DOCSLIB.ORG

SLC45A3-ELK4 Is a Novel and Frequent ETS Fusion Transcript in Prostate Cancer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
SLC45A3-ELK4 Is a Novel and Frequent ETS Fusion Transcript in Prostate Cancer SUPPLEMENTAL INFORMATION SLC45A3-ELK4 is a Novel and Frequent ETS Fusion Transcript in Prostate Cancer David S. Rickman1, Dorothee Pflueger1, Benjamin Moss1, Vanessa E. VanDoren1, Chen X. Chen1, Alexandre de la Taille2,3, Rainer Kuefer4, Ashutosh K. Tewari5, Sunita R. Setlur6 Francesca Demichelis1,7 and Mark A. Rubin1 1Department of Pathology & Laboratory Medicine, Weill Cornell Medical Center, New York, NY 10065, USA. 2Department of Urology, CHU Mondor, Créteil, France 3INSERM, Unité 841, Créteil, France 4Department of Urology, University Hospital Ulm, Ulm, Germany 5Department of Urology, Weill Cornell Medical College, New York, NY 10065, USA 6Department of Pathology Brigham and Women’s Hospital, Boston, MA; Harvard Medical School, Boston, MA 02115, USA 7Institute for Computational Biomedicine, Weill Cornell Medical Center, New York, NY 10065, USA. Supplemental Materials and Methods Sample processing and RNA extraction. Hematoxylin and eosin (H&E) slides were evaluated for cancer extent and tumor grade (Gleason Score). Areas with high-density cancer foci (< 10% stromal and other non-tumor tissue contamination) were cored using a 1.5 mm dermatome from the corresponding frozen tissue block. RNA was isolated using TRIzol® Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. After purification, we measured the quality of RNA using the Bioanalyzer 2100 (Agilent Technologies Inc., Santa Clara, CA). RNA was then subjected to DNase treatment (Invitrogen) and quantified using a NanoDrop 8000 spectrophotometer (Thermo Scientific, Wilmington, DE). Cell lines were obtained from American Type Culture Collection (ATCC®, Manassas, VA). Cells were maintained according to the supplier’s instructions. Quantitative RT-PCR using Taqman technology. To quantify SLC45A3-ELK4 and endogenous ELK4 transcripts we employed custom designed (SLC45A3-ELK4: primers in SLC45A3 exon 1 and ELK4 exon 2, probe in ELK4 exon2) and inventoried (ELK4, Hs00360812_m1) TaqMan Gene Expression Assays using the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA) following the manufacturer’s RNA- to-CT™ 1-step protocol. Each target was run in triplicate and expression levels were normalized using TCFL1 as and calibrated to the median expression levels of benign samples. For the analyses on RNA extracted from urine raw values for SLC45A3-ELK were normalized to the control gene TCFL1 and then calibrated to 1 of the cases yielding negative cancer results on biopsy material. Conventional RT-PCR Sequencing. The qualitative detection of SLC45A3-ELK4 transcripts was performed using Platinum Taq DNA Polymerase kit (Invitrogen) and 50 ng of cDNA as template in a final volume of 25 ml. The PCR was run using a forward primer in SLC45A3 exon 1 (5-CCGCGGAGTAACCTGGAGATTT-3) and reverse primer in ELK4 exon 2 (5-TGCCCATCATTAGAGGTCCAACAG-3). DNA fragments corresponding to the expected sizes of fusion transcripts were sequenced at the Life Sciences Core Laboratories Center's DNA sequencing facility of Cornell University (Ithaca, NY). Chromosome 1q32, SLC45A3 to ELK4 region assessment. To assess the DNA copy number status of the of chromosome 1 region separating SLC45A3 and