Identification of FXYD Protein Genes in a Teleost

CORE Metadata, citation and similar papers at core.ac.uk

Provided by University of Southern Denmark Research Output Am J Physiol Regul Integr Comp Physiol 294: R1367–R1378, 2008. First published February 6, 2008; doi:10.1152/ajpregu.00454.2007.

Identiﬁcation of FXYD protein genes in a teleost: tissue-speciﬁc expression and response to salinity change

Christian Kølbæk Tipsmark Institute of Biology, University of Southern Denmark, Odense, Denmark Submitted 26 June 2007; accepted in ﬁnal form 1 February 2008

Tipsmark CK. Identification of FXYD protein genes in a teleost: developmental- and tissue-specific manner, suggesting partic- tissue-specific expression and response to salinity change. Am J ular roles during development or coupled to specific physio- Physiol Regul Integr Comp Physiol 294: R1367–R1378, 2008. First logical functions (10, 40). The FXYD proteins are, in many published February 6, 2008; doi:10.1152/ajpregu.00454.2007.—It is cases, expressed in a tissue-specific manner (6, 12, 15), and, increasingly clear that alterations in Naϩ-Kϩ-ATPase kinetics to fit along the collecting duct of the rat kidney, FXYD isoform Downloaded from the demands in specialized cell types is vital for the enzyme to execute expression is differentiated among segments and cell types (41, its different physiological roles in diverse tissues. In addition to 48). Specific interactions with FXYD proteins may, therefore, tissue-dependent expression of isoforms of the conventional subunits, ϩ ϩ ␣ and ␤, auxiliary FXYD proteins appear to be essential regulatory add to the versatility of the Na -K -ATPase in various tissues, components. The present study identified genes belonging to this and they can be regarded as tissue-specific modulators of ion family in Atlantic salmon by analysis of expressed sequence tags. transport. In addition, FXYD1, FXYD2, and FXYD10 also Based on the conserved domain of these small membrane proteins, seem to operate as regulatory subunits responsive to exterior

ϩ ϩ http://ajpregu.physiology.org/ eight expressed FXYD isoforms were identified. Phylogenetic analy- signals, since the interaction with Na -K -ATPase in these iso- sis suggests that six isoforms are homologues to the previously forms is altered by PKA and PKC phosphorylation (18, 25, 43). identified FXYD2, FXYD5, FXYD6, FXYD7, FXYD8, and FXYD9, Little is known about the presence and function of FXYD while two additional isoforms were found (FXYD11 and FXYD12). proteins in nonmammalian vertebrates. In spiny dogfish (Squa- Using quantitative PCR, tissue-dependent expression of the different lus acanthias), a FXYD protein has been characterized and isoforms was analyzed in gill, kidney, intestine, heart, muscle, brain, cloned (FXYD10, Ref. 44). In teleosts, three FXYD isoforms and liver. Two isoforms were expressed in several tissues (FXYD5 were identified among expressed sequence tags (ESTs) from and FXYD9), while six isoforms were distributed in a discrete zebrafish by Sweadner and Rael (55). In several teleost species, manner. In excitable tissues, two isoforms were highly expressed in ϩ tissue-dependent expression of the ␣-subunit isoforms of Na - brain (FXYD6 and FXYD7) and one in skeletal muscle (FXYD8). In ϩ osmoregulatory tissues, one isoform was expressed predominantly K -ATPase has been observed (20, 30, 52). Recently, it was

in gill (FXYD11), one in kidney (FXYD2), and one equally in kidney suggested that, in rainbow trout, a shift in salinity between by 10.220.33.6 on January 9, 2017 and intestine (FXYD12). Expression of several FXYD genes in fresh water (FW) and seawater (SW) is associated with a shift kidney and gill differed between fresh water and seawater salmon, in branchial expression of two of these isoforms (␣1a and ␣1b; suggesting significance during osmoregulatory adaptations. In addi- Ref. 49). FXYD proteins may well have regulatory influence tion to identifying novel FXYD isoforms, these studies are the first to on both cellular and transepithelial ion transport in teleosts, show the tissue dependence in their expression and modulation by similar to what is known for mammals. For example, during salinity in any teleosts. transitions between FW and SW, expression of FXYD proteins may contribute to the switch from hyper- to hypoosmoregula- Atlantic salmon; sodium-potassium-adenosinediphosphatase; osmo- ϩ ϩ regulation; Salmo salar; quantitative polymerase chain reaction tion by altering the kinetic behavior of Na -K -ATPase in branchial chloride cells and in epithelial cells of other osmoregulatory tissues. In addition, due to the sensitivity of some DURING THE LAST DECADE, THERE has been an increasing focus on FXYD proteins to kinase signaling, they may also be involved in the role of FXYD proteins in regulation of cellular ion trans- altered tissue responsiveness to endocrine or paracrine signals. port. FXYD proteins constitute a family of small proteins with Despite the importance of FXYD proteins in determining ion a single transmembrane segment (for review, see Refs. 17, 26, transport characteristics in mammalian tissues, studies of these 28). They are named after the conserved extracellular motif, potential regulators in teleosts are, however, largely missing. The and all have a high degree of homology in a 35-amino acid propositions of the present study are as follows: 1) there may be stretch adjacent to and in the transmembrane domain, whereas more teleost FXYD isoforms than the three identified in zebrafish homology outside this area is low (55). In mammals, eight (55); 2) some isoforms may be expressed in a tissue-specific different FXYD isoforms have been identified, and association manner; and 3) salinity change may induce altered expression with the Naϩ-Kϩ-ATPase has been reported to affect the patterns in osmoregulatory tissues. The anadromous Atlantic ϩ ϩ enzyme affinity for substrate (Na ,K , and ATP) and/or Vmax salmon were used as the choice model to test these hypotheses. (e.g., FXYD1, Ref. 39; FXYD2, Ref. 4; FXYD3, Ref. 19; METHODS FXYD4, Ref. 6; FXYD5, Ref. 41; FXYD7, Ref. 7). It is well established that three of four mammalian isoforms of the Fish and sampling. One-year-old Atlantic salmon (Salmo salar, catalytic ␣-subunit of Naϩ-Kϩ-ATPase are expressed in a A¨ tran stock) were obtained in early March from The Danish Centre

Address for reprint requests and other correspondence: C. K. Tipsmark, The costs of publication of this article were defrayed in part by the payment Institute of Biology, Univ. of Southern Denmark, Campusvej 55, DK-5230 of page charges. The article must therefore be hereby marked “advertisement” Odense M, Denmark (e-mail: [email protected].). in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

http://www.ajpregu.org 0363-6119/08 $8.00 Copyright © 2008 the American Physiological Society R1367 R1368 EXPRESSION OF FXYD GENES IN A TELEOST for Wild Salmon (Randers, Denmark; http://www.vildlaks.dk/). They genes were chosen as a mammalian representative with FXYD1 were kept at a constant photoperiod (12:12-h light-dark) in recircu- (EDL23964), FXYD2 (EDL25650), FXYD3 (EDL23956), FXYD4 lated FW in indoor 500-liter tanks on the Odense Campus of the (EDK99588), FXYD5 (EDL23967), FXYD6 (AAH42579), and University of Southern Denmark until sampling in January, when the FXYD7 (EDL23965). Three chicken (Gallus gallus) representatives fish weight was 100–150 g. SW-acclimated fish were obtained by were found: a chicken protein similar to mouse FXYD2 (expect value transferring a batch of fish to 28 parts per thousand (ppt) artificial SW 6e-12; BX931806), a chicken protein weakly similar to mouse (Red Sea, Eliat, Israel) 2 wk before sampling. The fish were fed ad FXYD5 (expect value 1e-6; BU252825), and chicken FXYD6 libitum three times a week with pelleted trout feed. When sampled, (NP001074348). Amphibian representatives were found in the Afri- fish were stunned with a blow to the head, and blood was collected can clawed frog (Xenopus laevis): frog FXYD1 (NP001091365), frog with a heparinized syringe from the caudal vessels after which the fish FXYD2 (NP001081551), frog protein similar to mouse FXYD3 (ex- was killed. The first gill arch, posterior trunk kidney, anterior intes- pect value 9e-19; CX132847), a long frog FXYD5-like protein tine, heart, muscle, brain, and liver were dissected and, when needed, (BC085206), frog FXYD6 (NP001086408), and frog protein weakly trimmed free of cartilage, fat, and connective tissue and then instantly similar to mouse FXYD7 (expect value 7e-8; CF548198). A known frozen in liquid N2 until analysis. The experimental protocols were elasmobranch FXYD protein from spiny dogfish (Squalus Acanthias) approved by the Danish Animal Experiments Inspectorate, in accor- was included (FXYD10, AJ556170). A sea lamprey (Petromyzon

