DOCSLIB.ORG

(12) United States Patent (10) Patent No.: US 7,611,839 B2 Twine Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) United States Patent (10) Patent No.: US 7,611,839 B2 Twine Et Al US00761 1839B2 (12) United States Patent (10) Patent No.: US 7,611,839 B2 Twine et al. (45) Date of Patent: Nov. 3, 2009 (54) METHODS FOR DIAGNOSING RCC AND 2002/0168638 A1 1 1/2002 Schlegel et al. OTHER SOLD TUMIORS 2002/0182614 A1 12/2002 Gillis et al. (75) I nVentors:t NatalieNatale U.C. Twine.Wine, UOIISLOWn,Goffst NH (US) 2004/0175743 A1 9/2004 Burczynski et al. Michael E. Burczynski, Swampscott, 2004/0235020 A1 1 1/2004 Burczynski et al. MA (US); William L. Trepicchio, Andover, MA (US); Andrew J. Dorner, Lexington, MA (US); Jennifer A. Stover, Topsfield, MA (US); Donna K. FOREIGN PATENT DOCUMENTS Slonim, North Andover, MA (US) WO WO 89/10134 11, 1989 (73) Assignee: Wyeth, Madison, NJ (US) WO WO 97.07668 3, 1997 WO WO 97.07669 3, 1997 (*) Notice: Subject to any disclaimer, the term of this WO WO99,14346 3, 1999 patent is extended or adjusted under 35 WO WO99,27132 6, 1999 U.S.C. 154(b) by 56 days. WO WOOOf 40749 T 2000 (21) Appl. No.: 10/717,597 WO WOOOf 44895 8, 2000 WO WOOOf 63364 10, 2000 (22) Filed: Nov. 21, 2003 WO WOO1/29058 4/2001 WO WOO1,36646 5, 2001 (65) Prior Publication Data WO WOO1? 68836 9, 2001 US 2004/O110221A1 Jun. 10, 2004 WO WOO1,70949 9, 2001 O O WO WOO1,75164 10, 2001 Related U.S. Application Data WO WOO1,81916 11, 2001 (60) Provisional application No. 60/427,982, filed on Nov. WO WOO1/92513 12/2001 21, 2002, provisional application No. 60/459,782, WO WOO2,08399 1, 2002 filed on Apr. 3, 2003. WO WO O2/24924 3, 2002 (51) Int. Cl WO WOO2/4OOOO 5, 2002 CI2O I/68 (2006.01) WO WO O2/4O717 A2 5, 2002 C7H 2L/02 (2006.01) WO WOO3,O32813 4/2003 (52) U.S. Cl. .......................................... 435/6:536/23.1 WO WO2004/048.933 6, 2004 (58) Field of Classification Search ..................... 435/4, WO WO2004/072265 8, 2004 435/6; 536/23.1 See application file for complete search history. (56) References Cited (Continued) U.S. PATENT DOCUMENTS OTHER PUBLICATIONS 4.489,710 A 12/1984 Spitler 4,522,811 A 6/1985 Eppstein et al. Olive et al. Expression of cytokine mRNA transcripts in renal cell 4,569,789 A 2f1986 Blattler et al. carcinoma. Immunology and Cell Biology, vol. 76: 357-362. 1998.* 4,625,014 A 11, 1986 Senter et al. 4,638.045. A 1/1987 Kohn et al. (Continued) 4,671,958 A 6, 1987 Rodwell et al. 4,751,180 A 6/1988 Cousens et al. Primary Examiner Sue Liu 4,935,233 A 6, 1990 Bell et al. (74) Attorney, Agent, or Firm Joseph E. Zahner 5,459,039 A 10, 1995 Modrich et al. 5,498,531 A 3, 1996 Jarrell 5,840,506 A 11/1998 Giordano (57) ABSTRACT 5,919,619 A 7, 1999 Tullis 6,087,098 A 7/2000 McKiernan et al. 6,110,675 A 8, 2000 Cohen et al. Methods, systems and equipment for diagnosing renal cell 6,190,857 B1 * 2/2001 Ralph et al. .................... 