ELK4, we designed primers targeted against repeat-masked genomic DNA to be used in a quantitative PCR (Q-PCR) assay that target 13 100-200 bp segments between the last exon of SLC45A3 and the first exon of ELK4, see below for primer information). Quantitation was performed using Q-PCR by relative standard curve method. Primers targeting a copy number stable chromosomal region in ARHGEF (chr1:155205397- 155205600) were used for normalization (FWD: 5’ TCTCTGCTCCCTCACTCTCAA 3’, REV: 5’TGTGCCTCTTCCATCGTTCT3’). DNA from Hapmap sample NA12155 at 5 concentrations (0.5 ng – 50ng) was run for each of the 13 primer pairs to generate the standard curve per primer pair and per 384-well plate. All reactions were run in triplicates. Hormonal treatment of LNCaP. The prostate cancer cell line LNCaP was obtained from ATCC (Manassas, VA; cat.# CRL-1740) and maintained according to the suppliers instructions. For hormonal treatment, cells were plated (500,000 cells/10 cm2) in the presence of complete growth medium supplemented with 1% Penicillin/Streptomycin. Cells were starved for 48h in charcoal-stripped (CS) medium (RPMI-1640 1x, 5% CS- FBS, 1% Penicillin/Streptomycin) and then treated with R1881 (1nM) or vehicle for 3h, 12h and 24h. RNA was extracted using the TRIzol Reagent (Invitrogen, Carlsbad, CA), subjected to DNase treatment (DNA-freeTM Kit, Applied Biosystems) according to the manufacturers instructions and used in quantitative RT-PCR with ETV1 (Hs00951947_m1) as an androgen read-out gene, specific to this cell line. To test for the specificity of androgen-stimulation cells were treated with 10um Flutamide for 48 hours and then treated with R1881 as described above. Supplemental Figure Legends Supplemental Figure 1. Conventional PCR results. Using primers indicated in Figure 1C RT-PCR was performed on total RNA extracted from 35 prostate cancer samples, 6 benign samples, 6 prostate cancer cell lines (NCI-H660, VCaP, PC3, LNCaP, DU145, 22-RV1) and 1 benign cell line (RWPE-1). This gel representative bands from 13 prostate cancer samples (PCa) and NCI-H660, VCaP, PC3, LNCaP and RWPE-1 cells and 6 benign prostate tissue (below). While we demonstrated SLC45A3-ELK4 mRNA signal in all of these samples by Taqman (Figure 1) detectable bands were observed in 8 PCa samples, 1 cell line (LNCaP) and 1 benign sample (1024_C). Supplemental Figure 2. FISH SLC45A3 b/a assay. To assess for rearrangement of SLC45A3, we employed a break-apart (b/a) FISH assay as previously described(25). The centromeric and telomeric probes for SLC45A3 were RP11-249H15 and RP11-131E5, respectively. Correct chromosomal probe localization was confirmed on normal lymphocyte metaphase preparations. For each sample a minimum of 100 nuclei were analyzed. Sequence Information for the different SLC45A3-ELK4 mRNA variants (GeneBank accession numbers are pending). Variant 1: SLC45A3 (exon 1) -ELK4 (exon 2) AACCTGGAGATTTAAAAGCCGCCGGCTGGCGCGCGTGGGGGGCAAGGAAGGGGGGGCGGAACCAGCCTGCACGCGCT GGCTCCGGGTGACAGCCGCGCGCCTCGGCCAGCTCATTGCTATGGACAGTGCTATCACCCTGTGGCAGTTCCTTCTTCA GCTCCTGCAGAAGCCTCAGAACAAGCACATGATCTGTTGGACCTCTAATGATGGGCAGTTTAAGCTTTTGCAGGCAGAA GAGGTGGCTCGTCTCTGGGGGATTCGCAAGAACAAGCCTAACATGAATTATGACAAACTCAGCCGAGCCCTCAGATAC TATTATGTAAAG Variant 2: SLC45A3 (exon 1)-SLC45A3 (beginning of exon 2)-ELK4 (exon 2) AACCTGGAGATTTAAAAGCCGCCGGCTGGCGCGCGTGGGGGGCAAGGAAGGGGGGGCGGAACCAGCCTGCACGCGCT