1
Hephaestin protein levels but not mRNA levels are regulated by
iron status*
H. Chen‡, Z. Attieh‡, T. Su‡, S. Zippin‡, G. Anderson§ and C. Vulpe‡¶
‡ Department of Nutritional Science and Toxicology, University of California, Berkeley §
Joint Clinical Sciences Program, Queensland Institute of Medical Research and University of Queensland, PO Royal Brisbane Hospital, Brisbane Queensland 4029, Australia
¶ To whom correspondence should be addressed: Department of Nutritional Science and
Toxicology, 119 Morgan Hall, University of California, Berkeley CA 94720. Tel.: 510-
642-1834; Fax.: 510-642-0535; E-mail : [email protected] 2
RUNNING TITLE
Iron regulates hephaestin levels 3
SUMMARY
Hephaestin (abbreviated Hp)1 is a membrane-bound multicopper ferroxidase necessary for iron egress from intestinal enterocytes into the circulation. We have investigated the regulation by iron of hephaestin (heph) mRNA expression, protein levels and HP activity in whole animals in three separate dietary studies. C57BL/6J mice were separated at weaning into three groups of ten to fifteen mice with different dietary regimens. The eight week dietary treatments were iron deficient (2-3 ppm iron), iron sufficient (40-50 ppm iron) and iron deficient for 6 weeks then replete with an iron sufficient diet for two weeks. We found no significant differences in mRNA levels of HP in small intestine enterocytes as assayed by Northen blotting in the three groups. HP protein levels were determined by Western blotting and immuno-precipitation with affinity purified polyclonal antisera to the C-terminus of HP. We observed consistent two fold more protein expression in the iron deficient group as compared to the iron replete group. Native in gel
PPD oxidase assay of HP activity revealed an activity pattern similar to the protein levels.
These results indicate that HP protein levels and activity are regulated by iron status in the small intestine. We hypothesize that HP levels are increased in iron deficient mice to stimulate increased iron egress from intestinal enterocytes and consequent whole body iron 4
absorption. Conversely, with increased iron availability, decreased HP levels similarly reduce iron absorption. 5
INTRODUCTION
Iron is essential for normal metabolic function and disturbances of iron homeostasis, including iron deficiency and iron overlord, can have significant clinical consequences.
Humans maintain iron homeostasis through regulation of intestinal iron absorption since the capacity to excrete iron is very limited (1, 2). Iron deficiency increases while sufficient states decreases iron absorption from the diet. A delay of 2-3 days in response to changes in iron status corresponds to the migration time of the differentiating enterocytes from the intestinal crypts to the villi (3). Iron status during differentiation from the crypt appears to set the absorptive capacity of the mature enterocyte. The intestinal enterocyte therefore represents the key regulatory point for iron metabolism of the body.
Heme and non-heme iron in the diet enters the enterocyte by distinct paths but follow a convergent export pathway. Iron must cross the apical brush border of the intestinal enterocyte, translocate within the enterocyte from apical to basolateral surfaces, and ultimately exit into the circulation. A recently identified ferric reductase, DctyB, present on the apical surface of the mature enterocyte likely acts on non-heme ferric [Fe (III)] iron in diet (4). DMT1(previously NRAMP2 or DCT1)(5-7) then transports resulting ferrous [Fe
(II)] iron into the enterocytes. In contrast, the means by which heme is actively transported into intestinal enterocytes remains unknown (8). Although heme oxygenase releases the iron from heme (9) in the enterocyte. Iron from both sources exits into the circulation through a common export path involving at least two proteins, a basolateral iron exporter,
Ireg1 (also known as ferroportin or MTP1) (10-12) and the focus of this study, a membrane 6
bound ferroxidase, Hephaestin (HP). The common export path for distinct uptake systems represents a physiologic check point for control of iron absorption.
Physiologic studies of iron absorption support control of basolateral iron export as key to iron absorption. Rate constants for both uptake and transfer are similar (13) in iron replete humans. Both the uptake and transfer steps of iron absorption are inversely related to body iron stores (14-18). Studies from rodents and people suggest that in iron deficiency, basolateral transport is rate limiting and there is a greater proportional increase in basolateral iron export than brush border uptake (13,19-24). However, other studies have not confirmed these (25-27). In addition, the inappropriately high iron absorption in hereditary hemochromatosis is associated with an elevated rate constant for the transfer step
(13). Together, the physiologic studies suggest that the rate of basolateral export is a key determinant of iron uptake into the body especially in iron deficiency.