dance with the European convention for the protection of vertebrate marinus) protein weakly similar to mouse FXYD1 (expect value Downloaded from animals used for experiments and other scientific purposes (no. 6e-10; CO551377) was used as the outgroup. 86/609/EØF). The predicted FXYD genes from Atlantic salmon and zebrafish Extraction of RNA and cDNA synthesis. Total RNA was extracted (Danio rerio), together with those of mouse and other vertebrates, by the TRIzol procedure (Invitrogen, Carlsbad, CA) using maximally were aligned using ClustalW. A majority rule consensus tree was 100 mg tissue/ml TRIzol, according to manufacturer’s recommenda- generated using SEQBOOT, PROML, and CONSENSE, all programs tions. Total RNA concentrations were determined by measuring ratio in the PHYLIP package (22). Maximum likelihood (ML) was used for of absorbance at 260 nm to that at 280 nm in duplicate with a the phylogenetic tree construction. A total of 1,000 bootstraps were http://ajpregu.physiology.org/ NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, used to test the consistency of the grouping within the tree. A Wilmington, DE). Purity (ratio of absorbance at 260 nm to that at 280 parsimonious model was used to further evaluate the main nodes found nm) ranged from 1.9 to 2.2. One-microgram RNA was treated with 1 with the ML method, also with the PHYLIP package (SEQBOOT, unit RQ1 DNase (Promega, Madison, WI) for 40 min at 37°C in a PROTPARS, and CONSENSE). total volume of 10 ␮l, followed by 10 min at 65°C to inactivate RQ1 Primers. Primers specifically detecting the deduced sequences were DNase. Single-stranded cDNA was synthesized by reverse tran- designed using Primer3 software (50) and checked using NetPrimer scription carried out on 1-␮g DNase-treated RNA using 0.5 ␮g software (Premier Biosoft International). Primer sequences are listed oligo(dT)12–18 primers (Invitrogen) and 200 units Superscript II re- in Table 1. They were in all cases designed to detect multiple verse transcriptase (Invitrogen) for1hat42°C in a reaction volume transcript variants of the specific isoforms, when such were found. of 25 ␮l. At the end, the reaction mixture was heated to 70°C for 10 Primers were tested for nonspecific product amplification and primer- min and then kept at Ϫ20°C until use. dimer formation by analysis of melting curve and agarose gel verifi-

FXYD sequences. Sequences were obtained from GenBank (9). For cation of amplicon size. In addition, the PCR product of the specific by 10.220.33.6 on January 9, 2017 most of the work, the bioinformatics tools available at the National primers was separated on a low-melting agarose gel, purified on spin Center for Biotechnology Information (www.ncbi.nlm.nih.gov) and columns (Geneclean Turbo kit; QBIOgene, Irvine, CA), and se- ExPASy proteomics server of the Swiss Institute of Bioinformatics quenced (DNA Technology A/S; Aarhus, Denmark). In all cases, the (http://www.expasy.org/sprot/) (27) were applied. The main search products matched the deduced sequences and confirmed the covered tool was Basic Local Alignment Search Tool (BLAST) (3), and the consensus fragments. All primers were synthesized by DNA Tech- conserved regions in FXYD proteins previously found were used to nology A/S. search the salmonid EST database. Multiple alignments were per- Real-time PCR. Quantitative real-time PCR analysis using formed with ClustalW server at the European Bioinformatics Institute SYBRgreen detection was carried out on a Mx3000p instrument (http://www.ebi.ac.uk/clustalw) (31), and consensus sequences were (Stratagene, La Jolla, CA) using standard software settings with generated in Jalview 2.2 (16). adaptive baseline for background detection, moving average, and The deduced consensus sequences have been submitted to the amplification-based threshold settings with built-in FAM/SYBR filter Third Party Annotation database (BK006241–BK006254). Nucleotide (excitation wavelength: 492 nm; emission wavelength: 516 nm). consensus sequences were translated to protein with the translate Reactions were carried out with 1 ␮l cDNA (40 ng RNA), 4 pmol resource at the ExPASy server, and sequences were aligned with forward and reverse primer, and 12.5 ␮lof2ϫ Brilliant SYBRgreen ClustalW and JalView 2.2. The amino acid sequences of the salmon master mix (Stratagene) in a total volume of 25 ␮l. Cycling conditions FXYD proteins were used to identify putative membrane domains by were 95°C for 30 s, 60°C for 60 s, and 95°C for 60 s in 50 cycles. means of the HMMTOP server and TMHMM Server version 2.0 for Melting curve analysis was carried out consistently with 30 s for each predicting transmembrane helices and topology of proteins [http:// 1°C interval from 55 to 95°C. For each primer set, cDNA was diluted www.enzim.hu/hmmtop/ (58) and http://www.cbs.dtu.dk/services/ 2, 4, 8, and 16 times and analyzed by real-time PCR to establish TMHMM-2.0/ (38, 53), respectively]. The NetPhos 2.0 server neural amplification efficiency. network was used for predictions of kinase-specific serine, threonine, The amplification efficiency for each primer set was used for and tyrosine phosphorylation sites (http://www.cbs.dtu.dk/services/ calculation of relative copy numbers of individual target genes. For NetPhosK/) (11). Potential N-glycosylation was predicted by the normalization of gene expression, elongation factor (EF)-1␣ was used NetNglyc server (http://www.cbs.dtu.dk/services/NetNGlyc/) (35). in accordance with Olsvik and coworkers (46). No significant differ- Potential O-glycosylation was predicted by the NetOglyc server ences were observed between groups in their expression of EF-1␣ (http://www.cbs.dtu.dk/services/NetOGlyc/) (34). The SignalP 3.0 normalized to total RNA. Relative copy number of the target genes (⌬Ct) server was used to predict the presence and location of signal peptide was calculated as Ea , where Ct is the threshold cycle number, and cleavage sites in the amino acid sequences (http://www.cbs.dtu.dk/ Ea is the amplification efficiency. Normalized units were obtained by services/SignalP/) (8). dividing relative copy number of FXYD genes with relative copy Phylogenetic analysis. Protein sequences and hypothetical amino number of EF-1␣. acid sequences deduced from nucleotide sequences of nonteleost Statistics. Data were analyzed by one-way ANOVA when the FXYD proteins were obtained from GenBank. Mouse (Mus musculus) assumption of homogeneity of variance was met, as tested by Lev-

AJP-Regul Integr Comp Physiol • VOL 294 • APRIL 2008 • www.ajpregu.org EXPRESSION OF FXYD GENES IN A TELEOST R1369 Table 1. Primer sequences for mRNA quantiﬁcation of Atlantic salmon FXYD genes by real-time PCR

Gene Primer Sequence (5Ј33Ј) Amplicon Size, bp Gene Sequence Reference (Accession No.) FXYD2 Left: ATGGGTGGAGAAACATCACA 114 BK006252 Right: AGCAATACCCAGGCAGAAGA FXYD5a,b Left: GCAAAGTGGGATGAACCATT 120 BK006253, BK006254 Right: CCGGCATACTTTACCACAGC FXYD6 Left: CTGGTCTTTGGCGTGGTACT 109 BK006241 Right: TGGGCTTCTTCTCCTGATTG FXYD7a,b Left: GAGTCATCATGGGAGGTGCT 117 BK006245, BK006246 Right: CTGGGTGTGCACCATACTTG FXYD8 Left: CCTCATCGTCAGCCAGAAAT 107 BK006242 Right: CTTCACATCACTGGGGACCT FXYD9a,b Left: TGGAGATCAGAGGTGTGCTG 119 BK006243, BK006244 Right: GTCTGTGTGTGCTTGCTGGT FXYD11a,b Left: CTCTGTGCATTCTTCGTGGA 115 BK006247, BK006248