GGCTCCGGGTGACAGCCGCGCGCCTCGGCCAGGATCTGAGTGATGAGACGTGTCCCCACTGAGGTGCCCCACAGCAGC AGGTGTTGAGCATGGGCTGAGAAGCTGGACCGGCACCAAAGGGCTGGCAGAAATGGGCGCCTGGCTGATTCCTAGGCA GTTGGCGGCAGCAAGGAGGAGAGGCCGCAGCTTCTGGAGCAGAGCCGAGACGAAGCAGTTCTGGAGTGCCTGAACGG CCCCCTGAGCCCTACCCGCCTGGCCCACTATGGTCCAGAGGCTGTGGGTGAGCCGCCTGCTGCGGCACCGGAAAGCCC AGCTCTTGCTGGTCAACCTGCTAACCTTTGGCCTGGAGGTGTGTTTGGCCGCAGGCATCACCTATGTGCCGCCTCTGCTG CTGGAAGTGGGGGTAGAGGAGAAGTTCATGACCATGGTGCTGGCTCATTGCTATGGACAGTGCTATCACCCTGTGGCA GTTCCTTCTTCAGCTCCTGCAGAAGCCTCAGAACAAGCACATGATCTGTTGGACCTCTAATGATGGGCA Variant 3: SLC45A3 (exon 1)-SLC45A3 (beginning of exon 2)-SLC45A3 (end of exon 2)- ELK4 (exon 2) AACCTGGAGATTTAAAAGCCGCCGGCTGGCGCGCGTGGGGGGCAAGGAAGGGGGGGCGGAACCAGCCTGCACGCGCT GGCTCCGGGTGACAGCCGCGCGCCTCGGCCAGGATCTGAGTGATGAGACGTGTCCCCACTGAGGTGCCCCACAGCAGC TCTTGCTGGTCAACCTGCTAACCTTTGGCCTGGAGGTGTGTTTGGCCGCAGGCATCACCTATGTGCCGCCTCTGCTGCTG GAAGTGGGGGTAGAGGAGAAGTTCATGACCATGGTGCTGGCTCATTGCTATGGACAGTGCTATCACCCTGTGGCAGTTC CTTCTTCAGCTCCTGCAGAAGCCTCAGAACAAGCACATGATCTGTTGGACCTCTAATGATGGGCA Variant 4: SLC45A3 (exon 1)-SLC45A3 (beginning of exon 2)-SLC45A3 (end of exon 4)- intergenic sequence between SLC45A3 and ELK4-ELK4 (exon 2) AACCTGGAGATTTAAAAGCCGCCGGCTGGCGCGCGTGGGGGGCAAGGAAGGGGGGGCGGAACCAGCCTGCACGCGCT GGCTCCGGGTGACAGCCGCGCGCCTCGGCCAGGATCTGAGTGATGAGACGTGTCCCCACTGAGGTGCCCCTACACACT GGCCTCCCTCTACCACCGGGAGAAGCAGTGGAGGACTTTTGACCCGTCTCCTCACCTTCTGATACACACCAACCAACCAGTCAAC CAGCCATTGCTGTTTACTGGATACCTGCTCATTGCTATGGACAGTGCTATCACCCTGTGGCAGTTCCTTCTTCAGCTCCTGCA GAAGCCTCAGAACAAGCACATGATCTGTTGGACCTCTAATGATGGGCA Variant 5: SLC45A3 (end of exon 3)-SLC45A3 (exon 4)-intergenic sequence between SLC45A3 and ELK4-ELK4 (exon 2) from 5’ RACE. TGGGCCCCACCGAGCCAGCAGAAGGGCTGTCGGCCCCCTCCTTGTCGCCCCACTGCTGTCCATGCCGGGCCCGCTTGGC TTTCCGGAACCTGGGCGCCCTGCTTCCCCGGCTGCACCAGCTGTGCTGCCGCATGCCCCGCACCCTGCGCCGGCTCTTC GTGGCTGAGCTGTGCAGCTGGATGGCACTCATGACCTTCACGCTGTTTTACACGGATTTCGTGGGCGAGGGGCTGTACC AGGGCGTGCCCAGAGCTGAGCCGGGCACCGAGGCCCGGAGACACTATGATGAAGGCGTTCGGATGGGCAGCCTGGGG CTGTTCCTGCAGTGCGCCATCTCCCTGGTCTTCTCTCTGGTCATGGACCGGCTGGTGCAGCGATTCGGCACTCGAGCAGT CTATTTGGCCAGTGTGGCAGCTTTCCCTGTGGCTGCCGGTGCCACATGCCTGTCCCACAGTGTGGCCGTGGTGACAGCTT CAGCCGCCCTCACCGGGTTCACCTTCTCAGCCCTGCAGATCCTGCCCTACACACTGGCCTCCCTCTACCACCGGGAGAA GCAGTGGAGGACTTTTGACCCGTCTCCTCACCTTCTGATACACACCAACCAACCAGTCAACCAGCCATTGCTGTTTACT GGATACCTGCTCATTGCTATGGACAGTGCTATCACCCTGTGGCAGTTCCTTCTTCAGCTCCTGCAGAAGCCTCAGAACA AGCACATGATCTGTTGGACCTCTAATGATGGGCAGTTTAAGCTTTTGCAGGCAGAAGAGGTGG Primer Information for the quantitative PCR assay for chr1q32.1 Amplicon Amplicon Tm # Location Length Primers Primer (5'-3) Value GC % 1 chr1:203872537 234bp Forward GTCCACGACTTCCAGCATTT 60.1 50.0 203872770 Reverse TCAAACTCCACCCTTTCCAG 60.1 50.0 5 chr1:203876382 236bp Forward CAACAAGACATTTTCAGTTAAGGGT 59.9 36.0 203876617 Reverse GGCAAAACAAACAGGTATGCTATAA 60.6 36.0 6 chr1:203876970 237bp Forward ACAGCTTTCCTTGCTCTCCA 60.1 50.0 203877206 Reverse TGGCATCTGAAGAGGTTGAA 59.4 45.0 8 chr1:203878442 217bp Forward ATTCCATCCTCAGCTAACAGGTAA 60.4 41.7
Load more

Recommended publications
  • Detection of Interacting Transcription Factors in Human Tissues Using
