Is There a Future for Knockdown Experiments in the Era of Genome Editing? Alex M

COMMENTARY Loss-of-function approaches in comparative physiology: is there a future for knockdown experiments in the era of genome editing? Alex M. Zimmer1,*,‡, Yihang K. Pan1,*, Theanuga Chandrapalan2, Raymond W. M. Kwong2 and Steve F. Perry1

ABSTRACT genome aimed at ablating gene function. LOF mutations may be Loss-of-function technologies, such as morpholino- and RNAi- null (amorphic; see Glossary), resulting in the complete loss of gene mediated gene knockdown, and TALEN- and CRISPR/Cas9- function, or may only partially reduce gene function (hypomorphic; mediated gene knockout, are widely used to investigate gene see Glossary), depending on the nature of the mutation (Housden function and its physiological significance. Here, we provide a et al., 2017). While mutant lines (see Glossary) in many species general overview of the various knockdown and knockout were initially established through forward genetic screens (Brenner, technologies commonly used in comparative physiology and 1974; Nüsslein-volhard and Wieschaus, 1980; Haffter et al., 1996; discuss the merits and drawbacks of these technologies with a Driever et al., 1996; Nolan et al., 2000; de Angelis et al., 2000), the particular focus on research conducted in zebrafish. Despite their recent development of zinc-finger nucleases (ZFNs), transcription widespread use, there is an ongoing debate surrounding the use of activator-like effector nucleases (TALENs) and clustered regularly knockdown versus knockout approaches and their potential off-target interspaced palindromic repeats (CRISPR)/CRISPR-associated effects. This debate is primarily fueled by the observations that, in nuclease (Cas) has allowed for precise targeted gene knockout. some studies, knockout mutants exhibit phenotypes different from Currently, the merits of knockdown versus knockout approaches those observed in response to knockdown using morpholinos or in biological research are being debated. Since the advent of RNAi. We discuss the current debate and focus on the discrepancies relatively simple genetic knockout approaches (primarily CRISPR/ between knockdown and knockout phenotypes, providing literature Cas), there is a growing sentiment that these techniques should be ‘ ’ and primary data to show that the different phenotypes are not considered as gold standards for determining gene function and necessarily a direct result of the off-target effects of the knockdown that knockdown approaches, which often result in only a partial agents used. Nevertheless, given the recent evidence of some LOF, should be used only when null mutants are available for knockdown phenotypes being recapitulated in knockout mutants comparison (Schulte-Merker and Stainier, 2014; Lawson, 2016; lacking the morpholino or RNAi target, we stress that results of Stainier et al., 2017). The view that knockdown approaches should knockdown experiments need to be interpreted with caution. We be used only when comparison can be made to a null mutant stems ultimately argue that knockdown experiments should not be mainly from reports of off-target effects (see Glossary): either discontinued if proper control experiments are performed, and that binding of knockdown reagents to non-target gene products or with careful interpretation, knockdown approaches remain useful to toxicity leading to non-specific phenotypes, with the use of RNAi complement the limitations of knockout studies (e.g. lethality of and morpholino knockdown (Jackson et al., 2003, 2006a; Jackson knockout and compensatory responses). and Linsley, 2004; Aleman et al., 2007; Robu et al., 2007; Kok et al., 2015; Joris et al., 2017). Knockout approaches are thought to KEY WORDS: CRISPR/Cas9, RNAi, Morpholino, Reverse genetics, have lower incidences of off-target effects compared with RNAi or Knockdown, Knockout morpholino knockdown, and thus are argued to be the preferred LOF approach moving forward. Perhaps most worrying is that in a Introduction screen of more than 24 genes, 80% of morphant (morpholino- Techniques in loss-of-function (LOF) experiments have continually treated; see Glossary) zebrafish did not phenocopy individuals expanded in their applicability, ease of use and affordability. As carrying null mutations of the targeted gene, suggesting widespread such, LOF experiments, involving either knockdown or knockout off-target effects of morpholinos (Kok et al., 2015) and spurring approaches (see Glossary), are now used widely in many research debate in some fields (e.g. Faucherre et al., 2014, 2016; Shmukler fields, including comparative physiology. Knockdown refers to the et al., 2015, 2016). Here, we provide experimental evidence and transcriptional or translational repression of gene expression, present support from the literature to argue that differences between ultimately leading to a reduction in protein expression, without knockdown and knockout-induced phenotypes may not always be a any genome modifications. The most widely used knockdown result of non-specific, off-target effects in carefully controlled techniques are RNA interference (RNAi) and morpholino antisense knockdown experiments. We advocate that knockdown approaches oligonucleotide knockdown. Importantly, knockdown approaches should continue to be used in comparative physiology research. often result in only a ‘partial’ LOF, whereby some protein function may be retained. By contrast, knockout refers to a mutation in the Knockdown techniques RNA interference The development of RNAi for targeted gene knockdown was 1Department of Biology, University of Ottawa, Ottawa, ON K1N 6N5, Canada. – 2Department of Biology, York University, Toronto, ON M3J 1P3, Canada. pioneered by Andrew Fire and Craig Mello, who along with co- *These authors contributed equally to this work workers – discovered that the administration of double-stranded RNA (dsRNA) targeting unc-22 in Caenorhabditis elegans ‡Author for correspondence ([email protected]) produced phenotypes that mimicked those of unc-22 null mutants

A.M.Z., 0000-0002-4574-1334 (Fire et al., 1998). RNAi can be achieved through dsRNA Journal of Experimental Biology

1 COMMENTARY Journal of Experimental Biology (2019) 222, jeb175737. doi:10.1242/jeb.175737

Morpholino antisense oligonucleotides Glossary Morpholino antisense oligonucleotides (morpholinos) are another Genetic compensation class of antisense knockdown reagent that consist of a 6-member Changes in RNA or protein levels that can functionally compensate for morpholine ring backbone and phosphorodiamidate inter-subunit the loss of function of another gene. linkages (Summerton, 2007). Morpholinos [typically about 25 base Hypomorphic mutation pairs (bp) in length] can be designed to bind to the start of the coding Mutation that leads to only a partial loss or reduction in gene function. Knockdown region of an mRNA or to the intron/exon boundaries of a pre-mRNA Perturbation at the DNA, RNA or protein level that reduces the amount of to block translation or splicing, respectively, by complementary base- functional protein. pairing (Fig. 1B). Morpholinos were first demonstrated to be capable Knockout of phenocopying null mutant phenotypes in frogs (Heasman et al., Genetic perturbation that completely ablates gene function. 2000) and zebrafish (Nasevicius and Ekker, 2000), and rapidly Morphant became an important tool for assessing gene function in biological Individual treated with morpholino antisense oligonucleotide. Mutant research (Ekker, 2000; Corey and Abrams, 2001; Heasman, 2002; Individual carrying a knockout mutation in the genome. Bill et al., 2009). Guidelines for morpholino use have since been Null (amorphic) mutation established (Ekker and Larson, 2001; Eisen and Smith, 2008; Bill Mutation that leads to complete loss of gene function. et al., 2009; Stainier et al., 2017; Xin and Duan, 2018). Off-target effects The use of morpholino oligonucleotides has expanded markedly Non-specific effects of loss-of-function reagents resulting from targeting to include several species and applications in comparative of unintended genes or from toxic effects such as activation of immune or apoptotic pathways. physiology research (Table 1). Initially, morpholinos were used in Transcriptional adaptation early embryonic/larval stages, where they are directly administered Changes in RNA levels that result from a genetic mutation and not from into embryos at the one-cell stage, limiting effective knockdown to a the loss of gene function. narrow window of early-life development (Bill et al., 2009). However, the advent of vivo-morpholinos (Morcos et al., 2008; Moulton and Shan, 2009; Ferguson et al., 2014a) possessing a membrane-penetrating, eight-guanidine conjugate has allowed gene administration or introduction of short hairpin RNA (shRNA) knockdown in adults and in cell cultures (Table 1). As controls, a expression vectors (Hannon, 2002; Meister and Tuschl, 2004; Rao morpholino in which 5 bases of the original sequence are altered et al., 2009). While the cellular processing of dsRNA and shRNA to prevent binding to the target mRNA or a standard control differ, both ultimately produce small/short interfering RNA morpholino that has no biological activity except in reticulocytes of (siRNA) that is incorporated into the RNA-induced silencing humans with a specific mutation linked to β-thalassemia can be used complex (RISC). The antisense siRNA strand guides RISC to the (Gene-Tools, LLC). target mRNA for degradation or translational repression (Fig. 1A; Like RNAi, morpholinos are also prone to off-target effects. Hannon, 2002; Novina and Sharp, 2004; Carthew and Sontheimer, Ekker and Larson (2001) reported that 15–20% of morpholinos 2009; Rao et al., 2009; Wilson and Doudna, 2013; Housden et al., display off-target phenotypic effects (phenotypes that do not copy 2017). Importantly, mechanisms of RNAi may differ between known null mutations), even when dose is carefully controlled. species (Meister and Tuschl, 2004). These off-target phenotypes are generally characterized by reduced RNAi-mediated gene knockdown has been used in an attempt to head and eye size, notochord malformations and craniofacial silence gene expression in zebrafish (Wargelius et al., 1999), defects. One major cause of these effects is the activation of p53- Drosophila (Kennerdell and Carthew, 1998) and mice (Wianny and mediated apoptosis, which can be attenuated by co-injection of a Zernicka-Goetz, 2000), and is used extensively in comparative morpholino that targets the p53 gene (Robu et al., 2007). In addition physiology research (Table 1), although concerns have been raised to p53 activation, evidence from Xenopus tropicalis has about off-target effects of RNAi. In zebrafish, injection of dsRNA demonstrated widespread regulation of non-target genes, primarily designed to target tbx16/spt produced novel phenotypes not seen in those with immune function, and mis-splicing of non-target genes tbx16/spt null mutants (Oates et al., 2000). Moreover, while in response to morpholino injection (Gentsch et al., 2018). Indeed, injection of the dsRNA resulted in a dose-dependent decrease in there is now mounting evidence, derived primarily from zebrafish, tbx16/spt mRNA, it also resulted in a similar decrease in the mRNA that morphants often do not phenocopy null mutants (Robu et al., of non-target genes. Most strikingly, injection of dsRNA targeting 2007; Gerety and Wilkinson, 2011; Kok et al., 2015; Novodvorsky the lacZ gene of Escherichia coli, for which there is no homolog in et al., 2015; Rossi et al., 2015; Shmukler et al., 2015; Eve et al., zebrafish, caused the same phenotype and decrease in tbx16/spt 2017; Joris et al., 2017). In addition, unlike RNAi, where many of mRNA as the tbx16/spt dsRNA (Oates et al., 2000). Several studies the mechanisms of off-target effects have been characterized have demonstrated off-target effects of RNAi at the transcript, (Jackson and Linsley, 2004; Seok et al., 2018), the mechanisms protein and phenotype levels (Jackson et al., 2003, 2006a; Scacheri of p53 activation, immune responses, splice defects and non-target et al., 2004; Lin et al., 2005; Aleman et al., 2007). These effects are binding are not as well understood for morpholinos, and minimizing suggested to result from binding to non-target transcripts, activation off-target effects may therefore be challenging. of the interferon immune response or interference with endogenous micro-RNA (miRNA) pathways (Jackson and Linsley, 2004; Cullen, Knockout techniques 2006; Svoboda, 2007; Seok et al., 2018). There is evidence, however, Genome editing using targetable nucleases such as ZFNs (Bibikova that specific chemical modifications of dsRNA can limit off-target et al., 2002; Doyon et al., 2008; Geurts et al., 2009; Urnov et al., effects (Jackson et al., 2006b). Compared with dsRNA, shRNA is 2010), TALENs (Huang et al., 2011; Tesson et al., 2011; Joung and thought to produce fewer off-target effects because this approach Sander, 2013) and CRISPR/Cas9 (Cong et al., 2013; Jinek et al., utilizes endogenous miRNA cellular processing pathways and is thus 2013; Mali et al., 2013a; Hwang et al., 2013) allows for the less likely to trigger immune responses (Rao et al., 2009). generation of specific gene knockouts exhibiting complete and Journal of Experimental Biology

