DOCSLIB.ORG

Global Bpgen Supplement Page 1 Eight Blood Pressure Loci Identified by Genome-Wide Association Study of 34,433 People Of

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Global Bpgen Supplement Page 1 Eight Blood Pressure Loci Identified by Genome-Wide Association Study of 34,433 People Of Eight blood pressure loci identified by genome-wide association study of 34,433 people of European ancestry Christopher Newton-Cheh1,2,3,94, Toby Johnson4,5,6,94, Vesela Gateva7,94, Martin D Tobin8,94, Murielle Bochud5, Lachlan Coin9, Samer S Najjar10, Jing Hua Zhao11,12, Simon C Heath13, Susana Eyheramendy14,15, Konstantinos Papadakis16, Benjamin F Voight1,3, Laura J Scott7, Feng Zhang17, Martin Farrall18,19, Toshiko Tanaka20,21, Chris Wallace22,23, John C Chambers9, Kay-Tee Khaw12,24, Peter Nilsson25, Pim van der Harst26, Silvia Polidoro27, Diederick E Grobbee28, N Charlotte Onland-Moret28,29, Michiel L Bots28, Louise V Wain8, Katherine S Elliott19, Alexander Teumer30, Jian'an Luan11, Gavin Lucas31, Johanna Kuusisto32, Paul R Burton8, David Hadley16, Wendy L McArdle33, Wellcome Trust Case Control Consortium34, Morris Brown35, Anna Dominiczak36, Stephen J Newhouse22, Nilesh J Samani37, John Webster38, Eleftheria Zeggini19,39, Jacques S Beckmann4,40, Sven Bergmann4,6, Noha Lim41, Kijoung Song41, Peter Vollenweider42, Gerard Waeber42, Dawn M Waterworth41, Xin Yuan41, Leif Groop43,44, Marju Orho-Melander25, Alessandra Allione27, Alessandra Di Gregorio27,45, Simonetta Guarrera27, Salvatore Panico46, Fulvio Ricceri27, Valeria Romanazzi27,45, Carlotta Sacerdote47, Paolo Vineis9,27, Inês Barroso12,39, Manjinder S Sandhu11,12,24, Robert N Luben12,24, Gabriel J. Crawford3, Pekka Jousilahti48, Markus Perola48,49, Michael Boehnke7, Lori L Bonnycastle50, Francis S Collins50, Anne U Jackson7, Karen L Mohlke51, Heather M Stringham7, Timo T Valle52, Cristen J Willer7, Richard N Bergman53, Mario A Morken50, Angela Döring15, Christian Gieger15, Thomas Illig15, Thomas Meitinger54,55, Elin Org56, Arne Pfeufer54, H Erich Wichmann15,57, Sekar Kathiresan1,2,3, Jaume Marrugat31, Christopher J O'Donnell58,59, Stephen M Schwartz60,61, David S Siscovick60,61, Isaac Subirana31,62, Nelson B Freimer63, Anna-Liisa Hartikainen64, Mark I McCarthy19,65,66, Paul F O’Reilly9, Leena Peltonen39,49, Anneli Pouta64,67, Paul E de Jong68, Harold Snieder69, Wiek H van Gilst26, Robert Clarke70, Anuj Goel18,19, Anders Hamsten71, John F Peden18,19, Udo Seedorf72, Ann-Christine Syvänen73, Giovanni Tognoni74, Edward G Lakatta10, Serena Sanna75, Paul Scheet76, David Schlessinger77, Angelo Scuteri78, Marcus Dörr79, Florian Ernst30, Stephan B Felix79, Georg Homuth30, Roberto Lorbeer80, Thorsten Reffelmann79, Rainer Rettig81, Uwe Völker30, Pilar Galan82, Ivo G Gut13, Serge Hercberg82, G Mark Lathrop13, Diana Zeleneka13, Panos Deloukas12,39, Nicole Soranzo17,39, Frances M Williams17, Guangju Zhai17, Veikko Salomaa48, Markku Laakso32, Roberto Elosua31,62, Nita G Forouhi11, Henry Völzke80, Cuno S Uiterwaal28, Yvonne T van der Schouw28, Mattijs E Numans28, Giuseppe Matullo27,45, Gerjan Navis68, Göran Berglund25, Sheila A Bingham12,83, Jaspal S Kooner84, Andrew D Paterson85, John M Connell36, Stefania Bandinelli86, Luigi