    Myšičková and Vingron BMC Genomics 2012, 13(Suppl 1):S2 http://www.biomedcentral.com/1471-2164/13/S1/S2 PROCEEDINGS Open Access Detection of interacting transcription factors in human tissues using predicted DNA binding affinity Alena Myšičková*, Martin Vingron From The Tenth Asia Pacific Bioinformatics Conference (APBC 2012) Melbourne, Australia. 17-19 January 2012 Abstract Background: Tissue-specific gene expression is generally regulated by combinatorial interactions among transcription factors (TFs) which bind to the DNA. Despite this known fact, previous discoveries of the mechanism that controls gene expression usually consider only a single TF. Results: We provide a prediction of interacting TFs in 22 human tissues based on their DNA-binding affinity in promoter regions. We analyze all possible pairs of 130 vertebrate TFs from the JASPAR database. First, all human promoter regions are scanned for single TF-DNA binding affinities with TRAP and for each TF a ranked list of all promoters ordered by the binding affinity is created. We then study the similarity of the ranked lists and detect candidates for TF-TF interaction by applying a partial independence test for multiway contingency tables. Our candidates are validated by both known protein-protein interactions (PPIs) and known gene regulation mechanisms in the selected tissue. We find that the known PPIs are significantly enriched in the groups of our predicted TF-TF interactions (2 and 7 times more common than expected by chance). In addition, the predicted interacting TFs for studied tissues (liver, muscle, hematopoietic stem cell) are supported in literature to be active regulators or to be expressed in the corresponding tissue.
    [Show full text]
  • Identifying and Mapping Cell-Type-Specific Chromatin PNAS PLUS Programming of Gene Expression
    Identifying and mapping cell-type-specific chromatin PNAS PLUS programming of gene expression Troels T. Marstranda and John D. Storeya,b,1 aLewis-Sigler Institute for Integrative Genomics, and bDepartment of Molecular Biology, Princeton University, Princeton, NJ 08544 Edited by Wing Hung Wong, Stanford University, Stanford, CA, and approved January 2, 2014 (received for review July 2, 2013) A problem of substantial interest is to systematically map variation Relating DHS to gene-expression levels across multiple cell in chromatin structure to gene-expression regulation across con- types is challenging because the DHS represents a continuous ditions, environments, or differentiated cell types. We developed variable along the genome not bound to any specific region, and and applied a quantitative framework for determining the exis- the relationship between DHS and gene expression is largely tence, strength, and type of relationship between high-resolution uncharacterized. To exploit variation across cell types and test chromatin structure in terms of DNaseI hypersensitivity and genome- for cell-type-specific relationships between DHS and gene expres- wide gene-expression levels in 20 diverse human cell types. We sion, the measurement units must be placed on a common scale, show that ∼25% of genes show cell-type-specific expression ex- the continuous DHS measure associated to each gene in a well- plained by alterations in chromatin structure. We find that distal defined manner, and all measurements considered simultaneously. regions of chromatin structure (e.g., ±200 kb) capture more genes Moreover, the chromatin and gene-expression relationship may with this relationship than local regions (e.g., ±2.5 kb), yet the local only manifest in a single cell type, making standard measures of regions show a more pronounced effect.