435/4 6.288,220 B1 9/2001 Kambara et al carcinoma (RCC) and other solid tumors. This invention 6,303.30 1 B1 10, 2001 Macket al. identifies numerous disease genes that are differentially 6,317,731 B1 1 1/2001 Luciano expressed in the peripheral blood of patients having RCC or 6,391,562 B2 5/2002 Kambara et al. other solid tumors relative to disease-free humans. These 6,506,559 B1 1/2003 Fire et al. disease genes can be used as Surrogate markers for detecting 6,647,341 B1 1 1/2003 Golub et al. the presence or absence of RCC or other solid tumors. 2001/0053548 A1 12/2001 Rybak et al. 2002fOO42072 A1 4/2002 Van Meel 2002/0132274 A1 9, 2002 Nevalainen et al. 7 Claims, 5 Drawing Sheets 2002/0164664 A1 1 1/2002 Hlavaty et al. (1 of 5 Drawing Sheet(s) Filed in Color) US 7,611,839 B2 Page 2 FOREIGN PATENT DOCUMENTS Deprimo et al., “Expression Profiling of Blood Samples from an SU5416 Phase III Metastatic Colorectal Cancer Clinical Trial: a WO WO 2004/072265 A2 8, 2004 Novel Strategy for Biomarker Identification'. Biomed Central, pp. WO WO 2004/094673 A2 11/2004 1471-2407. WO WO 2004/097052 A2 11/2004 Altschul et al.; “Gapped Blast and PSI-Blast: a New Generation of Protein Database Search Programs'. Nucleic Acids Research, 1997, pp. 3389-3402, vol. 25, No. 17, Oxford University Press. OTHER PUBLICATIONS Berger P. et al.: “Loss of Phosphatase Activity in Myotubularin Golub et al. Molecular classification of cancer: class discovery and Related Protein 2 is Associated With Charcot-Marie Tooth Disease class prediction by gene expression monitoring. Science. Vol. 286: Type 4BI'', Human Molecular Genetics, 2002, pp. 1569-1579, vol. 531-537. 1999. 11, No. 13, Oxford University Press. Liu et al. Upregulation of Toll-like receptor 2 gene expression in Boe R. et al.; "The Protein Phosphatase Inhibitor Okadaic Acid macrophage response to peptidoglycan and high concentration of Induces Morphological Changes Typical of Apoptosis in Mammalian lipopolysaccharide is involved in NG-kB Activation. Infection and Cells'. Experimental Cell Research 195, 1991, pp. 237-246, Aca Immunity, vol. 69: 2788-2796. 2001.* demic Press, Inc. Mayo et al., Biochimica et Biophysica Acta. vol. 1470: M55-M62; Bottini N. et al.: “Low-Molecular-Weight Protein Tjirosine 2OOO. Phosphatase and Human Disease. in Search of Biochemical Mecha GenBank Printout, (http://www.ncbi.nih.gov/Genbank/index.html), nisms'. Archivum Immunologiae EtTherapiae Experimentalis, 2002 “Updating or Revising a Sequence'; downloaded Feb. 21, 2007.* pp. 95-104, vol. 50. Brown-Shimer, et al.; “Effect of Protein Tvrosine Phosphatase Ib UNIGENE Printout, “Hs.63668; downloaded Feb. 21, 2007.* Expression on Transformation by the Human neu Oncogene'. Can Anand et al., Nature Genetics. Vol. 31:301-305; 2002.* cer Research, 52, 1992, pp. 478-548. Young et al., American Journal of Pathology, vol. 158(5): 1639-1651: Chen et al.; "The Myotonic Dystrophy Kinase-Related Cdc42-Bind May 2001.* ing Kinase is Involved in the Regulation of Neurite Outgrowth in Palsson-McDermott et al., Ir J. Med. Sci., vol. 176: 253-260; 2007.* PCI 2 Cells'. The Journal of Biological Chemistry 1999, pp. 1990.1- El-Omar et al., Oncogene. vol. 27: 244-252; 2008.* 19905, vol. 274, No. 28. The American Society for Biochemistry and Thornton et al., J. Mol. Med... vol. 81: 536-548; 2003.