonicated for 30 Seconds and analysed by resin and deprotection of Side-chain protecting groups was MALDI-MS (ACH-matrix), giving peaks according to carried out in TFA containing 5% EDT and 5% water for 2 Structures from (b) and (c) respectively. hours. Crude material was precipitated from ether and 50 e) In Vitro Analysis purified by preparative liquid chromatography using a gra The microbubbles were tested in the in vitro assay as dient of 70 to 100% B over 60 minutes (A=0.1% TFA/water detailed in Example 21. A gradual accumulation of and B=0.1% TFA/acetonitrile) at a flow rate of 10 ml/min. microbubbles binding to the cells was observed. After lyophilisation, a yield of 38 mg of pure material was EXAMPLE 59 obtained (analytical HPLC, gradient 70–100% B over 20 55 minutes, A=0.1% TFA/water and B=0.1% TFA/acetonitrile, Gas-filled Microbubbles Comprising Phosphatidylserine flow rate 1 ml/minute, detection UV 214 nm, retention time and biotinamide-PEG-B-Ala-cholesterol and a Cholesterol 25 minutes). Further characterisation was carried out using Ester of Chlorambucil for Diagnostic and Therapeutic MALDI mass spectrometry (ACH matrix), giving M+H at Applications 1258, expected 1257. a) Synthesis of Cholesterol N-Boc-f-alaninate c) Synthesis of Cholanic Acid Thiol Ester of Captopril 60 DIC (510 ul) was added to a solution of Boc-B-Ala-OH A mixture of 5-B-cholanic acid (361 mg, 1.00 mmol) and (1.25 g. 6.60 mmol) in dichloromethane (15 ml) under an DIC (77 ul, 0.50 mmol) in dichloromethane (5 ml) was inert atmosphere. The reaction mixture was stirred for 30 stirred for 10 minutes and then added to a Solution of minutes and then transferred to a flask containing a Solution captopril (130 mg, 0.600 mmol) and DBU (180 ul, 1.20 of cholesterol (1.16 g, 3.00 mmol) and DMAP (367 mg, 3.00 mmol) in dichloromethane (10 ml). The reaction mixture 65 mmol) in dichloromethane (15 ml). The reaction mixture was Stirred overnight and then poured onto dilute hydro was Stirred for 2 hours and then poured onto an aqeous chloric acid. Chloroform (30 ml) was added. The phases Solution of potassium hydrogen Sulphate. After phase Sepa US 6,261,537 B1 143 144 ration the aqueous phase was extracted with chloroform. The was shaken in a cap mixer for 45 Seconds, whereafter the combined organic phases were washed with aqueous potas contents were extensively washed with deionised water. sium hydrogen Sulphate and water and dried (MgSO). After MALDI mass spectrometry showed no detectable level of filtration and evaporation the crude product was chromato graphed (silica, chloroform/methanol 99:1) to give 1.63 g compound from (c) or (d) in the final wash Solution. Incor (97%) of white solid. The structure was confirmed by "H poration of compounds from (c) and (d) into the NMR (500 MHz). microbubbles was confirmed by MALDI-MS as follows: ca. b) Synthesis of Cholesteryl B-alaninate Hydrochloride 50 ul of microbubbles were transferred to a clean vial A solution of compound from (a) (279 mg, 0.500 mmol) containing ca. 100 ul of 90% methanol. The mixture was in 1M hydrochloric acid in 1,4-dioxane (5 ml) was stirred at Sonicated for 30 seconds and analysed by MALDI-MS room temperature for 4 hours. The reaction mixture was (ACH-matrix), giving M-H peaks corresponding to com concentrated to give a quantitative yield of cholesteryl pounds from (c) and (d). B-alaninate hydrochloride. The structure was confirmed by "H NMR (500 MHz) analysis and by MALDI mass EXAMPLE 60 Spectrometry, giving a M+Na peak at 482, expected 481. Gas-filled Microbubbles Comprising DSPS and a Lipopep c) Biotin-PEGoo-B-Ala-Cholesterol 15 To a solution of cholesteryl B-alaninate hydrochloride (15 tide Containing a Derivative of Bestatin for Diagnostic and mg, 0.03 mmol) in chloroform/wet methanol (2.6:1, 3 ml) Therapeutic Applications was added triethylamine (42 ul, 0.30 mmol). The mixture a) Synthesis of a Lipopeptide Containing a Derivative of was stirred for 10 minutes at room temperature and a Bestatin (SEQ ID NO:23)