2 COMMENTARY Journal of Experimental Biology (2019) 222, jeb175737. doi:10.1242/jeb.175737

A RNAi/RISC siRNA Dicer Double-strand cleavage dsRNA

3Ј mRNA cleavage mRNA RISC mRNA 5Ј degradation

B Splice-blocking or translation-blocking MO Ј DNA 5Ј 3 3Ј 5Ј

MO MO 3Ј 5Ј Pre-mRNA mRNA AUG Exon Intron Exon Intron 5Ј 3Ј Sterically blocks Splice blocking translation

Exon Intron Exon No protein Mis-spliced protein

C ZFN and TALEN D CRISPR/Cas9

Cas9 ZFP DNA binding domain sgRNA or 5Ј TALE DNA binding domain

3Ј FokI Target sequence Ј 3’ DNA 5 3Ј 5’ FokI PAM

Double-strand break

5Ј 3Ј 3Ј 5Ј Endogenous repair mechanism (NHEJ)

5Ј 3Ј Frameshift mutation resulting in 3Ј 5Ј gene knockout Indel^

Fig. 1. Mechanisms of loss-of-function technologies. (A) Gene knockdown via RNA interference (RNAi). RNA-induced silencing complex (RISC) is mediated by Dicer to produce small interfering RNA (siRNA), which guides RISC to the target mRNA, initiating its degradation. (B) Splice-blocking or translation-blocking morpholinos result in a mis-spliced or absent protein, respectively. (C) ZFN and TALEN, and (D) CRISPR/Cas9 introduce double-strand breaks (DSBs) in target DNA. These DSBs are repaired by non-homologous end-joining (NHEJ), causing frameshift mutations and ultimate knockout of the gene. Abbreviations: Cas9, CRISPR-associated protein 9; FokI, restriction endonuclease FokI; Indel, insertions/deletions; MO, morpholino; PAM, protospacer adjacent motif; sgRNA, single-guide RNA; TALEN, transcription activator-like effector nuclease; ZFN, zinc-finger nuclease. See Box 1 for further details on the mechanisms of programmable nucleases for gene editing. permanent silencing of target gene function (Box 1). These cycle (see Table 1). Exceptions exist where homozygous mutants techniques introduce double-strand breaks (DSBs) at specific are non-viable or more subtly where the homozygous mutant is sites, and error-prone cellular repair mechanisms introduce viable, yet the gene of interest has early developmental effects, insertion or deletion mutations when DSBs are repaired. Repair resulting in subsequent phenotypic analysis being unable to identify occurs either through non-homologous end-joining (NHEJ; Fig. 1C,D) the primary function of the gene of interest. or homology-directed repair (HDR) when a donor DNA template is present. Knockout techniques are generally used at the single-cell ZFNs and TALENs embryo stage, with the aim of inducing a heritable mutation in the Chimeric ZFNs and TALENs are composed of a DNA-binding germline. This results in the generation of homozygous mutants that domain that recognizes specific sequences (Box 1), and a restriction can be used for experiments at most stages of the organism’s life enzyme FokI nuclease domain for DNA cleavage. However, Journal of Experimental Biology

3 COMMENTARY Journal of Experimental Biology (2019) 222, jeb175737. doi:10.1242/jeb.175737

Table 1. Examples of LOF studies in comparative physiology LOF Experiment Model system LOF approach Delivery method induced performed References Invertebrates Nematode RNAi E. coli feeding Embryo/ Embryo to Choe and Strange, 2008; (Caenorhabditis larva larva Crombie et al., 2016 elegans) CRISPR/Cas9 Plasmid construct injection into adult Embryo Adults Van Sinay et al., 2017 gonad Fruit fly RNAi Gal4-UAS-dsRNA Adult Adults Stergiopoulos et al., 2009; (Drosophila Chahine et al., 2012 melanogaster) TALEN TALEN mRNA microinjection Embryo Adult Sajwan et al., 2015 CRISPR/Cas9 Microinjection of plasmid construct Embryo Embryo to Gáliková et al., 2015; Newman adult et al., 2017 Mosquito RNAi Waterborne exposure Larva Larva Chasiotis et al., 2016; Durant (Aedes aegypti) et al., 2017; Misyura et al., 2017 CRISPR/Cas9 Microinjection of sgRNA+Cas9 protein Embryo Adult Vinauger et al., 2018 Mosquito RNAi Microinjection Adult Adult Sim and Denlinger, 2009 (Culex pipiens) Whitefly RNAi Direct feeding Adult Adult Lu and Wan, 2011 (Bemisia tabaci) Beet armyworm RNAi Microinjection Larva Larva Park and Kim, 2013 (Spodoptera exigua) Australian crayfish RNAi Injection Juvenile Juvenile Pamuru et al., 2012 (Cherax quadricarinatus) Chinese mitten crab RNAi Injection Juvenile Juvenile Li et al., 2016 (Eriocheir sinensis) Swimming crab RNAi Injection Adult Adult Si et al., 2018 (Portunus trituberculatus) Fujian oyster RNAi Waterborne exposure Larva Larva Yang et al., 2017 (Crassostrea angulata) Pacific oyster RNAi Injection Adult Adult Choi et al., 2013; Zhao et al., (Crassostrea gigas) 2017 Eastern oyster RNAi Injection Adult Adult Pales Espinosa and Allam, (Crassostrea virginica) 2018 Sea urchin Morpholino Microinjection Embryo Embryo Katow et al., 2010 (Hemicentrotus pulcherrimus)

Vertebrates Zebrafish (Danio rerio) Morpholino Microinjection Embryo Embryo Horng et al., 2007; Shih et al., 2008; Braun et al., 2009; Kumai and Perry, 2011 TALEN TALEN mRNA microinjection Embryo Larva to adult Shu et al., 2016; Yabuki et al., 2016; Yong et al., 2017 CRISPR/Cas9 Microinjection of sgRNA+Cas9 mRNA Embryo Larva to adult Chen et al., 2017; Facchinello et al., 2017; Lupton et al., 2017; Cai et al., 2018 Medaka CRISPR/Cas9 Microinjection of sgRNA+Cas9 mRNA Embryo Larva to adult Homma et al., 2017; Yeh et al., (Oryzias latipes) 2017; Watanabe et al., 2018 African cichlid CRISPR/Cas9 Microinjection of sgRNA+Cas9 mRNA Embryo Adult Juntti et al., 2016 (Astatotilapia burtoni) Chinese tongue sole TALEN TALEN mRNA microinjection Embryo Adult Cui et al., 2017 (Cynoglossus semilaevis) Red sea bream (Pagrus CRISPR/Cas9 Microinjection of sgRNA+Cas9 mRNA Embryo Adult Kishimoto et al., 2018 major) African clawed frog Morpholino Microinjection Embryo Embryo Horn et al., 2013 (Xenopus laevis) Western clawed frog CRISPR/Cas9 Microinjection of sgRNA+Cas9 mRNA Embryo Larva to adult Sakane et al., 2018 (Xenopus tropicalis) Atlantic killifish Morpholino Microinjection Embryo Embryo Matson et al., 2008 (Fundulus heteroclitus) Vivo-morpholino Injection Adult Adult Notch et al., 2011 ZFN and Microinjection Embryo Embryo Aluru et al., 2015 CRISPR/Cas9 Laboratory mouse (Mus RNAi Injection of viral vector Adult Adult Sun et al., 2008 musculus) Vivo-morpholino Injection Adult Adult Ferguson et al., 2013; Ferguson et al., 2014b Continued Journal of Experimental Biology

4 COMMENTARY Journal of Experimental Biology (2019) 222, jeb175737. doi:10.1242/jeb.175737

Table 1. Continued LOF Experiment Model system LOF approach Delivery method induced performed References TALEN Microinjection of TALEN mRNA into Embryo Adult Wang et al., 2016 fertilized one-cell embryos CRISPR/Cas9 Electroporation of sgRNA plasmid into Embryo Adult Tsuchiya et al., 2015; Davies embryonic stem cell/microinjection of et al., 2017 sgRNA+Cas9 mRNA into fertilized eggs Laboratory rat RNAi Tracheal administration/lipofection of Adult Adult Li and Folkesson, 2006 (Rattus norvegicus) plasmid DNA Pig (Sus scrofa TALEN Cell transfection followed by somatic cell Somatic Juvenile Quadalti et al., 2018 domesticus) nuclear transfer cell CRISPR/Cas9 Cell transfection followed by somatic cell Somatic Juvenile Quadalti et al., 2018 nuclear transfer cell

In vitro cell/tissue culture Rainbow trout RNAi Lipofection of cultured gill cells –– Kolosov and Kelly, 2017; (Oncorhynchus mykiss) Kolosov et al., 2017 Laboratory rat (Rattus RNAi Reversible chemical permeabilization of –– Wickramasekera et al., 2013 norvegicus) cultured brain tissue Morpholino Endo-porter delivery into seeded –– Figeac et al., 2010 pancreatic INS-1 cells CRISPR/Cas9 sgRNA plasmid transfection –– Roy et al., 2014 A non-exhaustive list of studies in comparative physiology that have employed LOF techniques, including the study species, LOF approach, delivery method, life stage at which the LOF was induced and life stage at which the experiments were performed. construction of sequence-specific ZFNs and TALENs is specificity are the modular assembly approach and selection- challenging and time-consuming, which has led to their gradual based approach (see Beerli and Barbas, 2002; Ochiai and replacement by CRISPR/Cas. The two main approaches for Yamamoto, 2015 for review). The recognition code of TALEs is constructing zinc-finger proteins with unique DNA-binding simpler than that of zinc fingers (Box 1), but provides similar technical challenges to synthesis due to extensive identical repeat sequences. Several methods have been developed that enable rapid Box 1. Mechanism of ZFNs, TALENs and CRISPR/Cas- assembly of custom TALE arrays (see Joung and Sander, 2013; mediated genome targeting Ochiai and Yamamoto, 2015 for review). Zinc-finger nucleases (ZFNs) are artificial restriction enzymes generated by fusing a zinc-finger DNA-binding domain to a DNA-cleavage domain. ZFN specificity is conferred by Cys2–His2 zinc-finger domains, which CRISPR/Cas consist of 30 amino acids arranged in a ββα configuration. These CRISPR has been transformative across nearly all biological and domains bind a specific 3 bp DNA sequence (Beerli and Barbas, 2002). medical science-related fields, and rapidly became the method of Sequence specificity of zinc-finger proteins can be determined by choice for genome editing. Unlike ZFNs and TALENs, where each combining up to three contiguous domains, resulting in a 9 bp recognition sequence. The design of a linker sequence to connect two new target site requires the design and construction of a new three-finger proteins further increased ZFN specificity to 18 bp in length, nuclease, CRISPR/Cas9 uses a CRISPR RNA (crRNA) and a trans- allowing specificity in genomes up to 68 billion bp (Liu et al., 1997). By activating crRNA (tracrRNA) that can be engineered into a single fusing zinc-finger proteins to the cleavage domain of FokI nuclease, guide RNA (sgRNA) to target the Cas9 nuclease to a specific DNA ZFNs capable of cleaving DNA in a sequence-specific manner were sequence (Box 1; Fig. 1D). For a more comprehensive review of the generated (Fig. 1C; Kim et al., 1996). history and mechanisms of CRISPR/Cas9-mediated genome Similarly to ZFNs, the specificityof TALENs is conferred by DNA-binding proteins termed transcription activator-like effectors (TALEs). TALEs are targeting, see Doudna and Charpentier (2014). naturally occurring proteins found in phytopathogenic bacteria of the genus Following the first demonstrations that CRISPR/Cas9 can be Xanthomonas. The DNA-binding domain of TALE is composed of multiple, repurposed for genome editing in eukaryotic cells (Cong et al., nearly identical repeats, each of which comprises ∼34 amino acids. Two 2013; Mali et al., 2013a; Jinek et al., 2013), this technique was hypervariable amino acid residues in each repeat recognize one bp in adopted for studies on fruit flies (Bassett et al., 2013; Gratz et al., target DNA (Boch et al., 2009; Moscou and Bogdanove, 2009). By joining 2013), zebrafish (Chang et al., 2013; Hwang et al., 2013; Xin and appropriate repeat units, TALEs can be redesigned to bind to user-defined Duan, 2018; Box 2), nematodes (Friedland et al., 2013), mice (Yang sequences (Boch et al., 2009), and their fusion with FokI nuclease generated TALENs for genome editing (Fig. 1C; Christian et al., 2010; Li et al., 2013) and other organisms (Blitz et al., 2013; Flowers et al., et al., 2010; Mahfouz et al., 2011; Miller et al., 2011). 2014; Niu et al., 2014; Whitworth et al., 2014). CRISPR has also CRISPR/Cas-mediated genome editing utilizes the microbial adaptive been adopted for LOF experiments to study gene function in immune system CRISPR. Unlike ZFNs and TALENs, the CRISPR nuclease physiological processes (Table 1). Cas9 is targeted by a short guide RNA that comprises a constant region Despite the simplicity of CRISPR, some studies have shown (which facilitates the binding of Cas9 nuclease and maintains the that Cas9 nucleases can induce mutations at off-target sites complex in its active form) and a target-specific region (typically 20 bp in length) that is complementary to the target DNA sequence (Jinek et al., (reviewed by Tsai and Joung, 2016). However, the majority of 2012; Lim et al., 2016). In addition, binding of a protospacer-adjacent off-target sites exhibit mutation frequencies at least 2-fold lower motif (PAM) downstream of the target locus is required to direct Cas9- than on-target mutation frequency if the off-target site has greater mediated double-strand breaks (Gasiunas et al., 2012). than one bp mismatch compared with the on-target site (Hsu

