Mouse Rb1 Conditional Knockout Project (CRISPR/Cas9)

Total Page:16

File Type:pdf, Size:1020Kb

Mouse Rb1 Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Rb1 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Rb1 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Rb1 gene (NCBI Reference Sequence: NM_009029 ; Ensembl: ENSMUSG00000022105 ) is located on Mouse chromosome 14. 27 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 27 (Transcript: ENSMUST00000022701). Exon 8 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Rb1 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-217E12 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Homozygotes for targeted mutations exhibit abnormalities of the neuronal and hematopoietic systems and die in utero. Heterozygotes may develop pituitary tumors associated with loss of the normal allele. Exon 8 starts from about 25.37% of the coding region. The knockout of Exon 8 will result in frameshift of the gene. The size of intron 7 for 5'-loxP site insertion: 2603 bp, and the size of intron 8 for 3'-loxP site insertion: 1630 bp. The size of effective cKO region: ~643 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 8 9 27 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Rb1 Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7143bp) | A(31.39% 2242) | C(16.9% 1207) | T(31.43% 2245) | G(20.29% 1449) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr14 - 73280515 73283514 3000 browser details YourSeq 144 859 1054 3000 87.2% chr17 + 10912133 10912334 202 browser details YourSeq 143 859 1054 3000 86.4% chr14 + 111965693 111965862 170 browser details YourSeq 137 880 1052 3000 88.2% chr16 - 27474605 27474774 170 browser details YourSeq 137 880 1053 3000 89.4% chr13 - 102679735 102679906 172 browser details YourSeq 136 1495 1783 3000 86.1% chr5 + 131407271 131407575 305 browser details YourSeq 130 880 1056 3000 87.9% chr10 + 7079969 7080143 175 browser details YourSeq 129 880 1053 3000 87.1% chr6 - 40621894 40622064 171 browser details YourSeq 128 880 1047 3000 87.4% chr11 - 12674398 12674561 164 browser details YourSeq 127 870 1056 3000 84.5% chr1 - 177102344 177102532 189 browser details YourSeq 127 881 1047 3000 86.6% chrX + 151197655 151197818 164 browser details YourSeq 125 897 1054 3000 94.4% chr2 - 136015165 136015340 176 browser details YourSeq 125 884 1057 3000 90.8% chr5 + 91845303 91845476 174 browser details YourSeq 125 859 1052 3000 89.9% chr15 + 43054302 43054497 196 browser details YourSeq 124 907 1055 3000 93.2% chr2 - 129371749 129761496 389748 browser details YourSeq 123 870 1054 3000 85.8% chr4 - 16155349 16155525 177 browser details YourSeq 123 881 1046 3000 85.8% chr12 + 109310140 109310302 163 browser details YourSeq 122 857 1056 3000 92.3% chr11 + 63822140 63822340 201 browser details YourSeq 122 880 1115 3000 84.1% chr10 + 12195268 12195467 200 browser details YourSeq 121 870 1052 3000 93.1% chr14 - 119316544 119316733 190 Note: The 3000 bp section upstream of Exon 8 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr14 - 73276872 73279871 3000 browser details YourSeq 183 1853 2378 3000 85.9% chr16 - 90579169 90579459 291 browser details YourSeq 182 1860 2366 3000 88.2% chr16 - 16308959 16610346 301388 browser details YourSeq 156 2194 2378 3000 93.6% chr13 + 86397817 86398006 190 browser details YourSeq 154 2202 2387 3000 91.8% chr6 + 79985886 79986070 185 browser details YourSeq 150 2213 2376 3000 96.4% chr17 - 54722888 54723331 444 browser details YourSeq 146 2201 2377 3000 93.8% chr12 - 3047591 3047773 183 browser details YourSeq 139 2201 2787 3000 82.4% chr1 - 15381573 15381793 221 browser details YourSeq 138 2209 2368 3000 92.5% chr4 + 71751924 71752082 159 browser details YourSeq 137 2202 2368 3000 95.5% chr3 - 133576030 133576205 176 browser details YourSeq 135 2206 2360 3000 94.8% chr17 - 28520356 28520510 155 browser details