    [Show full text]
  • REST Mediates Androgen Receptor Actions on Gene Repression And
    Published online 24 October 2013 Nucleic Acids Research, 2014, Vol. 42, No. 2 999–1015 doi:10.1093/nar/gkt921 REST mediates androgen receptor actions on gene repression and predicts early recurrence of prostate cancer Charlotte Svensson1, Jens Ceder2, Diego Iglesias-Gato1, Yin-Choy Chuan1, See Tong Pang3, Anders Bjartell2, Roxana Merino Martinez4, Laura Bott5, Leszek Helczynski6, David Ulmert2,7, Yuzhuo Wang8, Yuanjie Niu9, Colin Collins8 and Amilcar Flores-Morales1,* 1Novo Nordisk Foundation Center for Protein Research, Faculty of Health Sciences, University of Copenhagen, Downloaded from DK-2200 Copenhagen, Denmark, 2Division of Urological Cancers, Department of Clinical Sciences, Ska˚ ne University Hospital, Lund University, 20502 Malmo¨ , Sweden, 3Department of Urology, Chang Gung Memorial Hospital, Tao-Yuan 33305, Taiwan, R.O.C., 4Department of Epidemiology, Karolinska Institutet, 171 77 Stockholm, Sweden, 5Department of Cell and Molecular Biology, Karolinska Institute, 171 77 Stockholm, Sweden, 6Regional Laboratories Region Ska˚ ne, Clinical Pathology, 205 80 Malmo¨ , Sweden, 7Department of Surgery (Urology), Memorial Sloan-Kettering Cancer Center, New York, NY 100 65, USA, 8Vancouver Prostate http://nar.oxfordjournals.org/ Centre and The Department of Urologic Sciences, University of British Columbia, Vancouver, BC Canada V6H 3Z6 and 9Tianjin Institute of Urology, Tianjin Medical University, Tianjin 300 211, China Received December 19, 2012; Accepted September 20, 2013 ABSTRACT that has previously been implicated in the growth at University of British Columbia on August 12, 2014 The androgen receptor (AR) is a key regulator of NE-like castration-resistant tumors. The of prostate tumorgenesis through actions that are analysis of prostate cancer tissue microarrays not fully understood. We identified the repressor revealed that tumors with reduced expression of element (RE)-1 silencing transcription factor REST have higher probability of early recurrence, (REST) as a mediator of AR actions on gene repres- independently of their Gleason score.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Elucidation of the ELK1 Target Gene Network Reveals a Role in the Coordinate Regulation of Core Components of the Gene Regulation Machinery
    Downloaded from genome.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press Letter Elucidation of the ELK1 target gene network reveals a role in the coordinate regulation of core components of the gene regulation machinery Joanna Boros,1,5 Ian J. Donaldson,1,5 Amanda O’Donnell,1 Zaneta A. Odrowaz,1 Leo Zeef,1 Mathieu Lupien,2,4 Clifford A. Meyer,3 X. Shirley Liu,3 Myles Brown,2 and Andrew D. Sharrocks1,6 1Faculty of Life Sciences, University of Manchester, Manchester M13 9PT, United Kingdom; 2Division of Molecular and Cellular Oncology, Department of Medical Oncology, Dana-Farber Cancer Institute and Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, Massachusetts 02115, USA; 3Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute and Harvard School of Public Health, Boston, Massachusetts 02115, USA Transcription factors play an important role in orchestrating the activation of specific networks of genes through targeting their proximal promoter and distal enhancer regions. However, it is unclear how the specificity of downstream responses is maintained by individual members of transcription-factor families and, in most cases, what their target repertoire is. We have used ChIP-chip analysis to identify the target genes of the ETS-domain transcription factor ELK1. Two distinct modes of ELK1 target gene selection are identified; the first involves redundant promoter binding with other ETS-domain family members; the second occurs through combinatorial binding with a second transcription factor SRF, which specifies a unique group of target genes. One of the most prominent groups of genes forming the ELK1 target network includes classes involved in core gene expression control, namely, components of the basal transcriptional machinery, the spliceosome and the ribosome.