O --~~~~ NH NH2

O O O H H --~~~~ N NullsY N Null1 NH H E H E O O

Os, OH O NH2 HN

O i H solution of biotin-PEG-NHS (100 mg, 0.03 mmol) in The structure shown above was synthesised by the manual 1,4-dioxane (1 ml) was added dropwise. After stirring at 40 bubbler method starting with Fmoc-protected Rink Amide room temperature for 3 hours the mixture was evaporated to MBHA resin on a 0.125 mmol Scale, using appropriate dryneSS and the residue was purified by flash chromatogra amino acids and palmitic acid. Coupling was carried out phy to give white crystals, yield 102 mg (89%). The struc using standard TBTU/HOBt/DIEA protocols. Simultaneous ture was verified by MALDI-MS and by NMR analysis. removal of the peptide from the resin and deprotection of d) Synthesis of Cholesterol 4-4-bis(2-chloroethyl) Side-chain protecting groups was carried out in TFA con aminophenylbutanoate 45 taining 5% EDT and 5% water for 2 hours. Crude material DIC (170 ul, 1.10 mmol) was added to a solution of was precipitated from ether and purified by preparative chlorambucil (669 mg, 2.20 mmol) in dry dichloromethane liquid chromatography using a gradient of 70 to 100% B (15 ml). The mixture was stirred at room temperature for 0.5 over 60 minutes (A=0.1% TFA/water and B=0.1% TFA/ hour and added to a solution of cholesterol (387 mg, 1.00 acetonitrile) at a flow rate of 10 ml/min. After lyophilisation, mmol) and DMAP (122 mg, 1.00 mmol) in dichloromethane 50 a yield of 12 mg of pure material was obtained (analytical (10 ml). The reaction mixture was stirred overnight and then HPLC, gradient 70–100% B over 20 minutes, A=0.1% poured onto 5% sodium bicarbonate. The phases were TFA/water and B=0.1% TFA/acetonitrile, flow rate 1 Separated and the organic phase was washed with brine and ml/minute, detection UV 214 nm, retention time 25 dried (MgSO). The solution was filtered and concentrated minutes). Further characterisation was carried out using and the product was purified by column chromatography MALDI mass spectrometry (ACH matrix), giving M+H at (silica, chloroform) to give 560 mg (83%) yield of colouless 55 1315, expected 1314. oil. The product was characterised by MALDI mass b) Preparation of Gas-filled Microbubbles Comprising Spectrometry, giving M-H at 674 as expected. Further DSPS and a Lipopeptide Containing a Derivative of Bestatin characterisation was carried out using H (500 MHz) and for Diagnostic and Therapeutic Applications 'C (125 MHz) NMR analysis, giving spectra in accordance A solution of 1.4% propylene glycol/2.4% glycerol (1.0 with the structure. 60 ml) was added to a mixture of DSPS (4.5 mg) and product e) Preparation of Gas-filled Microbubbles from (a) (0.5 mg) in a vial. The mixture was sonicated for A solution of 1.4% propylene glycol/2.4% glycerol (1.0 5 minutes and then heated at 80° C. for 5 minutes (vial was ml) was added to a mixture of DSPS (5 mg) and products Shaken during warming) and cooled. The head space was from (c) (0.5 mg) and (d) (0.5 mg) in a vial. The mixture was flushed with perfluorobutane gas and the Vial was Shaken in Sonicated for 5 minutes and then heated at 80 C. for 5 65 a cap mixer for 45 seconds and the contents were extensively minutes (vial was shaken during warming) and cooled. The washed with deionised water. MALDI mass spectrometry head Space was flushed with perfluorobutane gas and the Vial showed no detectable level of compound from (b) in the final US 6,261,537 B1 145 146 wash Solution. Incorporation of atenolol-containing lipopep Shaken during warming) and cooled. The head space was tide into the microbubbles was confirmed by MALDI-MS as flushed with perfluorobutane gas and the Vial was Shaken in follows: ca. 50 ul of microbubbles were transferred to a a cap mixer for 45 Seconds, whereafter the contents were clean vial containing ca. 100 ul of 90% methanol. The extensively washed with deionised water. MALDI mass mixture was Sonicated for 30 Seconds and analysed by Spectrometry showed no detectable level of compound from MALDI-MS (ACH-matrix), giving a M+H peak at 1320, (a) in the final wash Solution. Incorporation of chlorambucil expected at 1314, corresponding to lipopeptide from (a). containing lipopeptide into the bubbles was confirmed by c) In Vitro Analysis MALDI-MS as follows: ca. 50 ul of microbubbles were The microbubbles were tested in the in vitro assay as transferred to a clean vial containing ca. 100 ul of 90% detailed in Example 21. A gradual accumulation of methanol. The mixture was Sonicated for 30 seconds and microbubbles binding to the cells was observed. analysed by MALDI-MS (ACH-matrix), giving a M+H peak EXAMPLE 61 at 1300, expected at 1294 and a M+Na peak at 1324, Gas-filled Microbubbles Comprising DSPS and a Lipopep expected 1317. tide Containing Chlorambucil for Diagnostic and Therapeu c) In Vitro Analysis tic Applications 15 The microbubbles were tested in the in vitro assay as a) Synthesis of a Lipopeptide Containing Chlorambucil detailed in Example 21. A gradual accumulation of (SEQ ID NO:24) microbubbles binding to the cells was observed. ~~~~ O

