DOCSLIB.ORG

FXYD6-FXYD2 (NM 001243598) Human Untagged Clone Product Data

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
FXYD6-FXYD2 (NM 001243598) Human Untagged Clone Product Data OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC330149 FXYD6-FXYD2 (NM_001243598) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: FXYD6-FXYD2 (NM_001243598) Human Untagged Clone Tag: Tag Free Symbol: FXYD6-FXYD2 Synonyms: FXYD6 Vector: pCMV6 series Fully Sequenced ORF: >NCBI ORF sequence for NM_001243598, the custom clone sequence may differ by one or more nucleotides ATGGAGTTGGTGCTGGTCTTCCTCTGCAGCCTGCTGGCCCCCATGGTCCTGGCCAGTGCAGCTGAAAAGG AGAAGGAAATGGACCCTTTTCATTATGATTACCAGACCCTGAGGATTGGGGGACTGGTGTTCGCTGTGGT CCTCTTCTCGGTTGGGATCCTCCTTATCCTAAGGCCCCAGGAGATGAGGAAGCCCAGGTGGAGAACCTCA TCACCGCCAATGCAACAGAGCCCCAGAAAGCAGAGAACTGAAGTGCAGCCATCAGGTGGAAGGCGGCAGC CCCAAGGGGGACGTGGACCCGTTCTACTATGGCAGAAGATTCCGCTGTGGGGGCAATAA Restriction Sites: SgfI-MluI ACCN: NM_001243598 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). RefSeq: NM_001243598.2, NP_001230527.1 RefSeq Size: 1122 bp RefSeq ORF: 339 bp Locus ID: 100533181 UniProt ID: A0A0A6YYL5 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 FXYD6-FXYD2 (NM_001243598) Human Untagged Clone – SC330149 Gene Summary: This locus represents naturally occurring read-through transcription between the neighboring FXYD domain-containing ion transport regulator 6 (GeneID 53826) and sodium/potassium- transporting ATPase subunit gamma (GeneID 486) genes on chromosome 11. One read- through transcript produces a fusion protein that shares sequence identity with each individual gene product, while another read-through transcript encodes a protein that has a distinct C-terminus and only shares sequence identity with the upstream locus (GeneID 53826). [provided by RefSeq, Aug 2011] Transcript Variant: This variant (2) has multiple differences in the coding region, compared to variant 1, one of which results in a translational frameshift. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.
Load more

Recommended publications
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • Identification of FXYD Protein Genes in a Teleost
    CORE Metadata, citation and similar papers at core.ac.uk Provided by University of Southern Denmark Research Output Am J Physiol Regul Integr Comp Physiol 294: R1367–R1378, 2008. First published February 6, 2008; doi:10.1152/ajpregu.00454.2007. Identification of FXYD protein genes in a teleost: tissue-specific expression and response to salinity change Christian Kølbæk Tipsmark Institute of Biology, University of Southern Denmark, Odense, Denmark Submitted 26 June 2007; accepted in final form 1 February 2008 Tipsmark CK. Identification of FXYD protein genes in a teleost: developmental- and tissue-specific manner, suggesting partic- tissue-specific expression and response to salinity change. Am J ular roles during development or coupled to specific physio- Physiol Regul Integr Comp Physiol 294: R1367–R1378, 2008. First logical functions (10, 40). The FXYD proteins are, in many published February 6, 2008; doi:10.1152/ajpregu.00454.2007.—It is cases, expressed in a tissue-specific manner (6, 12, 15), and, increasingly clear that alterations in Naϩ-Kϩ-ATPase kinetics to fit along the collecting duct of the rat kidney, FXYD isoform Downloaded from the demands in specialized cell types is vital for the enzyme to execute expression is differentiated among segments and cell types (41, its different physiological roles in diverse tissues. In addition to 48). Specific interactions with FXYD proteins may, therefore, tissue-dependent expression of isoforms of the conventional subunits, ϩ ϩ ␣ and ␤, auxiliary FXYD proteins appear to be essential regulatory add to the versatility of the Na -K -ATPase in various tissues, components. The present study identified genes belonging to this and they can be regarded as tissue-specific modulators of ion family in Atlantic salmon by analysis of expressed sequence tags.