Hephaestin (heph) represents a key component in the control of iron export into the body and therefore control of whole body iron homeostasis. We previously identified a mutation in the heph gene encoding hephaestin in the sex-linked anemia mouse (sla) (28).
The mouse hephaestin protein is 50% identical and 68% similar to the multi-copper ferroxidase [Fe (II) to Fe (III)] ceruloplasmin. HP contains a N-terminal leader peptide and an additional 85 residues at the C-terminus containing a predicted transmembrane domain and a short cytosolic tail. Sla is an X-linked recessive disorder (29) in which affected homozygous female and hemizygous male animals possess a microcytic, hypochromic anemia which is due to impaired intestinal iron transport (30-32). An accumulation of prominent iron deposits within the enterocytes of affected mice suggested and iron 7
absorption studies confirmed that sla mice take up iron from the intestinal lumen normally but that the exit of iron from intestinal cells is impaired (33). Recent studies in which sla mice were crossed to mice disrupted in the hereditary hemochromatis locus, Hfe, demonstrated the key role of hephaestin in modulating iron homeostasis (34). Homozygous mutant hfe/hfe mice accumulate very high levels of iron in the liver while mice carrying both the hfe and sla mutations accumulate markedly less iron. The phenotype of the sla mouse provides convincing evidence of hephaestin's central role in whole body iron homeostasis.
Hephaestin's role as an intestinal ferroxidase suggests that oxidation state of iron is critical to effective export. Our recent detailed analysis show wide spread gastrointestinal expression of heph consistent with a role in iron export (35). We have recently demonstrated that hephaestin from cultured intestinal cells has an oxidase activity (36) and demonstrate a similar activity in intestinal enteroctyes in this study. Furthermore, we have recently shown that mouse hephaestin can complement the iron transport defect of DFET3 yeast which lack this yeast ferroxidase (36). Yeast mutants in copper transport demonstrated that the activity of hephaestin was dependent on copper. These data suggest that hephaestin role is a multicopper ferroxidase involved in intestinal iron export.
In this study, we have investigated the regulation by iron status of heph mRNA expression, protein levels and hephaestin activity in whole animals to further understand the role of hephaestin in iron metabolism. 8
EXPERIMENTAL PROCEDURES
Animals and Diets
C57BL/6J mice were separated at weaning into three groups of ten to fifteen mice each different dietary regimens. The eight week dietary treatments were iron sufficient (40-
50 ppm iron, TekLab) group (15 mice), iron deficient (2-3 ppm iron) group (15 mice), and iron deficient for 6 weeks then replete iron by iron sufficient diet for two weeks group (10 mice). Sla mice (28) were fed a control diet. The mice were sacrificed at the end of the treatment and blood was collected for serum iron, total iron binding capacity (TIBC) and transferrin saturation analysis. Each liver was snap frozen in liquid N2 and used subsequently for atomic absorption analysis. Each duodenum and upper jejunum was first rinsed with ice cold phosphate buffer saline (PBS), and then was filled with PBS with 1.5 mM EDTA for 15 min to release enterocytes. The enterocytes were washed in PBS and then snap frozen in liquid N2 for subsequent RNA, protein and enzyme analysis.
Antisera to hephaestin
An anti-peptide polyclonal antisera to HP was used in these studies. A 15 mer peptide corresponding to the C-terminus of HP (QHRQRKLRRNRRSIL) was synthesized
(HHMI-UCSF peptide synthesis service), conjugated to keyhole limpet hemocyanin (KLH) and injected into rabbits (Animal Pharm, San Francisco, CA). The rabbits were bled at eight weeks and anti-sera collected. Affinity purification of anti-HP antisera was carried out using the Sulfolink purification kit (Pierce). Five micrograms of the peptide were conjugated to Amino-Sulfolink columns which were loaded with 20 ml of antisera. After 9
extensive washing IgG to Hp was eluted with 10 mM Glycine pH 2.5 and neutralized with
1M Tris pH 8.0.
Heph expression vectors. A full-length mouse cDNA with a C-terminal FLAG tag was isolated by RT-PCR from intestinal RNA from C57BL/6J and cloned into the pcDNA3.1 vector (Invitrogen) and is designated mHP. Similarly, a truncated version of HP lacking the
C-terminal transmembrane domain (the terminal 66 amino acid from MLGM to SLKQ nt
3899-4090 of Genbank AC# AF0825672) was cloned into the same vector with C-term
FLAG tag and is designated smHP. The clones were sequence verified and are illustrated in Fig1A.