Ferrucci21, Hugh Watkins18,19, Tim D Spector17, Jaakko Tuomilehto52,87,88, David Altshuler1,3,89,90, David P Strachan16, Maris Laan56, Pierre Meneton91, Nicholas J Wareham11,12, Manuela Uda75, Marjo-Riitta Jarvelin9,67,92, Vincent Mooser41, Olle Melander25, Ruth JF Loos11,12, Paul Elliott9,95, Gonçalo R Abecasis93,95, Mark Caulfield22,95, Patricia B Munroe22,95 Global BPgen Supplement page 1 Table of Contents Supplementary Figure 1 Study design pages 3-4 Supplementary Figure 2a GWAS results: quantile-quantile plots page 5-14 Supplementary Figure 2b GWAS results: -log(P) page 15-16 Supplementary Table 1 Genotyping/imputation pages 17-19 Supplementary Table 2 Follow-up genotyping results pages 20-23 Supplementary Table 3 In silico exchange CHARGE pages 24-25 Supplementary Table 4 SBP, DBP by gender page 26 Supplementary Methods Population-based GWAS samples pages 27-29 Control samples GWAS samples pages 29-30 Validation genotyping samples pages 30-32 Stage 2a follow up genotyping pages 32 Annotation of top results pages 32 Author contributions, acknowledgments by cohort pages 33-40 Supplementary Note Appendix A: WTCCC members pages 41-44 Appendix B: MIGen members pages 45-46 References pages 47-48 Global BPgen Supplement page 2 Supplementary Figures Supplementary Figure 1. Study design. Meta analysis of genome-wide association data was performed in stage 1 across all the cohorts listed. Twenty SNPs representing loci most associated with SBP or DBP were selected for follow up (stage 2). Twelve SNPs were directly genotyped (2a), all twenty SNPs were tested for replication in silico (2b). Global BPgen Supplement page 3 Stage 1 Stage 2a Genome wide association studies Genotyping in population or case‐control series n=34,433 European ancestry n≤71,225 European, n≤12, 889 Indian Asian Population‐based cohorts ARYA (n=736) BLSA (n=708) BRIGHT‐HTN (n=2,445) B58C‐T1DGC (n=2,580) BRIGHT‐NT (()n=673) B58C‐WTCCC (n=1,473) EPIC‐Italy (n=3,909) CoLaus (n=4,969) EPIC‐Norfolk‐REP (n=15,858) EPIC‐Norfolk (n=2,100) Finrisk97 (n=7,023) Fenland (n=1,401) FUSION2 ((,)n=1,162) InCHIANTI (n=562) Lolipop‐Eur (n=6,006) KORA (n=1,644) Lolipop IA (n=12,823) NFBC1966 n=4,761) MDC‐CC (n=5,330) SardiNIA (n=3,998) METSIM ((,)n=5,934) SHIP (n=3,310) MPP (n=14,249) SUVIMAX (n=1,823) PREVEND (n=7,272) TwinsUK (n=873) Prospect‐EPIC (n=1,680) Utrecht Health Project (()n=2,829) Controls from case‐control series Stage 2b DGI (n=1,277) In silico replication samples FUSION (n=1,038) MIGen (n=1,121) n=29,122 European ancestry PROCARDIS (n=795) CHARGE consortium Supplementary Figure 2. Panel A. Quantile-quantile plots of association results by cohort and overall. Meta-analysis of 2,497,993 autosomal SNPs in 34,433 individuals was performed using inverse variance weighting after cohort-specific genomic control. Shown are plots of -log10(P) of association tests for diastolic and systolic blood pressure for each cohort in gender-specific analysis and for overall meta-analysis results. λGC before genomic control was 1.08 for systolic and 1.07 for diastolic blood pressure for the overall meta-analysis. Panel B. Association results for systolic and diastolic blood pressure. Plotted are the -log10(P) of results for 2,497,993 SNPs