Right: GGACAAACAATCCACCTGCT Downloaded from FXYD12a,b,c Left: GCTCCTGAGTACGACCCTGA 89 BK006249, BK006250, BK006251 Right: ATCATGATGACCGCAACAAA EF-1␣ Left: AGAACCATTGAGAAGTTCGAGAAG 71 AF321836 Right: GCACCCAGGCATACTTGAAAG EF-1␣, elongation factor-1␣. http://ajpregu.physiology.org/ ene’s test. In most cases, examination of the data sets was carried out quences that incorrectly are grouped with 26,033 sequences in by Kruskal-Wallis nonparametric one-way ANOVA. Differences be- Ssa.423. In the present study, the relevant sequences were tween means were assessed by Student’s t-test or Mann-Whitney assembled into separate contigs and dealt with individually. U-test, as appropriate, followed by Bonferroni adjustment for a priori Seven FXYD isoforms were found in the EST sequences chosen number of comparisons. Significance was set at ␣ϭ0.05. All tests were performed using Simstat (version 2.5.5 for Windows, by available for rainbow trout (Oncorhynchus mykiss) and Japa- Provalis Research, Montreal, QC, Canada). nese medaka (Oryzias latipes) and eight isoforms for zebrafish. Amino acid homology to their apparent Atlantic salmon ortho- RESULTS logues is shown in Table 2. The FXYD protein identified in Ssa.7814 differs from the others in having a much longer Salmonid FXYD genes. The conserved regions in FXYD amino-terminal segment, and, in this case, the nucleotide protein sequences found in mammals, zebrafish, and spiny Ј Ј by 10.220.33.6 on January 9, 2017 dogfish (40, 51) were used to search the salmonid EST data- consensus sequences were extended 5 and 3 by means of base, which is accessible through GenBank. Related protein overlapping ESTs. For some isoforms, two abundant transcript coding sequences derived from ESTs were found by their variants with changes in the coding region were found. For homology with the known amino acid sequences. Correspond- three isoforms (FXYD2, FXYD6, and FXYD8), the available ing nucleotide sequences of ESTs were aligned, and consensus number of ESTs is relatively low, and determining differential sequences were generated. transcripts is limited by the redundancy. For the other isoforms, The FXYD sequences were found to be organized in six “a” and “b” isotypes are based on an approximately equal Unigenes for Atlantic salmon (FXYD2: Ssa.25839; FXYD5: number of ESTs, and a higher redundancy gives the sequences Ssa.7814; FXYD6: Ssa.2060; FXYD7: Ssa.23766; FXYD8: good quality. In the case of FXYD12, three transcript variants Ssa.13359; FXYD9: Ssa.10273), with homologous sequences were detected and are denoted “a”, “b”, and “c”. found in rainbow trout for all but Ssa.25839. In addition, two Homology examination and phylogenetic analysis. In the Unigenes in rainbow trout (FXYD11: Omy.10988; FXYD12: present study, a classification of teleost FXYD isoforms is Omy.13072) were also clearly contigs representing FXYD proposed based on their homology to the known isoforms proteins and 97–100% homologous to Atlantic salmon se- (Table 3) and phylogenetic analysis (Fig. 1) and is supported

Table 2. Percent amino acid identity of Atlantic salmon FXYD isoforms compared with teleost homologues

Rainbow Trout Zebraﬁsh Japanese Medaka

Atlantic Salmon % Reference Sequence No. % Reference Sequence No. % Reference Sequence No. FXYD2 80 Dr.92641 FXYD5 100 Omy.27290, Omy38157 62 Dr.133190 62 Ola.17166 FXYD6 82 CA361514 68 Dr.26591 68 Ola.12634 FXYD7 85 CA382418 68 Dr.74809 68 Ola.522 FXYD8 97 Omy.16702 74 Dr.112766 77 Ola.6321 FXYD9 100 Omy.4273 91 Dr.81748 91 Ola.539 FXYD11 100 Omy.30681 57 Dr.10650 62 Ola.3854 FXYD12 97 BX871395, BX883313 57 Dr.34220 57 Ola.7172 For clarity, only “a” variants are used when more than one transcript variant was identiﬁed. Homologies are for the 35 amino acids of the conserved region. Reference sequences are indicated as accession no. or Unigene no. when applicable. Omy, Oncorhynchus mykiss; Dr, Danio rerio; Ola, Oryzias latipes.

AJP-Regul Integr Comp Physiol • VOL 294 • APRIL 2008 • www.ajpregu.org R1370 EXPRESSION OF FXYD GENES IN A TELEOST FXYD12aSsa Ͼ 0.1 Ͼ 0.1 FXYD11aSsa Ͼ 0.1 Downloaded from FXYD9aSsa Ͼ 0.1 http://ajpregu.physiology.org/ FXYD8Ssa 0.002 37/51 4e-08 36/46 0.043 32/53 0.005 33/47 Ͼ 0.1 by 10.220.33.6 on January 9, 2017

FXYD7aSsa Fig. 1. Phylogenetic analysis of FXYD proteins based on amino acid se- Ͼ 0.1 Ͼ 0.1 quences and using maximum likelihood. The tree was generated using FXYD protein sequences from mouse [Mus musculus (Mm)], chicken [Gallus gallus (Gga)], African clawed frog [Xenopus laevis (Xla)], spiny dogfish [Squalus Acanthias (Squ)], zebrafish [Danio rerio (Dr)], and Atlantic salmon [Salmo salar (Ssa)]. A sea lamprey member of the gene family was used as the outgroup (accession no. CO551377). Numbers represent bootstrap values in percentage of 1,000 replicates. Teleost isoforms were classified according to (salmon).

FXYD6Ssa their position in the phylogenetic tree, along with other characteristics common among the isoforms in different phyla. Ͼ 0.1 3e-04 32/60 2e-05 26/37 1e-06 40/73 3e-04 27/45 0.001 31/55 0.004 33/60 1e-05 41/62

Salmo salar by specific characters, like tissue distribution and glycosylation domains. In general, conservation of sequence outside the membrane domain is limited, making phylogenetic analysis difficult. The homology of the proposed salmon and zebrafish FXYD5aSsa

(mouse); Ssa, FXYD2 to its mammalian counterpart is somewhat greater than 0.047 23/34 7e-05 32/51 0.048 24/49 9e-07 36/56 6e-12 38/66 9e-05 32/50 0.063 25/44 9e-04 40/76 5e-04 28/46 0.009 26/42 2e-04 32/49 3e-05 29/51 0.068 22/36 Ͼ 0.1 Ͼ 0.1 Ͼ 0.1 to other isoforms (Table 3), and phylogenetic analysis includes this teleost isoform in a clade with mammalian, amphibian, and bird isoforms (Fig. 1). The proposed FXYD5 is very weakly similar to mouse FXYD5 (Table 3). It shares a node with the Mus musculus mammalian and the putative chicken FXYD5 and, for the latter, with a bootstrap value of 67 (Fig. 1). The FXYD6 and FXYD2Ssa FXYD8 are both very clearly grouped with their previously E Value Similarity E Value Similarity E Value Similarity E Value Similarity E Value Similarity E Value Similarity E Value Similarity E Value Similarity Ͼ 0.1 Ͼ 0.1 Ͼ 0.1 Ͼ 0.1 described zebraﬁsh homologue (Fig. 1; Ref. 55) and are both most similar to tetrapod FXYD6 (Fig. 1, Table 3). The pre- Amino acid similarity of salmon FXYD proteins vs. mouse isoforms found with blastp at National Center for Biotechnology Information sumed salmon FXYD7 is weakly similar to the mouse counterpart (expect value ϭ 1e-06, Table 1). Phylogenetic analysis

Isoform groups teleost FXYD7 with mammalian and amphibian iso- The expect (E) value describes the number of hits that are expected to occur by chance, and, therefore, a low E value indicates a reliable match. For clarity, “a” variants are used when more than one transcript FXYD5Mm FXYD6MmFXYD7Mm 8e-05 0.002 23/34 24/41 0.015 0.003 24/42 27/37 1e-21 2e-05 73/108 34/62 2e-05 1e-06 29/48 35/54 8e-12 6e-05 45/65 42/70 6e-11 3e-04 42/68 29/49 3e-04 0.10 33/50 30/52 5e-05 0.069 32/55 25/40 FXYD2Mm 2e-05 29/45 FXYD3Mm FXYD4Mm FXYD1Mm variant was identiﬁed. Mm, Table 3. forms (Fig. 1). FXYD9 are grouped with the previously de-