et al., 2013; Pattanayak et al., 2013; Cho et al., 2014). Journal of Experimental Biology

5 COMMENTARY Journal of Experimental Biology (2019) 222, jeb175737. doi:10.1242/jeb.175737

the same locus to result in DNA cleavage (Ran et al., 2013; Mali Box 2. Workflow for establishing a mutant line of zebrafish et al., 2013b), and fusing catalytic residue inactive, ‘dead’ Cas9 using CRISPR/Cas9 gene editing (dCas9) with FokI, requiring dual sgRNAs to coordinate FokI– CRISPR/Cas9 technology provides an efficient way of generating dCas9 dimerization at a specific locus to enable DNA cleavage knockout lines in zebrafish. First, wild-type (WT) zebrafish embryos are (Guilinger et al., 2014; Tsai et al., 2014). Even if off-target microinjected with sgRNA-Cas9 solution at the one-cell stage of effects are unavoidable, unlinked off-target mutations should development. These embryos are reared to reproductive maturity segregate through breeding when generating a homozygous (∼90 dpf). Founder fish (F0, mosaic red and blue stripes) are then out-crossed with WT fish (solid blue stripes) to yield heterozygous F1 fish mutant line (Box 2), and phenotyping of mutants generated from (F1 +/–, solid red and blue stripes). Mature F1 fish that carry the same two independent founder animals would be sufficient to establish mutation are in-crossed to obtain homozygous F2 (F2 −/−, solid red causality between phenotype and genotype. stripes). Genotypic and phenotypic screening may take place The success of CRISPR/Cas9 as a genome editing tool has periodically at either the embryonic or adult stage (e.g. using fin resulted in a search for additional Cas nucleases for applications in biopsy) to ensure the presence of a frameshift mutation. genome editing. Notably, Cas12a (previously named Cpf1) has emerged as an alternative for Cas9. Cas12a only requires a ∼44- F0 Microinjected embryos nucleotide crRNA for activation (Zetsche et al., 2015), which is much shorter than the ∼100-nucleotide sgRNA required for Cas9, Screen for mutagenesis providing a significant advantage for the production of synthetic guide RNAs. Furthermore, instead of the blunt cuts produced by X Cas9, Cas12a generates staggered cuts at target DNA, allowing gene fragments to be inserted in the desired orientation via Founder WT complementary sticky ends, as in traditional restriction enzyme cloning methods (Zetsche et al., 2015). Genotypic and phenotypic F1 characterization The knockdown versus knockout debate The knockdown versus knockout debate in the zebrafish community has been ongoing for over a decade and has led to the publication of specific guidelines for the use of morpholinos in zebrafish research X (Eisen and Smith, 2008; Stainier et al., 2017). Similarly, guidelines for the use and design of RNAi have also been established (Cullen, F1 +/− F1 +/− 2006; Bofill-De Ros and Gu, 2016) and research in RNAi approaches continues to produce methods to minimize off-target Genotypic and phenotypic F2 characterization effects (Jackson et al., 2006b; Mockenhaupt et al., 2015; Suter et al., 2016). Recently, the knockdown versus knockout debate was spurred by Kok et al. (2015), who demonstrated that in 80% of the 24 genes studied, morphants failed to phenocopy mutants. Some researchers have advocated limiting the use of morpholinos to cases in which comparison can be made to a null mutant phenotype F2 −/− (Schulte-Merker and Stainier, 2014; Lawson, 2016; Stainier et al., 2017). Others propose the continued use of morpholinos even in the F0 animals generated by CRISPR/Cas9 technology are often mosaic; absence of a null mutant in order to maintain progress in biological to screen for the presence of insertion/deletion mutations from a large research (Blum et al., 2015). number of F0 animals, a variety of methods can be used other than Sanger sequencing. The easiest methods are to take screening into Even with proper experimental design and careful control of consideration when selecting target sites, such that the target site dose, morpholinos and RNAi can exert non-specific off-target contains a restriction enzyme site that will be lost along with the lesion; effects that are unrelated to target gene function. However, there are this loss can be identified through PCR/restriction enzyme analysis (Gao several additional reasons for the discrepancy between knockdown et al., 2015; Bhowmik et al., 2018). Alternatively, segmental deletions and mutant phenotypes that need to be considered to appreciate how can be generated by simultaneously targeting multiple sites. This results the comparison of differences between mutant and morphant in fragment size differences between WT and mutant alleles that can be phenotypes has likely overestimated the prevalence of off-target detected through PCR and agarose gel electrophoresis (Tabebordbar et al., 2016). Other screening methods that are applicable to all target effects of this particular knockdown reagent. First, in many of the sites include T7E1 and surveyor assay (Mashal et al., 1995; Qiu et al., studies cited by Kok et al. (2015), morpholino dose was not properly 2004; Guschin et al., 2010), PAGE-based assay (Zhu et al., 2014), high- controlled, a factor that we demonstrate with experimental evidence resolution melting (HRM) curve analysis (Montgomery et al., 2007; to have profound gross morphological off-target effects in zebrafish. Thomas et al., 2014) and annealing at critical temperature (ACT) PCR Second, transcriptional adaptation (see Glossary) in mutants can (Hua et al., 2017). In F1 and F2 animals, the precise alteration of the lead to genetic compensation (see Glossary) of functionally related target loci can be further characterized by using Sanger sequencing. gene pathways (El-Brolosy and Stainier, 2017), which would not be observed in knockdown approaches that do not alter the genome. Third, LOF mutant progeny generated from heterozygous parents Refinements in the CRISPR/Cas9 system have further improved (Box 2) can carry sufficient wild-type maternal mRNA to maintain targeting specificity; these include truncating sgRNA to have normal gene function in the absence of wild-type zygotic mRNA in fewer than 20 nucleotides of complementarity with its target early life. These maternal mRNA-carrying null mutants will display DNA (Fu et al., 2014), converting Cas9 to a nickase enzyme phenotypes that differ from those generated with knockdown

(Cas9n) requiring two separate Cas9 binding events to occur at approaches that target both maternal and zygotic mRNA. Finally, Journal of Experimental Biology

6 COMMENTARY Journal of Experimental Biology (2019) 222, jeb175737. doi:10.1242/jeb.175737 partial knockdown by morpholino or RNAi can result in the still cause off-target effects (Ekker and Larson, 2001; Schulte- complete retention of normal physiological function if the targeted Merker and Stainier, 2014; Lawson, 2016), highlighting the protein has a high affinity for its substrate or has a high catalytic rationale for the recent suggestion that this knockdown reagent efficiency. In such cases, partial LOF phenotypes that retain normal needs to be validated in a null mutant of the same target (Stainier protein function will differ from amorphic mutant phenotypes. et al., 2017). Indeed, in our experiment, treating the Rhcgb null mutant with Rhcgb morpholino demonstrated the kinked-tail Dose-specific off-target effects phenotype is an off-target effect of the high morpholino dose The prevalence of off-target effects of morpholinos has likely been (Fig. 2). However, it is likely that the prevalence of gross inflated by inadequate control of dose in previous research. For morphological off-target effects of morpholinos has been inflated instance, Topczewska et al. (2001) reported that administration of a by poor control of reagent dose. morpholino targeting foxc1a at a dose of 10 ng/embryo resulted in a complete loss of somite boundaries in developing zebrafish larvae. Transcriptional adaptation and genetic compensation In a later study, foxc1a was knocked out using TALENs, resulting in Genetic knockout can lead to transcriptional adaptation and only mild somite defects (Li et al., 2015). However, when foxc1a resulting compensatory gene regulation through DSB-induced morpholinos were administered at 4 ng per embryo (Topczewska RNAs, mutant mRNA transcripts or RNA-binding proteins, et al., 2001), the resulting phenotype was milder and more similar to though the exact mechanisms and heritability of these the mutant phenotype reported by Li et al. (2015). To further transcriptomic changes are still unclear (El-Brolosy and Stainier, demonstrate how an incorrect dose of morpholino can lead to 2017). Since transcriptional adaptation is triggered by changes in morphological off-target effects, we performed an experiment with the genome, this response would not be observed in knockdown a morpholino designed to block the translation of the ammonia- approaches. For instance, Rossi et al. (2015) showed that severe transporting protein Rhcgb (Shih et al., 2012). At a dose of 4 ng, no vascular defects observed in Egfl7 knockdown zebrafish were not gross morphological defects were observed, and Rhcgb expression observed in egfl7 mutants, which would suggest off-target effects of was effectively abolished, such that the Rhcgb immunostaining Egfl7 knockdown. However, egfl7 knockout resulted in the pattern was indistinguishable from that of CRISPR/Cas9-generated upregulation of a different class of proteins and genes related to rhcgb null mutants (Fig. 2; see Appendix for details of methods vascular development, which was not observed in response to Egfl7 used). However, at higher doses, a specific phenotype was observed knockdown, indicating that the egfl7 mutants compensated for the whereby the trunk/tail was curved or kinked, as quantified by the loss of Egfl7 function (Rossi et al., 2015). Importantly, knockdown angular deviation from the midline of the body in the dorso–ventral can also result in genetic compensation if the compensatory or sagittal planes. Importantly, this effect was not observed in larvae mechanism is regulated by changes downstream of the gene (i.e. treated with the sham (standard control) morpholino even up to protein function). 12 ng per embryo (Fig. 2). This curved trunk phenotype was also observed, and perhaps was even more severe, in rhcgb null mutants Influence of maternal mRNA treated with 8–12 ng doses of morpholino (Fig. 2), demonstrating Where knockout results in death or loss of reproductive viability, that the observed phenotype can be considered an off-target effect researchers have used F2 homozygous mutant progeny of that is present only at morpholino doses that exceed those necessary heterozygous parents to assess LOF outcomes. In these cases, to effectively knock down Rhcgb protein expression. Importantly, heterozygous mutant parents may pass sufficient wild-type mRNA the lack of overt phenotype at the 4 ng dose does not necessarily of the target gene on to mutant offspring, resulting in early imply that this morpholino was free of off-target effects. For both developmental expression of the target protein from maternal morpholinos and RNAi, studies have demonstrated widespread mRNA (Wu et al., 2003). Alternatively, germ line replacement regulation of non-target genes thought to be related to immune (Ciruna et al., 2002) can be used to generate wild-type females with responses, splice defects or promiscuous binding in the case of homozygous mutant germ lines to obtain mutant offspring without morpholinos (Joris et al., 2017; Gentsch et al., 2018) or to alteration contribution of maternal mRNA; however, this method would not be of miRNA pathways by shRNA (Baek et al., 2014). It is possible feasible if the gene of interest is essential for germline development. In that these sub-phenotypic effects can have confounding effects on contrast, RNAi and translation-blocking morpholinos can knock the interpretation of knockdown results. down the expression of both maternal and zygotic transcripts, These experimental results highlight how the proportion of uncovering phenotypes that may not be observed in LOF morpholinos that are non-specific can be inflated by poor control of experiments when using mutant offspring generated from morpholino dose, resulting in off-target effects that have been heterozygous parents. In instances where maternal proteins are misinterpreted as the effect of targeted knockdown. Indeed, it is directly deposited into embryos, careful comparisons of mutants important to point out several features of the morphant phenotypes generated from heterozygous and homozygous crosses can help analyzed by Kok et al. (2015) who concluded that off-target effects elucidate the function of the gene of interest (Cote et al., 2007). occurred in 80% of morphants. First, of the 24 morphant phenotypes analyzed, 7 did not report the information necessary to determine Proteins with high affinity or efficiency dose. Second, of those doses that were reported, several were >8 ng, When utilizing knockdown approaches, protein function must be a dose that we found to result in a kinked-tail off-target phenotype considered. For example, Pena et al. (2017) used morpholinos and with the Rhcgb morpholino (Fig. 2). Third, the curved or kinked CRISPR/Cas9 to knock down or knock out, respectively, aldh7a1. trunk/tail phenotype that we observed in larvae treated with 8–12 ng This gene encodes α-aminoadipic-semialdehyde dehydrogenase Rhcgb morpholino was observed in 11 of 24 morphant phenotypes. (antiquitin), an enzyme important in the pathology of pyridoxine- In fact, Kok et al. (2015) conceded that a caveat of their study is that dependent epilepsy (PDE). In the absence of antiquitin, the toxic the phenotypes they chose to analyze were those most typically lysine intermediate piperideine-6-carboxylic acid (P6C) associated with off-target effects of morpholinos. It is important to accumulates and causes the pathophysiological effects of PDE. stress here that even with careful control of dose, morpholinos can Injection of a splice-blocking morpholino (2.5 ng per embryo) led Journal of Experimental Biology