Heph transfections of CHO cells
Eight micrograms of mHp or smHp constructs were transfected into 3´ 106 cells by lipofectamine method (BRL). Stable transfectants were obtained by selection in G418
(1mg/ml). The transfected cells were harvested and washed 2 times in ice cold working buffer (PBS with 0.1%BSA and 0.02% NaN3). Aliquots of 1 ´ 105cells /tube were fixed with PBS containing 1% paraformaldehyde at room temperature for 30 min, then cells washed with cold working buffer and permeabilized with 0.1% Triton X-100 in 0.1% citrate buffer for 5 min at 4°C. Cells were washed twice and stained with rabbit IgG, anti-
FLAG or anti-HP antibody as primary antibody (2-10 mg /ml) for 30 min at 4°C. The washed cells were incubated with FITC-conjugated anti-mouse IgG or anti-rabbit IgG antibody (1:300) for 30 min at 4°C. Cell were washed and resuspented cells in 1ml working buffer and analyzed by flow cytometry using a FACScan (Becton Dickinson, San Jose, 10
CA). Transiently transfected CHO cells were incubated for 48h and harvested by scraping with PBS on ice. Cells (1´ 107) were lysed in 0.5 ml lysis buffer (1% Triton X-100 in PBS plus protease inhibitors: 1mM AEBSF, 10mM pepstatin A and 20mM leupeptin) for 15 min at 4°C. The lysate was centrifuged at 10,000 ´ g for 20 min at 4°C and the supernatant was collected. Immunoprecipitation of FLAG fusion protein was performed with 50 ml of anti-
FLAG M2 agarose affinity beads (SIGMA) overnight at 4°C on rotator. Samples were washed 3 times in 1ml volumes of wash buffer (25mM Hepes-KOH, 1mM EDTA, 10%
Glycerol, 0.02% NP-40, 3mM MgCl2, 0.2M KCl) and the immunoprecipitates were eluted in 40 ml volume of SDS sample buffer solution for SDS PAGE as described below.
Northern blot analysis
Intestinal enterocytes were prepared as described above and total RNA was prepared using Trizol reagent (BRL) according to the manufacturer's protocol. Fifty micrograms per lane of total RNA was fractionated on a 1% agarose formaldehyde gel. The samples were transfered to nylon membrane, and hybridized with 32P-labeled mouse heph probe (793 bp fragment of mouse heph corresponding to nts 2068-2861 of Genbank AC# AF082567).
The same membrane was rehybridized with mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA probe purchased from Clontech (Clontech, Palo Alto,
CA). Geneticin-resistant transfectant clones were screened for expression of heph mRNA by reverse transcriptase (RT)-PCR using the forward primer (5'
CACCATCCAGGTGGTCTTCT 3') and a reverse primer (5'
TTCGAACCATCACAACCGCA 3'). 11
Cell lysis and immunoprecipitation
C57BL/6J and sla enterocytes were washed twice with ice-cold PBS and lysed in
PBS with 1.5 % Triton X-100 supplemented with protease inhibitors (Cat. No. 1697498
Boehringer Mannheim, Germany) by passing through a 27-gauge needle. The lysates were centrifuged at 10,000 ´ g for 20 min at 4°C and the supernatants were collected. Protein concentrations were determined using a protein assay kit (Cat. No. 500 Bio-Rad).
Enterocyte sample supernatants (300 mg protein) were precleared by incubation with
Protein G Sepharose FF (Amersham Pharmacia Biotech) for 1 hr with rotation at 4°C, then washed and supernatants incubated with affinity purified anti-HP Ab (1: 500 dilution) and
Protein G Sepharose FF (50ml) and rotated overnight at 4°C. The agarose beads were washed 3 times with 1ml volumes of lysing buffer and the immunoprecipitates were eluted in 40ml SDS sample buffer, and used for SDS-PAGE.
Western Blot Analysis
Immunoprecipitates and supernatants of lysate samples were denatured by boiling in
SDS sample buffer for 5 min, subjected to SDS-polyacrylamide gel electrophoresis using a
7.5% running gel and transferred to nitrocellulose membrane. Non specific binding was blocked by incubation of the membrane with PBS containing 0.1% Tween 20 (PBS-T) with
5% BSA and 5% fat free dry milk for 1 hr at room temperature on rotating platform. The membrane was then washed in PBS-T and incubated with a 1: 6,000 dilution of affinity purified anti-HP antibodies in PBS-T containing 2% BSA overnight. The membrane was 12
washed in PBS-T, and incubated with 1: 60,000 dilution of anti-rabbit IgG immunoglobulin peroxidase conjugate (Santa Cruz Biotechnology) in PBS-T containing 2% BSA for 1 hr.