    [Show full text]
  • SLC45A3-ELK4 Is a Novel and Frequent Erythroblast Transformation–Specific Fusion Transcript in Prostate Cancer
    Published OnlineFirst March 17, 2009; DOI: 10.1158/0008-5472.CAN-08-4926 Priority Report SLC45A3-ELK4 Is a Novel and Frequent Erythroblast Transformation–Specific Fusion Transcript in Prostate Cancer David S. Rickman,1 Dorothee Pflueger,1 Benjamin Moss,1 Vanessa E. VanDoren,1 Chen X. Chen,1 Alexandre de la Taille,4,5 Rainer Kuefer,6 Ashutosh K. Tewari,2 Sunita R. Setlur,7 Francesca Demichelis,1,3 and Mark A. Rubin1 Departments of 1Pathology and Laboratory Medicine and 2Urology, and 3Institute for Computational Biomedicine, Weill Cornell Medical College, New York, New York; 4Department of Urology, CHU Mondor and 5Institut National de la Sante et de la Recherche Medicale, Unite´841, Cre´teil,France; 6Department of Urology, University Hospital Ulm, Ulm, Germany; and 7Department of Pathology, Brigham and Women’s Hospital and Harvard Medical School, Boston, Massachusetts Abstract (2, 3), and a specific expression profile (4, 5). Androgen-regulated ¶ Chromosomal rearrangements account for all erythroblast genes account for the majority of the 5 genomic regulatory transformation–specific (ETS) family member gene fusions promoters elements fused with ETS genes in prostate cancer (6). The promoter of the androgen-regulated transmembrane protease, that have been reported in prostate cancer and have clinical, serine 2 TMPRSS2 diagnostic, and prognostic implications. Androgen-regulated ( ) gene is fused to the coding region of members genes account for the majority of the 5¶ genomic regulatory of the ETS family of transcription factors, most commonly v-ets TMPRSS2-ERG, erythroblastosis virus E26 oncogene homologue (avian; ERG; ref. 7). promoter elements fused with ETS genes. Solute carrier family 45, member 3 SLC45A3 TMPRSS2-ETV1, and SLC45A3-ERG rearrangements account ( ), also referred to as for roughly 90% of ETS fusion prostate cancer.
    [Show full text]
  • Pharmacodynamic Effects of Seliciclib, an Orally Administered
    Cancer Therapy: Clinical Pharmacodynamic Effects of Seliciclib, an Orally Administered Cell Cycle Modulator, in Undifferentiated Nasopharyngeal Cancer Wen-Son Hsieh,4 Ross Soo,1Bee-Keow Peh,2 Thomas Loh,4 Difeng Dong,3 Donny Soh,5 Lim-SoonWong,3,5 Simon Green,6 Judy Chiao,6 Chun-Ying Cui,1Yo k e -F o n g L a i , 4 Soo-Chin Lee,1Benjamin Mow,1 Richie Soong,2 Manuel Salto-Tellez,2 and Boon-Cher Goh1, 2 Abstract Purpose: Cell cycle dysregulation resulting in expression of antiapoptotic genes and uncontrolled proliferation is a feature of undifferentiated nasopharyngeal carcinoma. The pharmacodynamic effects of seliciclib, a cyclin-dependent kinase (CDK) inhibitor, were studied in patients with nasopharyngeal carcinoma. Experimental Design: Patients with treatment-naI«ve locally advanced nasopharyngeal carci- noma received seliciclib at 800 mg or 400 mg twice daily on days1 to 3 and 8 to12.Paired tumor samples obtained at baseline and on day 13 were assessed by light microscopy, immunohisto- chemistry, and transcriptionalprofiling using real-time PCR low-density array consisting of apanel of 380 genes related to cell cycle inhibition, apoptosis, signal transduction, and cell proliferation. Results: At 800 mg bd, one patient experienced grade 3 liver toxicity and another had grade 2 vomiting; no significant toxicities were experienced in 13 patients treated at 400 mg bd. Seven of fourteen evaluable patients had clinical evidence of tumor reduction. Some of these responses were associated with increased tumor apoptosis, necrosis, and decreases in plasma EBV DNA posttreatment. Reduced protein expression of Mcl-1, cyclin D1, phosphorylated retinoblastoma protein pRB (T821), and significant transcriptional down-regulation of genes related to cellular proliferation and survival were shown in some patients posttreatment, indicative of cell cycle modulation by seliciclib, more specifically inhibition of cdk2/cyclin E, cdk7/cyclin H, and cdk9/cyclinT.