AJP-Regul Integr Comp Physiol • VOL 294 • APRIL 2008 • www.ajpregu.org EXPRESSION OF FXYD GENES IN A TELEOST R1371 scribed zebrafish homologue (Fig. 1; Ref. 55) and shark derived from 50 and 32 ESTs, respectively, and organized in FXYD10 and most similar to tetrapod FXYD3 and FXYD4 Unigene Ssa.7814. They are mostly homologous in the ϳ100 (Fig. 1, Table 3). The proposed FXYD11 shares highest ho- amino acids of the carboxy terminal, where they share homol- mology with tetrapod FXYD3 and FXYD4, teleosts FXYD9, ogy with the other teleosts members of the FXYD family. In and shark FXYD10 and are grouped with these in the phylo- the extended amino-terminal domain, they mainly differ in genetic tree (Fig. 1). The proposed FXYD12 shares little inserts that do not induce frame shifts, but are lacking in the homology with any known isoform and is isolated in the smaller FXYD5b. The shared amino acid sequence has only a phylogenetic tree. The annotation of FXYD2, FXYD5, and few substitutions, but additional regions are found in the “a” FXYD7 was all supported by a parsimonious model bootstrap variant. However, since substitutions are found, the two forms analysis (bootstrap values: 69 for FXYD2, 100 for FXYD5, 83 may not merely be splice variants. None of them contains for FXYD7). predicted intracellular phosphorylation sites, and both contains The predicted protein products of the eight genes are aligned a transmembrane domain. The sequences of FXYD6 are based in Fig. 2, as translated from consensus nucleotide sequences. on four ESTs (accession no. BK006241), and, due to variations For clarity, just “a” forms are used for comparisons when more in the 5Ј end, the deduced consensus does not cover sequence than one transcript variant was identified. The eight salmon upstream of the start codon. The three ESTs containing a stop Downloaded from contigs clearly represents FXYD proteins, as judged by their codon deviate, so consensus in the 3Ј end covering the carboxy sequential characteristics. As indicated in Fig. 2, a FXYDY terminus of the putative peptide was not established. In Fig. 2, domain is shared, with only minor deviations. The fish se- the peptide sequence carboxy terminus is based on DW178692, quences have two conserved glycine residues within the pre- and amino acids that are not supported by the consensus are dicted membrane domains, as found in all prior characterized shown in lowercase letters. Five putative phosphorylation sites members of the family. A serine residue at the end of the were found in the intracellular domain of FXYD6. Isoform 7 http://ajpregu.physiology.org/ membrane domain was shared by five isoforms, whereas an- is represented by a series of ESTs organized in Unigene other polar amino acid was found in the remaining three. Just Ssa.2060, and the sequences of two transcript variants were before the predicted membrane domain, an invariant leucine found (FXYD7a, accession no. BK006245; FXYD7b, acces- and arginine residue was found. sion no. BK006246). The two transcript types were 100% Sequence characteristics of the FXYD isoforms. The de- homologous, except for a deletion in the coding region. The duced protein sequences were examined for the potential pres- deletion leads to exclusion of seven amino acids in the cyto- ence of membrane domains, phosphorylation sites, glycosyla- solic domain, but no reading frame shift occur. The deletion tion sites, and signal peptides. All of the FXYD proteins were resulted, in FXYD7b, in a removal of three of the four predicted to be membrane proteins with an extracellular amino cytosolic phosphorylation sites predicted for FXYD7a. In the terminal and a cytosolic carboxy terminal. They all contained case of FXYD8, the sequences of two transcript variants were a ϳ19-residue membrane-spanning domain (Fig. 2). At least recognized in rainbow trout, found in Unigene Omy.16702 and by 10.220.33.6 on January 9, 2017 two transcript variants were found in five FXYD proteins in Omy.34505. A long variant (Omy.16702, 5 ESTs) contained an salmon, and these are aligned in Supplemental Table S1. (The insert in the coding region, but was otherwise similar in amino online version of this article contains supplemental data.) acid sequence compared with a short variant (Omy.34505; 16 The sequence of FXYD2 (accession no. BK006252) was ESTs). In Atlantic salmon, it was possible to established deduced from three ESTs organized in Unigene Ssa.25839. consensus for a similar long variant in Ssa.13359 (accession The three ESTs for this isoforms were 100% homologous, no. BK006242). However, substitution and deletions are found apart from one EST (CK880699), which contained an insert in in two ESTs (EG799673 and EG773650), and they may rep- the coding region. Therefore, two splice variants of this FXYD resent alternative short transcripts, as suggested by the variants protein may be present. The consensus of FXYD5a (accession found in rainbow trout. The possible FXYD8 variants of no. BK006253) and FXYD5b (accession no. BK006254) are salmon and trout distinguished themselves by an extracellular

Fig. 2. Alignment of putative amino acid sequences of the 8 salmon FXYD proteins. Conserved residues are shown with blue background. Isoforms 5, 6, 8, 9, and 11 all contain a potential signal peptide in the amino terminal, here shown with green background. Putative regulatory phosphorylation sites in the cytosolic domain are shown with red background. The putative membrane domain is indicated by a bar. For clarity, only “a” forms are shown when more than one transcript variant was identiﬁed. Lowercase letters in FXYD6 denote tentative sequence based on only DW178692. The extended amino terminal of FXYD5a is indicated by a blue asterisk, and only the 100 amino acids of the carboxyl end of the potential 367 residues are shown.

AJP-Regul Integr Comp Physiol • VOL 294 • APRIL 2008 • www.ajpregu.org R1372 EXPRESSION OF FXYD GENES IN A TELEOST deletion in the peptide sequence, and both contain two putative intracellular phosphorylation sites. The consensus of FXYD9a (accession no. BK006243) and FXYD9b (accession no. BK006244) are based on 73 and 99 ESTs, respectively. The two transcript variants are 96% homologous, and five nucleotide substitutions within the coding region lead to one amino acid substitution toward the amino terminal. Within the great number of ESTs representing both of these transcript variants, minor additional substitutions are found. Both contain three possible cytosolic phosphorylation sites at serine residues 73, 75, and 88, being potential substrates for a series of protein kinases [ribosomal S6 kinase, protein kinase (PK) A, PKB, PKC, and PKG]. Isoform FXYD11 is represented by a great number of ESTs placed in Ssa.473, but clearly constituting a contig of their own. Two transcript types were deduced from a comparable Downloaded from number of sequences (FXYD11a, accession no. BK006247; FXYD11b, accession no. BK006248). The two transcript types were 98% homologous, and five nucleotide substitutions within the coding region lead to five amino acid substitutions in the extracellular domain, three of which are within the putative signal peptide. The substitutions introduce an addi- http://ajpregu.physiology.org/ tional predicted membrane domain in variant “a”, located upstream of the conserved membrane domain. However, this possible additional membrane domain may be part of a putative signal peptide. Both putative proteins have two potential cytosolic phosphorylation sites. Isoform FXYD12 is represented by a series of ESTs placed in Ssa.473 but constituting their own contig. Nineteen ESTs represent FXYD12a (accession no. BK006249). Two other less numerous transcript types, FXYD12b (accession no.

BK006250) and FXYD12c (accession no. BK006251), are by 10.220.33.6 on January 9, 2017 found to be mostly homologous, except toward the 3Ј end. The two variants contain a deletion leading to a frame shift and a series of substitutions in the nucleotide sequences following. This may result in dissimilar carboxy terminals in the mature peptides. The SignalP 3.0 server was used to analyze for likely signal peptides, and these were found in FXYD5, -6, -8, -9, and -11, but not in FXYD2, -7, and -12. There are no sites for N-glycosylation outside the predicted signal-peptide area, except in FXYD5a and FXYD5b, where eight and five potential N-glycosylation sites were found, respectively. Thirty potential O-glycosylation sites were found in the extracellular domain of salmon FXYD5, and this character is also observed in the isoform of Japanese medaka (31 sites) and zebrafish (22 sites). Tissue expression. Expression of the eight FXYD isoforms was analyzed in osmoregulatory tissues (gill, kidney, intestine), excitable tissues (heart, skeletal muscle, brain), and glandular tissue (liver) from FW-acclimated salmon. The mRNA expression of FXYD2 was strongest in kidney, being 30-fold higher than in intestine and more than 100-fold higher than in any other tissue (Fig. 3A). The relative order between tissues was as follows: kidney Ͼ intestine Ͼ gill ϭ heart ϭ Fig. 3. Expression of FXYD2 (A), FXYD5 (B), FXYD6 (C), and FXYD7 (D) ϭ ϭ mRNA in gill, kidney, intestine, heart, skeletal muscle, brain, and liver tissue brain liver muscle. The ESTs representing this isoform from fresh water (FW) salmon. Values are means Ϯ SE (n ϭ 6). EF, elongation were only found in kidney and mixed tissue libraries. The factor. A,B,C,DGroups marked with different letters are significantly different. FXYD5 isoform does not display major tissue difference in expression (Fig. 3B). The relative expression levels among the tissues were as follows: kidney ϭ gill ϭ heart Ͼ intestine Ͼ The mRNA expression of FXYD6 was higher in brain than muscle ϭ brain ϭ liver. The ESTs representing this isoform in any other tissue (Fig. 3C), with the following order between were found in many different libraries, thus indicating a broad tissues: brain ϾϾ muscle ϭ intestine Ͼ gill ϭ kidney ϭ and less tissue-specific distribution of this transcript. heart Ͼ liver. Two of three ESTs representing this isoform