7 COMMENTARY Journal of Experimental Biology (2019) 222, jeb175737. doi:10.1242/jeb.175737

A B C

B-F

D E F

G 70 I Sham morpholino y,* 60 Rhcgb morpholino

40 y,* 30 ) 20 deg

10 a a x a 0 70 J H 60

50 Angular trunk deviation ( y,* 40 y,*

10 x a a a 0 4812 Morpholino dose (ng)

Fig. 2. Off-target effects of Rhcgb morpholino in zebrafish when administered at doses in excess of that causing effective protein knockdown. Anti-Rhcgb whole-mount immunostaining of 4 dpf wild-type zebrafish larvae (A) treated with 4 ng sham (B), 4 ng Rhcgb (C), 12 ng sham (D) and 12 ng Rhcgb (E) morpholino, and of 4 dpf rhcgb mutants (F). Scale bars: 50 µm. Representative images of wild-type (G) and rhcgb mutant (H) larvae injected with 12 ng Rhcgb MO. Scale bars: 0.1 cm. (I,J) Quantitative analysis of the angular deviation from the midline of the body in wild-type (I) and rhcgb mutant (J) larvae injected with 4, 8 or 12 ng sham or Rhcgb morpholino. In I and J, different letters within a morpholino treatment represent statistically significant differences between doses and asterisks represent statistically significant differences of morpholino treatment within a given dose as determined by a two-way ANOVA followed by a Holm–Sıdá ́k post hoc test (n=16–25; *P<0.05). Journal of Experimental Biology

8 COMMENTARY Journal of Experimental Biology (2019) 222, jeb175737. doi:10.1242/jeb.175737 to a >80% reduction in Aldh7a1 protein expression in 4 dpf experiments should be interpreted with caution. While the advent zebrafish larvae, yet the levels of P6C were unchanged compared of simple and precise gene editing technologies such as CRISPR/ with levels in sham-injected larvae. However, P6C was found to Cas9 has revolutionized LOF approaches, it is clear that knockdown accumulate in aldh7a1 null mutants compared with wild-type larvae approaches will continue to be used in comparative physiology (Pena et al., 2017). The authors concluded that this difference in (Table 1). We advocate that carefully executed and interpreted P6C accumulation between morphants and mutants is likely due to knockdown experiments in comparative physiology, alongside the high catalytic efficiency of antiquitin for its substrate, such that knockout experiments when possible, will be important for normal physiological function is maintained even when protein maintaining progress in our understanding of gene function in expression is reduced by >80% (Pena et al., 2017). Therefore, physiological systems. protein/enzyme affinity/efficiency is certainly an important feature Appendix of physiological systems to bear in mind when interpreting results from − − Generation of rhcgb / null mutant zebrafish partial knockdown of target proteins. This example highlights that, in Expression of rhcgb (formerly rhcg1; NCBI gene accession: some instances, complete knockout is the only way to assess gene or NM_001320382.1) was knocked out using CRISPR/Cas9. A sgRNA protein function in physiological systems, and that maintenance of was synthesized using a cloning-free method described previously normal phenotypes in response to partial knockdown should be (Talbot and Amacher, 2014), and the guide sequence of the interpreted cautiously. sgRNA which was specific to a region of exon 1 of rhcgb (GGGCAACTGCTTCGGCTCCA) was designed using CHOPCHOP Should knockdown approaches continue to be used in (Montague et al., 2014; Labun et al., 2016). sgRNA size and quality were comparative physiology? verified by gel electrophoresis, and RNA concentration was determined Knockdown approaches have been used in comparative spectrophotometrically following purification (RNeasy mini kit, physiology research for over a decade, and their use continues QIAGEN). Cas9 mRNA was synthesized from zebrafish codon- today (Table 1). These studies have undoubtedly advanced our optimized Cas9 (pCS2-nls-zCas9-nls; Jao et al., 2013) using understanding of various physiological systems, yet the current mMESSAGE mMACHINE SP6 kit (Invitrogen). Following view in the zebrafish community for morpholinos is that purification (RNeasy Mini kit, Qiagen), mRNA size and quality was knockdown reagents should be limited to instances where the checked by gel electrophoresis and concentration was determined reagent can be tested in a null mutant background (Schulte- spectrophotometrically. Merker and Stainier, 2014; Lawson, 2016; Stainier et al., 2017). One-cell stage embryos were injected with 1 nl injection solution Indeed, this important control has demonstrated that some containing 150 pg Cas9 mRNA, 50 pg sgRNA and 0.01% Phenol morphant and RNAi-induced phenotypes can be recapitulated Red suspended in Danieau buffer (Nasevicius and Ekker, 2000). in null mutants lacking the gene target (Baek et al., 2014; Kok Embryos were reared to sexual maturity (60–90 dpf) and mutants in et al., 2015; Song et al., 2015; Jahangiri et al., 2016; Liu et al., this adult F0 population were identified through DNA extraction of 2017). While we agree that administration of knockdown fin clips and Sanger sequencing (Genome Quebec, McGill reagents in a null background is the most definitive way to University, Montreal, Canada), which confirmed that a portion prove knockdown specificity, many researchers in comparative (∼80%) of the embryos had a mutated rhcgb gene. A mutant line physiology work with non-model organisms (Table 1) for which was then established following the protocol outlined in Box 1 using mutant lines may not exist. Furthermore, generation time and founders carrying a 1 bp insertion 3 bp upstream of the PAM. husbandry of some species would make it impractical or Effective knockout of rhcgb was confirmed by whole-mount impossible to establish mutant founder lines. Indeed, the immunohistochemistry using an antibody and methods described production of mutant lines in zebrafish can take over a year previously (Nakada et al., 2007). (Box 2), and this species has a relatively short generation time (∼2–3 months). Therefore, we strongly believe that eliminating Morpholino knockdown knockdown experiments as an acceptable approach will limit One-cell stage embryos were injected with either sham (standard progress in the field of comparative physiology, in agreement control) morpholino (Gene-Tools, LLC, Philomath, OR, with the sentiment raised previously for developmental research USA; 5′-CCTCTTACCTCAGTTACAATTTATA-3′), which has (Blum et al., 2015). no biological target in zebrafish, or a translation-blocking The prevalence of off-target phenotypes arising from knockdown morpholino that targeted the translation start site of rhcgb (5′- approaches, in particular morpholinos, may have been CAGTTGCCCATGTCTACAGCTTGAG-3′; Shih et al., 2012) overestimated in the literature, but these reagents can still produce diluted in Danieau buffer and 0.01% Phenol Red. Effective off-target effects even when reagents and experiments are carefully knockdown of Rhcgb was confirmed by whole-mount designed and controlled. However, if researchers in comparative immunohistochemistry. physiology follow some of the earlier guidelines developed for morpholinos and RNAi (Cullen, 2006; Eisen and Smith, 2008) such Acknowledgements as: (1) confirmation of knockdown at the transcript or protein level; The authors wish to thank Christine Archer and ACVS staff at the University of Ottawa and also extend thanks to Dr Izabella Pena for many thoughtful (2) the use of multiple antisense reagents designed to target the same conversations that aided in this work. gene to demonstrate phenotype specificity; (3) concomitant treatment with an antisense reagent control that does not target Competing interests any gene within the host genome; and (4) careful titration of dose to The authors declare no competing or financial interests. the lowest causing target knockdown, rather than overt phenotype, we believe that knockdown results should still be admissible in peer- Funding A.M.Z. was supported by a Natural Sciences and Engineering Research Council of reviewed journals. It is important to bear in mind, however, that Canada (NSERC) postdoctoral fellowship. This research was supported by NSERC without the ability to confirm specificity in a mutant background, Discovery grants (G13017 to S.F.P. and 05984 to R.W.M.K.). R.W.M.K. was also results from even the most carefully conducted knockdown supported by the Canada Research Chairs Program. Journal of Experimental Biology