    [Show full text]
  • MOCHI Enables Discovery of Heterogeneous Interactome Modules in 3D Nucleome
    Downloaded from genome.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press MOCHI enables discovery of heterogeneous interactome modules in 3D nucleome Dechao Tian1,# , Ruochi Zhang1,# , Yang Zhang1, Xiaopeng Zhu1, and Jian Ma1,* 1Computational Biology Department, School of Computer Science, Carnegie Mellon University, Pittsburgh, PA 15213, USA #These two authors contributed equally *Correspondence: [email protected] Contact To whom correspondence should be addressed: Jian Ma School of Computer Science Carnegie Mellon University 7705 Gates-Hillman Complex 5000 Forbes Avenue Pittsburgh, PA 15213 Phone: +1 (412) 268-2776 Email: [email protected] 1 Downloaded from genome.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract The composition of the cell nucleus is highly heterogeneous, with different constituents forming complex interactomes. However, the global patterns of these interwoven heterogeneous interactomes remain poorly understood. Here we focus on two different interactomes, chromatin interaction network and gene regulatory network, as a proof-of-principle, to identify heterogeneous interactome modules (HIMs), each of which represents a cluster of gene loci that are in spatial contact more frequently than expected and that are regulated by the same group of transcription factors. HIM integrates transcription factor binding and 3D genome structure to reflect “transcriptional niche” in the nucleus. We develop a new algorithm MOCHI to facilitate the discovery of HIMs based on network motif clustering in heterogeneous interactomes. By applying MOCHI to five different cell types, we found that HIMs have strong spatial preference within the nucleus and exhibit distinct functional properties. Through integrative analysis, this work demonstrates the utility of MOCHI to identify HIMs, which may provide new perspectives on the interplay between transcriptional regulation and 3D genome organization.
    [Show full text]
  • The Tumor Suppressor HHEX Inhibits Axon Growth When Prematurely Expressed in Developing Central Nervous System Neurons
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by epublications@Marquette Marquette University e-Publications@Marquette Biological Sciences Faculty Research and Biological Sciences, Department of Publications 9-1-2015 The umorT Suppressor HHEX Inhibits Axon Growth when Prematurely Expressed in Developing Central Nervous System Neurons Matthew .T Simpson Marquette University Ishwariya Venkatesh Marquette University Ben L. Callif Marquette University Laura K. Thiel Marquette University Denise M. Coley Marquette University See next page for additional authors Accepted version. Molecular and Cellular Neuroscience, Vol 68 )September 2015): 272-283. DOI. © 2015 Elsevier Inc. Used with permission. NOTICE: this is the author’s version of a work that was accepted for publication in Molecular and Cellular Neuroscience. Changes resulting from the publishing process, such as peer review, editing, corrections, structural formatting, and other quality control mechanisms may not be reflected in this document. Changes may have been made to this work since it was submitted for publication. A definitive version was subsequently published in Molecular and Cellular Neuroscience, Vol 68 )September 2015): 272-283. DOI. Authors Matthew T. Simpson, Ishwariya Venkatesh, Ben L. Callif, Laura K. Thiel, Denise M. Coley, Kristen N. Winsor, Zimei Wang, Audra A. Kramer, Jessica K. Lerch, and Murray G. Blackmore This article is available at e-Publications@Marquette: https://epublications.marquette.edu/bio_fac/515 NOT THE PUBLISHED VERSION; this is the author’s final, peer-reviewed manuscript. The published version may be accessed by following the link in the citation at the bottom of the page. The Tumor Suppressor HHEX Inhibits Axon Growth When Prematurely Expressed in Developing Central Nervous System Neurons Matthew T.