* Molecular Biology, Inc. U.S. Appl. No. 60/427,982, Burczynski. M. et al. Delagrave et al., “Recursive Ensemble Mutagenesis'. Protein Engi U.S. Appl. No. 60/459.782, Twine, N. C. et al. neering, 1993, pp. 327-331, vol. 6 No. 3, Oxford University Press. U.S. Appl. No. 60/446,133, Burczynski. M. et al. Dong et al.; “Cdc42 Antagonizes Inductive Action of cAMP On Cell U.S. Appl. No. 60/538,246, Burczynski. M. et al. Shape, Via Effects of the Myotonic Dystropht Kinase-Related Cdc42 U.S. Appl. No. 60/466,067, Dorner, A. et al. Binding Kinase (MRCK) On Myosin Light Chain Phosphorylation'. Burczynski et al., "Pharmacogenomic expression profiling of renal European Journal of Cell Biology Apr. 2002, pp. 231-242, vol. 81. cell carcinoma in a phase II trial of CCI-779: identification of surro Engelman et al.; "Identifiving Nonpolar Transbilayer Helices in gate markers of disease and predictors of outcome in the compart Amino Acid Sequences of Membrane Proteins'. Ann. Rev. Biophys. ment of peripheral blood”. European Journal of Cancer; Pergamon Chem. 1986, pp. 321-353, vol. 15, Annual Reviews Inc. Press, Oxford, GB, vol. 38, Nov. 11, 2002, p. S51. Florea et al.; "A Computer Program for Aligning A cDNA Sequence Schulze-Koops, H. et al., “Persistent reduction in IL-6 mRNA in with a Genomic DNA Sequence'. Genome Research 1998, pp. 967 peripheral blood mononuclear cells of patients with rheumatoid 974, vol. 8, Cold Spring Harbor Laboratory Press. arthritis after treatment with a monoclonal antibody to CD54 (ICAM Gossen et al.:"Transcriptional Activation by Tetracyclines in Mam 1). Clinical and Experimental Immunology, vol. 106, No. 2, Nov. malian Cells'. Science Jun. 23, 1995, pp. 1766-1769, vol. 268. 1996, pp. 190-196. Guatellietal. “Isothermal, in Vitro Amplification of Nucleic Acids by Dipaola, R.S., et al., “Phase I clinical and pharmacologic study of a Multienzyme Reaction Modeled Afier Retroviral Replication'. 13-cis-retinoic acid, interferon alfa, and paclitaxel in patients with Proc. Natl. Acad. Sci. USA, Mar. 1990, pp. 1874-1878, vol. 87. prostate cancer and other advanced malignancies.” Journal of Clini Haseloffet al.; "Simple RNA Enzymes with New and Highly Specific cal Oncology. Official Journal of the American Society of Clinical Endoribonuclease Activities', Nature, Aug. 18, 1988, pp. 585-591, Oncology, vol. 17, No. 7, Jul. 1999, pp. 2213-2218. vol. 334. “Product Catalogue'. Jan. 2001. Afjmetrix, p. 1. Hyrup et al.; “Peptide Nucleic Acids (PNA): Synthesis, Properties Lichtenfels, R. et al., “Identification of metabolic enzymes in renal and Potential Applications'. Bioorganic & Medicinal Chemistry, cell carcinoma utilizing PROTEOMEX analyses'. Biochimica et 1996, pp. 5-23, vol. 4. No. 1, Elsevier Science Ltd., Great Britain. Biophysica Acta, vol. 1646, No. 1-2, Mar. 21, 2003, pp. 21-31. Ishida et al.; "Treatment of Myeloid Leukemic Cells With the Su, Andrew I., et al., "Large-scale analysis of the human and mouse Phosphatase Inhibitor Okadaic Acid Induces Cell Cycle Arrest at transcriptomes.” Proceedings of the National Academy of Sciences of Either G1/S or G2/M Depending on Dose'.