after genomic control of meta-analysis results for 34,433 individuals for systolic (a) and diastolic blood pressure (b). Red squares denote SNPs that achieved genome-wide significance in final meta-analysis of results from stages, 1, 2a, 2b. Note that loci 10q21 and 15q24 show genome-wide significant SNPs that are not the strongest SNPs at the locus. These SNPs were selected for validation genotyping at an interim analysis and are shown throughout the text for consistency. Note that two independent loci on 17q21 are associated with blood pressure, one with SBP and one with DBP. Global BPgen Supplement page 5 a DBP B58C−T1DGC Males b DBP B58C−WTCCC Males c DBP BLSA Males d DBP CoLaus Males GC= 1.01 GC= 1.02 GC= 1.05 GC= 1.00 ● ● ● 8 8 8 8 ● ● ● 6 ● ● ● 6 ●● 6 ● 6 ● ● ● ● ● ● ● ●●● ● ●●● ● ●● ●●● ●● ● ● ● ● ●●● ●● ● ● ● ●● ●●●● ●●●●● ●●● ●● ●● ●●●●●●●●●●● ● ●●●●●●● ●● ●● ●●●●● ●●● ●● ●● ●●●●●● ● ● ●●● ●●●●● ●●●● ● ●●●●●●●● ●●● ●● ●●● ●● ● ●● ●●●●●● ●● ●● ●●● ● ●●●●● observed ●●●●● observed ● observed ●●● observed ●●● ●● ●●● ●● ●●● ●● ●● ●●● ●● ) ●● ) ● ) ●●●●●●●●●●●● ) ● ●● ●●● ●●●● ●● ●●●● ●●●● ●● ●● ●●●●●●●● ●●● ●● ●●●● ●● ●●● ●●●● ●● ●●●● ●●● ●●● ●●● ●●●● ●●●● ●● ●●● P ●●● P ●● P ●●●●● P ●●●● ●●● ●●●● ●●● ●●● ●●●● ●● ●● ●●●● ( ●● ( ●● ( ●● ( ● ●●● ●●● ●●●● ●●●● ●●● ●● ●●●● ●●● ●●● ●●● ●● ●●● 4 ●●●● 4 ●●●● 4 ●●● 4 ●●●●● ●● ●●● ●●● ●●● ●●● ●● ●●● ●●●● 10 ●● 10 ●● 10 ●● 10 ●● ●● ●●● ●●●● ●●● ●●● ●● ●●● ●●● ●●● ●●●● ●●●● ●●● ●●● ●●● ●●● ●● g ●● g ●● g ●●● g ●●● ●●● ●●● ●●●●●● ●●● ●●● ●●● ●●● ●● ●●● ●●● ●●● ●●● ●● ●●● ●●● ●●● o ●●● o ●● o ●●● o ●●● ●●●● ●●●● ●●● ●● l ●●● l ●●● l ●●● l ●●● ●●● ●●● ●●● ●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●●● ●●●● ●●● ●●● ●●● ●●● ●●● ● − ● − ● − ● − ●●● ●● ●●● ●●● ●●●● ●●● ●●● ●● ●●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● 2 ●● 2 ● 2 ●● 2 ●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● ●●● 0 0 0 0 ● ● ● 0 2 4 6 8 0 2 4 6 8 0 2 4 6 8 0 2 4 6 8 − log10(P) expected − log10(P) expected − log10(P) expected − log10(P) expected DBP B58C−T1DGC Females DBP B58C−WTCCC Females DBP BLSA Females DBP CoLaus Females GC= 1.00 GC= 1.00 ● GC= 1.03 GC= 1.01 ● 8 8 8 8 ● ● ●● ● ● ● ● ●●● ●● ● ● ●●● ●● ●●● ● ● 6 6 ●●●● 6 6 ● ● ●● ●● ● ●●●●● ●● ● ● ●● ● ● ● ●● ●● ● ● ●● ●● ●●● ●●● ● ● ●●● ●●●●● ● ● ● ● ●● ●● ●● ●●●● ● ● ● ●●●● ●●●● ●● ●●●●●● ●●●●●●● ●●● ● ●●● ●●● ●●● ●●●● ●●●● ●● ● ●●●● ●●●● ●●● ●●●●● ● ●●● ● ● ● ●● ●● ●●● ●● observed ●● observed ●● observed ●● observed ●● ●●● ● ●●● ●●● ●●●● ● ●●● ● ) ●●● ) ● ) ●●● ) ●●●●● ● ● ●●● ●●●●●● ●●● ●● ●● ●●●●● ● ●●● ●● ● ●●●● ●●● ●● ●● ●● ●●● ●●●● ●●● ●● ●●● ●● ●●● P ●●●●● P ●● P ●● P ●●●● ●● ●●● ●●● ●●● ●●●● ●● ●●● ●●●●
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • S1 Supplemental Materials Supplemental Methods Supplemental Figure 1. Immune Phenotype of Mcd19 Targeted CAR T and Dose Titratio