YourSeq 134 1841 2309 3000 87.5% chr2 - 139513671 139514244 574 browser details YourSeq 134 2200 2360 3000 94.2% chr4 + 73243123 73243290 168 browser details YourSeq 134 2202 2356 3000 91.4% chr2 + 87369006 87369157 152 browser details YourSeq 133 2202 2348 3000 93.9% chr4 - 139325457 139325602 146 browser details YourSeq 132 2199 2348 3000 95.3% chr18 + 60829255 60829784 530 browser details YourSeq 132 2202 2368 3000 94.3% chr12 + 18382445 18382617 173 browser details YourSeq 132 2210 2372 3000 91.3% chr10 + 56551387 56551564 178 browser details YourSeq 131 2206 2356 3000 94.0% chr11 - 80087999 80088163 165 browser details YourSeq 131 2201 2352 3000 91.4% chr10 - 49755646 49755795 150 Note: The 3000 bp section downstream of Exon 8 is BLAT searched against the genome. No significant similarity is found. Page 4 of 8 https://www.alphaknockout.com Gene and protein information: Rb1 RB transcriptional corepressor 1 [ Mus musculus (house mouse) ] Gene ID: 19645, updated on 22-Oct-2019 Gene summary Official Symbol Rb1 provided by MGI Official Full Name RB transcriptional corepressor 1 provided by MGI Primary source MGI:MGI:97874 See related Ensembl:ENSMUSG00000022105 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as Rb; pRb; Rb-1; pp105 Expression Ubiquitous expression in liver E14 (RPKM 8.6), whole brain E14.5 (RPKM 8.3) and 24 other tissues See more Orthologs human all Genomic context Location: 14 38.73 cM; 14 D3 See Rb1 in Genome Data Viewer Exon count: 28 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 14 NC_000080.6 (73192858..73325951, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 14 NC_000080.5 (73595309..73725598, complement) Chromosome 14 - NC_000080.6 Page 5 of 8 https://www.alphaknockout.com Transcript information: This gene has 6 transcripts Gene: Rb1 ENSMUSG00000022105 Description RB transcriptional corepressor 1 [Source:MGI Symbol;Acc:MGI:97874] Gene Synonyms Rb, Rb-1, pRb, retinoblastoma 1 Location Chromosome 14: 73,183,673-73,325,822 reverse strand. GRCm38:CM001007.2 About this gene This gene has 6 transcripts (splice variants), 201 orthologues, 2 paralogues, is a member of 1 Ensembl protein family and is associated with 81 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Rb1-201 ENSMUST00000022701.6 4656 921aa ENSMUSP00000022701.6 Protein coding CCDS27267 P13405 TSL:1 GENCODE basic APPRIS P1 Rb1-203 ENSMUST00000164624.1 324 47aa ENSMUSP00000125967.1 Nonsense mediated decay - E9Q5C5 TSL:5 Rb1-204 ENSMUST00000168495.1 946 No protein - Retained intron - - TSL:2 Rb1-205 ENSMUST00000169002.1 355 No protein - Retained intron - - TSL:3 Rb1-202 ENSMUST00000163932.1 411 No protein - lncRNA - - TSL:5 Rb1-206 ENSMUST00000170967.1 408 No protein - lncRNA - - TSL:5 Page 6 of 8 https://www.alphaknockout.com 162.15 kb Forward strand 73.20Mb 73.25Mb 73.30Mb Genes Rcbtb2-209 >protein coding Lpar6-201 >protein coding Gm49131-201 >processed pseudogene (Comprehensive set... Rcbtb2-226 >protein coding Rcbtb2-223 >protein coding Rcbtb2-217 >protein coding Rcbtb2-219 >protein coding Rcbtb2-201 >protein coding Rcbtb2-202 >protein coding Rcbtb2-218 >protein coding Rcbtb2-207 >nonsense mediated decay Rcbtb2-208 >nonsense mediated decay Rcbtb2-215 >protein coding Rcbtb2-220 >retained intron Contigs CT571265.12 > AC154718.2 > Genes (Comprehensive set... < Gm17233-201lncRNA < Rb1-201protein coding < Rb1-202lncRNA < Rb1-204retained intron < Rb1-206lncRNA < Rb1-205retained intron < Mir687-201miRNA < Rb1-203nonsense mediated decay Regulatory Build 73.20Mb 73.25Mb 73.30Mb Reverse strand 162.15 kb Regulation Legend CTCF Enhancer Open Chromatin Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding processed transcript RNA gene pseudogene Page 7 of 8 https://www.alphaknockout.com
Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Literature Mining Sustains and Enhances Knowledge Discovery from Omic Studies