    [Show full text]
  • Supplement. Transcriptional Factors (TF), Protein Name and Their Description Or Function
    Supplement. Transcriptional factors (TF), protein name and their description or function. TF Protein name TF description/function ARID3A AT rich interactive domain 3A (BRIGHT-like) This gene encodes a member of the ARID (AT-rich interaction domain) family of DNA binding proteins. ATF4 Activating Transcription Factor 4 Transcriptional activator. Binds the cAMP response element (CRE) (consensus: 5-GTGACGT[AC][AG]-3), a sequence present in many viral and cellular promoters. CTCF CCCTC-Binding Factor Chromatin binding factor that binds to DNA sequence specific sites. Involved in transcriptional regulation by binding to chromatin insulators and preventing interaction between promoter and nearby enhancers and silencers. The protein can bind a histone acetyltransferase (HAT)-containing complex and function as a transcriptional activator or bind a histone deacetylase (HDAC)-containing complex and function as a transcriptional repressor. E2F1-6 E2F transcription factors 1-6 The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. EBF1 Transcription factor COE1 EBF1 has been shown to interact with ZNF423 and CREB binding proteins.
    [Show full text]
  • ERK Signaling Controls Innate-Like CD8+ T Cell Differentiation Via the ELK4 (SAP-1) and ELK1 Transcription Factors
    ERK Signaling Controls Innate-like CD8+ T Cell Differentiation via the ELK4 (SAP-1) and ELK1 Transcription Factors This information is current as Diane Maurice, Patrick Costello, Mathew Sargent and of October 2, 2021. Richard Treisman J Immunol 2018; 201:1681-1691; Prepublished online 1 August 2018; doi: 10.4049/jimmunol.1800704 http://www.jimmunol.org/content/201/6/1681 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2018/07/31/jimmunol.180070 Material 4.DCSupplemental http://www.jimmunol.org/ References This article cites 39 articles, 17 of which you can access for free at: http://www.jimmunol.org/content/201/6/1681.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 2, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Author Choice Freely available online through The Journal of Immunology Author Choice option Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2018 The Authors All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology ERK Signaling Controls Innate-like CD8+ T Cell Differentiation via the ELK4 (SAP-1) and ELK1 Transcription Factors Diane Maurice, Patrick Costello, Mathew Sargent, and Richard Treisman In mouse thymocyte development, signaling by the TCR through the ERK pathway is required for positive selection of conventional naive T cells.
    [Show full text]
  • Molecular Genetic Characterization of Retinoblastoma Tumors Lacking Rb1 Mutations
    MOLECULAR GENETIC CHARACTERIZATION OF RETINOBLASTOMA TUMORS LACKING RB1 MUTATIONS by Jennifer Yvonne Kennett B.Sc., Simon Fraser University, 2005 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in The Faculty Of Graduate Studies (Pathology and Laboratory Medicine) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) December 2012 © Jennifer Yvonne Kennett, 2012 Abstract Retinoblastoma is a rare childhood cancer of the retina and is the most common intraocular tumor in children. Classically, retinoblastoma results from biallelic loss of the RB1 tumor suppressor gene. As with other cancer types, dysregulation of a single gene alone is not considered sufficient for complete transformation to malignancy. Frequent regions of genetic alteration harbouring additional genes, implicated in retinoblastoma oncogenesis and progression, include chromosomes 1q, 2p, 6p, 13q and 16q. Sensitive molecular genetic screening techniques are capable of identifying RB1 mutations in 98% of unilateral retinoblastoma tumors. The remaining 2% harbour no identifiable RB1 inactivating alterations, and therefore molecular interrogation of these cases would likely reveal alternative genetic events driving retinoblastoma tumorigenesis in the absence of RB1 inactivation. Towards this objective, in this thesis work, I describe genetic alterations identified by tiling path array comparative genomic hybridization in a rare sample set composed of 23 RB1+/+ tumors. In addition to gene disruption by copy number alteration, mechanisms of gene disruption resulting in no overall change in copy number or change in copy number with allelic imbalance were also investigated utilizing genome-wide SNP array analysis on five of the RB1+/+ tumors. The most striking recurrent genetic alteration identified in retinoblastoma tumors lacking RB1 inactivating mutations, was focal high-level MYCN amplification, which occurred at a frequency of approximately 48%.
    [Show full text]