After washing the membrane 3 times, immunoreactive proteins are visualized with ECL detection system (Amersham Pharmacia Biotech). The same membrane was redetected by western blot analysis using a monoclonal antibody against GAPDH (Chemicon) as a primary antibody (1: 300 dilution) and a anti-mouse IgG (HRP conjugated -1:
20,000dilution) as a secondary antibody.
PPD oxidase activity assay
Oxidase activity of HP was determined in mice enterocytes. The enterocytes were washed and lysed in phosphate buffered saline (PBS) containing 1.5% Triton X-100. Cell homogenates were centrifuged at 10,000 ´ g for 10 min to remove unlysed cells and nuclei.
The clear lysate was applied onto native non-reducing, non-denaturing 4-12% Tris-glycine
PAGE (Invitrogen). The gels were then incubated with 0.1% PPD in 0.1M acetate buffer pH 5.45 for 2 hours and air dried in the dark. Purified human ceruloplasmin (Vital
Products) was used as a positive control.
Statistical Analysis
The results were expressed as mean ± SDM. Data were analyzed by ANOVA. A value of p < 0.05 was considered statistically significant. 13
RESULTS
Establishment and Characterization of HP antibody
We demonstrated the specificity of the affinity purified antisera to hephaestin by analysis of stably transfected CHO cell lines expressing an epitope tagged HP. The complete cDNA corresponding to full length HP gene was amplified by RT-PCR with primers modified to include a C-terminal FLAG epitope tag and cloned into the pcDNA3.1 plasmid (mHP, Figure 1 A). In addition, a truncated version which lacks the C-terminal transmembrane domain was also cloned with a C-terminal FLAG tag (smHP). Geneticin- resistant transfectant clones (1mg/ml G418) were screened for expression of heph mRNA by Northern blot analysis (data not shown) and one of the transfectant clones with the highest expression of full length heph was selected and used for flow cytometric analysis.
The antisera to HP demonstrated high and specific reactivity with a pcDNA3.1mHp-FLAG plasmid transfected CHO cell. Staining of heph-transfected CHO cell with anti-FLAG or anti-HP but not with control rabbit IgG is shown in Figure 1 B.
We show next that antisera to HP and a monoclonal antibody to the FLAG epitope tag immunoprecipated identical sized bands in transiently transfected CHO with the full length HP (mHP). An Anti-FLAG antibody immunoprecipiated a 155 kD protein from mHP transfected cells and not from the parental CHO cells. Similarly, the affinity purified anti-HP antisera immunoprecipitated a 155 kD protein from mHP transfected cells lines. the C-terminal truncated version (smHP). A 145 kD protein is immunoprecipated with the anti-FLAG antisera from smHP transfected cells. As the antisera were raised to the C- 14
terminus of HP, the truncated smHP does not contain the epitope for this antisera and no reactivity is expected or seen.
Sla (28) mice express a smaller protein than wild type mice . Direct western analysis of C57BL/6J and sla mice enterocytes lysates with anti-HP antisera identified a 155 kD protein in C57 BL/6J mice and a 130 kD protein in the sla mice (Figure 1 D).
Iron status of different dietary regimens
We examined the effect of iron status on heph mRNA and HP protein levels in mice.
As described in material and methods, we studied three different groups, iron sufficient (15 mice), iron deficient group (15 mice), and iron deficient for 6 weeks then repleted with iron sufficient diet (10 mice). Serum iron, total iron-binding capacity (TIBC), transferrin saturation and liver iron concentration were determined in the different groups (Table 1).
There was a significant decrease in serum iron, transferrin saturation and liver iron content of the iron deficient mice compared with control mice.
Effect of iron status on heph mRNA levels
The expression of mouse heph mRNA in mouse enterocytes isolated from mice on the three different dietary regimens was examined by Northern blot analysis. We found no significant change in mRNA levels of heph in different groups of small intestine enterocytes as assayed by Northen blotting. GAPDH was used as a loading control (Figure
2 A). Figure 2 B show heph quantitative analysis by the Northern blot of enterocytes RNA from three different conditional mice. All values were corrected for the loading differences 15
by normalizing to the GAPDH mRNA intensity. Data represent the means ± SDM of ten separate experiments.
