Identification of Tumor-Associated Cassette Exons in Human Cancer
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Tepzz¥ 6Z54za T
(19) TZZ¥ ZZ_T (11) EP 3 260 540 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 27.12.2017 Bulletin 2017/52 C12N 15/113 (2010.01) A61K 9/127 (2006.01) A61K 31/713 (2006.01) C12Q 1/68 (2006.01) (21) Application number: 17000579.7 (22) Date of filing: 12.11.2011 (84) Designated Contracting States: • Sarma, Kavitha AL AT BE BG CH CY CZ DE DK EE ES FI FR GB Philadelphia, PA 19146 (US) GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO • Borowsky, Mark PL PT RO RS SE SI SK SM TR Needham, MA 02494 (US) • Ohsumi, Toshiro Kendrick (30) Priority: 12.11.2010 US 412862 P Cambridge, MA 02141 (US) 20.12.2010 US 201061425174 P 28.07.2011 US 201161512754 P (74) Representative: Clegg, Richard Ian et al Mewburn Ellis LLP (62) Document number(s) of the earlier application(s) in City Tower accordance with Art. 76 EPC: 40 Basinghall Street 11840099.3 / 2 638 163 London EC2V 5DE (GB) (71) Applicant: The General Hospital Corporation Remarks: Boston, MA 02114 (US) •Thecomplete document including Reference Tables and the Sequence Listing can be downloaded from (72) Inventors: the EPO website • Lee, Jeannie T •This application was filed on 05-04-2017 as a Boston, MA 02114 (US) divisional application to the application mentioned • Zhao, Jing under INID code 62. San Diego, CA 92122 (US) •Claims filed after the date of receipt of the divisional application (Rule 68(4) EPC). (54) POLYCOMB-ASSOCIATED NON-CODING RNAS (57) This invention relates to long non-coding RNAs (IncRNAs), libraries of those ncRNAs that bind chromatin modifiers, such as Polycomb Repressive Complex 2, inhibitory nucleic acids and methods and compositions for targeting IncRNAs. -
Tpd52l2 (NM 025482) Mouse Tagged ORF Clone – MR202509
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR202509 Tpd52l2 (NM_025482) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Tpd52l2 (NM_025482) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Tpd52l2 Synonyms: 2810411G23Rik; AU016537; C86069; D54 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MR202509 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACTCTGCTAGCCAAGATATCAACCTGAATTCTCCTAACAAAGGTGTGCTGTCTGACTTTATGACTG ACGTCCCTGTTGACCCAGGTGTGGTCCACCGGACTCCAGTTGTAGAAGGCCTGACAGAGGGGGAGGAAGA AGAGCTTCGGGCTGAGCTTGCTAAGGTGGAAGAAGAAATTGTCACTCTGCGCCAGGTGCTGGCAGCCAAA GAGAGGCACTGTGGAGAGCTGAAAAGGAGGCTGGGCCTCTCCACATTAGGGGAGCTGAAGCAGAACCTGT CTAGGAGCTGGCATGATGTGCAGGTCTCTACTGCCTATGTGAAAACGTCTGAGAAACTTGGAGAGTGGAA TGAGAAAGTGACGCAGTCTGACCTCTACAAGAAGACTCAAGAAACTCTTTCACAGGCTGGACAGAAAACA TCAGCTGCCCTGTCCACCATGGGCTCTGCCATCAGCAGGAAGCTTGGAGACATGAGCAGCTACTCCATCC GCCACTCGATAAGTATGCCTGTCATGAGGAACTCAGCCACCTTCAAGTCATTTGAAGACCGAGTGGGGAC CATAAAGTCTAAGGTTGTGGGTGGCAGAGAGAATGGCAGCGATAACCTCCCTCCCTCTCCTGGAAGTGGT GACCAGACATTGCCGGATCATGCGCCTTTC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA This product is to be used for laboratory only. Not for diagnostic or therapeutic use. -
Supplementary Materials
Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine -
(12) Patent Application Publication (10) Pub. No.: US 2009/0297536A1 Chin Et Al