Load more

Recommended publications
  • Investigation of RNA-Mediated Pathogenic Pathways in a Drosophila Model of Expanded Repeat Disease
    Investigation of RNA-mediated pathogenic pathways in a Drosophila model of expanded repeat disease A thesis submitted for the degree of Doctor of Philosophy, June 2010 Clare Louise van Eyk, B.Sc. (Hons.) School of Molecular and Biomedical Science, Discipline of Genetics The University of Adelaide II Table of Contents Index of Figures and Tables……………………………………………………………..VII Declaration………………………………………………………………………………......XI Acknowledgements…………………………………………………………………........XIII Abbreviations……………………………………………………………………………....XV Drosophila nomenclature…………………………………………………………….….XV Abstract………………………………………………………………………………........XIX Chapter 1: Introduction ............................................................................................1 1.0 Expanded repeat diseases....................................................................................1 1.1 Translated repeat diseases...................................................................................2 1.1.1 Polyglutamine diseases .............................................................................2 Huntington’s disease...................................................................................3 Spinal bulbar muscular atrophy (SBMA) .....................................................3 Dentatorubral-pallidoluysian atrophy (DRPLA) ...........................................4 The spinal cerebellar ataxias (SCAs)..........................................................4 1.1.2 Pathogenesis and aggregate formation .....................................................7
    [Show full text]
  • Tpd52l2 (NM 025482) Mouse Tagged ORF Clone – MR202509
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR202509 Tpd52l2 (NM_025482) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Tpd52l2 (NM_025482) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Tpd52l2 Synonyms: 2810411G23Rik; AU016537; C86069; D54 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MR202509 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACTCTGCTAGCCAAGATATCAACCTGAATTCTCCTAACAAAGGTGTGCTGTCTGACTTTATGACTG ACGTCCCTGTTGACCCAGGTGTGGTCCACCGGACTCCAGTTGTAGAAGGCCTGACAGAGGGGGAGGAAGA AGAGCTTCGGGCTGAGCTTGCTAAGGTGGAAGAAGAAATTGTCACTCTGCGCCAGGTGCTGGCAGCCAAA GAGAGGCACTGTGGAGAGCTGAAAAGGAGGCTGGGCCTCTCCACATTAGGGGAGCTGAAGCAGAACCTGT CTAGGAGCTGGCATGATGTGCAGGTCTCTACTGCCTATGTGAAAACGTCTGAGAAACTTGGAGAGTGGAA TGAGAAAGTGACGCAGTCTGACCTCTACAAGAAGACTCAAGAAACTCTTTCACAGGCTGGACAGAAAACA TCAGCTGCCCTGTCCACCATGGGCTCTGCCATCAGCAGGAAGCTTGGAGACATGAGCAGCTACTCCATCC GCCACTCGATAAGTATGCCTGTCATGAGGAACTCAGCCACCTTCAAGTCATTTGAAGACCGAGTGGGGAC CATAAAGTCTAAGGTTGTGGGTGGCAGAGAGAATGGCAGCGATAACCTCCCTCCCTCTCCTGGAAGTGGT GACCAGACATTGCCGGATCATGCGCCTTTC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA This product is to be used for laboratory only. Not for diagnostic or therapeutic use.