    LITERATURE MINING SUSTAINS AND ENHANCES KNOWLEDGE DISCOVERY FROM OMIC STUDIES by Rick Matthew Jordan B.S. Biology, University of Pittsburgh, 1996 M.S. Molecular Biology/Biotechnology, East Carolina University, 2001 M.S. Biomedical Informatics, University of Pittsburgh, 2005 Submitted to the Graduate Faculty of School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2016 UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE This dissertation was presented by Rick Matthew Jordan It was defended on December 2, 2015 and approved by Shyam Visweswaran, M.D., Ph.D., Associate Professor Rebecca Jacobson, M.D., M.S., Professor Songjian Lu, Ph.D., Assistant Professor Dissertation Advisor: Vanathi Gopalakrishnan, Ph.D., Associate Professor ii Copyright © by Rick Matthew Jordan 2016 iii LITERATURE MINING SUSTAINS AND ENHANCES KNOWLEDGE DISCOVERY FROM OMIC STUDIES Rick Matthew Jordan, M.S. University of Pittsburgh, 2016 Genomic, proteomic and other experimentally generated data from studies of biological systems aiming to discover disease biomarkers are currently analyzed without sufficient supporting evidence from the literature due to complexities associated with automated processing. Extracting prior knowledge about markers associated with biological sample types and disease states from the literature is tedious, and little research has been performed to understand how to use this knowledge to inform the generation of classification models from ‘omic’ data. Using pathway analysis methods to better understand the underlying biology of complex diseases such as breast and lung cancers is state-of-the-art. However, the problem of how to combine literature- mining evidence with pathway analysis evidence is an open problem in biomedical informatics research.
    [Show full text]
  • Cytogenetic Analysis of a Pseudoangiomatous Pleomorphic/Spindle Cell Lipoma
    ANTICANCER RESEARCH 37 : 2219-2223 (2017) doi:10.21873/anticanres.11557 Cytogenetic Analysis of a Pseudoangiomatous Pleomorphic/Spindle Cell Lipoma IOANNIS PANAGOPOULOS 1, LUDMILA GORUNOVA 1, INGVILD LOBMAIER 2, HEGE KILEN ANDERSEN 1, BODIL BJERKEHAGEN 2 and SVERRE HEIM 1,3 1Section for Cancer Cytogenetics, Institute for Cancer Genetics and Informatics, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway; 2Department of Pathology, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway; 3Faculty of Medicine, University of Oslo, Oslo, Norway Abstract. Background: Pseudoangiomatous pleomorphic/ appearance’ (1). To date, only 20 patients have been described spindle cell lipoma is a rare subtype of pleomorphic/spindle in the literature with this diagnosis, 15 of whom were males cell lipoma. Only approximately 20 such tumors have been (1-10). The pseudoangiomatous pleomorphic/spindle cell described. Genetic information on pseudoangiomatous lipomas were mostly found in the neck (seven patients) and pleomorphic/spindle cell lipoma is restricted to a single case shoulders (four patients), but have also been seen in the in which deletion of the forkhead box O1 (FOXO1) gene was cheek, chest, chin, elbow, finger, subscapular region, and found, using fluorescence in situ hybridization (FISH). thumb. Genetic information on pseudoangiomatous Materials and Methods: G-banding and FISH analyses were pleomorphic/ spindle cell lipoma is restricted to one case only performed on a pseudoangiomatous pleomorphic/spindle cell (8) in which fluorescence in situ hybridization (FISH) with a lipoma. Results: G-banding of tumor cells showed complex probe for the forkhead box O1 ( FOXO1 ) gene, which maps karyotypic changes including loss of chromosome 13. FISH to chromosome sub-band 13q14.11, showed a signal pattern analysis revealed that the deleted region contained the RB1 indicating monoallelic loss of the gene in 57% of the gene (13q14.2) and the part of chromosome arm 13q (q14.2- examined cells.