US 20090297536A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2009/0297536A1 Chin et al. (43) Pub. Date: Dec. 3, 2009 (54) COMPOSITIONS, KITS, AND METHODS FOR Related U.S. Application Data IDENTIFICATION, ASSESSMENT, (60) Provisional application No. 60/575,795, filed on May PREVENTION AND THERAPY OF CANCER 28, 2004, provisional application No. 60/580,337, filed on Jun. 15, 2004. (75) Inventors: Lynda Chin, Brookline, MA (US); Publication Classification Cameron W. Brennan, New York, NY (US); Ronald A. DePinho, (51) Int. Cl. Brookline, MA (US); Andrew J. A 6LX 39/395 (2006.01) Aguirre, Boston, MA (US) CI2O I/68 (2006.01) C40B 30/00 (2006.01) AOIK 67/00 (2006.01) Correspondence Address: A 6LX 3L/7052 (2006.01) FOLEY HOAG, LLP A638/02 (2006.01) PATENT GROUP, WORLD TRADE CENTER A638/16 (2006.01) WEST C07K I4/00 (2006.01) 155 SEAPORT BLVD C7H 2L/00 (2006.01) BOSTON, MA 02110 (US) C07K 6/00 (2006.01) A6IP35/00 (2006.01) (73) Assignee: Dana-Farber Cancer Institute, (52) U.S. Cl. ................ 424/172.1; 435/6:506/7; 800/10: Inc., Boston, MA (US) 424/183.1; 424/178.1: 514/44 A: 514/2: 514/12: 530/350:536/23.1; 530/389.1 (21) Appl. No.: 11/597,825 (57) ABSTRACT The invention relates to compositions, kits, and methods for (22) PCT Filed: May 27, 2005 detecting, characterizing, preventing, and treating human cancer. A variety of chromosomal regions (MCRs) and mark (86). PCT No.: PCT/US05/18850 ers corresponding thereto, are provided, wherein alterations in the copy number of one or more of the MCRs and/or S371 (c)(1), alterations in the amount, structure, and/or activity of one or (2), (4) Date: Jun. -
Molecular Analyses of Malignant Pleural Mesothelioma
Molecular Analyses of Malignant Pleural Mesothelioma Shir Kiong Lo National Heart and Lung Institute Imperial College Dovehouse Street London SW3 6LY A thesis submitted for MD (Res) Faculty of Medicine, Imperial College London 2016 1 Abstract Malignant pleural mesothelioma (MPM) is an aggressive cancer that is strongly associated with asbestos exposure. Majority of patients with MPM present with advanced disease and the treatment paradigm mainly involves palliative chemotherapy and best supportive care. The current chemotherapy options are limited and ineffective hence there is an urgent need to improve patient outcomes. This requires better understanding of the genetic alterations driving MPM to improve diagnostic, prognostic and therapeutic strategies. This research aims to gain further insights in the pathogenesis of MPM by exploring the tumour transcriptional and mutational profiles. We compared gene expression profiles of 25 MPM tumours and 5 non-malignant pleura. This revealed differentially expressed genes involved in cell migration, invasion, cell cycle and the immune system that contribute to the malignant phenotype of MPM. We then constructed MPM-associated co-expression networks using weighted gene correlation network analysis to identify clusters of highly correlated genes. These identified three distinct molecular subtypes of MPM associated with genes involved in WNT and TGF-ß signalling pathways. Our results also revealed genes involved in cell cycle control especially the mitotic phase correlated significantly with poor prognosis. Through exome analysis of seven paired tumour/blood and 29 tumour samples, we identified frequent mutations in BAP1 and NF2. Additionally, the mutational profile of MPM is enriched with genes encoding FAK, MAPK and WNT signalling pathways. -
The DNA Sequence and Comparative Analysis of Human Chromosome 20
articles The DNA sequence and comparative analysis of human chromosome 20 P. Deloukas, L. H. Matthews, J. Ashurst, J. Burton, J. G. R. Gilbert, M. Jones, G. Stavrides, J. P. Almeida, A. K. Babbage, C. L. Bagguley, J. Bailey, K. F. Barlow, K. N. Bates, L. M. Beard, D. M. Beare, O. P. Beasley, C. P. Bird, S. E. Blakey, A. M. Bridgeman, A. J. Brown, D. Buck, W. Burrill, A. P. Butler, C. Carder, N. P. Carter, J. C. Chapman, M. Clamp, G. Clark, L. N. Clark, S. Y. Clark, C. M. Clee, S. Clegg, V. E. Cobley, R. E. Collier, R. Connor, N. R. Corby, A. Coulson, G. J. Coville, R. Deadman, P. Dhami, M. Dunn, A. G. Ellington, J. A. Frankland, A. Fraser, L. French, P. Garner, D. V. Grafham, C. Grif®ths, M. N. D. Grif®ths