Effect of iron status on HP protein levels
HP protein levels were determined by Western blotting and immuno-precipitation with affinity purified polyclonal antisera to the C-terminus of HP. We observed robust protein levels of HP in the iron deficient group that was consistently greater than two and one half fold greater than the control and iron depleted and then repleted mice. Figure 3 A shown a direct western blotting of enterocytes with antisera to HP. The upper bands with an molecular mass of 155 kD correspond to the HP protein, and the lower bands with a molecular mass of 36 kD correspond to the GAPDH protein as a control for protein loading. Figure 3 B is an immunoprecipitation of HP from enterocyte lysates. Figure 3 C shown the levels of enterocyte expression of HP protein in iron deficient (15 mice), iron deficient to iron replete (10 mice) and control mice (15 mice) group. The HP protein was increased 2.5-fold (on average) in the iron deficient mice relative to iron replete mice. Data represent the means ± SDM of ten to fifteen separate experiments.
PPD Oxidase Activity
We have previously shown in cultured epithelial cells that Hp is a multi-copper ferroxidase (36) that is involved in cellular iron metabolism. In this report, we present data indicating that the ferroxidase activity of Hp is induced under iron deficiency conditions to levels similar to that of the protein amounts. As depicted in figure 4 (A), there was a two- 16
fold increase in Hp ferroxidase activity in iron deficient mouse enterocytes. This induction correlates with the observed changes in protein levels. 17
DISCUSSION
We investigated in this study the role of regulation of HP expression and activity in maintaining iron status in whole animals. Our focus was on the regulatory transitions between an iron deficient and iron replete diets necessary to maintain homeostasis. We used dietary manipulations of iron status rather than other mechanisms (such as phenyl- hydrazine treatment to induce anemia) known to increase iron absorption to isolate as much as possible the effects of iron status from other stimuli of iron absorption. We did a three way comparison between chronically iron deficient mice, iron deficient mice recently transferred to an iron replete diet, and iron replete mice. We compared heph mRNA levels,
HP protein levels and HP oxidase activity in three separate dietary studies with a total of
>10 mice for each study. We found no significant change in mRNA levels of heph in isolated small intestine enterocytes as assayed by Northern blotting. We determined HP protein levels both by direct immunoblotting (western) and immunoprecipitation and consistently observed 2 fold higher levels in the iron deficient mice as compared to the mice on the other diets. The greatest difference was between the chronically iron deficient mice and the mice that were recently repleted with iron after a six week period on an iron deficient diet. We demonstrated a similar pattern of HP activity with native in gel PPD oxidase assay. These results suggest that HP levels may be most critical in adapting to new environmental conditions. In iron deficiency, increased HP levels and activity in combination with the demonstrated increases in the ferrireductase, DctyB, the apical transporter (4, 37), DMT1 (6) and the basolateral transporter, Ireg1(10) leads to maximal intestinal throughput of the limited available dietary iron. 18
The iron dependent regulation of HP protein levels may represent a novel post- transcriptional mechanism as the heph transcript does not have an identifiable iron response element (IRE) (data not shown). We do not know if the increased protein levels represent increased translation, increased protein stability or a combination accounts for differences.
A similar iron dependent regulation of IRP2 (38-40) is mediated by a 74 amino acid motif in the protein which is not present in HP (41). Ceruloplasmin protein levels have not been reported to be regulated by iron status so the C-terminal domains of HP which are not present in ceruloplasmin could be involved in the response to iron levels.