    [Show full text]
  • Downloaded from Here
    bioRxiv preprint doi: https://doi.org/10.1101/017566; this version posted November 19, 2015. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 1 Testing for ancient selection using cross-population allele 2 frequency differentiation 1;∗ 3 Fernando Racimo 4 1 Department of Integrative Biology, University of California, Berkeley, CA, USA 5 ∗ E-mail: [email protected] 6 1 Abstract 7 A powerful way to detect selection in a population is by modeling local allele frequency changes in a 8 particular region of the genome under scenarios of selection and neutrality, and finding which model is 9 most compatible with the data. Chen et al. [2010] developed a composite likelihood method called XP- 10 CLR that uses an outgroup population to detect departures from neutrality which could be compatible 11 with hard or soft sweeps, at linked sites near a beneficial allele. However, this method is most sensitive 12 to recent selection and may miss selective events that happened a long time ago. To overcome this, 13 we developed an extension of XP-CLR that jointly models the behavior of a selected allele in a three- 14 population tree. Our method - called 3P-CLR - outperforms XP-CLR when testing for selection that 15 occurred before two populations split from each other, and can distinguish between those events and 16 events that occurred specifically in each of the populations after the split.
    [Show full text]
  • Genotype-Phenotype Correlations in Patients with Retinoblastoma And
    Genotype-phenotype correlations in patients with Retinoblastoma and an interstitial 13q deletion Diana Mitter, Reinhard Ullmann, Artur Muradyan, Ludger Klein-Hitpaß, Deniz Kanber, Dietmar R Lohmann, Katrin Ounap, Marc Kaulisch To cite this version: Diana Mitter, Reinhard Ullmann, Artur Muradyan, Ludger Klein-Hitpaß, Deniz Kanber, et al.. Genotype-phenotype correlations in patients with Retinoblastoma and an interstitial 13q deletion. European Journal of Human Genetics, Nature Publishing Group, 2011, 10.1038/ejhg.2011.58. hal- 00633984 HAL Id: hal-00633984 https://hal.archives-ouvertes.fr/hal-00633984 Submitted on 20 Oct 2011 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. 1 Genotype-phenotype correlations in patients with Retinoblastoma and interstitial 13q deletions 1, *Diana Mitter, 2Reinhard Ullmann, 2Artur Muradyan, 3Ludger Klein-Hitpaß, 1Deniz Kanber, 4Katrin Õunap, 5Marc Kaulisch, 1Dietmar Lohmann 1Institut für Humangenetik, Universitätsklinikum Essen, Germany; 2Max-Planck- Institute of Molecular Genetic, Berlin, Germany; 3Institute for Cell Biology (Tumor Research), University of Duisburg-Essen, Germany; 4Department of Genetics, United Laboratories, Tartu University Hospital, Estonia; 5Institute for Research Information and Quality Assurance, Germany. *Correspondence and present address: Diana Mitter, Institut für Humangenetik, Universitätsklinikum Leipzig, Philipp-Rosenthal-Str.