    [Show full text]
  • Identification of Tumor-Associated Cassette Exons in Human Cancer
    Valletti et al. Molecular Cancer 2010, 9:230 http://www.molecular-cancer.com/content/9/1/230 RESEARCH Open Access Identification of tumor-associated cassette exons in human cancer through EST-based computational prediction and experimental validation Alessio Valletti1†, Anna Anselmo2†, Marina Mangiulli1, Ilenia Boria1, Flavio Mignone3, Giuseppe Merla4, Vincenzo D’Angelo5, Apollonia Tullo6, Elisabetta Sbisà6, Anna Maria D’Erchia1, Graziano Pesole1,7* Abstract Background: Many evidences report that alternative splicing, the mechanism which produces mRNAs and proteins with different structures and functions from the same gene, is altered in cancer cells. Thus, the identification and characterization of cancer-specific splice variants may give large impulse to the discovery of novel diagnostic and prognostic tumour biomarkers, as well as of new targets for more selective and effective therapies. Results: We present here a genome-wide analysis of the alternative splicing pattern of human genes through a computational analysis of normal and cancer-specific ESTs from seventeen anatomical groups, using data available in AspicDB, a database resource for the analysis of alternative splicing in human. By using a statistical methodology, normal and cancer-specific genes, splice sites and cassette exons were predicted in silico. The condition association of some of the novel normal/tumoral cassette exons was experimentally verified by RT-qPCR assays in the same anatomical system where they were predicted. Remarkably, the presence in vivo of the predicted alternative transcripts, specific for the nervous system, was confirmed in patients affected by glioblastoma. Conclusion: This study presents a novel computational methodology for the identification of tumor-associated transcript variants to be used as cancer molecular biomarkers, provides its experimental validation, and reports specific biomarkers for glioblastoma.
    [Show full text]
  • A Bootstrap-Based Regression Method for Comprehensive Discovery of Differential Gene Expressions: an Application to the Osteoporosis Study
    A bootstrap-based regression method for comprehensive discovery of differential gene expressions: an application to the osteoporosis study Yan Lu1,2, Yao-Zhong Liu3, Peng–Yuan Liu2, Volodymyr Dvornyk4, and Hong–Wen Deng1,3 1. College of Life Sciences and Bioengineering, Beijing Jiaotong University, Beijing 100044, P. R. China 2. Department of Physiology and the Cancer Center, Medical College of Wisconsin, Milwaukee, WI 53226, USA 3. Department of Biostatistics and Bioinformatics & Center for Bioinformatics and Genomics, Tulane University School of Public Health, New Orleans, LA 70112, USA 4. School of Biological Sciences, University of Hong Kong, Pokfulam Rd., Pokfulam, Hong Kong, P.R. China Running title: Bootstrap-based regression method for microarray analysis Key words: microarray, bootstrap, regression, osteoporosis Corresponding author: Hong–Wen Deng, Ph. D. Department of Biostatistics and Bioinformatics & Center for Bioinformatics and Genomics, Tulane University School of Public Health, 1440 Canal Street, Suite 2001, New Orleans, LA 70112 Tel: 504-988-1310 Email: [email protected] 1 Abstract A common purpose of microarray experiments is to study the variation in gene expression across the categories of an experimental factor such as tissue types and drug treatments. However, it is not uncommon that the studied experimental factor is a quantitative variable rather than categorical variable. Loss of information would occur by comparing gene-expression levels between groups that are factitiously defined according to the quantitative threshold values of an experimental factor. Additionally, lack of control for some sensitive clinical factors may bring serious false positive or negative findings. In the present study, we described a bootstrap-based regression method for analyzing gene expression data from the non-categorical microarray experiments.