    Supplemental Materials Supplemental Methods Supplemental Figure 1. Immune phenotype of mCD19 targeted CAR T and dose titration of in vivo efficacy. Supplemental Figure 2. Gene expression of fluorescent-protein tagged CAR T cells. Supplemental Figure 3. Fluorescent protein tagged CAR T cells function similarly to non-tagged counterparts. Supplemental Figure 4. Transduction efficiency and immune phenotype of mCD19 targeted CAR T cells for survival study (Figure 2D). Supplemental Figure 5. Transduction efficiency and immune phenotype of CAR T cells used in irradiated CAR T study (Fig. 3B-C). Supplemental Figure 6. Differential gene expression of CD4+ m19-humBBz CAR T cells. Supplemental Figure 7. CAR expression and CD4/CD8 subsets of human CD19 targeted CAR T cells for Figure 5E-G. Supplemental Figure 8. Transduction efficiency and immune phenotype of mCD19 targeted wild type (WT) and TRAF1-/- CAR T cells used for in vivo study (Figure 6D). Supplemental Figure 9. Mutated m19-musBBz CAR T cells have increased NF-κB signaling, improved cytokine production, anti-apoptosis, and in vivo function. Supplemental Figure 10. TRAF and CAR co-expression in human CD19-targeted CAR T cells. Supplemental Figure 11. TRAF2 over-expressed h19BBz CAR T cells show similar in vivo efficacy to h19BBz CAR T cells in an aggressive leukemia model. S1 Supplemental Table 1. Probesets increased in m19z and m1928z vs m19-musBBz CAR T cells. Supplemental Table 2. Probesets increased in m19-musBBz vs m19z and m1928z CAR T cells. Supplemental Table 3. Probesets differentially expressed in m19z vs m19-musBBz CAR T cells. Supplemental Table 4. Probesets differentially expressed in m1928z vs m19-musBBz CAR T cells.
    [Show full text]
  • Effects and Mechanisms of Eps8 on the Biological Behaviour of Malignant Tumours (Review)
    824 ONCOLOGY REPORTS 45: 824-834, 2021 Effects and mechanisms of Eps8 on the biological behaviour of malignant tumours (Review) KAILI LUO1, LEI ZHANG2, YUAN LIAO1, HONGYU ZHOU1, HONGYING YANG2, MIN LUO1 and CHEN QING1 1School of Pharmaceutical Sciences and Yunnan Key Laboratory of Pharmacology for Natural Products, Kunming Medical University, Kunming, Yunnan 650500; 2Department of Gynecology, Yunnan Tumor Hospital and The Third Affiliated Hospital of Kunming Medical University; Kunming, Yunnan 650118, P.R. China Received August 29, 2020; Accepted December 9, 2020 DOI: 10.3892/or.2021.7927 Abstract. Epidermal growth factor receptor pathway substrate 8 1. Introduction (Eps8) was initially identified as the substrate for the kinase activity of EGFR, improving the responsiveness of EGF, which Malignant tumours are uncontrolled cell proliferation diseases is involved in cell mitosis, differentiation and other physiological caused by oncogenes and ultimately lead to organ and body functions. Numerous studies over the last decade have demon- dysfunction (1). In recent decades, great progress has been strated that Eps8 is overexpressed in most ubiquitous malignant made in the study of genes and signalling pathways in tumours and subsequently binds with its receptor to activate tumorigenesis. Eps8 was identified by Fazioli et al in NIH-3T3 multiple signalling pathways. Eps8 not only participates in the murine fibroblasts via an approach that allows direct cloning regulation of malignant phenotypes, such as tumour proliferation, of intracellular substrates for receptor tyrosine kinases (RTKs) invasion, metastasis and drug resistance, but is also related to that was designed to study the EGFR signalling pathway. Eps8 the clinicopathological characteristics and prognosis of patients.