AJP-Regul Integr Comp Physiol • VOL 294 • APRIL 2008 • www.ajpregu.org EXPRESSION OF FXYD GENES IN A TELEOST R1373 were found in brain libraries, thus supporting the expression data. The expression of FXYD7 was 1,000-fold higher in brain than in any other tissue (Fig. 3D), with the following order between tissues: brain ϾϾϾ muscle ϭ gill ϭ heart ϭ liver Ͼ intestine ϭ kidney. In accord with this observation, the ESTs representing this isoform were found in brain libraries. The order of expression of FXYD8 (Fig. 4A) was as follows: muscle Ͼ brain ϭ gill Ͼ kidney ϭ intestine ϭ heart Ͼ liver. The ESTs representing this isoform, and annotated to tissue, were found in muscle, lymphoreticular, and thyroid libraries. The FXYD9 isoform was expressed at a relatively high level in all of the investigated tissues, with the following order between tissues (Fig. 4B): heart Ͼ gill ϭ brain ϭ liver Ͼ kidney ϭ intestine ϭ muscle. In accord with our data, the ESTs representing this isoform were found in many different tissue Downloaded from libraries. The expression of FXYD11 was 1,000-fold higher in gill than any other examined tissue (Fig. 4C), with the following relative order between tissues: gill ϾϾϾ kidney ϭ intestine ϭ heart ϭ muscle ϭ brain ϭ liver. The ESTs representing this isoform were from thyroid, thymus, and gill. The expres-

sion of FXYD12 was 100-fold higher in kidney and intestine http://ajpregu.physiology.org/ than in any other tissue (Fig. 4D). The relative order between tissues was as follows: kidney ϭ intestine ϾϾ heart ϭ muscle ϭ brain Ͼ gill ϭ liver. The ESTs representing this isoform belonged to kidney and intestine libraries. Salinity effects. To get an indication of the relative importance of the different FXYD isoforms in osmoregulatory tissues in FW relative to SW, the expression level in fully acclimated salmon was examined. The relative expression of the different isoforms in gill, kidney, and intestine (Figs. 5 and 6) was generally the same as found previously (Figs. 3 and 4). Spec- ificity of expression in SW was the same as in FW, as far as by 10.220.33.6 on January 9, 2017 FXYD11 appeared to be gill specific, FXYD12 kidney and intestine specific, and FXYD2 kidney specific. In gill, the levels of FXYD5, FXYD6, FXYD9, FXYD11, and FXYD12 transcripts doubled in SW salmon compared with FW salmon, yet this was only significant for FXYD12. In kidney, FXYD2 and FXYD12 were both expressed at a significantly lower level in SW compared with FW salmon.

DISCUSSION It is increasingly clear that, in mammals, FXYD protein isoforms are involved in adjusting the kinetics of Naϩ-Kϩ- ATPase to specific demands in different tissues and cell types (26). This study classified several novel isoforms of these proteins and demonstrated differential tissue expression and response to salinity in a euryhaline teleost. Two isoforms were expressed consistently in all tissues, whereas differential expression of three isoforms, in particular in osmoregulatory tissues, and three isoforms in excitable tissues is suggested. Identification and characterization of expressed FXYD genes. Rather than being poorer, consensus sequences derived from multiple ESTs can be better quality than average sequences in the GenBank nr division. Individual ESTs have the same problems, but analysis of multiple replicate sequences Fig. 4. Expression of FXYD8 (A), FXYD9 (B), FXYD11 (C), and FXYD12 gives the consensus a higher confidence through the attained (D) mRNA in gill, kidney, intestine, heart, skeletal muscle, brain, and liver redundancy. The sequences coding FXYD proteins were tissue from FW salmon. Values are means Ϯ SE (n ϭ 6). A,B,C,D,EGroups picked out based on alignment with the conserved region of marked with different letters are significantly different. sequences formerly described. Separate Unigenes were located for all but two family members. Both FXYD11 and FXYD12

AJP-Regul Integr Comp Physiol • VOL 294 • APRIL 2008 • www.ajpregu.org R1374 EXPRESSION OF FXYD GENES IN A TELEOST consensus are able to pick up misplaced ESTs, a process that is, however, difﬁcult to automate because of alternatively spliced forms, contamination, and chimeric entries. In the present study, the relevant sequences were assembled into separate contigs and dealt with individually. Both start and stop codons were found in all isoforms, indicating that they all may be translational competent and suggesting that they are not expressed pseudogenes. Most family members had apparent or- thologue ESTs arranged in Unigenes in other teleosts (e.g., Downloaded from http://ajpregu.physiology.org/ by 10.220.33.6 on January 9, 2017

Fig. 5. Expression of FXYD2 (A), FXYD5 (B), FXYD6 (C), and FXYD7 (D) mRNA in gill tissue from FW- and saltwater (SW)-acclimated salmon. Values are means Ϯ SE (n ϭ 7). *Significant difference between the FW and SW for a particular tissue. A,a,B,b,C,cGroups marked with different letters are significantly different, where uppercase letters are used for FW fish, and lowercase letters for SW fish. were located in the Ssa.423, annoted ␤-globin. However, both were 97–100% homologous to sequences found in their own Unigene in rainbow trout (Table 2). Unigene formation is an automated process, and there is little doubt that Ssa.423 has sequences that should not be included. For example, a series of Fig. 6. Expression of FXYD8 (A), FXYD9 (B), FXYD11 (C), and FXYD12 Atlantic salmon ESTs (EG845224, EG828874, EG828875, (D) mRNA in gill, kidney, and intestine tissue from FW- and SW-acclimated salmon. Values are means Ϯ SE (n ϭ 7). *Significant difference between the EG855281, EG855280, EG845223) are located in this cluster, FW and SW for a particular tissue. A,a,B,bGroups marked with different letters but share 97% nucleotide homology with the ␣1a-subunit of are significantly different, where uppercase letters are used for FW fish, and ϩ ϩ Na -K -ATPase from rainbow trout. Assembled contigs and lowercase letters for SW fish.