--~~~~ O E 2 l O l NH2 HN

O C

C

The structure shown above was synthesised by the manual EXAMPLE 62 bubbler method starting with Fmoc-protected Rink Amide Gas-filled Microbubbles Comprising DSPS, a Lipopeptide MBHA resin on a 0.125 mmol Scale, using appropriate Containing Atenolol and a Lipophilic Derivative of Capto amino acids and palmitic acid. Coupling was carried out pril for Diagnostic and Therapeutic Applications using standard TBTU/HOBt/DIEA protocol. Chlorambucil 45 a) Synthesis of a Protected Atenolol Derivative Suitable was coupled through the Side-chain of Lys as a Symmetrical for Solid Phase Coupling anhydride using DIC preactivation. Simultaneous removal i) Synthesis of methyl 4-(2,3-epoxy)propoxy of the peptide from the resin and deprotection of Side-chain phenylacetate protecting groups was carried out in TFA containing 5% A mixture of methyl 4-hydroxyphenylacetate (4.98 g, EDT, 5% water and 5% ethyl methyl sulphide for 2 hours. 50 0.030 mol), epichlorohydrin (23.5 ml, 0.30 mol) and pyri An aliqout of 10 mg of the crude material was purified by dine (121 ul, 1.5 mmol) was stirred at 85°C. for 2 hours. The preparative liquid chromatography using a gradient of 70 to reaction mixture was cooled, and exceSS epichlorohydrin 100% B over 60 minutes (A=0.1% TEA/water and B=0.1% was distilled off (rotavapor). The residue was taken up in TFA/acetonitrile) at a flow rate of 10 ml/min. After ethyl acetate, washed with brine and dried (NaSO). The lyophilisation, a yield of 30 mg of pure material was Solution was filtered and concentrated. The dark residue was obtained (analytical HPLC, gradient 70–100% B over 20 55 chromatographed (silica, hexane/ethyl acetate 7:3) to give minutes, A=0.1% TFA/water and B=0.1% TFA/acetonitrile, 2.25 g (34%) of a colourless oil. "H (300 MHz) and 3C flow rate 1 ml/minute, detection UV 214 nm retention time NMR (75 MHz) spectra were in accordance with the struc 26.5 minutes). Further characterisation was carried out using ture. MALDI mass spectrometry, giving M+H at 1295, expected ii) Synthesis of methyl 4-2-hydroxy-3-(1-methyl-ethyl) 1294. 60 aminopropoxyphenylacetate b) Preparation of Gas-filled Microbubbles Comprising A mixture of methyl 4-(2,3-epoxy) propoxy DSPS and a Lipopeptide Containing Chlorambucil for Diag phenylacetate (2.00 g, 9.00 mmol), isopropylamine (23 ml, nostic and Therapeutic Applications 0.27 mol) and water (1.35 ml, 74.7 mmol) was stirred at A solution of 1.4% propylene glycol/2.4% glycerol (1.0 room temperature overnight. The reaction mixture was con ml) was added to a mixture of DSPS (4.5 mg) and product 65 centrated (rotavapor) and the oily residue was dissolved in from (a) (0.5 mg) in a vial. The mixture was sonicated for chloroform and dried (NaSO). Filtration and concentration 5 minutes and then heated at 80° C. for 5 minutes (vial was gave quantitative yield of a yellow oil that was used in the US 6,261,537 B1 147 148 next Step without further purification. The Structure was dient of 70 to 100% B over 60 minutes (A=0.1% TFA/water verified by H and 'C NMR analysis. and B=0.1% TFA/acetonitrile) at a flow rate of 10 ml/min. iii) Synthesis of 4-2-hydroxy-3-(1-methyl-ethyl)amino After lyophilisation, a yield of 38 mg of pure material was propoxyphenylacetic acid hydrochloride obtained (analytical HPLC, gradient 70–100% B over 20 A solution of methyl 4-2-hydroxy-3-(1-methyl-ethyl) minutes, A=0.1 TFA/water and B=0.1% TFA/acetonitrile, aminopropoxyphenylacetate (563 mg, 2.00 mmol) in 6M flow rate 1 ml/minute, detection UV 214 nm, retention time hydrochloric acid (15 ml) was heated at 100° C. for 4 hours. 25 minutes). Further characterisation was carried out using The reaction mixture was concentrated (rotavapor) and the MALDI mass spectrometry (ACH matrix), giving M+H at residue was taken up in water and lyophilised. "H and 3C 1258, expected 1257. NMR spectra were in accordance with the strucure and c) Synthesis of N-(S)-3-hexadecylthio-2- MALDI mass spectrometry gave a M+H at 268 as expected. methylpropionylproline iv) Synthesis of N-Boc-4-2-hydroxy-3-(1-methyl-ethyl) DIEA (188 ul, 1.10 mmol) was added to a solution of aminopropoxyphenylacetic acid 1-iodohexadecane (176 mg, 0.500 mmol), captopril (120 A solution of the 4-2-hydroxy-3-(1-methyl-ethyl) 15 mg, 0.550 mmol) and DBU (165ul, 1.10 mmol) in tetrahy aminopropoxyphenylacetic acid hydrochloride (2.0 mmol) drofuran (5 ml). The mixture was heated at 70° C. for 2 in water (2 ml) was added to a Solution of Sodium bicar hours and then concentrated. The residue was poured onto bonate (0.60 g, 7.2 mmol) in water/dioxane (2:1, 15 ml). A water Saturated with potassium hydrogen Sulphate and solution of di-tert-butyl dicarbonate (0.48 g, 2.2 mmol) in organic material was extracted into chloroform. The organic dioxane (5 ml) was added. Progress of the reaction was phase was washed with water and dried (MgSO). The monitored by TLC analysis (silica, CHCl/MeOH/AcOH product was purified by chromatography (silica, CHCl/ 85:10:5), and portions of di-tert-butyl dicarbonate were MeOH/AcOH 85:10:5) and lyophilised to give 105 mg added until conversion was complete. The reaction mixture (48%) of white solid material. The structure was verified by was poured onto water Saturated with potassium hydrogen 25 "H (500 Mhz) and 'C (125 Mhz) NMR analysis and further Sulphate and organic material was extracted into ethyl characterised by MALDI mass spectrometry, giving M-H in acetate. The organic phase was washed with water and brine, negative mode at m/z 440 as expected. dried (Na2SO) and filtered to give 0.6 g of crude material. d) Preparation of Gas-filled Microbubbles Comprising The product was purified by chromatography (Silica, CHCl/ DSPS, a Lipopeptide Containing Atenolol and a Lipophilic MeOH/AcOH 85:10:5). The solution was concentrated and Derivative of Captopril for Diagnostic and Therapeutic the residue was taken up in glacial acetic acid and lyophi Applications lised. Yield 415 mg (56%), white solid. The structure was A solution of 1.4% propylene glycol/2.4% glycerol (1.0 confirmed by H and 3C NMR analysis. ml) was added to a mixture of DSPS (4.5 mg) and products b) Synthesis of a Lipopeptide Functionalised with from (b) (0.5 mg) and (c) in a vial. The mixture was Atenolol (SEQ ID NO:21) Sonicated for 5 minutes and then heated at 80° C. for 5