    [Show full text]
  • A Genomic View of Estrogen Actions in Human Breast Cancer Cells by Expression Profiling of the Hormone-Responsive Transcriptome
    719 A genomic view of estrogen actions in human breast cancer cells by expression profiling of the hormone-responsive transcriptome Luigi Cicatiello1, Claudio Scafoglio1, Lucia Altucci1, Massimo Cancemi1, Guido Natoli1, Angelo Facchiano2, Giovanni Iazzetti3, Raffaele Calogero4, Nicoletta Biglia6, Michele De Bortoli5,7, Christian Sfiligoi7, Piero Sismondi6,7, Francesco Bresciani1 and Alessandro Weisz1 1Dipartimento di Patologia generale, Seconda Università degli Studi di Napoli, Vico L. De Crecchio 7, 80138 Napoli, Italy 2Istituto di Scienze dell’Alimentazione del Consiglio Nazionale delle Ricerche, Avellino, Italy 3Dipartimento di Genetica, Biologia generale e molecolare, Università di Napoli ‘Federico II’, Napoli, Italy 4Dipartimento di Scienze cliniche e biologiche, Università degli Studi di Torino, Torino, Italy 5Dipartimento di Scienze oncologiche, Università degli Studi di Torino, Torino, Italy 6Dipartimento di Discipline ostetriche e ginecologiche, Università degli Studi di Torino, Torino, Italy 7Laboratorio di Ginecologia oncologica, Istituto per la Ricerca e la Cura del Cancro, Candiolo, Italy (Requests for offprints should be addressed to A Weisz; Email: [email protected]) Abstract Estrogen controls key cellular functions of responsive cells including the ability to survive, replicate, communicate and adapt to the extracellular milieu. Changes in the expression of 8400 genes were monitored here by cDNA microarray analysis during the first 32 h of human breast cancer (BC) ZR-75·1 cell stimulation with a mitogenic dose of 17-estradiol, a timing which corresponds to completion of a full mitotic cycle in hormone-stimulated cells. Hierarchical clustering of 344 genes whose expression either increases or decreases significantly in response to estrogen reveals that the gene expression program activated by the hormone in these cells shows 8 main patterns of gene activation/inhibition.
    [Show full text]
  • Comparative Transcriptome Profile Between Iberian Pig Varieties
    animals Article Comparative Transcriptome Profile between Iberian Pig Varieties Provides New Insights into Their Distinct Fat Deposition and Fatty Acids Content Ana Villaplana-Velasco 1,2, Jose Luis Noguera 3, Ramona Natacha Pena 4 , Maria Ballester 5, Lourdes Muñoz 6, Elena González 7 , Juan Florencio Tejeda 7 and Noelia Ibáñez-Escriche 8,* 1 Genetics and Genomics, The Roslin Institute, Royal (Dick) School of Veterinary Studies, The University of Edinburgh, Easter Bush Campus, Midlothian, Edinburgh EH25 9RG, UK; [email protected] 2 Centre for Medical Informatics, Usher Institute, The University of Edinburgh, 9 Little France Road, Edinburgh EH16 4UX, UK 3 Animal Breeding and Genetics Program, IRTA, 25198 Lleida, Spain; [email protected] 4 Departament de Ciència Animal, Universitat de Lleida-Agrotecnio Center, 25198 Lleida, Spain; [email protected] 5 Animal Breeding and Genetics Program, IRTA, Torre Marimon, 08140 Caldes de Montbui, Spain; [email protected] 6 INGA FOOD S.A, 06200 Almendralejo, Spain; [email protected] 7 Department of Animal Production and Food Science, Research University Institute of Agricultural Resources (INURA), Escuela de Ingenierías Agrarias, Universidad de Extremadura, 06007 Badajoz, Spain; [email protected] (E.G.); [email protected] (J.F.T.) 8 Department for Animal Science and Tecnology, Universistat Politécnica de València, 46022 Valencia, Spain * Correspondence: [email protected]; Tel.: +34-963-877-438 Citation: Villaplana-Velasco, A.; Noguera, J.L.; Pena, R.N.; Ballester, Simple Summary: Iberian pigs are meat quality models due to their high fat content, high intra- M.; Muñoz, L.; González, E.; Tejeda, J.F.; Ibáñez-Escriche, N.