AJP-Regul Integr Comp Physiol • VOL 294 • APRIL 2008 • www.ajpregu.org EXPRESSION OF FXYD GENES IN A TELEOST R1375 zebrafish, Japanese medaka, and rainbow trout; Table 2). As aspargine, in FXYD11. No such substitution is seen in shown in Table 2, very high amino acid homology (82–100%) FXYD1–7 from mouse, rat, or human (55), but is found was found between the orthologues of two salmonids: Atlantic consistently in FXYD9 and FXYD11 of rainbow trout, ze- salmon and rainbow trout. brafish, and Japanese medaka. The aspartic acid substitution A classification of the teleost FXYD proteins are proposed with aspargine is also observed in the newly annoted human based on ML phylogenetic analysis (Fig. 1) and homology FXYD8, identified within the DNA sequence of the human X examination (Table 3) and were supported by parsimonious chromosome (UniProt KB entry: P58550). A tyrosine follow- analysis, tissue distribution, and further characters. The homol- ing the FXYD domain was conserved in all isoforms of the ogy of the proposed salmon and zebrafish FXYD2 to mamma- four teleosts inspected. This tyrosine is retained in mammalian lian counterpart is only slightly greater than to other isoforms FXYD1, -2, -6, and -7. As shown in Fig. 2, an arginine (Table 3). However, phylogenetic analysis includes the teleost following a leucine and a leucine following a glycine are isoforms in a clade with mammalian, amphibian, and bird further conserved motifs, as is a glycine later in the potential isoforms (Fig. 1), and expression is found predominantly in the membrane domain. These features confirm the association of kidney, similar to what has been observed in mammalian these genes compared with the FXYD family signature se- FXYD2 (49). Similarly, presumed salmon FXYD7 is only quence (Ref. 26, or see the Expasy site: http://us.expasy.org/ Downloaded from weakly similar to the mouse counterpart (Table 3). Again, cgi-bin/nicedoc.pl?PDOC01014). The conservation in the phylogenetic analysis groups teleost FXYD7 with mammalian transmembrane span of bigger and smaller side chains suggests and amphibian isoforms (Fig. 1), and expression appears to be that this is not merely an anchoring structure, and the two brain specific, as seen in mammals (7). The proposed FXYD12 conserved glycines within this span thus may represent points share little homology with the ␥-subunit (FXYD2) and is involved in helix packing (1, 33). Outside of the signature isolated in the phylogenetic tree. It is located upstream of motif, there is considerable sequence variation between family http://ajpregu.physiology.org/ FXYD6 on the zebrafish genome, just like it is seen in FXYD2 members, as is also the case in mammals. in mammals (FXYD6-FXYD2). This could suggest that For isoforms 5, 7, 9, and 11, two major transcript variants FXYD12 is a second teleost homologue of the ␥-subunit. with changes in the coding region were found, and each is Interestingly, FXYD12 is expressed predominantly in kidney represented by a comparable number of ESTs. For FXYD12, and intestine, and, like FXYD2 and FXYD7, it has no pre- three transcript variants were detected. The transcript variants dicted signal peptide, which parallels what is found for these are aligned in Supplemental Table S1. In FXYD2, FXYD6, isoforms in other vertebrates (17). The proposed FXYD5 and FXYD8, one consensus sequence could be extracted, but shares a node with the mammalian and putative chicken ho- additional transcript variant may still escape detection due to mologues (Fig. 1) and is very weakly similar to mouse FXYD5 the low number of ESTs available for these isoforms. In the (expect value Ͻ 1e-5). In this FXYD protein isoform, a large case of FXYD7, “a” and “b” variants are most likely splice extracellular domain is observed in the proposed teleost variants, as their sole difference is a deletion in the coding by 10.220.33.6 on January 9, 2017 FXYD5, similar to what is seen in other vertebrates. The sequence. Splice variants are also known in mammals where domain is in the salmonid protein predicted to be very highly the FXYD transcripts have been shown to be made up of at O-glycosylated, as it is seen in mammalian, amphibian, and least six exons (56). Among the remaining of the salmon bird FXYD5. This character is only observed in this isoform isoforms, the variants discern themselves by deletions and and appears to be well conserved. Surprisingly, both salmon substitutions for FXYD5 and FXYD12 and only substitutions FXYD5a and FXYD5b are longer than any other FXYD5, for FXYD9 and FXYD11. Because genetic changes are more including other nonsalmonid teleost FXYD5, like Japanese frequent in fishes, their genes have, in several cases, more medaka (Unigene Ola.17166) and zebrafish (Unigene isoforms than other vertebrates (59). A recent gene duplication Dr.133190). The long salmon FXYD5 does not appear to be an event could be involved in the occurrence of isotypes, and, in intron-derived cloning artifact, since the sequence material is favor of this explanation, a recent polyploidization has been ESTs derived from mRNA. Both FXYD5a and FXYD5b are detected in the salmonid lineage (2). based on more than 30 ESTs, with a redundancy that is never The sequence of the eight salmon genes contained a putative lower than 11 and 14, respectively. In addition, the rainbow membrane domain downstream of the FXYDY motif (Fig. 2). trout counterparts also appear to be extended compared with In all family members, the carboxy terminal has more positive other teleosts, suggesting that this may be an occurrence charge than the NH2-terminal end, consistent with insertion in specific to the salmonid lineage. The phylogenetic analysis the membrane with the amino terminal outward. This orienta- suggests that the new teleost isoform, FXYD11, along with the tion has been demonstrated experimentally in mammals for previously described FXYD9 (55), is grouped with amphibian FXYD1 and FXYD2 (5, 47). The mammalian family members FXYD3 and mammalian FXYD3 and FXYD4. The analysis have residues in the carboxy terminal ends that potentially does not clearly group them with FXYD3 or FXYD4, and it is could be phosphorylation sites. FXYD1 (39), FXYD2 (18), and possible that FXYD4 has occurred in the mammalian lineage, FXYD10 (44) have been phosphorylated in vitro, leading to since no amphibian form was found in the available amphibian altered interaction with the Naϩ-Kϩ-ATPase. Potential regu- database. Shark FXYD10 also belongs to this clade and could latory phosphorylation sites are found in the intracellular do- be an elasmobranch counterpart to teleost FXYD9 (similarity: main of all salmon isoforms, except FXYD12a and FXYD5. It 70%; expect value: 1e-21 with blast). is important to stress that the presence of predicted phosphor- In all of the teleost family members, the FXYD motif was ylation sites does not automatically mean that they are physi- largely conserved, with two exceptions (Fig. 2): 1) the tyrosine ologically relevant. For instance, even though phosphorylation is exchanged with phenylalanine, another aromatic amino acid, of consensus sites in the purified ␣-subunit is observed, prox- in FXYD9; 2) the aspartic acid is exchanged with its amide, imity to the plasma membrane or adjacent loops may alter