    [Show full text]
  • Antigen-Specific Memory CD4 T Cells Coordinated Changes in DNA
    Downloaded from http://www.jimmunol.org/ by guest on September 24, 2021 is online at: average * The Journal of Immunology The Journal of Immunology published online 18 March 2013 from submission to initial decision 4 weeks from acceptance to publication http://www.jimmunol.org/content/early/2013/03/17/jimmun ol.1202267 Coordinated Changes in DNA Methylation in Antigen-Specific Memory CD4 T Cells Shin-ichi Hashimoto, Katsumi Ogoshi, Atsushi Sasaki, Jun Abe, Wei Qu, Yoichiro Nakatani, Budrul Ahsan, Kenshiro Oshima, Francis H. W. Shand, Akio Ametani, Yutaka Suzuki, Shuichi Kaneko, Takashi Wada, Masahira Hattori, Sumio Sugano, Shinichi Morishita and Kouji Matsushima J Immunol Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Author Choice option Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Freely available online through http://www.jimmunol.org/content/suppl/2013/03/18/jimmunol.120226 7.DC1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material Permissions Email Alerts Subscription Author Choice Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 24, 2021. Published March 18, 2013, doi:10.4049/jimmunol.1202267 The Journal of Immunology Coordinated Changes in DNA Methylation in Antigen-Specific Memory CD4 T Cells Shin-ichi Hashimoto,*,†,‡ Katsumi Ogoshi,* Atsushi Sasaki,† Jun Abe,* Wei Qu,† Yoichiro Nakatani,† Budrul Ahsan,x Kenshiro Oshima,† Francis H.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2009/0297536A1 Chin Et Al
    US 20090297536A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2009/0297536A1 Chin et al. (43) Pub. Date: Dec. 3, 2009 (54) COMPOSITIONS, KITS, AND METHODS FOR Related U.S. Application Data IDENTIFICATION, ASSESSMENT, (60) Provisional application No. 60/575,795, filed on May PREVENTION AND THERAPY OF CANCER 28, 2004, provisional application No. 60/580,337, filed on Jun. 15, 2004. (75) Inventors: Lynda Chin, Brookline, MA (US); Publication Classification Cameron W. Brennan, New York, NY (US); Ronald A. DePinho, (51) Int. Cl. Brookline, MA (US); Andrew J. A 6LX 39/395 (2006.01) Aguirre, Boston, MA (US) CI2O I/68 (2006.01) C40B 30/00 (2006.01) AOIK 67/00 (2006.01) Correspondence Address: A 6LX 3L/7052 (2006.01) FOLEY HOAG, LLP A638/02 (2006.01) PATENT GROUP, WORLD TRADE CENTER A638/16 (2006.01) WEST C07K I4/00 (2006.01) 155 SEAPORT BLVD C7H 2L/00 (2006.01) BOSTON, MA 02110 (US) C07K 6/00 (2006.01) A6IP35/00 (2006.01) (73) Assignee: Dana-Farber Cancer Institute, (52) U.S. Cl. ................ 424/172.1; 435/6:506/7; 800/10: Inc., Boston, MA (US) 424/183.1; 424/178.1: 514/44 A: 514/2: 514/12: 530/350:536/23.1; 530/389.1 (21) Appl. No.: 11/597,825 (57) ABSTRACT The invention relates to compositions, kits, and methods for (22) PCT Filed: May 27, 2005 detecting, characterizing, preventing, and treating human cancer. A variety of chromosomal regions (MCRs) and mark (86). PCT No.: PCT/US05/18850 ers corresponding thereto, are provided, wherein alterations in the copy number of one or more of the MCRs and/or S371 (c)(1), alterations in the amount, structure, and/or activity of one or (2), (4) Date: Jun.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2003/0082511 A1 Brown Et Al
    US 20030082511A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2003/0082511 A1 Brown et al. (43) Pub. Date: May 1, 2003 (54) IDENTIFICATION OF MODULATORY Publication Classification MOLECULES USING INDUCIBLE PROMOTERS (51) Int. Cl." ............................... C12O 1/00; C12O 1/68 (52) U.S. Cl. ..................................................... 435/4; 435/6 (76) Inventors: Steven J. Brown, San Diego, CA (US); Damien J. Dunnington, San Diego, CA (US); Imran Clark, San Diego, CA (57) ABSTRACT (US) Correspondence Address: Methods for identifying an ion channel modulator, a target David B. Waller & Associates membrane receptor modulator molecule, and other modula 5677 Oberlin Drive tory molecules are disclosed, as well as cells and vectors for Suit 214 use in those methods. A polynucleotide encoding target is San Diego, CA 92121 (US) provided in a cell under control of an inducible promoter, and candidate modulatory molecules are contacted with the (21) Appl. No.: 09/965,201 cell after induction of the promoter to ascertain whether a change in a measurable physiological parameter occurs as a (22) Filed: Sep. 25, 2001 result of the candidate modulatory molecule. Patent Application Publication May 1, 2003 Sheet 1 of 8 US 2003/0082511 A1 KCNC1 cDNA F.G. 1 Patent Application Publication May 1, 2003 Sheet 2 of 8 US 2003/0082511 A1 49 - -9 G C EH H EH N t R M h so as se W M M MP N FIG.2 Patent Application Publication May 1, 2003 Sheet 3 of 8 US 2003/0082511 A1 FG. 3 Patent Application Publication May 1, 2003 Sheet 4 of 8 US 2003/0082511 A1 KCNC1 ITREXCHO KC 150 mM KC 2000000 so 100 mM induced Uninduced Steady state O 100 200 300 400 500 600 700 Time (seconds) FIG.