, R. Gwilliam, R. E. Hall, S. Hammond, J. L. Harley, P. D. Heath, S. Ho, J. L. Holden, P. J. Howden, E. Huckle, A. R. Hunt, S. E. Hunt, K. Jekosch, C. M. Johnson, D. Johnson, M. P. Kay, A. M. Kimberley, A. King, A. Knights, G. K. Laird, S. Lawlor, M. H. Lehvaslaiho, M. Leversha, C. Lloyd, D. M. Lloyd, J. D. Lovell, V. L. Marsh, S. L. Martin, L. J. McConnachie, K. McLay, A. A. McMurray, S. Milne, D. Mistry, M. J. F. Moore, J. C. Mullikin, T. Nickerson, K. Oliver, A. Parker, R. Patel, T. A. V. Pearce, A. I. Peck, B. J. C. T. Phillimore, S. R. Prathalingam, R. W. Plumb, H. Ramsay, C. M. -
Genotype–Phenotype Correlations to Aid in the Prognosis Of
European Journal of Human Genetics (2007) 15, 446–452 & 2007 Nature Publishing Group All rights reserved 1018-4813/07 $30.00 www.nature.com/ejhg ARTICLE Genotype–phenotype correlations to aid in the prognosis of individuals with uncommon 20q13.33 subtelomere deletions: a collaborative study on behalf of the ‘association des Cytoge´ne´ticiens de langue Franc¸aise’ Myle`ne Be´ri-Deixheimer1, Marie-Jose´ Gregoire1, Annick Toutain2, Kare`ne Brochet1, Sylvain Briault2, Jean-Luc Schaff3, Bruno Leheup4 and Philippe Jonveaux*,1 1Laboratoire de Ge´ne´tique, EA 4002, CHU, Nancy-University, France; 2Service de Ge´ne´tique, Hoˆpital Bretonneau, Tours, France; 3Service de neurologie, CHU, Nancy-Univeristy, France; 4Service de me´decine infantile et ge´ne´tique clinique, CHU, Nancy-Univeristy, France The identification of subtelomeric rearrangements as a cause of mental retardation has made a considerable contribution to diagnosing patients with mental retardation. It is remarkable that for certain subtelomeric regions, deletions have hardly ever been reported so far. All the laboratories from the ‘Association des Cytoge´ne´ticiens de Langue Franc¸aise’ were surveyed for cases where an abnormality of the subtelomere FISH analysis had been ascertained. Among 1511 cases referred owing to unexplained mental retardation, 115 (7.6%) patients showed a clinically significant subtelomeric abnormality. We report the clinical features and the molecular cytogenetic delineation of isolated de novo deletions on 20q13.33 in two cases. Detailed mapping was performed by micro-array CGH in one patient and confirmed by FISH in the two patients. We compare our data with the only three patients reported in the literature. -
Linkage to 20P13 Including the ANGPT4 Gene in Families With
Journal of Human Genetics (2010) 55, 649–655 & 2010 The Japan Society of Human Genetics All rights reserved 1434-5161/10 $32.00 www.nature.com/jhg ORIGINAL ARTICLE Linkageto20p13includingtheANGPT4 gene in families with mixed Alzheimer’s disease and vascular dementia Anna Sille´n1, Jesper Brohede1, Lena Lilius1, Charlotte Forsell1, Jorge Andrade2,5, Jacob Odeberg2, Hayao Ebise3, Bengt Winblad1 and Caroline Graff1,4 This study aimed at identifying novel susceptibility genes for a mixed phenotype of Alzheimer’s disease and vascular dementia. Results from a genome scan showed strongest linkage to 20p13 in 18 families, and subsequent fine mapping was performed with both microsatellites and single-nucleotide polymorphisms in 18 selected candidate transcripts in an extended sample set of 30 families. The multipoint linkage peak was located at marker rs2144151 in the ANGPT4 gene, which is a strong candidate gene for vascular disease because of its involvement in angiogenesis. Although the significance of the linkage decreased, we find this result intriguing, considering that we included additional families, and thus the reduced linkage signal may be caused by genetic heterogeneity. Journal of Human Genetics (2010) 55, 649–655; doi:10.1038/jhg.2010.79; published online 1 July 2010 Keywords: Alzheimer’s disease; ANGPT4; association study; candidate genes; familial dementia; linkage analysis; SNP INTRODUCTION Previous genome-wide family-based linkage analyses have identified Alzheimer’s disease (AD; MIM104300) is the major cause of dementia several loci linked to AD9–19 and confirmed linkage by several in the elderly. Its main neuropathological signs are extracellular groups has been reported to chromosome (chr.) 9p, 9q, 10q, 12p depositions of amyloid b-protein and intracellular neurofibrillary and 19q.20–24 Extensive follow-up and fine mapping studies have been tangles composed of hyperphosphorylated tau. -
D Isease Models & Mechanisms DMM a Ccepted Manuscript
© 2014. Published by The Company of Biologists Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits unrestricted use, distribution and reproduction in any medium provided that the original work is properly attributed. 1 Full title: 2 Histopathology Reveals Correlative and Unique Phenotypes in a High Throughput Mouse Phenotyping 3 Screen 4 Short title: 5 Histopathology Adds Value to a High Throughput Mouse Phenotyping Screen 6 Authors: 1,2,4* 3 3 3 3 7 Hibret A. Adissu , Jeanne Estabel , David Sunter , Elizabeth Tuck , Yvette Hooks , Damian M 3 3 3 3 1,2,4 8 Carragher , Kay Clarke , Natasha A. Karp , Sanger Mouse Genetics Project , Susan Newbigging , 1 1,2 3‡ 1,2,4‡ 9 Nora Jones , Lily Morikawa , Jacqui K. White , Colin McKerlie 10 Affiliations: Accepted manuscript Accepted 1 11 Centre for Modeling Human Disease, Toronto Centre for Phenogenomics, 25 Orde Street, Toronto, 12 ON, Canada, M5T 3H7 DMM 2 13 Physiology & Experimental Medicine Research Program, The Hospital for Sick Children, 555 University 14 Avenue, Toronto, ON, Canada, M5G 1X8 3 15 Mouse Genetics Project, Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, 16 Cambridge, CB10 1SA, UK 4 17 Department of Laboratory Medicine & Pathobiology, Faculty of Medicine, University of Toronto, 18 Toronto, ON, Canada, M5S 1A8 19 *Correspondence to Hibret A. Adissu, Centre for Modeling Human Disease, Toronto Centre for Disease Models & Mechanisms 20 21 Phenogenomics, 25 Orde Street, Toronto, ON, Canada, M5T 3H7; [email protected] ‡ 22 Authors contributed equally 23 24 Keywords: 25 Histopathology, High Throughput Phenotyping, Mouse, Pathology 26 1 DMM Advance Online Articles. -
Transposable Element Polymorphisms and Human Genome Regulation
TRANSPOSABLE ELEMENT POLYMORPHISMS AND HUMAN GENOME REGULATION A Dissertation Presented to The Academic Faculty by Lu Wang In Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in Bioinformatics in the School of Biological Sciences Georgia Institute of Technology December 2017 COPYRIGHT © 2017 BY LU WANG TRANSPOSABLE ELEMENT POLYMORPHISMS AND HUMAN GENOME REGULATION Approved by: Dr. I. King Jordan, Advisor Dr. John F. McDonald School of Biological Sciences School of Biological Sciences Georgia Institute of Technology Georgia Institute of Technology Dr. Fredrik O. Vannberg Dr. Victoria V. Lunyak School of Biological Sciences Aelan Cell Technologies Georgia Institute of Technology San Francisco, CA Dr. Greg G. Gibson School of Biological Sciences Georgia Institute of Technology Date Approved: November 6, 2017 To my family and friends ACKNOWLEDGEMENTS I am truly grateful to my advisor Dr. I. King Jordan for his guidance and support throughout my time working with him as a graduate student. I am fortunate enough to have him as my mentor, starting from very basic, well-defined research tasks, and guided me step-by-step into the exciting world of scientific research. Throughout my PhD training, I have been always impressed by his ability to explain complex ideas – sometimes brilliant ideas of his own – in short and succinct sentences in such a way that his students could easily understand. I am also very impressed and inspired by his diligence and passion for his work. It is my great honor to have Dr. Greg Gibson, Dr. Victoria Lunyak, Dr. John McDonald, Dr. Fredrik Vannberg as my committee members. I really appreciate the guidance they provided me throughout my PhD study and the insightful thoughts they generously share with me during our discussions. -