    [Show full text]
  • Human Social Genomics in the Multi-Ethnic Study of Atherosclerosis
    Getting “Under the Skin”: Human Social Genomics in the Multi-Ethnic Study of Atherosclerosis by Kristen Monét Brown A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Epidemiological Science) in the University of Michigan 2017 Doctoral Committee: Professor Ana V. Diez-Roux, Co-Chair, Drexel University Professor Sharon R. Kardia, Co-Chair Professor Bhramar Mukherjee Assistant Professor Belinda Needham Assistant Professor Jennifer A. Smith © Kristen Monét Brown, 2017 [email protected] ORCID iD: 0000-0002-9955-0568 Dedication I dedicate this dissertation to my grandmother, Gertrude Delores Hampton. Nanny, no one wanted to see me become “Dr. Brown” more than you. I know that you are standing over the bannister of heaven smiling and beaming with pride. I love you more than my words could ever fully express. ii Acknowledgements First, I give honor to God, who is the head of my life. Truly, without Him, none of this would be possible. Countless times throughout this doctoral journey I have relied my favorite scripture, “And we know that all things work together for good, to them that love God, to them who are called according to His purpose (Romans 8:28).” Secondly, I acknowledge my parents, James and Marilyn Brown. From an early age, you two instilled in me the value of education and have been my biggest cheerleaders throughout my entire life. I thank you for your unconditional love, encouragement, sacrifices, and support. I would not be here today without you. I truly thank God that out of the all of the people in the world that He could have chosen to be my parents, that He chose the two of you.
    [Show full text]
  • PDF Datasheet
    Product Datasheet RCBTB2 Overexpression Lysate NBL1-15241 Unit Size: 0.1 mg Store at -80C. Avoid freeze-thaw cycles. Protocols, Publications, Related Products, Reviews, Research Tools and Images at: www.novusbio.com/NBL1-15241 Updated 3/17/2020 v.20.1 Earn rewards for product reviews and publications. Submit a publication at www.novusbio.com/publications Submit a review at www.novusbio.com/reviews/destination/NBL1-15241 Page 1 of 2 v.20.1 Updated 3/17/2020 NBL1-15241 RCBTB2 Overexpression Lysate Product Information Unit Size 0.1 mg Concentration The exact concentration of the protein of interest cannot be determined for overexpression lysates. Please contact technical support for more information. Storage Store at -80C. Avoid freeze-thaw cycles. Buffer RIPA buffer Target Molecular Weight 60.1 kDa Product Description Description Transient overexpression lysate of regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2 (RCBTB2) The lysate was created in HEK293T cells, using Plasmid ID RC206560 and based on accession number NM_001268. The protein contains a C-MYC/DDK Tag. Gene ID 1102 Gene Symbol RCBTB2 Species Human Notes HEK293T cells in 10-cm dishes were transiently transfected with a non-lipid polymer transfection reagent specially designed and manufactured for large volume DNA transfection. Transfected cells were cultured for 48hrs before collection. The cells were lysed in modified RIPA buffer (25mM Tris-HCl pH7.6, 150mM NaCl, 1% NP-40, 1mM EDTA, 1xProteinase inhibitor cocktail mix, 1mM PMSF and 1mM Na3VO4, and then centrifuged to clarify the lysate. Protein concentration was measured by BCA protein assay kit.This product is manufactured by and sold under license from OriGene Technologies and its use is limited solely for research purposes.