    [Show full text]
  • DEAD-Box Helicase 27 Enhances Stem Cell-Like Properties with Poor Prognosis in Breast Cancer
    DEAD-Box Helicase 27 Enhances Stem Cell-Like Properties With Poor Prognosis in Breast Cancer Shan Li The First Aliated Hospital of China Medical University Jinfei Ma The First Aliated Hospital of China Medical University Ang Zheng The First Aliated Hospital of China Medical University Xinyue Song China Medical University Si Chen China Medical University Feng Jin ( [email protected] ) The First Aliated Hospital of China Medical University https://orcid.org/0000-0002-0325-5362 Research Article Keywords: DEAD-box helicase 27 (DDX27), Breast cancer, Stem cell-like properties, Prognosis Posted Date: June 7th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-521379/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published at Journal of Translational Medicine on August 6th, 2021. See the published version at https://doi.org/10.1186/s12967-021-03011-0. Page 1/22 Abstract Background Although the rapid development of diagnosis and treatment has improved prognosis in early breast cancer, challenges from different therapy response remain due to breast cancer heterogeneity. DEAD-box helicase 27 (DDX27) had been proved to inuence ribosome biogenesis and identied as a promoter in gastric and colorectal cancer associated with stem cell-like properties, while the impact of DDX27 on breast cancer prognosis and biological functions is unclear. We aimed to explore the inuence of DDX27 on stem cell-like properties and prognosis in breast cancer. Methods The expression of DDX27 was evaluated in 24 pairs of fresh breast cancer and normal tissue by western blot.
    [Show full text]
  • Literature Mining Sustains and Enhances Knowledge Discovery from Omic Studies
    LITERATURE MINING SUSTAINS AND ENHANCES KNOWLEDGE DISCOVERY FROM OMIC STUDIES by Rick Matthew Jordan B.S. Biology, University of Pittsburgh, 1996 M.S. Molecular Biology/Biotechnology, East Carolina University, 2001 M.S. Biomedical Informatics, University of Pittsburgh, 2005 Submitted to the Graduate Faculty of School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2016 UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE This dissertation was presented by Rick Matthew Jordan It was defended on December 2, 2015 and approved by Shyam Visweswaran, M.D., Ph.D., Associate Professor Rebecca Jacobson, M.D., M.S., Professor Songjian Lu, Ph.D., Assistant Professor Dissertation Advisor: Vanathi Gopalakrishnan, Ph.D., Associate Professor ii Copyright © by Rick Matthew Jordan 2016 iii LITERATURE MINING SUSTAINS AND ENHANCES KNOWLEDGE DISCOVERY FROM OMIC STUDIES Rick Matthew Jordan, M.S. University of Pittsburgh, 2016 Genomic, proteomic and other experimentally generated data from studies of biological systems aiming to discover disease biomarkers are currently analyzed without sufficient supporting evidence from the literature due to complexities associated with automated processing. Extracting prior knowledge about markers associated with biological sample types and disease states from the literature is tedious, and little research has been performed to understand how to use this knowledge to inform the generation of classification models from ‘omic’ data. Using pathway analysis methods to better understand the underlying biology of complex diseases such as breast and lung cancers is state-of-the-art. However, the problem of how to combine literature- mining evidence with pathway analysis evidence is an open problem in biomedical informatics research.