O

O O O H H N N N H Y. O O O-l

The structure shown above was synthesised by the manual minutes (vial was shaken during warming) and cooled. The bubbler method starting with Fmoc-protected Rink Amide head Space was flushed with perfluorobutane gas and the Vial MBHA resin on a 0.125 mmol Scale, using appropriate 60 was shaken in a cap mixer for 45 Seconds, whereafter the amino acids, palmitic acid and the compound from (a). contents were extensively washed with deionised water. Coupling was carried out using standard TBTU/HOBt/DIEA MALDI mass spectrometry showed no detectable level of protocols. Simultaneous removal of the peptide from the compound from (b) or (c) in the final wash Solution. Incor resin and deprotection of Side-chain protecting groups was poration of compounds (b) and (c) into the microbubbles carried out in TFA containing 5% EDT and 5% water for 2 65 was confirmed by MALDI-MS as follows: ca. 50 ul of hours. Crude material was precipitated from ether and microbubbles were transferred to a clean vial containing ca. purified by preparative liquid chromatography using a gra 100 ul of 90% methanol. The mixture was Sonicated for 30 US 6,261,537 B1 149 150 seconds and analysed by MALDI-MS (ACH-matrix), giving the residue was taken up in glacial acetic acid and lyophi M+H peaks corresponding to structures (b) and (c) respec lised. Yield 415 mg (56%), white solid. The structure was tively. confirmed by H and 'C NMR analysis. e) In Vitro Analysis e) Synthesis of Cholesterol N-Boc-f-alaninate The microbubbles were tested in the in vitro assay as DIC (510 ul) was added to a solution of Boc-B-Ala-OH detailed in Example 21. A gradual accumulation of (1.25 g. 6.60 mmol) in dichloromethane (15 ml) under an microbubbles binding to the cells was observed. inert atmosphere. The reaction mixture was stirred for 30 EXAMPLE 63 minutes and then transferred to a flask containing a Solution Gas-filled Microbubbles Comprising DSPS and a Choles of cholesterol (1.16 g, 3.00 mmol) and DMAP (367 mg, 3.00 terol Derivative of Atenolol for Diagnostic and Therapeutic mmol) in dichloromethane (15 ml). The reaction mixture Applications was Stirred for 2 hours and then poured onto an aqeous a) Synthesis of methyl 4-(2,3-epoxy)propoxy Solution of potassium hydrogen Sulphate. phenylacetate After phase Separation the aqueous phase was extracted A mixture of methyl 4-hydroxyphenylacetate (4.98 g, 15 with chloroform. The combined organic phases were washed 0.030 mol), epichlorohydrin (23.5 ml, 0.30 mol) and pyri with aqueous potassium hydrogen Sulphate and water and dine (121 ul, 1.5 mmol) was stirred at 85°C. for 2 hours. The dried (MgSO). After filtration and evaporation the crude reaction mixture was cooled, and exceSS epichlorohydrin product was chromatographed (silica, chloroform/methanol was distilled off (rotavapor). The residue was taken up in 99:1) to give 1.63 g (97%) of white solid. The structure was ethyl acetate, washed with brine and dried (Na2SO). The confirmed by H NMR (500 MHz). Solution was filtered and concentrated. The dark residue was f) Synthesis of cholesteryl B-alaninate Hydrochloride chromatographed (silica, hexane/ethyl acetate 7:3) to give A solution of compound from (a) (279 mg, 0.500 mmol) 2.25 g (34%) of a colourless oil. "H (300 MHz) and 'C in 1M hydrochloric acid in 1,4-dioxane (5 ml) was stirred at NMR (75 MHz) spectra were in accordance with the struc 25 room temperature for 4 hours. The reaction mixture was ture. concentrated to give a quantitative yield of cholesteryl b) Synthesis of methyl 4-2-hydroxy-3-(1-methyl-ethyl) B-alaninate hydrochloride. The structure was confirmed by aminopropoxyphenylacetate 1H NMR (500 MHz) analysis and by MALDI mass A mixture of methyl 4-(2,3-epoxy) propoxy Spectrometry, giving a M+Na peak at 482, expected 481. phenylacetate (2.00 g, 9.00 mmol), isopropylamine (23 ml, g) Synthesis of cholesteryl N-Boc-4-2-hydroxy-3-(1- 0.27 mol) and water (1.35 ml, 74.7 mmol) was stirred at methylethyl)aminopropoxyphenylacetyl-3-alaninate. room temperature overnight. The reaction mixture was con To a solution of N-Boc-4-2-hydroxy-3-(1-methyl-ethyl) centrated (rotavapor) and the oily residue was dissolved in aminopropoxyphenylacetic acid (55 mg, 0.15 mmol) and chloroform and dried (Na2SO). Filtration and concentration 35 cholesteryl B-alaninate hydrochloride (74 mg., 0.15 mmol) in gave quantitative yield of a yellow oil that was used in the DMF (5 ml) was added DIEA (26 ml, 0.15 mmol). HOBt (23 next Step without further purification. The Structure was mg, 0.15 mmol) and water-soluble carbodiimide (WSC) (29 verified by H and 'C NMR analysis. mg, 0.15 mmol) were added. The reaction mixture was c) Synthesis of 4-2-hydroxy-3-(1-methyl-ethyl)amino Stirred at room temperature overnight and then poured onto propoxyphenylacetic acid hydrochloride 40 water (25 ml) containing Sodium carbonate (2.5 g) and A solution of methyl 4-2-hydroxy-3-(1-methyl-ethyl) Sodium chloride (4.0 g). Precipitated material was extracted aminopropoxyphenylacetate (563 mg, 2.00 mmol) in 6M into chloroform. The organic phase was washed with water hydrochloric acid (15 ml) was heated at 100° C. for 4 hours. and dried (MgSO). After filtration and concentration, crude The reaction mixture was concentrated (rotavapor) and the 45 material (132 mg) was purified by column chromatography residue was taken up in water and lyophilised. "H and 'C (silica, chloroform/methanol/acetic acid, 95:4:1). Pooled NMR spectra were in accordance with the strucure and fractions were concentrated, taken up in glacial acetic acid MALDI mass spectrometry gave a M+H at 268 as expected. and lyophilised. Yield 83 mg (69%), yellow-white solid. d) Synthesis of N-Boc-4-2-hydroxy-3-(1-methyl-ethyl) Structure was confirmed by H NMR analysis. aminopropoxyphenylacetic acid 50 h) Synthesis of Cholesteryl 4-2-hydroxy-3-(1-methyl A solution of the 4-2-hydroxy-3-(1-methyl-ethyl) ethyl)aminopropoxyphenylacetyl-3-alaninate trifluoroac aminopropoxyphenylacetic acid hydrochloride (2.0 mmol) etate in water (2 ml) was added to a Solution of Sodium bicar To a solution of N-Boc-4-2-hydroxy-3-(1-methyl-ethyl) bonate (0.60 g, 7.2 mmol) in water/dioxane (2:1, 15 ml). A 55 aminopropoxyphenylacetyl-f-alaninate (40 mg, 0.05 solution of di-tert-butyl dicarbonate (0.48 g, 2.2 mmol) in mmol) in dry dichloromethane (4 ml) was added trifluoro dioxane (5 ml) was added. Progress of the reaction was acetic acid (2 ml). The reaction mixture was stirred for 2 monitored by TLC analysis (silica, CHCl/MeOH/AcOH hours and then concentrated. The product was lyophilised 85:10:5), and portions of di-tert-butyl dicarbonate were from a acetonitrile/water mixture to give a quantitative yield added until conversion was complete. The reaction mixture 60 of white-yellow material. The product was characterised by was poured onto water Saturated with potassium hydrogen MALDI mass spectrometry giving M+H at 708 as expected. Sulphate and organic material was extracted into ethyl i) Preparation of Gas-filled Microbubbles Comprising acetate. The organic phase was washed with water and brine, DSPS and a Cholesterol Derivative of Atenolol for Diag dried (NaSO) and filtered to give 0.6 g of crude material. 65 nostic and Therapeutic Applications The product was purified by chromatography (Silica, CHCl/ A solution of 1.4% propylene glycol/2.4% glycerol (1.0 MeOH/AcOH 85:10:5). The solution was concentrated and ml) was added to a mixture of DSPS (4.5 mg) and product US 6,261,537 B1 151 152 from (h) (0.5 mg) in a vial. The mixture was sonicated for containing 1.4% propylene glycol/2.4% glycerol in water 5 minutes and then heated at 80° C. for 5 minutes (vial was was added. The mixture was warmed to 80 C. for 5 minutes Shaken during warming) and cooled. The head space was (vial shaken during warming) and filtered while still hot flushed with perfluorobutane gas and the Vial was Shaken in through a 40 micron filter. The sample was cooled to room a cap mixer for 45 Seconds, whereafter the contents were temperature and the head Space was flushed with perfluo extensively washed with deionised water. MALDI mass robutane gas. The Vial was Shaken in a cap mixer for 45 Spectrometry showed no detectable level of compound from Seconds and then placed on aroller table overnight. The (b) in the final wash Solution. Incorporation of compound resulting microbubbles were washed several times with from (h) into the microbubbles was confirmed by MALDI deionised water and analysed for thiol group incorporation mass Spectrometry. using Ellmans Reagent. 1) In Vitro Analysis c) Modification of Transferrin and Avidin with The microbubbles were tested in the in vitro assay as fluorescein-NHS and sulpho-SMPB detailed in Example 21. A gradual accumulation of bubbles To a mixture of 2 mg of transferrin (Holo, human) and 2 15 mg of avidin in PBS (1 ml) was added 0.5 ml of a DMSO binding to the cells was observed. solution containing 1 mg Sulpho-SMPB and 0.5 mg EXAMPLE 64 fluorescein-NHS. The mixture was stirred for 45 minutes at Preparation of Multiple-sepecific Transferrin/avidin-coated room temperature then passed through a SephadeX 200 Gas-filled Microbubbles for Targeted Ultrasound Imaging column using PBS as eluent. The protein fraction was This example is directed to the preparation of collected and stored at 4 C. prior to use. microbubbles containing vectors for targeted ultrasound/ d) Microbubble Conjugation with Modified Transferrin/ therapy. aidin a) Synthesis of a Thiol-functionalised Lipid Molecule: To the thiol-containing microbubbles from (b) was added Dipalmitoyl-Lys-Lys-Lys-Aca-CyS.OH (SEQ ID NO:20) 1 ml of the modified transferrin/avidin protein solution from