    [Show full text]
  • Oxidized Phospholipids Regulate Amino Acid Metabolism Through MTHFD2 to Facilitate Nucleotide Release in Endothelial Cells
    ARTICLE DOI: 10.1038/s41467-018-04602-0 OPEN Oxidized phospholipids regulate amino acid metabolism through MTHFD2 to facilitate nucleotide release in endothelial cells Juliane Hitzel1,2, Eunjee Lee3,4, Yi Zhang 3,5,Sofia Iris Bibli2,6, Xiaogang Li7, Sven Zukunft 2,6, Beatrice Pflüger1,2, Jiong Hu2,6, Christoph Schürmann1,2, Andrea Estefania Vasconez1,2, James A. Oo1,2, Adelheid Kratzer8,9, Sandeep Kumar 10, Flávia Rezende1,2, Ivana Josipovic1,2, Dominique Thomas11, Hector Giral8,9, Yannick Schreiber12, Gerd Geisslinger11,12, Christian Fork1,2, Xia Yang13, Fragiska Sigala14, Casey E. Romanoski15, Jens Kroll7, Hanjoong Jo 10, Ulf Landmesser8,9,16, Aldons J. Lusis17, 1234567890():,; Dmitry Namgaladze18, Ingrid Fleming2,6, Matthias S. Leisegang1,2, Jun Zhu 3,4 & Ralf P. Brandes1,2 Oxidized phospholipids (oxPAPC) induce endothelial dysfunction and atherosclerosis. Here we show that oxPAPC induce a gene network regulating serine-glycine metabolism with the mitochondrial methylenetetrahydrofolate dehydrogenase/cyclohydrolase (MTHFD2) as a cau- sal regulator using integrative network modeling and Bayesian network analysis in human aortic endothelial cells. The cluster is activated in human plaque material and by atherogenic lipo- proteins isolated from plasma of patients with coronary artery disease (CAD). Single nucleotide polymorphisms (SNPs) within the MTHFD2-controlled cluster associate with CAD. The MTHFD2-controlled cluster redirects metabolism to glycine synthesis to replenish purine nucleotides. Since endothelial cells secrete purines in response to oxPAPC, the MTHFD2- controlled response maintains endothelial ATP. Accordingly, MTHFD2-dependent glycine synthesis is a prerequisite for angiogenesis. Thus, we propose that endothelial cells undergo MTHFD2-mediated reprogramming toward serine-glycine and mitochondrial one-carbon metabolism to compensate for the loss of ATP in response to oxPAPC during atherosclerosis.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name RCC1 and BTB domain-containing protein 2 Gene Symbol Rcbtb2 Organism Rat Gene Summary human homolog may be a guanine nucleotide exchange factor related to the regulator of chromosome condensation (RCC1) gene Gene Aliases Not Available RefSeq Accession No. NM_199084 UniGene ID Rn.8721 Ensembl Gene ID ENSRNOG00000015054 Entrez Gene ID 290363 Assay Information Unique Assay ID qRnoCID0004834 Assay Type SYBR® Green Detected Coding Transcript(s) ENSRNOT00000020836 Amplicon Context Sequence TCTGGAAGACAGCTTTACAAGAATCTAGACGGACCAAATTCCAGGCTCCAGAAC ATTCCAGCAACCAGCTTAGCAGACCATACATTCTACAGGAGCTGAGAACTGATAA GTCTC Amplicon Length (bp) 84 Chromosome Location 15:58766771-58769712 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 101 R2 0.9997 cDNA Cq 23.82 cDNA Tm (Celsius) 81.5 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Rcbtb2, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • Receptor Signaling Through Osteoclast-Associated Monocyte
    Downloaded from http://www.jimmunol.org/ by guest on September 29, 2021 is online at: average * The Journal of Immunology The Journal of Immunology , 20 of which you can access for free at: 2015; 194:3169-3179; Prepublished online 27 from submission to initial decision 4 weeks from acceptance to publication February 2015; doi: 10.4049/jimmunol.1402800 http://www.jimmunol.org/content/194/7/3169 Collagen Induces Maturation of Human Monocyte-Derived Dendritic Cells by Signaling through Osteoclast-Associated Receptor Heidi S. Schultz, Louise M. Nitze, Louise H. Zeuthen, Pernille Keller, Albrecht Gruhler, Jesper Pass, Jianhe Chen, Li Guo, Andrew J. Fleetwood, John A. Hamilton, Martin W. Berchtold and Svetlana Panina J Immunol cites 43 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Author Choice option Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Freely available online through http://www.jimmunol.org/content/suppl/2015/02/27/jimmunol.140280 0.DCSupplemental This article http://www.jimmunol.org/content/194/7/3169.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Author Choice Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2015 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606.