    [Show full text]
  • Dissertation
    Regulation of gene silencing: From microRNA biogenesis to post-translational modifications of TNRC6 complexes DISSERTATION zur Erlangung des DOKTORGRADES DER NATURWISSENSCHAFTEN (Dr. rer. nat.) der Fakultät Biologie und Vorklinische Medizin der Universität Regensburg vorgelegt von Johannes Danner aus Eggenfelden im Jahr 2017 Das Promotionsgesuch wurde eingereicht am: 12.09.2017 Die Arbeit wurde angeleitet von: Prof. Dr. Gunter Meister Johannes Danner Summary ‘From microRNA biogenesis to post-translational modifications of TNRC6 complexes’ summarizes the two main projects, beginning with the influence of specific RNA binding proteins on miRNA biogenesis processes. The fate of the mature miRNA is determined by the incorporation into Argonaute proteins followed by a complex formation with TNRC6 proteins as core molecules of gene silencing complexes. miRNAs are transcribed as stem-loop structured primary transcripts (pri-miRNA) by Pol II. The further nuclear processing is carried out by the microprocessor complex containing the RNase III enzyme Drosha, which cleaves the pri-miRNA to precursor-miRNA (pre-miRNA). After Exportin-5 mediated transport of the pre-miRNA to the cytoplasm, the RNase III enzyme Dicer cleaves off the terminal loop resulting in a 21-24 nt long double-stranded RNA. One of the strands is incorporated in the RNA-induced silencing complex (RISC), where it directly interacts with a member of the Argonaute protein family. The miRNA guides the mature RISC complex to partially complementary target sites on mRNAs leading to gene silencing. During this process TNRC6 proteins interact with Argonaute and recruit additional factors to mediate translational repression and target mRNA destabilization through deadenylation and decapping leading to mRNA decay.
    [Show full text]
  • The DNA Sequence and Comparative Analysis of Human Chromosome 20
    articles The DNA sequence and comparative analysis of human chromosome 20 P. Deloukas, L. H. Matthews, J. Ashurst, J. Burton, J. G. R. Gilbert, M. Jones, G. Stavrides, J. P. Almeida, A. K. Babbage, C. L. Bagguley, J. Bailey, K. F. Barlow, K. N. Bates, L. M. Beard, D. M. Beare, O. P. Beasley, C. P. Bird, S. E. Blakey, A. M. Bridgeman, A. J. Brown, D. Buck, W. Burrill, A. P. Butler, C. Carder, N. P. Carter, J. C. Chapman, M. Clamp, G. Clark, L. N. Clark, S. Y. Clark, C. M. Clee, S. Clegg, V. E. Cobley, R. E. Collier, R. Connor, N. R. Corby, A. Coulson, G. J. Coville, R. Deadman, P. Dhami, M. Dunn, A. G. Ellington, J. A. Frankland, A. Fraser, L. French, P. Garner, D. V. Grafham, C. Grif®ths, M. N. D. Grif®ths, R. Gwilliam, R. E. Hall, S. Hammond, J. L. Harley, P. D. Heath, S. Ho, J. L. Holden, P. J. Howden, E. Huckle, A. R. Hunt, S. E. Hunt, K. Jekosch, C. M. Johnson, D. Johnson, M. P. Kay, A. M. Kimberley, A. King, A. Knights, G. K. Laird, S. Lawlor, M. H. Lehvaslaiho, M. Leversha, C. Lloyd, D. M. Lloyd, J. D. Lovell, V. L. Marsh, S. L. Martin, L. J. McConnachie, K. McLay, A. A. McMurray, S. Milne, D. Mistry, M. J. F. Moore, J. C. Mullikin, T. Nickerson, K. Oliver, A. Parker, R. Patel, T. A. V. Pearce, A. I. Peck, B. J. C. T. Phillimore, S. R. Prathalingam, R. W. Plumb, H. Ramsay, C. M.
    [Show full text]