One possible role for a ferroxidase in intestinal iron export could be in loading iron into apo-transferrin. Iron which crosses the intestinal epithelium ultimately becomes bound to plasma transferrin as [Fe (III)] but whether a ferroxidase loads iron into apo-transferrin remains unclear. Isolated intestinal cells or intestinal cell plasma membranes which have been preloaded with radioactive iron can release this iron to transferrin (42,43) Iron-poor transferrin bound to the mucosal cells with a higher affinity than diferric transferrin (42), and recent studies with the intestinal cell line Caco2 have provided evidence that an apotransferrin-mediated iron export pathway may be operating (44,45). The rapid rate of spontaneous oxidation of ferrous iron to ferric iron in plasma argues against a need for a ferroxidase. In addition, the transcapillary exchange rate of transferrin from intestinal mucosa to the circulation is insufficient to account for iron absorption (46,21) which suggests that apo-transferrin is loaded with iron in the circulation rather than at the intestinal enterocyte. Furthermore, neither animals infused with iron-loaded transferrin (42) nor hypotransferrinaemic (47) animals show significantly impaired iron absorption. 19
Overall, these studies suggest that there may be additional roles for the ferroxidase activity of HP besides loading iron into apotransferrin. 20
REFERENCES
1. Bothwell, T. H., Charlton, R. W., Cook, J. D., and Finch, C. A. (1979). Iron Metabolism in Man: Iron Metabolism in Man, Blackwell Scientific Publications, Oxford
2. Skikne, B. S., and Baynes, R. D. (1994) Iron Metabolism in Health and Disease: Iron absorption, W. B. Saunders Company Ltd., London; Philadelpha
3. Ferraris, R. P., and Diamond, J. M. (1993) Proc. Natl. Acad. Sci. USA 90, 5868-5872
4. McKie, A. T., Barrow, D., Latunde-Dada, G. O., Rolfs, A., Sager, G., Mudaly, E.,
Mudaly, M., Richardson, C., Barlow, D., Bomford, A., Peters, T. J., Raja, K. B., Shirali, S.,
Hediger, M. A., Farzaneh, F., and Simpson, R. J. (2001) Science 291, 1755-1759
5. Gruenheid, S., Cellier, M., Vidal, S., Gros, P. (1995) Genomics. 25, 514-525
6. Gunshin, H., Mackenzie, B., Berger, U. V., Gunshin, Y., Romero, M. F., Boron, W. F.,
Nussberger, S., Gollan, J. L., Hediger, M. A. (1997) Nature 388, 482 - 488
7. Fleming, M. D., Trenor, CC. 3rd., Su, M. A., Foernzler, D., Beier, D. R., Dietrich, W. F.,
Andrews, N. C. (1997) Nat. Genet. 16, 383-386
8. Worthington, M. T., Cohn, S. M., Miller, S. K., Luo, R. Q., Berg, C. L. (2001) Am. J.
Physiol. Gastrointest Liver Physiol. 280, G1172-1177
9. Balla, J., Jacob, H. S., Balla, G., Nath, K., Eaton, J. W., Vercellotti, G. M. (1993)
Proc.Natl. Acad. Sci. USA 90, 9285-9289
10. McKie, A. T., Marciani, P., Rolfs, A., Brennan, K., Wehr, K., Barrow, D., Miret, S.,
Bomford, A., Peters, T. J., Farzaneh, F., Hediger, M. A., Hentze, M. W., Simpson, R. J.
(2000) Mol. Cell 5, 299-309 21
11. Donovan, A., Brownlie, A., Zhou, Y., Shepard, J., Pratt, S. J., Moynihan, J., Paw, B. H.,
Drejer, A., Barut, B., Zapata, A., Law, T. C., Brugnara, C., Lux, S. E., Pinkus, G. S.,
Pinkus, J. L., Kingsley, P. D., Palis, J., Fleming, M. D., Andrews, N. C., Zon, L. I. (2000)
Nature 403, 776 - 781
12. Abboud, S., and Haile, D. J. (2000) J. Biol. Chem. 275, 19906-19912
13. McLaren, G. D., Nathanson, M. H., Jacobs, A., Trevett, D., Thomson, W. (1988). Ann.
N Y Acad. Sci. 526, 185-198
14. Wheby, M. S., Jones, L. G., and Crosby, W. H. (1964) J. Clin. Invest. 43, 1433-1442
15. Cox, T. M. and Peters, T. J. (1980) Br. J. Haematol. 44, 75-86.
16. Greenberger, N. J., Balcerzak, S. P., Ackerman, G. A. (1969) J. Lab. Clin. Med. 73,
711-721
17. Thomson, A. B., and Valberg, L. S. (1971) Am. J. Physiol. 220, 1080-1085
18. Acheson L. S., and Schultz, S. G. (1972) Biochim. Biophys. Acta 255, 479-83
19. Dowdle, E. B., Schachter, D., and Wilson, E. (1960.) Am. J. Physiol. 198, 609-613
20.Wheby, M. S.,and Crosby, W. H. (1963) Blood 22, 416-428
21. Schümann, K., Osterloh, K., Forth, W. (1986) Blut 53, 391-400
22. Manis, J., and Schachter, D. (1962) Am. J. Physiol. 203, 73-80
23. Manis, J. (1971) Am. J. Physiol. 220, 135-139
24. Powell, L. W., Campbell, C. B., Wilson, E. (1970) Gut 11, 727-731
25. Schümann, K., Elsenhans, B., Forth, W. (1999) Am. J. Physiol. 276, G431-440
26. Greenberger, N. J., Ruppert, R. D., Cuppage, F. E. (1967) Gastroenterology 53, 590-
599 22
27. Howard, J., and Jacobs, A. (1972) Br. J. Haematol 23, 595-603
28. Vulpe, C. D., Kuo, Y. M., Murphy, T. L., Cowley, L., Askwith, C., Libina, N.,
Gitschier, J., Anderson, G. J. (1999) Nat. Genet. 21, 195-199.