O

--~~~~ H NH2

S H O O H H N N sus N N---- N OH H H H - O O O

The lipid structure shown above was Synthesised on an 45 (c). After adjusting the pH of the Solution to 9, the conju ABI 433A automatic peptide synthesiser starting with Fmoc gation reaction was allowed to proceed for 2 hours at room Cys(Trt)-Wang resin on a 0.25 mmol scale using 1 mmol temperature. Following extensive Washing with deionised amino acid cartridges. All amino acids and palmitic acid water the microbubbles were analysed by Coulter counter were preactivated using HBTU coupling chemistry. The (81% between 1 and 7 micron) and fluorescence microscopy Simultaneous removal of peptide from the resin and depro 50 (highly fluorescent microbubbles were observed). tection of Side-chain protecting groups was carried out in TFA containing 5% EDT and 5% HO for 2 hours, giving a EXAMPLE 65 crude product yield of 250 mg. Purification by preparative Gene Transfer by Gas-filled Microbubbles HPLC of a 40 mg aliquot of crude material was carried out This example is directed at the preparation of targeted using a gradient of 90 to 100% B over 50 minutes (A=0.1% 55 microbubbles for gene transfer. TFA/water and B=MeOH) at a flow rate of 9 ml/min. After a) Preparation of Gas-filled Microbubbles Comprising lyophilisation, 24 mg of pure material was obtained DSPS and Lipopeptide Coated with poly-L-lysine (analytical HPLC, gradient 70–100% B where B=0.1% DSPS (4.5 mg) and lipopeptide from Example 41 (0.5 TFA/acetonitrile, A=0.01% TFA/water: detection-UV 214 mg) were weighed in two 2 ml vials. To each vial, 0.8 ml nim-product retention time=23 minutes). Further product 60 propylene glycol/glycerol (4%) in water was added. Each characterisation was carried out using MALDI maSS Spec Solution was heated at 80° C. for 5 minutes, shaken and then trometry: expected M+H at 1096, found at 1099. cooled to ambient temperature, whereafter the headspaces b) Preparation of Gas-containing Microbubbles Compris were flushed with perfluorobutane. The vials were shaken on ing DSPS doped with a Thiol-containing Lipid Structure 65 a cap-mixer at 4450 oscillations/minute for 45 Seconds and DSPS (4.5 mg) and the lipid structure from (a) above (0.5 put on a roller table for 5 minutes. The content of the vials mg) were weighed into a clean vial and 0.8 ml of a Solution were mixed and the resulting Sample was washed by cen US 6,261,537 B1 153 154 trifugation at 2000 rpm for 5 minutes. The infranatant was 153732) in RPMI 1640 medium to which L-glutamine (200 removed and the same volume of distilled water was added. mM), penicillin/streptomycin (10,000 U/ml and 10,00 The Washing procedure was repeated once. Poly-L-lysine ug/ml) and 10% fetal calf serum were added. The cells were HBr (20.6 mg) was dissolved in 2 ml water, then an aliquot subcultured following trypsination with a split ratio of 1:5 to 1:7 when reaching confluence. 2 million cells from trypsi (0.4 ml) was made up to 2 ml with water. To 1.2 ml of the nated confluent cultures were added to each Set of five diluted poly-L-lysine solution was added 0.12 ml of the centrifuge tubes. Then control microbubbles or DSPS-lipopeptide microbubble suspension. Following microbubbles binding to endothelial cells, made as incubation, exceSS polylysine was removed by extensive described in Example 21 and in Example 38, were added at Washing with water. 2, 4, 6.8 or 10 million bubbles per tube. The cells at the b) Transfection of Cells bottom of the tubes after centrifugation at 400 g for 5 Endothelial cells (ECV304) were cultured in 6 well plates minutes were counted with a Coulter counter. It was found to a uniform Subconfluent layer. A transfection mixture the 4 or more microbubbles binding to a cell brought the consisting of 5 ug DNA (an Enhanced Green Fluorescent cells to the top of the fluid in the centrifugation tube. All Protein vector from CLONTECH) and 50 ul of microbubble 15 cells were floated by the microbbbles from Example 38 suspension from (a) in RPMI medium at a final volume of whereas about 50% were floated with the microbubbles from 250 ul was prepared. The mixture was left standing for 15 Example 21. minutes at room temperature then 1 ml of complete RPMI EXAMPLE 67 Gas-filled Microbubbles of distearoyl-phosphatidylserine medium was added. The medium was removed from the cell Comprising a Lipopeptide Containing a Vector with Affinity culture dish and the DNA-microbubble mixture was added for Endothelin Receptors for Targeted Ultrasound Imaging to the cells. The cells were incubated in a cell culture a) Synthesis of 4'-(3,4-dimethyl-5-isoxazolyl)- incubator (37° C). Sulfamoylsuccinanilic acid c) Ultrasonic Treatment To a solution of sulfisoxazole (267 mg, 1.00 mmol) in After 15 minutes incubation, Selected wells were exposed 25 DMF (10 ml) was added succinic anhydride (1.00 g, 10.0 to continious wave ultrasound of 1 MHz, 0.5 W/cm, for 30 mmol) and 4-dimethylaminopyridine (122 mg, 1.00 mmol). Seconds. The reaction mixture was stirred at 80° C. for 2 hours and then concentrated. The residue was taken up in 5% aqueous d) Incubation and Examination Sodium bicarbonate solution and extracted with ethyl The cells were further incubated in the cell culture incu acetate. The aqueous Solution was acidified with dilute bator (37° C.) for approximately 4.5 hours. The medium hydrochloric acid and organic material was extracted into containing DNA-microbubbles was then removed by ethyl acetate. The organic phase was washed with dilute aspiration, and 2 ml complete RPMI medium was added. hydrochloric acid, water and brine, treated with active The cells were incubated for 40-70 hours before examina charcoal and dried (MgSO). The solution was filtered and tion. Most of the medium was then removed and the cells 35 concentrated to give 280 mg (76%) of white solid. The were examined by fluorescence microScopy. The results structure was verified by H (300 MHz) and 'C (75 MHz) were compared to the results from control experiments NMR spectroscopy. Further characterisation was carried out where DNA or DNA-polylysine were added to the cells. using MALDI mass spectrometry (ACH matrix), giving a M+Na peak at m/z 390 and a M--K peak at m/z 406 as EXAMPLE 66 40 expected. Flotation of Endothelial Cells by Microbubbles with Vectors b) Synthesis of a Lipopeptide Functionalised with that Specifically Bind to the Endothelial Cells Sulfisoxazole (SEQ ID NO:25)