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Análise Correlacional Entre a Expressão Dos Fatores De Splicing E a Ocorrência De Splicing Alternativo Em Tecidos Humanos E De Camundongos
    ANÁLISE CORRELACIONAL ENTRE A EXPRESSÃO DOS FATORES DE SPLICING E A OCORRÊNCIA DE SPLICING ALTERNATIVO EM TECIDOS HUMANOS E DE CAMUNDONGOS JULIO CÉSAR NUNES Dissertação apresentada à Fundação Antônio Prudente para a obtenção do título de Mestre em Ciências Área de Concentração: Oncologia Orientador: Dr. Sandro José de Souza São Paulo 2008 Livros Grátis http://www.livrosgratis.com.br Milhares de livros grátis para download. FICHA CATALOGRÁFICA Preparada pela Biblioteca da Fundação Antônio Prudente Nunes, Julio César Análise correlacional entre a expressão dos fatores de splicing e a ocorrência de splicing alternativo em tecidos humanos e de camundongos / Julio César Nunes – São Paulo, 2008. 79p. Dissertação (Mestrado) - Fundação Antônio Prudente. Curso de Pós-Graduação em Ciências - Área de concentração: Oncologia. Orientador: Sandro José Souza Descritores: 1. SPLICING ALTERNATIVO 2. BIOLOGIA MOLECULAR COMPUTACIONAL 3. CÂNCER 4. GENOMICA. AGRADECIMENTOS Agradeço à FAPESP e CAPES pela bolsa de Mestrado. Ao Sandro José de Souza agradeço toda orientação e conhecimento oferecido. Meus especiais agradecimentos ao Pedro Alexandre Favoretto Galante que dedicou atenção a minha formação no processo de Pós-Graduação na Fundação Antônio Prudente, bem como pela sua oficiosa co-orientação ao projeto de pesquisa. À grande família e amigos pela dedicação e incentivo a minha formação acadêmica. À Fundação Antônio Prudente, Hospital do Câncer e Instituto Ludwig de Pesquisa sobre o Câncer dedico os meus nobres agradecimentos finais. RESUMO Nunes JC. Análise correlacional entre a expressão dos fatores de splicing e a ocorrência de splicing alternativo em tecidos humanos e de camundongos. São Paulo; 2007. [Dissertacão de Mestrado - Fundação Antônio Prudente] Splicing alternativo desempenha uma significante função no aumento da complexidade genômica, produzindo um extenso número de mRNA e isoformas protéicas.
    [Show full text]
  • Développement D'une Signature Moléculaire Dans La Maladie
    Développement d’une signature moléculaire dans la maladie osseuse de Paget Thèse Sabrina Guay-Bélanger Doctorat en médecine moléculaire Philosophiæ doctor (Ph.D.) Québec, Canada © Sabrina Guay-Bélanger, 2015 Résumé La maladie osseuse de Paget (MOP) a changé de visage au cours des dernières années, augmentant le nombre d’individus atteints qui demeurent asymptomatiques. Étant donné le risque élevé de développer un ostéosarcome associé avec la MOP, cette maladie est une contre-indication à la prescription d’agents ostéoformateurs. Avec l’apparition prochaine de nouveaux agents ostéoformateurs pour le traitement de l’ostéoporose, il devient crucial de pouvoir dépister de façon fiable la présence de la MOP. Les objectifs de ce projet étaient (1) de mettre au point un test plus sensible permettant de détecter et d’évaluer la fréquence des mutations post-zygotiques SQSTM1/P392L chez les patients pagétiques, (2) de développer un test génétique de dépistage de la MOP incluant les mutations germinales et post-zygotiques dans SQSTM1, (3) et d’évaluer les performances diagnostiques de ce test intégré avec des marqueurs biochimiques dans une signature moléculaire spécifique à la maladie. Une technique de PCR sensible utilisant un acide nucléique bloqué (LNA) spécifique à la mutation SQSTM1/P392L a été développée, puis la présence de cette mutation a été recherchée dans les cohortes disponibles au laboratoire et dans différents tissus. Ensuite, le développement de la signature moléculaire a utilisé les données génotypiques et biochimiques disponibles dans les cohortes du laboratoire, puis des régressions logistiques ont été effectuées afin de déterminer la combinaison de marqueurs ayant la meilleure capacité à identifier correctement les patients avec la MOP.