    [Show full text]
  • The Pdx1 Bound Swi/Snf Chromatin Remodeling Complex Regulates Pancreatic Progenitor Cell Proliferation and Mature Islet Β Cell
    Page 1 of 125 Diabetes The Pdx1 bound Swi/Snf chromatin remodeling complex regulates pancreatic progenitor cell proliferation and mature islet β cell function Jason M. Spaeth1,2, Jin-Hua Liu1, Daniel Peters3, Min Guo1, Anna B. Osipovich1, Fardin Mohammadi3, Nilotpal Roy4, Anil Bhushan4, Mark A. Magnuson1, Matthias Hebrok4, Christopher V. E. Wright3, Roland Stein1,5 1 Department of Molecular Physiology and Biophysics, Vanderbilt University, Nashville, TN 2 Present address: Department of Pediatrics, Indiana University School of Medicine, Indianapolis, IN 3 Department of Cell and Developmental Biology, Vanderbilt University, Nashville, TN 4 Diabetes Center, Department of Medicine, UCSF, San Francisco, California 5 Corresponding author: [email protected]; (615)322-7026 1 Diabetes Publish Ahead of Print, published online June 14, 2019 Diabetes Page 2 of 125 Abstract Transcription factors positively and/or negatively impact gene expression by recruiting coregulatory factors, which interact through protein-protein binding. Here we demonstrate that mouse pancreas size and islet β cell function are controlled by the ATP-dependent Swi/Snf chromatin remodeling coregulatory complex that physically associates with Pdx1, a diabetes- linked transcription factor essential to pancreatic morphogenesis and adult islet-cell function and maintenance. Early embryonic deletion of just the Swi/Snf Brg1 ATPase subunit reduced multipotent pancreatic progenitor cell proliferation and resulted in pancreas hypoplasia. In contrast, removal of both Swi/Snf ATPase subunits, Brg1 and Brm, was necessary to compromise adult islet β cell activity, which included whole animal glucose intolerance, hyperglycemia and impaired insulin secretion. Notably, lineage-tracing analysis revealed Swi/Snf-deficient β cells lost the ability to produce the mRNAs for insulin and other key metabolic genes without effecting the expression of many essential islet-enriched transcription factors.
    [Show full text]
  • Detection of H3k4me3 Identifies Neurohiv Signatures, Genomic
    viruses Article Detection of H3K4me3 Identifies NeuroHIV Signatures, Genomic Effects of Methamphetamine and Addiction Pathways in Postmortem HIV+ Brain Specimens that Are Not Amenable to Transcriptome Analysis Liana Basova 1, Alexander Lindsey 1, Anne Marie McGovern 1, Ronald J. Ellis 2 and Maria Cecilia Garibaldi Marcondes 1,* 1 San Diego Biomedical Research Institute, San Diego, CA 92121, USA; [email protected] (L.B.); [email protected] (A.L.); [email protected] (A.M.M.) 2 Departments of Neurosciences and Psychiatry, University of California San Diego, San Diego, CA 92103, USA; [email protected] * Correspondence: [email protected] Abstract: Human postmortem specimens are extremely valuable resources for investigating trans- lational hypotheses. Tissue repositories collect clinically assessed specimens from people with and without HIV, including age, viral load, treatments, substance use patterns and cognitive functions. One challenge is the limited number of specimens suitable for transcriptional studies, mainly due to poor RNA quality resulting from long postmortem intervals. We hypothesized that epigenomic Citation: Basova, L.; Lindsey, A.; signatures would be more stable than RNA for assessing global changes associated with outcomes McGovern, A.M.; Ellis, R.J.; of interest. We found that H3K27Ac or RNA Polymerase (Pol) were not consistently detected by Marcondes, M.C.G. Detection of H3K4me3 Identifies NeuroHIV Chromatin Immunoprecipitation (ChIP), while the enhancer H3K4me3 histone modification was Signatures, Genomic Effects of abundant and stable up to the 72 h postmortem. We tested our ability to use H3K4me3 in human Methamphetamine and Addiction prefrontal cortex from HIV+ individuals meeting criteria for methamphetamine use disorder or not Pathways in Postmortem HIV+ Brain (Meth +/−) which exhibited poor RNA quality and were not suitable for transcriptional profiling.
    [Show full text]