O

~ss NH2

O O O

--~~~ NH NH N H NH NH2 O O O. O &Sa / N O NH O NH2 NH NH O

This experiment was carried out to show that the present The Structure shown above was Synthesised on a manual invention can be used for Separation of cells to which the nitrogen bubbler apparatus Starting with Fmoc-protected microbubbles are targeted. The human endothelial cell line 65 Rink Amide BMHA resin on a 0.125 mmol scale, using ECV 304, derived from a normal umbilical cord (ATCC appropriate amino acids, palmitic acid and the compound CRL-1998) was cultured in Nunc culture flasks (chutney from (a). Coupling was carried out using standard TBTU/ US 6,261,537 B1 15S 156 HOBt/DIEA protocols. Simultaneous removal of the peptide from (b) (0.5 mg) in a vial. The mixture was sonicated for from the resin and deprotection of Side-chain protecting 5 minutes and then heated at 80° C. for 5 minutes (vial was groups was carried out in TFA containing 5% EDT and 5% Shaken during warming) and cooled. The head space was water for 2 hours. Crude material was precipitated from flushed with perfluorobutane gas and the Vial was Shaken in ether. The product was analysed by analytical HPLC, gra a cap mixer for 45 Seconds followed by extensive Washing dient 70–100% B over 20 minutes, A=0.1% TFA/water and with deionised water. MALDI mass spectrometry showed no B=0.1% TFA/acetonitrile, flow rate 1 ml/minute, detection detectable level of compound from (b) in the final wash UV 214 nm, retention time 27 minutes). Further characteri Solution. Incorporation of isoxazole-containing lipopeptide sation was carried out using MALDI mass Spectrometry, into the microbubbles was confirmed by MALDI-MS as giving a M+H at m/z 1359, expected 1356. follows: ca. 50 ul of microbubbles were transferred to a c) Preparation of Gas-filled Microbubbles Comprising the clean vial containing ca. 100 ul of 90% methanol. The Compound from (b) mixture was Sonicated for 30 Seconds and analysed by A solution of 1.4% propylene glycol/2.4% glycerol (1.0 MALDI-MS (ACH-matrix), giving a m+H peak at m/z 1359 ml) was added to a mixture of DSPS (4.5 mg) and product corresponding to lipopeptide (b).

SEQUENCE LISTING

<160> NUMBER OF SEQ ID NOS: 31 <210> SEQ ID NO: 1 <211& LENGTH 4 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: RGDC-Mal-PEG3400-DSPE

<400 SEQUENCE: 1 Arg Gly Asp Cys 1

<210> SEQ ID NO: 2 &2 11s LENGTH 25 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Peptide comprising phosphatidylserine-binding and heparin-binding sections

<400 SEQUENCE: 2 Phe Asn. Phe Arg Lieu Lys Ala Gly Glin 1 5 Lys Ile Arg Phe Gly Ala Ala 10 15 Ala Trp Glu Pro Pro Arg Ala Arg Ile 2O 25

<210> SEQ ID NO: 3 &2 11s LENGTH 8 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Heparin-binding peptide

<400 SEQUENCE: 3 Trp Glu Pro Pro Arg Ala Arg Ile 1 5

SEQ ID NO: 4 LENGTH 6 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Linker US 6,261,537 B1 157 158

-continued

sequence <221 NAME/KEY: MODRES <222> LOCATION: (1) <223> OTHER INFORMATION: MTX-phenylalanine <400 SEQUENCE: 4 Phe Lys Lieu Arg Lieu. Cys 1 5

<210 SEQ ID NO : 5 <211& LENGTH 4 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Heparin sulphate binding peptide

<400 SEQUENCE: 5 Lys Arg Lys Arg 1

<210> SEQ ID NO: 6 &2 11s LENGTH 8 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Fibronectin peptide

<400 SEQUENCE: 6 Trp Gln Pro Pro Arg Ala Arg Ile 1 5

<210 SEQ ID NO: 7 &2 11s LENGTH 13 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide consisting of a heparin sulphate binding peptide <221 NAME/KEY: MODRES <222> LOCATION: (1) <223> OTHER INFORMATION: Dipalmitoyl-lysine <400 SEQUENCE: 7 Lys Lys Arg Lys Arg Trp Gln Pro Pro 1 5 Arg Ala Arg Ile 10