Striking Similarities Between Publications from China Describing Single Gene Knockdown Experiments in Human Cancer Cell Lines
Scientometrics DOI 10.1007/s11192-016-2209-6 Striking similarities between publications from China describing single gene knockdown experiments in human cancer cell lines Jennifer A. Byrne1,2 Cyril Labbé3 [email protected] [email protected] Abstract Comparing 5 publications from China that described knockdowns of the human TPD52L2 gene in human cancer cell lines identified unexpected similarities between these publications, flaws in experimental design, and mismatches between some described experiments and the reported results. Following communications with journal editors, two of these TPD52L2 publications have been retracted. One retraction notice stated that while the authors claimed that the data were original, the experiments had been out-sourced to a biotechnology company. Using search engine queries, automatic text-analysis, different similarity measures, and further visual inspection, we identified 48 examples of highly similar papers describing single gene knockdowns in 1–2 human cancer cell lines that were all published by investigators from China. The incorrect use of a particular TPD52L2 shRNA sequence as a negative or non-targeting control was identified in 30/48 (63%) of these publications, using a combination of Google Scholar searches and visual inspection. Overall, these results suggest that some publications describing the effects of single gene knockdowns in human cancer cell lines may include the results of experiments that were not performed by the authors. This has serious implications for the validity -
W O 2019/079360 a L 25 April 2019 (25.04.2019) W 1P O PCT
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date W O 2019/079360 A l 25 April 2019 (25.04.2019) W 1P O PCT (51) International Patent Classification: (72) Inventors; and G01N 33/48 (2006.01) G01N 33/53 (2006.01) (71) Applicants: KEAN, Leslie [US/US]; c/o 818 Stewart St, Suite 603, Seattle, Washington 98101 (US). COLONNA, (21) International Application Number: Lucrezia [US/US]; c/o 818 Stewart St, Suite 603, Seattle, PCT/US2018/056166 Washington 98101 (US). CARROLL, Shaina [US/US]; (22) International Filing Date: c/o 77 Massachusetts Avenue, Cambridge, Massachusetts 16 October 2018 (16. 10.2018) 02139 (US). (25) Filing Language: English (72) Inventors: SHALEK, Alexander K.; c/o 77 Massachu¬ setts Avenue, Cambridge, Massachusetts 02139 (US). ZIE- (26) Publication Language: English GLER, Carly; c/o 77 Massachusetts Avenue, Cambridge, (30) Priority Data: Massachusetts 02139 (US). 62/573,015 16 October 2017 (16. 10.2017) US (74) Agent: SCHER, Michael B. et al.; Johnson, Marcou & (71) Applicants: MASSACHUSETTS INSTITUTE OF Isaacs, LLC, P.O. Bo 691, Hoschton, Georgia 30548 (US). TECHNOLOGY [US/US]; 77 Massachusetts Av¬ (81) Designated States (unless otherwise indicated, for every enue, Cambridge, Massachusetts 02139 (US). SEAT¬ kind of national protection available): AE, AG, AL, AM, TLE CHILDREN'S HOSPITAL DBA SEATTLE AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CHILDREN'S RESEARCH INSTITUTE [US/US]; 818 CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, Stewart St, Suite 603, Seattle, Washington 98101 (US).