AJP-Regul Integr Comp Physiol • VOL 294 • APRIL 2008 • www.ajpregu.org R1376 EXPRESSION OF FXYD GENES IN A TELEOST these site to be inaccessible in living cells (58). However, shark sion pattern should be investigated in the transition phase FXYD10 contains three regulatory phosphorylation sites in the during salinity change as well, since it is possible that the cytosolic domain (44), and these are also found in FXYD9 response may be larger during the transient stress period than (Fig. 1), indicating a conserved physiological importance. In in fully acclimated fish. By comparison, induction of gill general, the FXYD9 isoform has the highest degree of conser- transcripts with major roles in hypoosmoregulation (Naϩ-Kϩ- vation among the examined teleost species (Table 2), indicat- ATPase, Naϩ-Kϩ-2ClϪ cotransporter, and CFTR-like chloride ing that it may be involved in physiological processes that are channel) is at maximum level in euryhaline killifish in the not evolving within this group of vertebrates. initial days after SW transfer (51). In the kidney, the decreased Tissue expression. Judging from the relative abundance of levels of FXYD2 and FXYD12 mRNA in SW could reflect transcript in the tissues examined, it appears that FXYD6 is qualitative changes, since the renal Naϩ-Kϩ-ATPase level expressed mainly in brain (Fig. 3). FXYD6 shares highest itself is known to be unaffected by salinity in other salmonids homology with its mammalian counterpart (Table 3), which is like rainbow trout (24) and brown trout (42). It is also possible highly expressed in the brain (36), but also in epithelial cells of that posttranscriptional regulation is a factor, as in the regula- the inner ear (21). It is possible that a difference in basal tion of FXYD2 in mammalian kidney cells, which has been expression in other tissues than brain may result from different shown to involve both a transcriptional and a posttranscrip- Downloaded from degrees of innervation. The expression of FXYD7 was also tional component (16). specific to the brain. FXYD7 shares no obvious homology with Perspectives and significance. The present study classified a any mammalian FXYD family members. The highest homol- series of FXYD isoforms in teleosts, and the expression pat- ogy in the full sequence is found in FXYD7, a family member terns indicated general as well as tissue-specific isoforms also exclusively expressed in the brain (7). In skeletal muscle among these. In addition, some isoforms appeared to be re- tissue, FXYD8 expression was more than 20-fold higher than sponsive to major changes in environmental salinity, suggest- http://ajpregu.physiology.org/ in the brain and gill and more than 200-fold of that found in ing an involvement in regulation of ion transport. The next step heart muscle. This isoform shared highest homology with the will be to develop tools to study FXYD protein function at mammalian FXYD6 isoform (Table 3) and may represent a protein level to establish the physiological role. In this context, muscle-specific analog. FXYD8 could be expressed in muscle the interrelationship with the various distinct isoforms of Naϩ- cells or, for instance, nerve cells in the muscle tissue. Three of Kϩ-ATPase in osmoregulatory tissues will be a challenge to the salmon isoforms were predominantly expressed in osmo- investigate. Thus this study has opened a new perspective and regulatory tissues. FXYD11 was almost exclusively expressed a whole new level of complexity in the field of teleost osmo- in the gill, FXYD2 in the kidney, and FXYD12 in the kidney regulation. and intestine. Two isoforms, FXYD5 and FXYD9, did not display a major tissue-specific expression pattern. Although ACKNOWLEDGMENTS by 10.220.33.6 on January 9, 2017 originally identified in cancer cells, mammalian FXYD5 is Steffen S. Madsen (University of Southern Denmark) is warmly thanked for expressed in a series of normal tissues (41), and this parallels critical review of the manuscript. the current observations. Interestingly, the isoform most similar to teleost FXYD9, shark FXYD10, is highly expressed in GRANTS rectal gland, but also in heart, brain, intestine, and kidney (44). The research was supported by a grant from The Danish Natural Research Salinity effects. In many tissues, FXYD proteins are known Council (272-06-0526) and a Postdoctoral Fellowship grant by The Carlsberg ϩ ϩ to affect cellular ion transport by interacting with Na -K - Foundation (2005-1-311). ATPase (17). The Naϩ-Kϩ-ATPase is the major energizer of transepithelial ion transport in the gill, kidney, and intestine of REFERENCES teleosts, and, therefore, FXYD proteins may be expected to 1. Adamian L, Liang J. Helix-helix packing and interfacial pairwise inter- play a central role in the functioning of these tissues as well. actions of residues in membrane proteins. J Mol Biol 311: 891–907, 2001. During salinity acclimation of euryhaline teleosts, a substantial 2. Allendorf FW, Thorgaard GH. Tetraploidy and the evolution of Salmo- remodeling of these tissues is observed. For example, major nid fishes. In: Evolutionary Genetics of Fishes, edited by Turner BJ. New changes in cell type (37) and expression of ion transport York: Plenum, 1984, p. 1–53. 3. Altschul SF, Madden TL, Scha¨ffer AA, Zhang J, Zhang Z, Miller W, proteins are observed in the gill epithelium (e.g., Refs. 51, 57). ϩ ϩ Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of In addition, Na -K -ATPase isoform shifts (49) and lipid protein database search programs. Nucleic Acids Res 25: 3389–3402, composition of the gill cell membrane may play a role during 1997. salinity acclimation (13). 4. Arystarkhova E, Sweadner KJ. Splice variants of the gamma subunit (FXYD2) and their significance in regulation of the Na,K-ATPase in The expression of FXYD isoforms appeared at similar levels kidney. J Bioenerg Biomembr 37: 381–386, 2005. in the intestine of FW and SW salmon. This is unexpected, 5. Beguin P, Wang X, Firsov D, Puoti A, Claeys D, Horisberger JD, considering the major change that appears in water and ion Geering K. The gamma subunit is a specific component of the Na, transport and Naϩ-Kϩ-ATPase expression in the intestine KATPase and modulates its transport function. EMBO J 16: 4250– during acclimation to hyperosmotic conditions (see Ref. 29); 4260, 1997. 6. Be´guin P, Crambert G, Guennoun S, Garty H, Horisberger JD, however, this does not exclude a differential role in FW and Gerring K. CHIF, a member of the FXYD protein family, is a regulator SW. Several isoforms responded to salinity change in the gill of Na,KATPase distinct from the ␥-subunit. EMBO J 20: 3993–4002, and kidney, possibly signifying changes in type and function of 2001. ion-transporting cells in these tissues. The relative abundance 7. Be´guin P, Crambert G, Monnet-Tschudi F, Uldry M, Horisberger JD, Garty H, Geering K. FXYD7 is a brain-specific regulator of Na,K- in the gill of the generally expressed FXYD9 and gill-specific ATPase ␣1-␤ isozymes. EMBO J 21: 3264–3273, 2002. FXYD11 isoforms doubled in SW compared with FW salmon; 8. Bendtsen JD, Nielsen H, von Heijne G, Brunak S. Improved prediction however, this difference was insignificant. Changes in expres- of signal peptides: SignalP 3.0. J Mol Biol 340: 783–795, 2004.

AJP-Regul Integr Comp Physiol • VOL 294 • APRIL 2008 • www.ajpregu.org EXPRESSION OF FXYD GENES IN A TELEOST R1377

9. Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J, Rapp BA, 33. Javadpour MM, Eilers M, Groesbeek M, Smith SO. Helix packing in Wheeler DL. GenBank. Nucleic Acids Res 28: 15–18, 2000. polytopic membrane proteins: role of glycine in transmembrane helix 10. Blanco G, Mercer RW. Isozymes of the Na-K-ATPase: heterogeneity in association. Biophys J 77: 1609–1618, 1999. structure, diversity in function. Am J Physiol Renal Physiol 275: F633– 34. Johansen MB, Kiemer L, Brunak S. Analysis and prediction of mam- F650, 1998. malian protein glycation. Glycobiology 16: 844–853, 2006. 11. Blom N, Gammeltoft S, Brunak S. Sequence- and structure-based 35. Julenius K, Mølgaard A, Gupta R, Brunak S. Prediction, conservation prediction of eukaryotic protein phosphorylation sites. J Mol Biol 294: analysis and structural characterization of mammalian mucin-type O- 1351–1362, 1999. glycosylation sites. Glycobiology 15: 153–164, 2005. 12. Bogaev RC, Jia LG, Kobayashi YM, Palmer CJ, Mounsey JP, Moor- 36. Kadowaki K, Sugimoto K, Yamaguchi F, Song T, Watanabe Y, Singh man JR, Jones LR, Tucker AL. Gene structure and expression of K, Tokuda M. Phosphohippolin expression in the rat central nervous phospholemman in mouse. Gene 271: 69–79, 2001. system. Mol Brain Res 125: 105–112, 2004. ϩ ϩ 13. Bystriansky JS, Ballantyne JS. Gill Na -K -ATPase activity correlates 37. Kaneko T, Katoh F. Functional morphology of chloride cells in killiﬁsh with basolateral membrane lipid composition in seawater- but not fresh- Fundulus heteroclitus, a euryhaline teleost with seawater preference. Fish water-acclimated Arctic char (Salvelinus alpinus). Am J Physiol Regul Sci 70: 723–733, 2004. Integr Comp Physiol 292: R1043–R1051, 2007. 38. Krogh A, Larsson B, von Heijne G, Sonnhammer ELL. Predicting 14. Capasso JM, Rivard CJ, Berl T. Synthesis of the Na-K-ATPase ␥-sub- transmembrane protein topology with a hidden Markov model: application unit is regulated at both the transcriptional and translational levels in J Mol Biol