9 COMMENTARY Journal of Experimental Biology (2019) 222, jeb175737. doi:10.1242/jeb.175737

References Crombie, T. A., Tang, L., Choe, K. P. and Julian, D. (2016). Inhibition of the Aleman, L. M., Doench, J. and Sharp, P. A. (2007). Comparison of siRNA-induced oxidative stress response by heat stress in Caenorhabditis elegans. J. Exp. Biol. off-target RNA and protein effects. RNA 13, 385-395. 219, 2201-2211. Aluru, N., Karchner, S. I., Franks, D. G., Nacci, D., Champlin, D. and Hahn, M. E. Cui, Z., Liu, Y., Wang, W., Wang, Q., Zhang, N., Lin, F., Wang, N., Shao, C., Dong, (2015). Targeted mutagenesis of aryl hydrocarbon receptor 2a and 2b genes in Z. and Li, Y. (2017). Genome editing reveals dmrt1 as an essential male sex- Atlantic killifish (Fundulus heteroclitus). Aquat. Toxicol. 158, 192-201. determining gene in Chinese tongue sole (Cynoglossus semilaevis). Sci. Rep. 7, Baek, S. T., Kerjan, G., Bielas, S. L., Lee, J. E., Fenstermaker, A. G., Novarino, G. 42213. and Gleeson, J. G. (2014). Off-target effect of doublecortin family shRNA on Cullen, B. R. (2006). Enhancing and confirming the specificity of RNAi experiments. neuronal migration associated with endogenous microRNA dysregulation. Neuron Nat. Methods 3, 677-681. 82, 1255-1262. Davies, B., Brown, L. A., Cais, O., Watson, J., Clayton, A. J., Chang, V. T., Biggs, Bassett, A. R., Tibbit, C., Ponting, C. P. and Liu, J.-L. (2013). Highly efficient D., Preece, C., Hernandez-Pliego, P. and Krohn, J. (2017). A point mutation in targeted mutagenesis of Drosophila with the CRISPR/Cas9 system. Cell Rep. 4, the ion conduction pore of AMPA receptor GRIA3 causes dramatically perturbed 220-228. sleep patterns as well as intellectual disability. Hum. Mol. Genet. 26, 3869-3882. Beerli, R. R. and Barbas, C. F., III (2002). Engineering polydactyl zinc-finger de Angelis, M. H., Flaswinkel, H., Fuchs, H., Rathkolb, B., Soewarto, D., Heffner, transcription factors. Nat. Biotechnol. 20, 135. S., Pargent, W., Wuensch, K., Jung, M., Reis, A. et al. (2000). Genome-wide, Bhowmik, P., Ellison, E., Polley, B., Bollina, V., Kulkarni, M., Ghanbarnia, K., large-scale production of mutant mice by ENU mutagenesis. Nat. Genet. 25, 1-4. Song, H., Gao, C., Voytas, D. F. and Kagale, S. (2018). Targeted mutagenesis in Doudna, J. A. Charpentier, E. (2014). The new frontier of genome engineering with wheat microspores using CRISPR/Cas9. Sci. Rep. 8, 6502. CRISPR-Cas9. Science 346, 1258096. Bibikova, M., Golic, M., Golic, K. G. and Carroll, D. (2002). Targeted chromosomal Doyon, Y., McCammon, J. M., Miller, J. C., Faraji, F., Ngo, C., Katibah, G. E., cleavage and mutagenesis in Drosophila using zinc-finger nucleases. Genetics Amora, R., Hocking, T. D., Zhang, L. and Rebar, E. J. (2008). Heritable targeted 161, 1169-1175. gene disruption in zebrafish using designed zinc-finger nucleases. Nat. Bill, B. R., Petzold, A. M., Clark, K. J., Schimmenti, L. A. and Ekker, S. C. (2009). Biotechnol. 26, 702. A primer for morpholino use in zebrafish. Zebrafish 6, 69-77. Driever, W., Solnica-Krezel, L., Schier, A. F., Neuhauss, S. C., Malicki, J., Blitz, I. L., Biesinger, J., Xie, X. and Cho, K. W. Y. (2013). Biallelic genome Stemple, D. L., Stainier, D. Y., Zwartkruis, F., Abdelilah, S., Rangini, Z. et al. modification in F(0) Xenopus tropicalis embryos using the CRISPR/Cas system. (1996). A genetic screen for mutations affecting embryogenesis in zebrafish. Genesis 51, 827-834. Development. 123:37-46., 37-46. Blum, M., De Robertis, E. M., Wallingford, J. B. and Niehrs, C. (2015). Durant, A. C., Chasiotis, H., Misyura, L. and Donini, A. (2017). Aedes aegypti Morpholinos: antisense and sensibility. Dev. Cell 35, 145-149. Rhesus glycoproteins contribute to ammonia excretion by larval anal papillae. Boch, J., Scholze, H., Schornack, S., Landgraf, A., Hahn, S., Kay, S., Lahaye, T., J. Exp. Biol. 220, 588-596. Nickstadt, A. and Bonas, U. (2009). Breaking the code of DNA binding specificity Eisen, J. S. and Smith, J. C. (2008). Controlling morpholino experiments: don’t stop of TAL-type III effectors. Science 326, 1509-1512. making antisense. Development 135, 1735-1743. Bofill-De Ros, X. and Gu, S. (2016). Guidelines for the optimal design of miRNA- Ekker, S. C. (2000). Morphants: a new systematic vertebrate functional genomics based shRNAs. Methods 103, 157-166. approach. Yeast 17, 302-306. Braun, M. H., Steele, S. L., Ekker, M. and Perry, S. F. (2009). Nitrogen excretion in Ekker, S. C. and Larson, J. D. (2001). Morphant technology in model developing zebrafish (Danio rerio): a role for Rh proteins and urea transporters. developmental systems. Genesis 30, 89-93. Am. J. Physiol. Ren. Physiol. 296, F994-F1005. El-Brolosy, M. A. and Stainier, D. Y. R. (2017). Genetic compensation: a Brenner, S. (1974). The DNA of Caenorhabditis elegans. Genetics 77, 95-104. phenomenon in search of mechanisms. PLoS Genet. 13, 1-17. Cai, X., Zhang, D., Wang, J., Liu, X., Ouyang, G. and Xiao, W. (2018). Deletion of Eve, A. M. J., Place, E. S. and Smith, J. C. (2017). Comparison of zebrafish the fih gene encoding an inhibitor of hypoxia-inducible factors increases hypoxia tmem88a mutant and morpholino knockdown phenotypes. PLoS ONE 12, 1-17. tolerance in zebrafish. J. Biol. Chem. 293, 15370-15380. Facchinello, N., Skobo, T., Meneghetti, G., Colletti, E., Dinarello, A., Tiso, N., Carthew, R. W. and Sontheimer, E. J. (2009). Origins and mechanisms of miRNAs Costa, R., Gioacchini, G., Carnevali, O. and Argenton, F. (2017). nr3c1 null and siRNAs. Cell 136, 642-655. mutant zebrafish are viable and reveal DNA-binding-independent activities of the Chahine, S., Campos, A. and O’Donnell, M. J. (2012). Genetic knockdown of a glucocorticoid receptor. Sci. Rep. 7, 4371. single organic anion transporter alters the expression of functionally related genes Faucherre, A., Kissa, K., Nargeot, J., Mangoni, M. E. and Jopling, C. (2014). in Malpighian tubules of Drosophila melanogaster. J. Exp. Biol. 215, 2601-2610. Piezo1 plays a role in erythrocyte volume homeostasis. Haematologica 99, 70-75. Chang, N., Sun, C., Gao, L., Zhu, D., Xu, X., Zhu, X., Xiong, J.-W. and Xi, J. J. Faucherre, A., Kissa, K., Nargeot, J., Mangoni, M. E. and Jopling, C. (2016). (2013). Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Comment on: “Homozygous knockout of the piezo1 gene in the zebrafish is not Cell Res. 23, 465-472. associated with anemia”. Haematologica 101, e38. Chasiotis, H., Ionescu, A., Misyura, L., Bui, P., Fazio, K., Wang, J., Patrick, M., Ferguson, D. P., Schmitt, E. E. and Lightfoot, J. T. (2013). Vivo-morpholinos Weihrauch, D. and Donini, A. (2016). An animal homolog of plant Mep/Amt induced transient knockdown of physical activity related proteins. PLoS ONE 8, transporters promotes ammonia excretion by the anal papillae of the disease e61472. vector mosquito Aedes aegypti. J. Exp. Biol. 219, 1346-1355. Ferguson, D. P., Dangott, L. J. and Lightfoot, J. T. (2014a). Lessons learned from Chen, S., Reichert, S., Singh, C., Oikonomou, G., Rihel, J. and Prober, D. A. vivo-morpholinos: How to avoid vivo-morpholino toxicity. BioTechniques 56, (2017). Light-dependent regulation of sleep and wake states by prokineticin 2 in 251-256. zebrafish. Neuron 95, 153-168.e6. Ferguson, D. P., Dangott, L. J., Schmitt, E. E., Vellers, H. L. and Lightfoot, J. T. Cho, S. W., Kim, S., Kim, Y., Kweon, J., Kim, H. S., Bae, S. and Kim, J.-S. (2014). (2014b). Differential skeletal muscle proteome of high- and low-active mice. Analysis of off-target effects of CRISPR/Cas-derived RNA-guided endonucleases J. Appl. Physiol. 116, 1057-1067. and nickases. Genome Res. 24, 132-141. Figeac, F., Uzan, B., Faro, M., Chelali, N., Portha, B. and Movassat, J. (2010). Choe, K. P. and Strange, K. (2008). Genome-wide RNAi screen and in vivo protein Neonatal growth and regeneration of β-cells are regulated by the Wnt/β-catenin aggregation reporters identify degradation of damaged proteins as an essential signaling in normal and diabetic rats. Am. J. Physiol. Endocrinol. Metab. 298, hypertonic stress response. Am. J. Physiol. Cell Physiol. 295, C1488-C1498. E245-E256. Choi, S. H., Jee, B. Y., Lee, S. J., Cho, M. Y., Lee, S. J., Kim, J. W., Jeong, H. D. Fire, A., Xu, S. Q., Montgomery, M. K., Kostas, S. A., Driver, S. E. and Mello, and Kim, K. H. (2013). Effects of RNA interference-mediated knock-down of C. C. (1998). Potent and specific genetic interference by double-stranded RNA in hypoxia-inducible factor-α on respiratory burst activity of the Pacific oyster Caenorhabditis elegans. Nature 391, 806. Crassostrea gigas hemocytes. Fish Shellfish Immunol. 35, 476-479. Flowers, G. P., Timberlake, A. T., McLean, K. C., Monaghan, J. R. and Crews, Christian, M., Cermak, T., Doyle, E. L., Schmidt, C., Zhang, F., Hummel, A., C. M. (2014). Highly efficient targeted mutagenesis in axolotl using Cas9 RNA- Bogdanove, A. J. and Voytas, D. F. (2010). Targeting DNA double-strand breaks guided nuclease. Development 141, 2165-2171. with TAL effector nucleases. Genetics 186, 757-761. Friedland, A. E., Tzur, Y. B., Esvelt, K. M., Colaiácovo, M. P., Church, G. M. and Ciruna, B., Weidinger, G., Knaut, H., Thisse, B., Thisse, C., Raz, E. and Schier, Calarco, J. A. (2013). Heritable genome editing in C. elegans via a CRISPR-Cas9 A. F. (2002). Production of maternal-zygotic mutant zebrafish by germ-line system. Nat. Methods 10, 741. replacement. Proc. Natl. Acad. Sci. USA 99, 14919-14924. Fu, Y., Sander, J. D., Reyon, D., Cascio, V. M. and Joung, J. K. (2014). Improving Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., CRISPR-Cas nuclease specificity using truncated guide RNAs. Nat. Biotechnol. Jiang, W. and Marraffini, L. (2013). Multiplex genome engineering using 32, 279. CRISPR/Cas systems. Science 339, 819-823. Gáliková, M., Diesner, M., Klepsatel, P., Hehlert, P., Xu, Y., Bickmeyer, I., Predel, Corey, D. R. and Abrams, J. M. (2001). Morpholino antisense oligonucleotides: R. and Kühnlein, R. P. (2015). Energy homeostasis control in Drosophila tools for investigating vertebrate development. Genome Biol. 2, reviews1015-r1. adipokinetic hormone mutants. Genetics 201, 665-683. Cote, F., Fligny, C., Bayard, E., Launay, J.-M., Gershon, M. D., Mallet, J. and Gao, J., Wang, G., Ma, S., Xie, X., Wu, X., Zhang, X., Wu, Y., Zhao, P. and Xia, Q. Vodjdani, G. (2007). Maternal serotonin is crucial for murine embryonic (2015). CRISPR/Cas9-mediated targeted mutagenesis in Nicotiana tabacum.