<210 SEQ ID NO: 8 <211& LENGTH 24 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Fibronectin peptide sequence

<400 SEQUENCE: 8 Phe Asn. Phe Arg Lieu Lys Ala Gly Glin 1 5 Lys Ile Arg Phe Gly Gly Gly 10 15 Gly Trp Gln Pro Pro Arg Ala Ile 2O US 6,261,537 B1 159 160

-continued SEQ ID NO: 9 LENGTH 6 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Biotinylated endothelin-1 peptide NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Biotin-D-Trp <400 SEQUENCE: 9 Trp Lieu. Asp Ile Ile Trp 1 5

SEQ ID NO : 10 LENGTH 10 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Biotinylated fibrin-anti-polymerant peptide NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Biotinylated-Gly NAME/KEY: MODRES LOCATION: (10) OTHER INFORMATION AMIDATION

<400 SEQUENCE: 10 Gly Pro Arg Pro Pro Glu Arg His Glin 1 5

Ser 10

SEQ ID NO : 11 LENGTH 5 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide containing RGD sequence and fluorescein reporter NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-Lys NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION: Acetyl-RGD-K-fluorescein side chain

<400 SEQUENCE: 11 Lys Lys Lys Lys Gly 1 5

SEQ ID NO: 12 LENGTH 18 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Endothelial cell binding lipopeptide NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: 2-n-hexadecyl stearyl-Lys NAME/KEY: MOD RES LOCATION: (18) OTHER INFORMATION AMIDATION

<400 SEQUENCE: 12 Lys Lieu Ala Lieu Lys Lieu Ala Lieu Lys 1 5 US 6,261,537 B1 161 162

-continued

Ala Lieu Lys Ala Ala Lieu Lys 10 15

Leu Ala

<210> SEQ ID NO: 13 <211& LENGTH 4 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide functionalised with captopril <221 NAME/KEY: MODRES <222> LOCATION: (1) <223> OTHER INFORMATION: Dipalmitoyl-Lys <221 NAME/KEY: MOD RES <222> LOCATION: (4) <223> OTHER INFORMATION: Amide linked via side chain to captopril <221 NAME/KEY: MODRES <222> LOCATION: (4) &223> OTHER INFORMATION AMIDATION

<400 SEQUENCE: 13 Lys Lys Lys Lys 1

SEQ ID NO: 14 LENGTH 13 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence:Lipopeptide with an affinity for endothelial cells NAME/KEY: MOD RES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-Lys NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION: Acp NAME/KEY: MODRES LOCATION: (13) OTHER INFORMATION AMIDATION

<400 SEQUENCE: 14 Lys Lys Lys Xala Ile Arg Arg Val Ala 1 5

Arg Pro Pro Leu 10

SEQ ID NO: 15 LENGTH 14 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide comprising an interleukin-1 receptor binding NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-Lys <400 SEQUENCE: 15 Lys Gly Asp Trp Asp Glin Phe Gly Lieu 1 5 Trp Arg Gly Ala Ala 10

SEQ ID NO: 16 LENGTH 12 TYPE PRT US 6,261,537 B1 163 164

-continued ORGANISM: Artificial Sequence FEATURE: NAME/KEY: MOD RES LOCATION: (1) OTHER INFORMATION: Dabsyl-Tyr NAME/KEY: MODRES LOCATION: (10) OTHER INFORMATION: RGDS chain linked via NH2 group of lysine OTHER INFORMATION: Description of Artificial Sequence: Branched core peptide comprising a dabsylated atherosclerotic

<400 SEQUENCE: 16 Tyr Arg Ala Lieu Val Asp Thr Lieu Lys 1 5 Lys Gly Cys 10

SEQ ID NO: 17 LENGTH 25 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide NAME/KEY: misc feature LOCATION: (1) OTHER INFORMATION: Biotinylated <400 SEQUENCE: 17 gaaagg tagt ggggtogtgt gcc.gg

SEQ ID NO: 18 LENGTH 15 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide with affinity for thrombi NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-Lys NAME/KEY: MODRES LOCATION: (15) OTHER INFORMATION AMIDATION

<400 SEQUENCE: 18 Lys Asn Asp Gly Asp Phe Glu Glu Ile 1 5 Pro Glu Glu Tyr Leu Glin 10 15

SEQ ID NO : 19 LENGTH 6 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-Lys NAME/KEY: MODRES LOCATION: (5) OTHER INFORMATION: Biotinylated-Lys

<400 SEQUENCE: 19 Lys Trp Llys Lys Lys Gly 1 5

SEQ ID NO: 20 US 6,261,537 B1 165 166

-continued

LENGTH 5 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Thiol-functionalised lipid molecule NAME/KEY: MOD RES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-Lys NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION: Acp

<400 SEQUENCE: 20 Lys Lys Lys Xala Cys 1 5

SEQ ID NO: 21 LENGTH 4 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide functionalised with atenolol NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-Lys NAME/KEY: MOD RES LOCATION: (4) OTHER INFORMATION: Lysine with side chain linked via amide bond to atenolol NAME/KEY: MOD RES LOCATION: (4) OTHER INFORMATION AMIDATION

SEQUENCE: 21 Lys Lys Lys Lys 1

SEQ ID NO: 22 LENGTH 4 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide containing folic acid NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-Lys NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION AMIDATION NAME/KEY: MOD RES LOCATION: (4) OTHER INFORMATION: Lysine with side chain linked via amide bond to folic acid

<400 SEQUENCE: 22 Lys Lys Lys Lys 1

SEQ ID NO: 23 LENGTH 4 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide containing a derivative of bestatin NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-Lys NAME/KEY: MODRES LOCATION: (4) US 6,261,537 B1 167 168

-continued

OTHER INFORMATION AMIDATION NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION: Lysine with side chain linked via amide bond to derivative of bestatin

<400 SEQUENCE: 23 Lys Lys Lys Lys 1

SEQ ID NO: 24 LENGTH 4 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide containing chlorambucil NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-Lys NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION AMIDATION NAME/KEY: MOD RES LOCATION: (4) OTHER INFORMATION: Lysine with side chain linked via amide bond to chlorambucil