to complete genomes. 305: 567–580, 2001. Downloaded from IMCD3 cells. Am J Physiol Renal Physiol 288: F76–F81, 2005. 39. Lifshitz Y, Lindzen M, Garty H, Karlish SJ. Functional interactions of 15. Capurro C, Coutry N, Bonvalet JP, Escoubet B, Garty H, Farman N. phospholemman (PLM) (FXYD1) with Naϩ,Kϩ-ATPase. Purification of Cellular localization and regulation of CHIF in kidney and colon. Am J alpha1/beta1/PLM complexes expressed in Pichia pastoris. J Biol Chem Physiol Cell Physiol 271: C753–C762, 1996. 281: 15790–15799, 2006. 16. Clamp M, Cuff J, Searle SM, Barton GJ. The Jalview Java Alignment 40. Lingrel J, Moseley A, Dostanic I, Cougnon M, He SW, James P, Woo Editor. Bioinformatics 20: 426–427, 2004. A, O’Connor K, Neumann J. Functional roles of the alpha isoforms of 17. Cornelius F, Mahmmoud YA. Functional modulation of the sodium the Na,K-ATPase. Ann NY Acad Sci 986: 354–359, 2003. pump: the regulatory proteins “fixit”. News Physiol Sci 18: 119–124, 41. Lubarski I, Pihakaski-Maunsbach K, Karlish SJD, Maunsbach AB, http://ajpregu.physiology.org/ 2003. Garty H. Interaction with the Na, K-ATPase and tissue distribution of 18. Cortes VF, Veiga-Lopes FE, Barrabin H, Alves-Ferreira M, Fontes ϩ ϩ FXYD5 (related to ion channel). J Biol Chem 280: 37717–37724, 2005. CFL. The gamma subunit of Na ,K -ATPase: role on ATPase activity 42. Madsen SS, Jensen MK, Nøhr J, Kristiansen K. Expression of Naϩ- and regulatory phosphorylation by PKA. Int J Biochem Cell Biol 38: Kϩ-ATPase in the brown trout, Salmo trutta: in vitro modulation by 1901–1913, 2006. hormones and seawater. Am J Physiol Regul Integr Comp Physiol 269: 19. Crambert G, Li C, Swee LK, Geering K. FXYD7, mapping of func- R1339–R1345, 1995. tional sites involved in endoplasmic reticulum export, association with and 43. Mahmmoud YA, Vorum H, Cornelius F. Identification of a phos- regulation of Na,K-ATPase. J Biol Chem 279: 30888–30895, 2004. pholemman-like protein from shark rectal glands. Evidence for indirect 20. Cutler CP, Sanders IL, Hazon N, Cramb G. Primary sequence, tissue regulation of Na,K-ATPase by protein kinase C via a novel member of the specificity and expression of the Naϩ,Kϩ-ATPase ␣1 subunit in the FXYDY family. J Biol Chem 275: 35969–35977, 2000. European eel (Anguilla anguilla). Comp Biochem Physiol 111B: 567–573, 44. Mahmmoud YA, Cramb G, Maunsbach AB, Cutler CP, Meischke L, 1995. Cornelius F. Regulation of Na,K-ATPase by PLMS, the phospholemman- 21. Delprat B, Schaert D, Roy S, Wang J, Puel JL, Geering K. FXYD6 is by 10.220.33.6 on January 9, 2017 like protein from shark: molecular cloning, sequence, expression, cellulardis- a novel regulator of Na,K-ATPase expressed in the inner ear. J Biol Chem tribution, and functional effects of PLMS. J Biol Chem 278: 37427–37438, 2003. 282: 7450–7456, 2007. 45. Morrison BW, Moorman JR, Kowdley GC, Kobayashi YM, JonesLR, 22. Felsenstein J. PHYLIP–Phylogeny Inference Package (version 3.2). Cla- Leder P. Mat-8, a novel phospholemman-like protein expressed in human distics 5: 164–166, 1989. Xenopus oocytes J Biol 23. Fu X, Kamps MP. E2a-Pbx1 induces aberrant expression of tissue- breast tumors, induces a chloride conductance in . specific and developmentally regulated genes when expressed in NIH 3T3 Chem 270: 2176–2182, 1995. fibroblasts. Mol Cell Biol 17: 1503–1512, 1997. 46. Olsvik PA, Lie KK, Jordal AE, Nilsen TO, Hordvik I. Evaluation of 24. Fuentes J, Soengas JL, Rey P, Rebolledo E. Progressive transfer to potential reference genes in real-time RT-PCR studies of Atlantic salmon. seawater enhances intestinal and branchial Naϩ-Kϩ ATPase activity in BMC Mol Biol 6: 21, 2005. non-anadromous rainbow trout. Aquac Int 5: 217–227, 1997. 47. Palmer CJ, Scott D, Jones LR. Purification and complete sequence 25. Fuller W, Eaton P, Bell JR, Shattock MJ. Ischemia-induced phosphor- determination of the major plasma membrane substrate for cAMP-depen- ylation of phospholemman directly activates rat cardiac Na/K-ATPase. dent protein kinase and protein kinase C in myocardium. J Biol Chem 266: FASEB J 18: 197–199, 2004. 11126–11130, 1991. 26. Garty H, Karlish SJD. Role of FXYD proteins in ion transport. Annu Rev 48. Pihakaski-Maunsbach K, Vorum H, Honore B, Tokonabe S, Frokiaer Physiol 68: 431–459, 2006. J, Garty H, Karlish SJD, Maunsbach AB. Locations, abundances, and 27. Gasteiger E, Gattiker A, Hoogland C, Ivanyi I, Appel RD, Bairoch A. possible functions of FXYD ion transport regulators in rat renal medulla. ExPASy: the proteomics server for in-depth protein knowledge and Am J Physiol Renal Physiol 291: F1033–F1044, 2006. analysis. Nucleic Acids Res 31: 3784–3788, 2003. 49. Richards JG, Semple JW, Bystriansky JS, Schulte PM. Naϩ/Kϩ- 28. Geering K. FXYD proteins: new regulators of Na-K-ATPase. Am J ATPase alpha-isoform switching in gills of rainbow trout (Oncorhynchus Physiol Renal Physiol 290: F241–F250, 2006. mykiss) during salinity transfer. J Exp Biol 206: 4475–4486, 2003. 29. Grosell M. Intestinal anion exchange in marine fish osmoregulation. J Exp 50. Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and for Biol 209: 2813–2827, 2006. biologist programmers. In: Bioinformatics Methods and Protocols: Meth- 30. Guynn SR, Scofield MA, Petzel DH. Identification of mRNA and protein ods in Molecular Biology, edited by Krawetz S, Misener S. Totowa, NJ: expression of the Na/K-ATPase ␣1-, ␣2- and ␣3-subunit isoforms in Humana, 2000, p. 365–386. Antarctic and New Zealand nototheniid fishes. J Exp Mar Biol Ecol 273: 51. Scott GR, Richards JG, Forbush B, Isenring P, Schulte PM. Changes in 15–32, 2002. gene expression in gills of the euryhaline killifish Fundulus heteroclitus after 31. Higgins D, Thompson J, Gibson T, Thompson JD, Higgins DG, abrupt salinity transfer. Am J Physiol Cell Physiol 287: C300–C309, 2004. Gibson TJ. CLUSTAL W: improving the sensitivity of progressive 52. Semple JW, Green HJ, Schulte PM. Molecular cloning and character- multiple sequence alignment through sequence weighting, position-spe- ization of two Na/K-ATPase isoforms in Fundulus heteroclitus. Mar cific gap penalties and weight matrix choice. Nucleic Acids Res 22: Biotechnol (NY) 4: 512–519, 2002. 4673–4680, 1994. 53. Sonnhammer ELL, von Heijne G, Krogh A. A hidden Markov model 32. Ino Y, Gotoh M, Sakamoto M, Tsukagoshi. K, Hirohashi S. Dysad- for predicting transmembrane helices in protein sequences. In: Proceed- herin, a cancer-associated cell membrane glycoprotein, down-regulates ings of the Sixth International Conference on Intelligent Systems for E-cadherin and promotes metastasis. Proc Natl Acad Sci USA 99: 365– Molecular Biology, edited by Glasgow J, Littlejohn T, Major F, Lathrop R, 370, 2002. Sankoff D, Sensen C. Menlo Park, CA: AAAI, 1998, p. 175–182.

AJP-Regul Integr Comp Physiol • VOL 294 • APRIL 2008 • www.ajpregu.org R1378 EXPRESSION OF FXYD GENES IN A TELEOST

54. Sweadner KJ, Feschenko MS. Predicted location and limited accessibil- 57. Tipsmark CK, Madsen SS, Seidelin M, Christensen AS, Cutler CP, ity of protein kinase A phosphorylation site on Na-K-ATPase. Am J Cramb G. Dynamics of Naϩ,Kϩ,2ClϪ cotransporter and Naϩ,Kϩ- Physiol Cell Physiol 280: C1017–C1026, 2001. ATPase expression in the branchial epithelium of brown trout (Salmo 55. Sweadner KJ, Rael E. The FXYD gene family of small ion transport trutta) and Atlantic salmon (Salmo salar). J Exp Zool 293: 106–118, 2002. regulators or channels: cDNA sequence, protein signature sequence, and 58. Tusna´dy GE, Simon I. Principles governing amino acid composition of expression. Genomics 68: 41–56, 2000. integral membrane proteins: applications to topology prediction. J Mol 56. Sweadner KJ, Arystarkhova E, Donnet C, Wetzel RK. FXYD proteins Biol 283: 489–506, 1998. as regulators of the Na,K-ATPase in the kidney. Ann NY Acad Sci 986: 59. Venkatesh B. Evolution and diversity of ﬁsh genomes. Curr Opin Genet 382–387, 2003. Dev 13: 588–592, 2003. Downloaded from http://ajpregu.physiology.org/ by 10.220.33.6 on January 9, 2017

AJP-Regul Integr Comp Physiol • VOL 294 • APRIL 2008 • www.ajpregu.org