development. Proc. Natl. Acad. Sci. USA 104, 329-334. Plant Mol. Biol. 87, 99-110. Journal of Experimental Biology

10 COMMENTARY Journal of Experimental Biology (2019) 222, jeb175737. doi:10.1242/jeb.175737

Gasiunas, G., Barrangou, R., Horvath, P. and Siksnys, V. (2012). Cas9-crRNA Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A. and Charpentier, E. ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity (2012). A programmable dual-RNA–guided DNA endonuclease in adaptive in bacteria. Proc. Natl. Acad. Sci. USA 109, E2579-E2586. bacterial immunity. Science 337, 816-821. Gentsch, G. E., Spruce, T., Monteiro, R. S., Owens, N. D. L., Martin, S. R., Smith, Jinek, M., East, A., Cheng, A., Lin, S., Ma, E. and Doudna, J. (2013). RNA- J. C., Gentsch, G. E., Spruce, T., Monteiro, R. S., Owens, N. D. L. et al. (2018). programmed genome editing in human cells. Elife 2, e00471. Innate immune response and off-target mis-splicing are common morpholino- Joris, M., Schloesser, M., Baurain, D., Hanikenne, M., Muller, M. and Motte, P. inuced side effects in Xenopus. Dev. Cell 44, 1-14. (2017). Number of inadvertent RNA targets for morpholino knockdown in Danio Gerety, S. S. and Wilkinson, D. G. (2011). Morpholino artifacts provide pitfalls and rerio is largely underestimated: Evidence from the study of Ser/Arg-rich splicing reveal a novel role for pro-apoptotic genes in hindbrain boundary development. factors. Nucleic Acids Res. 45, 9547-9557. Dev. Biol. 350, 279-289. Joung, J. K. and Sander, J. D. (2013). TALENs: a widely applicable technology for Geurts, A. M., Cost, G. J., Freyvert, Y., Zeitler, B., Miller, J. C., Choi, V. M., targeted genome editing. Nat. Rev. Mol. Cell Biol. 14, 49. Jenkins, S. S., Wood, A., Cui, X. and Meng, X. (2009). Knockout rats via embryo Juntti, S. A., Hilliard, A. T., Kent, K. R., Kumar, A., Nguyen, A., Jimenez, M. A., microinjection of zinc-finger nucleases. Science 325, 433. Loveland, J. L., Mourrain, P. and Fernald, R. D. (2016). A neural basis for control α Gratz, S. J., Cummings, A. M., Nguyen, J. N., Hamm, D. C., Donohue, L. K., of cichlid female reproductive behavior by prostaglandin F2 . Curr. Biol. 26, Harrison, M. M., Wildonger, J. and O’Connor-Giles, K. M. (2013). Genome 943-949. Katow, H., Suyemitsu, T., Ooka, S., Yaguchi, J., Jin-nai, T., Kuwahara, I., Katow, engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. T., Yaguchi, S. and Abe, H. (2010). Development of a dopaminergic system in Genetics 194, 1029-1035. sea urchin embryos and larvae. J. Exp. Biol. 213, 2808-2819. Guilinger, J. P., Thompson, D. B. and Liu, D. R. (2014). Fusion of catalytically Kennerdell, J. R. and Carthew, R. W. (1998). Use of dsRNA-mediated genetic inactive Cas9 to FokI nuclease improves the specificity of genome modification. interference to demonstrate that frizzled and frizzled 2 act in the wingless pathway. Nat. Biotechnol. 32, 577. Cell 95, 1017-1026. Guschin, D. Y., Waite, A. J., Katibah, G. E., Miller, J. C., Holmes, M. C. and Kim, Y.-G., Cha, J. and Chandrasegaran, S. (1996). Hybrid restriction enzymes: Rebar, E. J. (2010). A rapid and general assay for monitoring endogenous gene zinc finger fusions to Fok I cleavage domain. Proc. Natl. Acad. Sci. USA 93, modification. Methods Mol. Biol. 649, 247-256. 1156-1160. Haffter, P., Granato, M., Brand, M., Mullins, M. C., Hammerschmidt, M., Kane, Kishimoto, K., Washio, Y., Yoshiura, Y., Toyoda, A., Ueno, T., Fukuyama, H., D. A., Odenthal, J., van Eeden, F. J. M., Jiang, Y.-J., Heisenberg, C.-P. et al. Kato, K. and Kinoshita, M. (2018). Production of a breed of red sea bream (1996). The identification of genes with unique and essential functions in the Pagrus major with an increase of skeletal muscle muss and reduced body length development of the zebrafish, Danio rerio. Development 123, 1-36. by genome editing with CRISPR/Cas9. Aquaculture 495, 415-427. Hannon, G. J. (2002). RNA interference. Nature 418, 244-251. Kok, F. O., Shin, M., Ni, C.-W., Gupta, A., Grosse, A. S., van Impel, A., Heasman, J. (2002). Morpholino oligos: making sense of antisense? Dev. Biol. 243, Kirchmaier, B. C., Peterson-Maduro, J., Kourkoulis, G., Male, I. et al. (2015). 209-214. Reverse genetic screening reveals poor correlation between morpholino-induced β Heasman, J., Kofron, M. and Wylie, C. (2000). -catenin signaling activity and mutant phenotypes in zebrafish. Dev. Cell 32, 97-108. dissected in the early Xenopus embryo: a novel antisense approach. Dev. Biol. Kolosov, D. and Kelly, S. P. (2017). Claudin-8d is a cortisol-responsive barrier 222, 124-134. protein in the gill epithelium of trout. J. Mol. Endocrinol. 59, 299-310. Homma, N., Harada, Y., Uchikawa, T., Kamei, Y. and Fukamachi, S. (2017). Kolosov, D., Donini, A. and Kelly, S. P. (2017). Claudin-31 contributes to Protanopia (red color-blindness) in medaka: a simple system for producing color- corticosteroid-induced alterations in the barrier properties of the gill epithelium. blind fish and testing their spectral sensitivity. BMC Genet. 18, 10. Mol. Cell. Endocrinol. 439, 457-466. Horn, E. R., El-Yamany, N. A. and Gradl, D. (2013). The vestibuloocular reflex of Kumai, Y. and Perry, S. F. (2011). Ammonia excretion via Rhcg1 facilitates Na+ tadpoles (Xenopus laevis) after knock-down of the isthmus related transcription uptake in larval zebrafish, Danio rerio, in acidic water. Am. J. Physiol. Regul. factor XTcf-4. J. Exp. Biol. 733-741. Integr. Comp. Physiol. 301, R1517-R1528. Horng, J.-L., Lin, L.-Y., Huang, C.-J., Katoh, F., Kaneko, T. and Hwang, P.-P. Labun, K., Montague, T. G., Gagnon, J. A., Thyme, S. B. and Valen, E. (2016). (2007). Knockdown of V-ATPase subunit A (atp6v1a) impairs acid secretion and CHOPCHOP v2: a web tool for the next generation of CRISPR genome ion balance in zebrafish (Danio rerio). Am. J. Physiol. Regul. Integr. Comp. engineering. Nucleic Acids Res. 44, W272-W276. Physiol. 292, R2068-R2076. Lawson, N. D. (2016). Reverse genetics in zebrafish: mutants, morphants, and Housden, B. E., Muhar, M., Gemberling, M., Gersbach, C. A., Stainier, D. Y. R., moving forward. Trends Cell Biol. 26, 77-79. Seydoux, G., Mohr, S. E., Zuber, J. and Perrimon, N. (2017). Loss-of-function Li, T. and Folkesson, H. (2006). RNA interference for a-ENaC inhibits rat lung fluid genetic tools for animal models: cross-species and cross-platform differences. absorption in vivo. Am. J. Physiol. Cell. Mol. Physiol. 95, 649-660. Nat. Rev. Genet. 18, 24. Li, T., Huang, S., Jiang, W. Z., Wright, D., Spalding, M. H., Weeks, D. P. and Hsu, P. D., Scott, D. A., Weinstein, J. A., Ran, F. A., Konermann, S., Agarwala, Yang, B. (2010). TAL nucleases (TALNs): hybrid proteins composed of TAL V., Li, Y., Fine, E. J., Wu, X., Shalem, O. et al. (2013). DNA targeting specificity of effectors and FokI DNA-cleavage domain. Nucleic Acids Res. 39, 359-372. RNA-guided Cas9 nucleases. Nat. Biotechnol. 31, 827-832. Li, J., Yue, Y., Dong, X., Jia, W., Li, K., Liang, D., Dong, Z., Wang, X., Nan, X., Hua, Y., Wang, C., Huang, J. and Wang, K. (2017). A simple and efficient method Zhang, Q. et al. (2015). Zebrafish foxc1a plays a crucial role in early for CRISPR/Cas9-induced mutant screening. J. Genet. Genomics 44, 207-213. somitogenesis by restricting the expression of aldh1a2 directly. J. Biol. Chem. Huang, P., Xiao, A., Zhou, M., Zhu, Z., Lin, S. and Zhang, B. (2011). Heritable 290, 10216-10228. gene targeting in zebrafish using customized TALENs. Nat. Biotechnol. 29, 699. Li, R., Tian, J.-Z., Zhuang, C.-H., Zhang, Y.-C., Geng, X.-Y., Zhu, L.-N. and Sun, Hwang, W. Y., Fu, Y., Reyon, D., Maeder, M. L., Tsai, S. Q., Sander, J. D., J.-S. (2016). CHHBP: a newly identified receptor of crustacean hyperglycemic Peterson, R. T., Yeh, J. R. J. and Joung, J. K. (2013). Efficient genome editing in hormone. J. Exp. Biol. 219, 1259-1268. Lim, Y., Bak, S. Y., Sung, K., Jeong, E., Lee, S. H., Kim, J.-S., Bae, S. and Kim, zebrafish using a CRISPR-Cas system. Nat. Biotechnol. 31, 227. S. K. (2016). Structural roles of guide RNAs in the nuclease activity of Cas9 Jackson, A. L. and Linsley, P. S. (2004). Noise amidst the silence: off-target effects endonuclease. Nat. Commun. 7, 13350. of siRNAs? Trends Genet. 20, 521-524. Lin, X., Ruan, X., Anderson, M. G., McDowell, J. A., Kroeger, P. E., Fesik, S. W. Jackson, A. L., Bartz, S. R., Schelter, J., Kobayashi, S. V., Burchard, J., Mao, M., and Shen, Y. (2005). siRNA-mediated off-target gene silencing triggered by a 7 nt Li, B., Cavet, G. and Linsley, P. S. (2003). Expression profiling reveals off-target complementation. Nucleic Acids Res. 33, 4527-4535. gene regulation by RNAi. Nat. Biotechnol. 21, 635. Liu, Q., Segal, D. J., Ghiara, J. B. and Barbas, C. F. (1997). Design of polydactyl Jackson, A. L., Burchard, J., Schelter, J., Jackson, A. L., Burchard, J., Schelter, zinc-finger proteins for unique addressing within complex genomes. Proc. Natl. J., Chau, B. N., Cleary, M., Lim, L. E. E. and Linsley, P. S. (2006a). Widespread Acad. Sci. USA 94, 5525-5530. “ ” siRNA off-target transcript silencing mediated by seed region sequence Liu, Y., Sepich, D. S. and Solnica-krezel, L. (2017). Stat3/Cdc25a-dependent cell complementarity. RNA 12, 1179-1187. proliferation promotes embryonic axis extension during zebrafish gastrulation. Jackson, A. L., Burchard, J., Leake, D., Reynolds, A., Schelter, J., Guo, J., PLoS Genet. 13, e1006564. Johnson, J. M., Lim, L., Karpilow, J., Nichols, K. et al. (2006b). Position- Lu, Z.-C. and Wan, F.-H. (2011). Using double-stranded RNA to explore the role of “ ” specific chemical modification of siRNAs reduces off-target transcript silencing. heat shock protein genes in heat tolerance in Bemisia tabaci (Gennadius). J. Exp. RNA 12, 1197-1205. Biol. 214, 764-769. Jahangiri, L., Sharpe, M., Novikov, N., González-Rosa, J. M., Borikova, A., Lupton, C., Sengupta, M., Cheng, R.-K., Chia, J., Thirumalai, V. and Nevis, K., Paffett-lugassy, N., Zhao, L., Adams, M., Guner-ataman, B. et al. Jesuthasan, S. (2017). Loss of the habenula intrinsic neuromodulator (2016). The AP-1 transcription factor component Fosl2 potentiates the rate of kisspeptin1 affects learning in larval zebrafish. eNeuro 4, ENEURO-0326- myocardial differentiation from the zebrafish second heart field. Development 143, 16.2017. 113-122. Mahfouz, M. M., Li, L., Shamimuzzaman, M., Wibowo, A., Fang, X. and Zhu, J.-K. Jao, L.-E., Wente, S. R. and Chen, W. (2013). Efficient multiplex biallelic zebrafish (2011). De novo-engineered transcription activator-like effector (TALE) hybrid genome editing using a CRISPR nuclease system. Proc. Natl. Acad. Sci. USA nuclease with novel DNA binding specificity creates double-strand breaks. Proc.