    [Show full text]
  • Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
    Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
    [Show full text]
  • Detecting Remote, Functional Conserved Domains in Entire Genomes by Combining Relaxed Sequence-Database Searches with Fold Recognition
    HMMerThread: Detecting Remote, Functional Conserved Domains in Entire Genomes by Combining Relaxed Sequence-Database Searches with Fold Recognition Charles Richard Bradshaw1¤a, Vineeth Surendranath1, Robert Henschel2,3, Matthias Stefan Mueller2, Bianca Hermine Habermann1,4*¤b 1 Bioinformatics Laboratory, Max Planck Institute of Molecular Cell Biology and Genetics, Dresden, Saxony, Germany, 2 Center for Information Services and High Performance Computing (ZIH), Technical University, Dresden, Saxony, Germany, 3 High Performance Applications, Pervasive Technology Institute, Indiana University, Bloomington, Indiana, United States of America, 4 Bioinformatics Laboratory, Scionics c/o Max Planck Institute of Molecular Cell Biology and Genetics, Dresden, Saxony, Germany Abstract Conserved domains in proteins are one of the major sources of functional information for experimental design and genome-level annotation. Though search tools for conserved domain databases such as Hidden Markov Models (HMMs) are sensitive in detecting conserved domains in proteins when they share sufficient sequence similarity, they tend to miss more divergent family members, as they lack a reliable statistical framework for the detection of low sequence similarity. We have developed a greatly improved HMMerThread algorithm that can detect remotely conserved domains in highly divergent sequences. HMMerThread combines relaxed conserved domain searches with fold recognition to eliminate false positive, sequence-based identifications. With an accuracy of 90%, our software is able to automatically predict highly divergent members of conserved domain families with an associated 3-dimensional structure. We give additional confidence to our predictions by validation across species. We have run HMMerThread searches on eight proteomes including human and present a rich resource of remotely conserved domains, which adds significantly to the functional annotation of entire proteomes.
    [Show full text]
  • Supporting Information
    Supporting Information Whittle et al. 10.1073/pnas.0812894106 SI Text range based on analysis on 1.5% agarose gels after reversal of In Vitro Genomic Selection. Recombinant NFI-1-GST fusion pro- cross-linking. DNA-protein complexes were precipitated with tein was immobilized on Glutathione Sepharose 4B (Amersham) anti-NFI immune serum (5 ␮l) or preimmune serum (5 ␮l) as a and C. elegans genomic DNA was used for in vitro genomic control and 5% of the input sample was set aside. Samples were selection. The fusion protein contained the NFI-1 DNA-binding processed using the ChIP assay kit (Upstate). Following reversal domain and a short downstream region. For NFI-1-GST Sepha- of the cross-links, RNase A and Proteinase K treatments, the rose preparation, 400 ml of induced DH5␣ cells expressing immunoprecipitated DNA was purified using phenol-chloro- NFI-1-GST (plasmid pGEXNFI-1) was extracted in buffer L (25 form, precipitated with ethanol, and dissolved in 50 ␮l of DNase, mM Hepes pH 7.5, 10% sucrose, 0.35 M NaCl, 5 mM DTT, 1 mM Rnase-free water. For ChIP-chip, samples were amplified by PMSF, 0.1% Nonidet P-40 and 2 mg/ml of lysozyme). The extract either ligation mediated PCR (5) or a modified Whole Genome (35 ml) was flash-frozen in 5-ml aliquots and stored at –70 °C. To Amplification protocol [Sigma; (6)] as previously described. immobilize NFI-1-GST protein on Glutathione Sepharose 4B, 5 ml of cell extract was incubated with 65 ␮l (bed volume) of Microarrays and Data Extraction.
    [Show full text]
  • Drosophila and Human Transcriptomic Data Mining Provides Evidence for Therapeutic
    Drosophila and human transcriptomic data mining provides evidence for therapeutic mechanism of pentylenetetrazole in Down syndrome Author Abhay Sharma Institute of Genomics and Integrative Biology Council of Scientific and Industrial Research Delhi University Campus, Mall Road Delhi 110007, India Tel: +91-11-27666156, Fax: +91-11-27662407 Email: [email protected] Nature Precedings : hdl:10101/npre.2010.4330.1 Posted 5 Apr 2010 Running head: Pentylenetetrazole mechanism in Down syndrome 1 Abstract Pentylenetetrazole (PTZ) has recently been found to ameliorate cognitive impairment in rodent models of Down syndrome (DS). The mechanism underlying PTZ’s therapeutic effect is however not clear. Microarray profiling has previously reported differential expression of genes in DS. No mammalian transcriptomic data on PTZ treatment however exists. Nevertheless, a Drosophila model inspired by rodent models of PTZ induced kindling plasticity has recently been described. Microarray profiling has shown PTZ’s downregulatory effect on gene expression in fly heads. In a comparative transcriptomics approach, I have analyzed the available microarray data in order to identify potential mechanism of PTZ action in DS. I find that transcriptomic correlates of chronic PTZ in Drosophila and DS counteract each other. A significant enrichment is observed between PTZ downregulated and DS upregulated genes, and a significant depletion between PTZ downregulated and DS dowwnregulated genes. Further, the common genes in PTZ Nature Precedings : hdl:10101/npre.2010.4330.1 Posted 5 Apr 2010 downregulated and DS upregulated sets show enrichment for MAP kinase pathway. My analysis suggests that downregulation of MAP kinase pathway may mediate therapeutic effect of PTZ in DS. Existing evidence implicating MAP kinase pathway in DS supports this observation.