    [Show full text]
  • FXYD5 (Dysadherin) Upregulation Predicts Shorter Survival and Reveals Platinum Resistance in High-Grade Serous Ovarian Cancer Patients
    www.nature.com/bjc ARTICLE Molecular Diagnostics FXYD5 (Dysadherin) upregulation predicts shorter survival and reveals platinum resistance in high-grade serous ovarian cancer patients Renata A. Tassi1, Angela Gambino2, Laura Ardighieri3, Eliana Bignotti1,4, Paola Todeschini1, Chiara Romani1,5, Laura Zanotti1, Mattia Bugatti3, Fulvio Borella6, Dionyssios Katsaros6, Germana Tognon4, Enrico Sartori2, Franco Odicino2, Chiara Romualdi7 and Antonella Ravaggi 1 BACKGROUND: High-grade serous ovarian carcinoma (HGSOC) is generally associated with a very dismal prognosis. Nevertheless, patients with similar clinicopathological characteristics can have markedly different clinical outcomes. Our aim was the identification of novel molecular determinants influencing survival. METHODS: Gene expression profiles of extreme HGSOC survivors (training set) were obtained by microarray. Differentially expressed genes (DEGs) and enriched signalling pathways were determined. A prognostic signature was generated and validated on curatedOvarianData database through a meta-analysis approach. The best prognostic biomarker from the signature was confirmed by RT-qPCR and by immunohistochemistry on an independent validation set. Cox regression model was chosen for survival analysis. RESULTS: Eighty DEGs and the extracellular matrix-receptor (ECM-receptor) interaction pathway were associated to extreme survival. A 10-gene prognostic signature able to correctly classify patients with 98% of accuracy was identified. By an ‘in-silico’ meta- analysis, overexpression of FXYD domain-containing ion transport regulator 5 (FXYD5), also known as dysadherin, was confirmed in HGSOC short-term survivors compared to long-term ones. Its prognostic and predictive power was then successfully validated, both at mRNA and protein level, first on training than on validation sample set. CONCLUSION: We demonstrated the possible involvement of FXYD5 and ECM-receptor interaction signal pathway in HCSOC survival and prognosis.
    [Show full text]
  • Regulation of the Cardiac Na+/K+-Atpase by Phospholemman
    Regulation of the cardiac Na+/K+-ATPase by phospholemman Hansraj Dhayan1, Rajender Kumar2 & Andreas Kukol1* Short title: Phospholemman 1) School of Life and Medical Sciences, University of Hertfordshire, College Lane, Hatfield AL10 9AB, United Kingdom 2) Department of Pharmacoinformatics, National Institute of Pharmaceutical Information and Research, S.A.S. Nagar. 160062, Punjab, INDIA *) Corresponding author: E-mail: [email protected], Tel.: +44-(0)1707 284 543, FAX: +44-(0)1707 285 046 Citation: Dhayan H, Kumar R, Kukol A (2016) Regulation of the Cardiac Na+/K+-ATPase by Phospholemman. In Regulation of Membrane Na+-K+ ATPase, Chakraborti S, Dhalla NS (eds), Vol. 15, 15, pp 261-276. Springer International Publishing 1 Abstract Phospholemman (PLM) is a regulatory subunit of the cardiac Na+/K+-ATPase (NKA), but exists also as an independent tetramer. The membrane spanning protein consists of 72 amino acid residues and is the first member of the FXYD motif-containing family of tissue specific NKA regulatory subunits (FXYD1). A comparative model of the human PLM/NKA complex shows the interactions between NKA and the extracellular FXYD motif as well as the transmembrane helix-helix interactions. A variety of intracellular posttranslational modifications points to a highly dynamic picture of interactions between NKA and the intracellular part of PLM. Posttranslational modifications of PLM include NKA-activating phosphorylation, inhibiting palmitoylation and activating glutathionylation. PLM gene expression has the potential for posttranscriptional regulation by the formation of potassium-ion stabilised G-quadruplex structures in pre-splicing mRNA. The overall physiological role of cardiac PLM is to protect the heart under conditions of increased heart rate and oxidative stress avoiding calcium overload of the cytoplasm and arrhythmias.