110, 13904-13909. Natl. Acad. Sci. USA 108, 2623-2628. Journal of Experimental Biology

11 COMMENTARY Journal of Experimental Biology (2019) 222, jeb175737. doi:10.1242/jeb.175737

Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E. Pattanayak, V., Lin, S., Guilinger, J. P., Ma, E., Doudna, J. A. and Liu, D. R. and Church, G. M. (2013a). RNA-guided human genome engineering via Cas9. (2013). High-throughput profiling of off-target DNA cleavage reveals RNA- Science 339, 823-826. programmed Cas9 nuclease specificity. Nat. Biotechnol. 31, 839. Mali, P., Aach, J., Stranges, P. B., Esvelt, K. M., Moosburner, M., Kosuri, S., Pena, I. A., Roussel, Y., Daniel, K., Mongeon, K., Johnstone, D., Mendes, H. W., Yang, L. and Church, G. M. (2013b). CAS9 transcriptional activators for target Bosma, M., Saxena, V., Lepage, N., Chakraborty, P. et al. (2017). Pryidoxine- specificity screening and paired nickases for cooperative genome engineering. dependent epilepsy in zebrafish caused by Aldh7a1 deficiency. Genetics 207, Nat. Biotechnol. 31, 833. 1501-1518. Mashal, R. D., Koontz, J. and Sklar, J. (1995). Detection of mutations by cleavage Qiu, P., Shandilya, H., D’Alessio, J. M., O’Connor, K., Durocher, J. and Gerard, of DNA heteroduplexes with bacteriophage resolvases. Nat. Genet. 9, 177-183. G. F. (2004). Mutation detection using Surveyor™ nuclease. BioTechniques 36, Matson, C. W., Clark, B. W., Jenny, M. J., Fleming, C. R., Hahn, M. E. and Di 702-707. Giulio, R. T. (2008). Development of the morpholino gene knockdown technique Quadalti, C., Brunetti, D., Lagutina, I., Duchi, R., Perota, A., Lazzari, G., Cerutti, in Fundulus heteroclitus: a tool for studying molecular mechanisms in an R., Di Meo, I., Johnson, M. and Bottani, E. (2018). SURF1 knockout cloned pigs: established environmental model. Aquat. Toxicol. 87, 289-295. early onset of a severe lethal phenotype. Biochim. Biophys. Acta Mol. Basis Dis. Meister, G. and Tuschl, T. (2004). Mechanisms of gene silencing by double- 1846, 2131-2142. stranded RNA. Nature 431, 343-349. Ran, F. A., Hsu, P. D., Lin, C.-Y., Gootenberg, J. S., Konermann, S., Trevino, Miller, J. C., Tan, S., Qiao, G., Barlow, K. A., Wang, J., Xia, D. F., Meng, X., A. E., Scott, D. A., Inoue, A., Matoba, S. and Zhang, Y. (2013). Double nicking Paschon, D. E., Leung, E. and Hinkley, S. J. (2011). A TALE nuclease by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154, architecture for efficient genome editing. Nat. Biotechnol. 29, 143. 1380-1389. Misyura, L., Yerushalmi, G. Y. and Donini, A. (2017). A mosquito Rao, D. D., Vorhies, J. S., Senzer, N. and Nemunaitis, J. (2009). siRNA vs. entomoglyceroporin, Aedes aegypti AQP5 participates in water transport across shRNA: similarities and differences. Adv. Drug Deliv. Rev. 61, 746-759. the Malpighian tubules of larvae. J. Exp. Biol. 220, 3536-3544. Robu, M. E., Larson, J. D., Nasevicius, A., Beiraghi, S., Brenner, C., Farber, Mockenhaupt, S., Grosse, S., Rupp, D., Bartenschlager, R. and Grimm, D. S. A. and Ekker, S. C. (2007). P53 activation By knockdown technologies. PLoS (2015). Alleviation of off-target effects from vector-encoded shRNAs via Genet. 3, 787-801. codelivered RNA decoys. Proc. Natl. Acad. Sci. USA 112, E4007-E4016. Rossi, A., Kontarakis, Z., Gerri, C., Nolte, H., Hölper, S., Krüger, M. and Stainier, Montague, T. G., Cruz, J. M., Gagnon, J. A., Church, G. M. and Valen, E. (2014). CHOPCHOP: A CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic D. Y. R. (2015). Genetic compensation induced by deleterious mutations but not Acids Res. 42, W401-W407. gene knockdowns. Nature 524, 230-233. Montgomery, J., Wittwer, C. T., Palais, R. and Zhou, L. (2007). Simultaneous Roy, A., Goodman, J. H., Begum, G., Donnelly, B. F., Pittman, G., Weinman, mutation scanning and genotyping by high-resolution DNA melting analysis. Nat. E. J., Sun, D. and Subramanya, A. R. (2014). Generation of WNK1 knockout cell Protoc. 2, 59-66. lines by CRISPR/Cas-mediated genome editing. Am. J. Physiol. Ren. Physiol. Morcos, P. A., Li, Y. and Jiang, S. (2008). Vivo-Morpholinos: a non-peptide 308, F366-F376. Ž ı ı transporter delivers Morpholinos into a wide array of mouse tissues. Sajwan, S., Sidorov, R., Stašková,T., aloud ková ́, A., Takasu, Y., Kodr k,́ D. BioTechniques 45, 613-623. and Zurovec, M. (2015). Targeted mutagenesis and functional analysis of Moscou, M. J. and Bogdanove, A. J. (2009). A simple cipher governs DNA adipokinetic hormone-encoding gene in Drosophila. Insect Biochem. Mol. Biol. recognition by TAL effectors. Science 326, 1501. 61, 79-86. Moulton, J. D. and Shan, J. (2009). Gene knockdowns in adult animals: PPMOs Sakane, Y., Iida, M., Hasebe, T., Fujii, S., Buchholz, D. R., Ishizuya-Oka, A., and vivo-morpholinos. Molecules 14, 1304-1323. Yamamoto, T. and Ken-ichi, T. S. (2018). Functional analysis of thyroid hormone Nakada, T., Hoshijima, K., Esaki, M., Nagayoshi, S., Kawakami, K. and Hirose, receptor beta in Xenopus tropicalis founders using CRISPR-Cas. Biol. Open 7, S. (2007). Localization of ammonia transporter Rhcg1 in mitochondrion-rich cells bio030338. of yolk sac, gill, and kidney of zebrafish and its ionic strength-dependent Scacheri, P. C., Rozenblatt-Rosen, O., Caplen, N. J., Wolfsberg, T. G., Umayam, expression. Am. J. Physiol. Regul. Integr. Comp. Physiol. 293, R1743-R1753. L., Lee, J. C., Hughes, C. M., Shanmugam, K. S., Bhattacharjee, A., Meyerson, Nasevicius, A. and Ekker, S. C. (2000). Effective targeted gene “knockdown” in M. et al. (2004). Short interfering RNAs can induce unexpected and divergent zebrafish. Nat. Genet. 26, 216-220. changes in the levels of untargeted proteins in mammalian cells. Proc. Natl. Acad. Newman, C. E., Toxopeus, J., Udaka, H., Ahn, S., Martynowicz, D. M., Graether, Sci. USA 101, 1892-1897. S. P., Sinclair, B. J. and Percival-Smith, A. (2017). CRISPR-induced null alleles Schulte-Merker, S. and Stainier, D. Y. R. (2014). Out with the old, in with the new: show that Frost protects Drosophila melanogaster reproduction after cold reassessing morpholino knockdowns in light of genome editing technology. exposure. J. Exp. Biol. 220, 3344-3354. Development 141, 3103-3104. Niu, Y., Shen, B., Cui, Y., Chen, Y., Wang, J., Wang, L., Kang, Y., Zhao, X., Si, W., Seok, H., Lee, H., Jang, E. S. and Chi, S. W. (2018). Evaluation and control of Li, W. et al. (2014). Generation of gene-modified cynomolgus monkey via Cas9/ miRNA–like off–target repression for RNA interference. Cell. Mol. Life Sci. 75, RNA-mediated gene targeting in one-cell embryos. Cell 156, 836-843. 797-814. Nolan, P. M., Peters, J., Strivens, M., Rogers, D., Hagan, J., Spurr, N., Gray, I. C., Shih, T.-H., Horng, J.-L., Hwang, P.-P. and Lin, L.-Y. (2008). Ammonia excretion Brooker, D., Whitehill, E., Washbourne, R. et al. (2000). A systematic, genome- by the skin of zebrafish (Danio rerio) larvae. Am. J. Physiol. Cell Physiol. 295, wide, phenotype-driven mutagenesis programme for gene function studies in the C1625-C1632. mouse. Nat. Genet. 25, 440-443. Shih, T.-H., Horng, J.-L., Lai, Y.-T. and Lin, L.-Y. (2012). Rhcg1 and Rhbg mediate Notch, E. G., Shaw, J. R., Coutermarsh, B. A., Dzioba, M. and Stanton, B. A. ammonia excretion by ionocytes and keratinocytes in the skin of zebrafish larvae: (2011). Morpholino gene knockdown in adult Fundulus heteroclitus: role of SGK1 H+-ATPase-linked active ammonia excretion by ionocytes. Am. J. Physiol. Regul. in seawater acclimation. PLoS ONE 6, e29462. Integr. Comp. Physiol. 304, R1130-R1138. Novina, C. D. and Sharp, P. A. (2004). The RNAi revolution. Nature 430, 161-164. Shmukler, B. E., Huston, N. C., Thon, J. N., Ni, C.-W., Kourkoulis, G., Lawson, Novodvorsky, P., Watson, O., Gray, C., Wilkinson, R. N., Reeve, S., Smythe, C., N. D., Paw, B. H. and Al, S. L. (2015). Homozygous knockout of the piezo1 gene Beniston, R., Plant, K., Maguire, R., Rothman, A. M. K. et al. (2015). klf2ash317 in the zebrafish is not associated with anemia. Haematologica 100, e483-e485. mutant zebrafish do not recapitulate morpholino-induced vascular and Shmukler, B. E., Lawson, N. D., Paw, B. H. and Alper, S. L. (2016). Authors haematopoietic phenotypes. PLoS ONE 10. response to “Comment on: “Homozygous knockout of the piezo1 gene in the Nüsslein-volhard, C. and Wieschaus, E. (1980). Mutations affecting segment ”” number and polarity in drosophila. Nature 287, 795-801. zebrafish is not associated with anemia . Haematologica 101, e39. Oates, A. C., Bruce, A. E. E. and Ho, R. K. (2000). Too much interference: Injection Shu, Y., Lou, Q., Dai, Z., Dai, X., He, J., Hu, W. and Yin, Z. (2016). The basal of double-stranded RNA has nonspecific effects in the zebrafish embryo. Dev. function of teleost prolactin as a key regulator on ion uptake identified with Biol. 224, 20-28. zebrafish knockout models. Sci. Rep. 6, 18597. Ochiai,H.andYamamoto,T.(2015). Genome editing using zinc-finger nucleases Si, L., Pan, L., Wang, H. and Zhang, X. (2018). Identification of the role of Rh protein (ZFNs) and transcription activator-like effector nucleases (TALENs). In Targeted in ammonia excretion of the swimming crab Portunus trituberculatus. J. Exp. Biol. Genome Editing Using Site-Specific Nucleases (ed. T. Yamamoto), pp. 3-24. Springer. 221, jeb184655. Pales Espinosa, E. and Allam, B. (2018). Reverse genetics demonstrate the role of Sim, C. and Denlinger, D. L. (2009). Transcription profiling and regulation of fat mucosal C-type lectins in food particle selection in the oyster Crassostrea metabolism genes in diapausing adults of the mosquito Culex pipiens. Physiol. virginica. J. Exp. Biol. 221, jeb174094. Genomics 39, 202-209. Pamuru, R. R., Rosen, O., Manor, R., Chung, J. S., Zmora, N., Glazer, L., Aflalo, Song, H., Bettegowda, A., Oliver, D., Yan, W., Phan, M. H., de Rooij, D. G., E. D., Weil, S., Tamone, S. L. and Sagi, A. (2012). Stimulation of molt by RNA Corbett, M. A. and Wilkinson, M. F. (2015). shRNA off-target effects in vivo: interference of the molt-inhibiting hormone in the crayfish Cherax quadricarinatus. impaired Endogenous siRNA expression and spermatogenic defects. PLoS ONE Gen. Comp. Endocrinol. 178, 227-236. 10, e0118549. Park, Y. and Kim, Y. (2013). RNA interference of glycerol biosynthesis suppresses Stainier, D. Y. R., Raz, E., Lawson, N. D., Ekker, S. C., Burdine, R. D., Eisen, J. S., rapid cold hardening of the beet armyworm, Spodoptera exigua. J. Exp. Biol. 216, Ingham, P. W., Schulte-Merker, S., Yelon, D., Weinstein, B. M. et al. (2017).