<400 SEQUENCE: 24 Lys Lys Lys Lys 1

SEQ ID NO; 25 LENGTH 4 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Lipopeptide functionalised with sulfisoxazole NAME/KEY: MODRES LOCATION: (1) OTHER INFORMATION: Dipalmitoyl-Lys NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION AMIDATION NAME/KEY: MODRES LOCATION: (4) OTHER INFORMATION: Lysine with side chain linked via amide bond to sulfisoxazole

<400 SEQUENCE: 25 Lys Lys Lys Lys 1

SEQ ID NO: 26 LENGTH 9 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Atherosclerotic plaque-binding peptide

<400 SEQUENCE: 26 Tyr Arg Ala Lieu Val Asp Thr Lieu Lys 1 5

SEQ ID NO: 27 LENGTH 16 TYPE PRT ORGANISM: Artificial Sequence FEATURE: US 6,261,537 B1 169 170

-continued <223> OTHER INFORMATION: Description of Artificial Sequence: Atherosclerotic plaque-binding peptide <400 SEQUENCE: 27 Tyr Ala Lys Phe Arg Glu Thir Lieu Glu 1 5 Asp Thr Arg Asp Arg Met Tyr 10 15

<210> SEQ ID NO: 28 &2 11s LENGTH 17 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Atherosclerotic plaque-binding peptide <400 SEQUENCE: 28 Arg Ala Lieu Val Asp Thr Glu Phe Lys 1 5 Wall Lys Glin Glu Ala Gly Ala Lys 10 15

<210 SEQ ID NO : 29 <211& LENGTH: 14 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Thrombus binding peptide

<400 SEQUENCE: 29 Asn Asp Gly Asp Phe Glu Glu Ile Pro 1 5

Glu Glu Tyr Lieu Glin 10

<210 SEQ ID NO : 30 <211& LENGTH 4 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Thrombus binding peptide

<400 SEQUENCE: 30 Gly Pro Arg Gly 1

<210> SEQ ID NO : 31 &2 11s LENGTH 13 &212> TYPE PRT <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence : Platelet binding peptide

<400 SEQUENCE: 31 Pro Leu Tyr Lys Lys Ile Ile Lys Lys 1 5

Lieu. Leu Glu Ser 10 US 6,261,537 B1 171 172 What is claimed is: Sue factor inhibitor, platelet inhibitor, coagulation protein 1. A targetable ultrasound diagnostic active agent com target inhibitor, fibrin formation inhibitor, fibrinolysis prising a Suspension in an aqueous carrier liquid of a reporter promoter, antiangiogenic, circulatory drug, metabolic comprising gas-filled microbubbles Stabilised by monolay potentiator, antitubercular, antiviral, vasodilator, antibiotic, ers of film-forming surfactant material, at least 75% of said antiinflammatory, antiprotozoan, antirheumatic, narcotic, film-forming Surfactant material comprising phospholipid opiate, cardiac glycoside, neuromuscular blocker, Sedative, molecules bearing a net overall charge and Said film-forming local anaesthetic, general anaesthetic or genetic material. Surfactant material including a positively charged peptide 10. An agent as claimed in claim 8 wherein said thera linker element comprising two or more lysine residues and peutic compound is covalently coupled or linked to the wherein Said linker element is anchored through electroStatic reporter through disulphide groups. interaction with the reporter material, Said peptide linker 11. An agent as claimed in claim 8 wherein a lipophilic coupling to one or more vector molecules Selected from the therapeutic compound is linked to the Surfactant monolayers group consisting of angiogenesis-specific binding vectors, stabilizing the gas-filled microbubbles of the reporter atherosclerotic plaque-binding peptides and thrombus 15 through hydrophobic interactions. binding peptides. 12. An agent as claimed in claim 1 wherein the vector(s) 2. An agent as claimed in claim 1 wherein the gas is air, is one or more atherosclerotic plaque-binding peptides nitrogen, oxygen, carbon dioxide, hydrogen, an inert gas, a selected from the group consisting of YRALVDTLK, YAK Sulphur fluoride, Selenium hexafluoride, a low molecular FRETLEDTRDRMY and RALVDTEFKVKOEAGAK. weight hydrocarbon, a ketone, an ester, a halogenated low 13. An agent as claimed in claim 12 wherein the vector molecular weight hydrocarbon or a mixture of any of the molecule is an atherosclerotic plaque-binding peptide hav foregoing. ing the sequence YRALVDTLK. 3. An agent as claimed in claim 2 wherein the gas is a 14. An agent as claimed in claim 1 wherein the vector perfluorinated ketone, perfluorinated ether or perfluorocar 25 molecule is a thrombus-binding peptide. bon. 15. An agent as claimed in claim 1 wherein the 4. An agent as claimed in claim 2 wherein the gas is angiogenesis-specific binding vector is O-antiplasmin. Sulphur hexafluoride, perfluoropropane, perfluorobutane or 16. An agent as claimed in claim 1 wherein the vector perfluoropentane. molecule is an angiogenesis-specific binding vector. 5. An agent as claimed in claim 1 wherein the film 17. An agent as claimed in claim 16 wherein the vector forming Surfactant material is one or more phospholipids binds to an integrin. Selected from the group consisting of phosphatidylserines, 18. An agent as claimed in claim 17 wherein the vector is phosphatidylglycerols, phosphatidylinositols, phosphatidic an RGD-peptide. acids and cardiolipins. 35 19. An agent as claimed in claim 17 wherein the vector is 6. An agent as claimed in claim 5 wherein at least 80% of a non-peptide RGD analogue. Said phospholipids are phosphatidylserines. 20. An agent as claimed in claim 17 wherein the vector is 7. An agent as claimed in claim 1 which further contains Selected from the group consisting of Vectors binding to one moieties which are radioactive or are effective as X-ray or more of the following angiogenesis targets: integrins f, contrast agents, light imaging probes or Spin labels. 40 f3 and fis, Clfs, Cof 1, C-231, Cly?is, Co and Cls. 8. An agent as claimed in claim 1 further comprising a 21. An agent as claimed in claim 20 wherein the vector is therapeutic compound. a vector which binds to the integrin C.B. 9. An agent as claimed in claim 8 wherein Said therapeutic 22. An agent as claimed in claim 1 wherein the vector is compound is an antineoplastic agent, blood product, bio 45 a urokinase-type Vector. logical response modifier, antifungal agent, hormone or hormone analogue, Vitamin, enzyme, antiallergic agent, tis k k k k k