    [Show full text]
  • FXYD5 Modulates Na,K-Atpase Activity and Is Increased in Cystic Fibrosis Airway Epithelia
    FXYD5 MODULATES NA,K-ATPASE ACTIVITY AND IS INCREASED IN CYSTIC FIBROSIS AIRWAY EPITHELIA By TIMOTHY J. MILLER Submitted in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Dissertation Advisor: Dr. Pamela B. Davis Department of Pharmacology CASE WESTERN RESERVE UNIVERSITY May, 2008 Case Western Reserve University School of Graduate Studies We hereby approve the dissertation of Timothy J. Miller candidate for the Ph.D degree *. (signed) Michael Maguire (chair of the committee) Pamela Davis Mitch Drumm Ruth E. Siegel ___________________________ Date March 21, 2008 * We also certify that written approval has been obtained for any proprietary material contained therein. ii DEDICATION The achievement of any worthwhile goal is often accomplished through hard work and commitment. It is often easier to succor such accolades with the inspiration of a beautiful wife and son. For her love, patience and guidance throughout our journey, her supremely generous and kind nature, and the joy of my life, I dedicate this thesis to my wife, Molly Megan Gallogly, and my son, Gavin Bryce Miller. iii TABLE OF CONTENTS LIST OF TABLES……………………………………………………………………. vii LIST OF FIGURES………………………………………………………………….. viii LIST OF ABBREVIATIONS…………………………………………………………. ix ACKNOWLEDGEMENTS……………………………………………………...……. xi ABSTRACT………………………………………………………………………….. xiv CHAPTER 1: BACKGROUND…………………………………………………….….1 Cystic Fibrosis is caused by defective ion transport……………………..….1 Na+ hyperabsorption and airway surface liquid dehydration…………….....3 The
    [Show full text]
  • Expression Profiling of Macrophages Reveals Multiple Populations With
    Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021 M. is online at: average * The Journal of Immunology published online 12 February 2016 from submission to initial decision 4 weeks from acceptance to publication http://www.jimmunol.org/content/early/2016/02/11/jimmun ol.1502364 Expression Profiling of Macrophages Reveals Multiple Populations with Distinct Biological Roles in an Immunocompetent Orthotopic Model of Lung Cancer Joanna M. Poczobutt, Subhajyoti De, Vinod K. Yadav, Teresa T. Nguyen, Howard Li, Trisha R. Sippel, Mary C. Weiser-Evans and Raphael A. Nemenoff J Immunol Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/02/11/jimmunol.150236 4.DCSupplemental Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 27, 2021. Published February 12, 2016, doi:10.4049/jimmunol.1502364 The Journal of Immunology Expression Profiling of Macrophages Reveals Multiple Populations with Distinct Biological Roles in an Immunocompetent Orthotopic Model of Lung Cancer Joanna M. Poczobutt,* Subhajyoti De,* Vinod K.
    [Show full text]