4196-4203. Guidelines for morpholino use in zebrafish. PLoS Genet. 13, 6-10. Journal of Experimental Biology

12 COMMENTARY Journal of Experimental Biology (2019) 222, jeb175737. doi:10.1242/jeb.175737

Stergiopoulos, K., Cabrero, P., Davies, S.-A. and Dow, J. A. T. (2009). Salty dog Wargelius, A., Ellingsen, S. and Fjose, A. (1999). Double–stranded RNA induces an SLC5 symporter, modulates Drosophila response to salt stress. Physiol. specific developmental defects in zebrafish embryos. Biochem. Biophys. Res. Genomics 37, 1-11. Commun. 263, 156-161. Summerton, J. (2007). Morpholino, siRNA, and S-DNA compared: impact of Watanabe, Y., Furukawa, E., Tatsukawa, H., Hashimoto, H., Kamei, Y., structure and mechanism of action on off-target effects and sequence specificity. Taniguchi, Y. and Hitomi, K. (2018). Higher susceptibility to osmolality of the Curr. Top. Med. Chem. 7, 651-660. medaka (Oryzias latipes) mutants in orthologue genes of mammalian skin Sun, Z., Bello-Roufai, M. and Wang, X. (2008). RNAi inhibition of mineralocorticoid transglutaminases. Biosci. Biotechnol. Biochem. 82, 1165-1168. receptors prevents the development of cold-induced hypertension. Am. J. Physiol. Whitworth, K. M., Lee, K., Benne, J. A., Beaton, B. P., Spate, L. D., Murphy, S. L., ’ Heart Circ. Physiol. 294, H1880-H1887. Samuel, M. S., Mao, J., O Gorman, C., Walters, E. M. et al. (2014). Use of the Suter, S. R., Sheu-gruttadauria, J., Schirle, N. T., Valenzuela, R., Ball-jones, CRISPR/Cas9 system to produce genetically engineered pigs from in vitro- derived oocytes and embryos. Biol. Reprod. 91, 78. A. A., Onizuka, K., Macrae, I. J. and Beal, P. A. (2016). Structure-guided control Wianny, F. and Zernicka-Goetz, M. (2000). Specific interference with gene function of siRNA off-target effects. J. Am. Chem. Soc. 138, 8667-8669. by double-stranded RNA in early mouse development. Nat. Cell Biol. 2, 70. Svoboda, P. (2007). Off-targeting and other non-specific effects of RNAi Wickramasekera, N. T., Gebremedhin, D., Carver, K. A., Vakeel, P., experiments in mammalian cells. Curr. Opin. Mol. Ther. 9, 248-257. Ramchandran, R., Schuett, A. and Harder, D. R. (2013). Role of dual- Tabebordbar, M., Zhu, K., Cheng, J. K. W., Chew, W. L., Widrick, J. J., Yan, W. X., specificity protein phosphatase-5 in modulating the myogenic response in rat Maesner, C., Wu, E. Y., Xiao, R. and Ran, F. A. (2016). In vivo gene editing in cerebral arteries. J. Appl. Physiol. 114, 252-261. dystrophic mouse muscle and muscle stem cells. Science 351, 407-411. Wilson, R. C. and Doudna, J. A. (2013). Molecular mechanisms of RNA Talbot, J. C. and Amacher, S. L. (2014). A streamlined CRISPR pipeline to reliably interference. Annu. Rev. Biophys. 42, 217-239. generate zebrafish frameshifting alleles. Zebrafish 11, 583-585. Wu, X., Viveiros, M. M., Eppig, J. J., Bai, Y., Fitzpatrick, S. L. and Matzuk, M. M. ́ Tesson, L., Usal, C., Menoret, S., Leung, E., Niles, B. J., Remy, S., Santiago, Y., (2003). Zygote arrest 1 (Zar1) is a novel maternal-effect gene critical for the Vincent, A. I., Meng, X. and Zhang, L. (2011). Knockout rats generated by oocyte-to-embryo transition. Nat. Genet. 33, 187-191. embryo microinjection of TALENs. Nat. Biotechnol. 29, 695. Xin, Y. and Duan, C. (2018). Microinjection of antisense morpholinos, CRISPR/ Thomas, H. R., Percival, S. M., Yoder, B. K. and Parant, J. M. (2014). High- Cas9, and RNA/DNA into zebrafish embryos. In Methods in Molecular Biology throughput genome editing and phenotyping facilitated by high resolution melting (ed. L. Huang), pp. 205-211. New York, NY: Humana Press. curve analysis. PLoS ONE 9, e114632. Yabuki, Y., Koide, T., Miyasaka, N., Wakisaka, N., Masuda, M., Ohkura, M., Topczewska, J. M., Topczewski, J., Shostak, A., Kume, T., Solnica-Krezel, L. Nakai, J., Tsuge, K., Tsuchiya, S. and Sugimoto, Y. (2016). Olfactory receptor and Hogan, B. L. M. (2001). The winged helix transcription factor Foxc1a is for prostaglandin F 2α mediates male fish courtship behavior. Nat. Neurosci. 19, essential for somitogenesis in zebrafish. Genes Dev. 15, 2483-2493. 897. Tsai, S. Q. and Joung, J. K. (2016). Defining and improving the genome-wide Yang, H., Wang, H., Shivalila, C. S., Cheng, A. W., Shi, L. and Jaenisch, R. specificities of CRISPR–Cas9 nucleases. Nat. Rev. Genet. 17, 300. (2013). One-step generation of mice carrying reporter and conditional alleles by Tsai, S. Q., Wyvekens, N., Khayter, C., Foden, J. A., Thapar, V., Reyon, D., CRISPR/Cas-mediated genome engineering. Cell 154, 1370-1379. Goodwin, M. J., Aryee, M. J. and Joung, J. K. (2014). Dimeric CRISPR RNA- Yang, B., Pu, F., Li, L., You, W., Ke, C. and Feng, D. (2017). Functional analysis of guided FokI nucleases for highly specific genome editing. Nat. Biotechnol. 32, a tyrosinase gene involved in early larval shell biogenesis in Crassostrea angulata 569. and its response to ocean acidification. Comp. Biochem. Physiol. B 206, 8-15. Tsuchiya, Y., Minami, Y., Umemura, Y., Watanabe, H., Ono, D., Nakamura, W., Yeh, Y.-C., Kinoshita, M., Ng, T. H., Chang, Y.-H., Maekawa, S., Chiang, Y.-A., Takahashi, T., Honma, S., Kondoh, G. and Matsuishi, T. (2015). Disruption of Aoki, T. and Wang, H.-C. (2017). Using CRISPR/Cas9-mediated gene editing to further explore growth and trade-off effects in myostatin-mutated F4 medaka MeCP2 attenuates circadian rhythm in CRISPR/Cas9-based Rett syndrome (Oryzias latipes). Sci. Rep. 7, 11435. model mouse. Genes Cells 20, 992-1005. Yong, L., Thet, Z. and Zhu, Y. (2017). Genetic editing of the androgen receptor Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S. and Gregory, P. D. (2010). contributes to impaired male courtship behavior in zebrafish. J. Exp. Biol. 220, Genome editing with engineered zinc finger nucleases. Nat. Rev. Genet. 11, 636. 3017-3021. Van Sinay, E., Mirabeau, O., Depuydt, G., Van Hiel, M. B., Peymen, K., Watteyne, Zetsche, B., Gootenberg, J. S., Abudayyeh, O. O., Slaymaker, I. M., Makarova, J., Zels, S., Schoofs, L. and Beets, I. (2017). Evolutionarily conserved TRH K. S., Essletzbichler, P., Volz, S. E., Joung, J., Van Der Oost, J. and Regev, A. neuropeptide pathway regulates growth in Caenorhabditis elegans. Proc. Natl. (2015). Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas Acad. Sci. USA 114, E4065-E4074. system. Cell 163, 759-771. Vinauger, C., Lahondere, C., Wolff, G., Locke, L., Liaw, J., Parrish, J., Akbari, O., Zhao, X., Li, Q., Meng, Q., Yue, C. and Xu, C. (2017). Identification and expression Dickinson, M. and Riffell, J. (2018). Modulation of host learning in Aedes aegypti of cysteine sulfinate decarboxylase, possible regulation of taurine biosynthesis in mosquitoes. Curr. Biol. 28, 333-344. Crassostrea gigas in response to low salinity. Sci. Rep. 7, 1-10. Wang, J., Pan, Z., Baribault, H., Chui, D., Gundel, C. and Véniant, M. (2016). Zhu, X., Xu, Y., Yu, S., Lu, L., Ding, M., Cheng, J., Song, G., Gao, X., Yao, L., Fan, GPR21 KO mice demonstrate no resistance to high fat diet induced obesity or D. et al. (2014). An efficient genotyping method for genome-modified animals and improved glucose tolerance. F1000Research 5, 136. human cells generated with CRISPR/Cas9 system. Sci. Rep. 4, 1-8. Journal of Experimental Biology