FXYD6-FXYD2 (NM 001243598) Human Untagged Clone Product Data

OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC330149

FXYD6-FXYD2 (NM_001243598) Human Untagged Clone Product data:

Product Type: Expression Plasmids Product Name: FXYD6-FXYD2 (NM_001243598) Human Untagged Clone Tag: Tag Free Symbol: FXYD6-FXYD2 Synonyms: FXYD6 Vector: pCMV6 series Fully Sequenced ORF: >NCBI ORF sequence for NM_001243598, the custom clone sequence may differ by one or more nucleotides

ATGGAGTTGGTGCTGGTCTTCCTCTGCAGCCTGCTGGCCCCCATGGTCCTGGCCAGTGCAGCTGAAAAGG AGAAGGAAATGGACCCTTTTCATTATGATTACCAGACCCTGAGGATTGGGGGACTGGTGTTCGCTGTGGT CCTCTTCTCGGTTGGGATCCTCCTTATCCTAAGGCCCCAGGAGATGAGGAAGCCCAGGTGGAGAACCTCA TCACCGCCAATGCAACAGAGCCCCAGAAAGCAGAGAACTGAAGTGCAGCCATCAGGTGGAAGGCGGCAGC CCCAAGGGGGACGTGGACCCGTTCTACTATGGCAGAAGATTCCGCTGTGGGGGCAATAA

Restriction Sites: SgfI-MluI ACCN: NM_001243598 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). RefSeq: NM_001243598.2, NP_001230527.1 RefSeq Size: 1122 bp RefSeq ORF: 339 bp Locus ID: 100533181 UniProt ID: A0A0A6YYL5

This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 FXYD6-FXYD2 (NM_001243598) Human Untagged Clone – SC330149

Gene Summary: This locus represents naturally occurring read-through transcription between the neighboring FXYD domain-containing ion transport regulator 6 (GeneID 53826) and sodium/potassium- transporting ATPase subunit gamma (GeneID 486) genes on chromosome 11. One read- through transcript produces a fusion protein that shares sequence identity with each individual gene product, while another read-through transcript encodes a protein that has a distinct C-terminus and only shares sequence identity with the upstream locus (GeneID 53826). [provided by RefSeq, Aug 2011] Transcript Variant: This variant (2) has multiple differences in the coding region, compared to variant 1, one of which results in a translational frameshift. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.