    [Show full text]
  • Cytogenetic and Molecular Characterization of the Macro- And
    University of Ulm Department of Human Genetics Prof. Dr. med. Walther Vogel Cytogenetic and Molecular Characterization of the Macro- and Micro-inversions, which Distinguish the Human and the Chimpanzee Karyotypes - from Speciation to Polymorphism Thesis Applying for the Degree of Doctor of Human Biology (Dr. hum. biol.) Faculty of Medicine University of Ulm Presented by Justyna Monika Szamalek from Wrze śnia in Poland 2006 Amtierender Dekan: Prof. Dr. Klaus-Michael Debatin 1. Berichterstatter: Prof. Dr. med. Horst Hameister 2. Berichterstatter: Prof. Dr. med. Konstanze Döhner Tag der Promotion: 28.07.2006 Content Content 1. Introduction ...................................................................................................................7 1.1. Primate phylogeny........................................................................................................7 1.2. Africa as the place of human origin and the living area of the present-day chimpanzee populations .................................................................9 1.3. Cytogenetic and molecular differences between human and chimpanzee genomes.............................................................................................10 1.4. Cytogenetic and molecular differences between common chimpanzee and bonobo genomes................................................................................17 1.5. Theory of speciation .....................................................................................................18 1.6. Theory of selection
    [Show full text]
  • SRSF6 (NM 006275) Human Untagged Clone – SC125351 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC125351 SRSF6 (NM_006275) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: SRSF6 (NM_006275) Human Untagged Clone Tag: Tag Free Symbol: SRSF6 Synonyms: B52; HEL-S-91; SFRS6; SRP55 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene ORF within SC125351 sequence for NM_006275 edited (data generated by NextGen Sequencing) ATGCCGCGCGTCTACATAGGACGCCTGAGCTACAACGTCCGGGAGAAGGACATCCAGCGC TTTTTCAGTGGCTATGGCCGCCTCCTCGAAGTAGACCTCAAAAATGGGTACGGCTTCGTG GAGTTCGAGGACTCCCGCGACGCCGACGACGCCGTTTACGAGCTGAACGGCAAGGAGCTC TGCGGCGAGCGCGTGATCGTAGAGCACGCCCGGGGCCCGCGTCGCGATCGCGACGGCTAC AGCTACGGAAGCCGCAGTGGTGGAGGTGGATACAGCAGTCGGAGAACATCTGGCAGAGAC AAATACGGACCACCTGTTCGTACAGAATACAGGCTTATTGTAGAAAATCTTTCTAGTCGG TGCAGTTGGCAAGATTTAAAGGATTTTATGCGACAAGCAGGTGAAGTAACCTATGCGGAT GCCCACAAGGAACGAACAAATGAGGGTGTAATTGAGTTTCGCTCCTACTCTGACATGAAG CGTGCTTTGGACAAACTGGATGGCACAGAAATAAATGGCAGAAATATTAGGCTTATTGAA GATAAGCCACGCACAAGCCATAGGCGATCTTACTCTGGAAGCAGATCCAGGTCTCGATCT AGAAGACGGTCACGAAGTAGGAGTCGCAGGAGCAGCCGCAGTAGATCTCGAAGTATCTCA AAAAGTCGCTCCCGTTCCAGGTCGCGGAGCAAAGGTCGATCACGTTCTCGATCAAAAGGC AGGAAATCTAGATCAAAGAGCAAATCTAAGCCCAAGTCTGATCGGGGCTCCCATTCACAT TCTCGAAGCAGATCTAAGGATGAGTATGAGAAATCTCGAAGCAGGTCTCGGTCCCGATCC CCCAAAGAAAATGGAAAGGGTGATATAAAGTCAAAATCCAGATCAAGGAGCCAGTCCCGT TCCAATTCGCCGCTACCTGTTCCACCCTCAAAGGCCCGTTCTGTGTCCCCTCCACCAAAA
    [Show full text]