29. Grewal, M. S. (1962) Genet. Res. 3, 238-247
30. Edwards, J. A., and Bannerman, R. M. (1970) J. Clin. Invest. 49,1869-1871
31. Bannerman, R. M., and Cooper, R. G. (1966) Science 151, 581-582
32. Bannerman, R. M., and Pinkerton, P. H. (1967) Br. J. Haematol. 13,1000-1013
33. Manis, J. (1971) Am. J. Physiol. 220, 135-139
34. Levy, J. E., Montross, L. K., and Andrews, N. C. (2000) J. Clin. Invest. 105, 1209-1216
35. Frazer, D. M., Vulpe, C. D., McKie, A. T., Wilkins, S. J., Trinder, D., Cleghorn, G. J. and Anderson, G. J. (2001) Amer. J. Physiol. In press.
36. Li, L., Attieh, Z., Su, T., Kaplan, J., Vulpe, C. (2001) Hephaestin, the product of the murine Sex-linked Anemia gene is a multicopper oxidase: Functional studies of hephaestin in yeast. Manuscript submitted.
37. Raja, K. B., Simpson, R. J., Peters, T. J. (1992) Biochim. Biophys. Acta. 1135, 141-146
38. Guo , B., Phillips, J. D., Yu , Y., Elizabeth, A. (1995) J. Biol. Chem. 270, 21645-21651
39. Iwai, K., Drake, S. K., Wehr, N. B., Weissman, A. M., LaVaute, T., Minato, N.,
Klausner, R. D., Levine, R. L., Rouault, T. A. (1998) Proc. Natl. Acad. Sci. USA 95, 4924-
4928
40. Hanson, E. S., Foot, L. M., and Leibold, E. A. (1999) J. Biol. Chem. 274, 5047-5052
41. Levy, A. P., Levy, N. S., and Goldberg, M. A. (1996) J. Biol. Chem. 271, 25492-25497
42. Levine, P. H., Levine, A. J., Weintraub, L. R. (1972) J. Lab. Clin. Med. 80, 333-341 23
43. Evans, G. W., and Grace, C. I. (1974) Proc. Soc. Exp. Biol. Med. 147, 687-689
44. Alvarez-Hernandez, X., Smith, M., Glass, J. (1994) Biochim. Biophys. Acta. 1192, 215-
222
45. Alvarez-Hernandez, X., Smith, M., Glass, J. (1998) Blood 91, 3974-3999
46. Morgan, E. H. (1980) Quarterly J. Exp. Physiol. Cognate Med. Sci. 65, 239-252
47. Bernstein, S. E. (1987) J. Lab. Clin. Med. 110, 690-705 24
FOOTNOTES
* This work was supported by NIH DK 56376 and DK57800.
1 The abbreviations used are: Hp or heph, Hephaestin; sla, sex-linked anemia mouse; RT, reverse transcriptase; PCR, polymerase chain reaction; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PBS, phosphate-buffered saline; PAGE, polyacrylamide gel electrophoresis; PPD, p-phenylenediamine;
IRE, iron response element.
2 Vulpe, C. D., Kuo, Y. M. et. al. GenBank Accession number AF082567.
ACKNOWLEDGEMENTS
We thank Dr. Yien-Ming Kuo and Dr. Jane Gitschier for providing anti-heph antibody, and thank Elizabeth Thiele for analysis of Heph transcription for IRE. We also thank Dr. Skin
Kawamata for helping FACScan analysis, and Dr. Jiri Petrak for useful discussions. 25
FIGURE LEGENDS
Figure 1. Antisera to Hephaestin identifies 155 kD protein.
A. A full length mouse heph cDNA with a C-terminal FLAG tag was isolated by RT-PCR from intestinal RNA from C57BL/6J and cloned into the pcDNA3.1 vector and is designated mHP. Similarly, a truncated version of heph encoding a protein lacking the C- terminal transmembrane domain but with a C-terminal FLAG was cloned into the same vector and is designated msHP. The clones were sequence verified.
B. Flow cytometric analysis of the transfected CHO cells. mHP was used to stably transfect CHO cells and one of the transfectant clones with the highest expression of full length heph was selected and used for flow cytometric analysis. The first panel shows non- specific staining with control rabbit IgG, the second shows histogram of staining with anti-
FLAG antisera, and the third panel demonstrated high and specific reactivity of anti-HP antisera with a mHp transfected CHO cell.
C. Anti-FLAG and Anti-HP antisera identify same protein. CHO cells were transfected with either the full-length cDNA for either HP (mHP) or the C-terminal truncated version
(smHP). In the first panel, the cell lysates were immunoprecipitated and detected on western blot with the anti-FLAG antibody. The anti-FLAG antibody immunoprecipitated a
155 kD protein from mHP transfected cells and 145 kD protein from smHP transfected cells and not from the parental CHO cells. In the second panel, the affinity purified anti-HP antisera immunoprecipitated a 155 kD protein from mHP transfected cells lines and did not immunoprecipitate the truncated protein which does not contain the epitope. 26
D. Sla mice express a smaller protein than wild type mice. Direct western analysis of
C57BL/6J and sla mice enterocytes lysates with anti-HP antisera identified a 155 kD protein in C57 BL/6J mice and a 130 kD protein in the sla mice.
Figure 2. Northern Blot analysis
A. A representative northern blot is shown of heph expression in the three dietary conditions. Total RNA was obtained isolated intestinal enterocytes from the mice on different diets for 8 weeks. The diets were a control diet with 40-50 ppm iron, a iron deficient diet with 2-3 ppm iron and a iron deficient diet for 6 weeks followed by 2 weeks on the control diet. The expression levels of heph mRNA was determined by Northern blot analysis of RNA using radiolabeled heph cDNA fragment as a probe (top panels). The same membrane was stripped and rehybridized with mouse GAPDH cDNA fragment as a probe as a loading and transfer control (bottom panels).
B. heph quantitative analysis by the Northern blot of enterocytes RNA from three independent dietary studies. All values were corrected for the loading differences by normalizing to the GAPDH mRNA intensity. Data represent the means ± SDM of ten separate experiments.
Figure 3. Western Blot analysis
A. Western blotting of HP expression in enterocytes. A representative direct western blot with anti-HP antisera of protein lysates of isolated intestinal enterocytes from the mice on 27
different diets is shown in the top panel. The second panel is western with anti-GAPDH antisera of the same blot for protein loading normalization.
B. Immunoprecipitation with anti-HP antisera of intestinal enterocyte lysates on three different diets shown a similar pattern of expression as direct western blot.
C. The average levels of enterocyte expression of HP protein in iron deficient (15 mice), iron deficient to iron replete (10 mice) and control mice (15 mice) group is shown. Data represent the means ± SDM of ten to fifteen separate experiments. ** Means HP protein expression level in iron deficient group is significantly different than other groups.
Figure 4. Reulation of PPD Oxidase Activity in mouse enterocytes.
A. In-gel PPD oxidase activity of mouse enterocytes. Non-denaturing "native" gel electrophoresis was used to separate the proteins of enterocytes cellular extracts isolated under non-denaturing conditions (1.5% TritonX-100). Lane 1 contains 40 micrograms of ceruloplasmin as positive control and Lane 2, 3, and 4 contain cellular extract. The gel was stained with PPD in acetate buffer.
B. Bar graph representation of densitometric analysis of the PPD activity of enterocytes. 28
Table 1 Serum and liver iron values in different groups of mice
¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾
Parameter Control Iron Deficient Iron Repleted
¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾
Serum Iron (mg/dL) 276 ± 6.0 177 ± 23.0 * 260 ± 55.0
TIBC (mg/dL) 557 ± 26.0 596 ± 15.0 559 ± 27.0
Transferrin Saturation (%) 48 ± 1.3 32 ± 1.8 47 ± 5.5
Hepatic Iron (mg/g wet weight) 142 ± 17 65 ± 25* 137 ± 21
¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾¾
TIBC indicates total iron binding capacity.
Values represent means ± SDM, n = 3.
* Show a significantly different at p < 0.05.