Novel Candidate Cancer Genes Identified by a Large-Scale Cross-Species Comparative Oncogenomics Approach
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Cell Adhesion and Specificity
RESEARCH ARTICLE Molecular basis of sidekick-mediated cell- cell adhesion and specificity Kerry M Goodman1†, Masahito Yamagata2,3†, Xiangshu Jin1,4‡, Seetha Mannepalli1, Phinikoula S Katsamba4,5, Go¨ ran Ahlse´ n4,5, Alina P Sergeeva4,5, Barry Honig1,4,5,6,7*, Joshua R Sanes2,3*, Lawrence Shapiro1,5,7* 1Department of Biochemistry and Molecular Biophysics, Columbia University, New York, United States; 2Department of Molecular and Cellular Biology, Harvard University, Cambridge, United States; 3Center for Brain Science, Harvard University, Cambridge, United States; 4Howard Hughes Medical Institute, Columbia University, New York, United States; 5Department of Systems Biology, Columbia University, New York, United States; 6Department of Medicine, Columbia University, New York, United States; 7Zuckerman Mind Brain and Behavior Institute, Columbia University, New York, United States *For correspondence: bh6@cumc. Abstract Sidekick (Sdk) 1 and 2 are related immunoglobulin superfamily cell adhesion proteins columbia.edu (BH); sanesj@mcb. required for appropriate synaptic connections between specific subtypes of retinal neurons. Sdks harvard.edu (JRS); shapiro@ mediate cell-cell adhesion with homophilic specificity that underlies their neuronal targeting convex.hhmi.columbia.edu (LS) function. Here we report crystal structures of Sdk1 and Sdk2 ectodomain regions, revealing similar †These authors contributed homodimers mediated by the four N-terminal immunoglobulin domains (Ig1–4), arranged in a equally to this work horseshoe conformation. These Ig1–4 horseshoes interact in a novel back-to-back orientation in both homodimers through Ig1:Ig2, Ig1:Ig1 and Ig3:Ig4 interactions. Structure-guided mutagenesis Present address: ‡Department results show that this canonical dimer is required for both Sdk-mediated cell aggregation (via trans of Chemistry, Michigan State interactions) and Sdk clustering in isolated cells (via cis interactions). -
Supplementary Table 1: Adhesion Genes Data Set
Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like, -
Natural Genetic Variation Screen in Drosophila Identifies
INVESTIGATION Natural Genetic Variation Screen in Drosophila Identifies Wnt Signaling, Mitochondrial Metabolism, and Redox Homeostasis Genes as Modifiers of Apoptosis Rebecca A. S. Palu,*,1 Elaine Ong,* Kaitlyn Stevens,* Shani Chung,* Katie G. Owings,* Alan G. Goodman,†,‡ and Clement Y. Chow*,2 *Department of Human Genetics, University of Utah School of Medicine, Salt Lake City, UT 84112, †School of Molecular Biosciences, and ‡Paul G. Allen School for Global Animal Health, Washington State University College of Veterinary Medicine, Pullman, WA 99164 ORCID IDs: 0000-0001-9444-8815 (R.A.S.P.); 0000-0001-6394-332X (A.G.G.); 0000-0002-3104-7923 (C.Y.C.) ABSTRACT Apoptosis is the primary cause of degeneration in a number of neuronal, muscular, and KEYWORDS metabolic disorders. These diseases are subject to a great deal of phenotypic heterogeneity in patient apoptosis populations, primarily due to differences in genetic variation between individuals. This creates a barrier to Drosophila effective diagnosis and treatment. Understanding how genetic variation influences apoptosis could lead to genetic variation the development of new therapeutics and better personalized treatment approaches. In this study, we modifier genes examine the impact of the natural genetic variation in the Drosophila Genetic Reference Panel (DGRP) on two models of apoptosis-induced retinal degeneration: overexpression of p53 or reaper (rpr). We identify a number of known apoptotic, neural, and developmental genes as candidate modifiers of degeneration. We also use Gene Set Enrichment Analysis (GSEA) to identify pathways that harbor genetic variation that impact these apoptosis models, including Wnt signaling, mitochondrial metabolism, and redox homeostasis. Fi- nally, we demonstrate that many of these candidates have a functional effect on apoptosis and degener- ation. -
Literature Mining Sustains and Enhances Knowledge Discovery from Omic Studies
LITERATURE MINING SUSTAINS AND ENHANCES KNOWLEDGE DISCOVERY FROM OMIC STUDIES by Rick Matthew Jordan B.S. Biology, University of Pittsburgh, 1996 M.S. Molecular Biology/Biotechnology, East Carolina University, 2001 M.S. Biomedical Informatics, University of Pittsburgh, 2005 Submitted to the Graduate Faculty of School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2016 UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE This dissertation was presented by Rick Matthew Jordan It was defended on December 2, 2015 and approved by Shyam Visweswaran, M.D., Ph.D., Associate Professor Rebecca Jacobson, M.D., M.S., Professor Songjian Lu, Ph.D., Assistant Professor Dissertation Advisor: Vanathi Gopalakrishnan, Ph.D., Associate Professor ii Copyright © by Rick Matthew Jordan 2016 iii LITERATURE MINING SUSTAINS AND ENHANCES KNOWLEDGE DISCOVERY FROM OMIC STUDIES Rick Matthew Jordan, M.S. University of Pittsburgh, 2016 Genomic, proteomic and other experimentally generated data from studies of biological systems aiming to discover disease biomarkers are currently analyzed without sufficient supporting evidence from the literature due to complexities associated with automated processing. Extracting prior knowledge about markers associated with biological sample types and disease states from the literature is tedious, and little research has been performed to understand how to use this knowledge to inform the generation of classification models from ‘omic’ data. Using pathway analysis methods to better understand the underlying biology of complex diseases such as breast and lung cancers is state-of-the-art. However, the problem of how to combine literature- mining evidence with pathway analysis evidence is an open problem in biomedical informatics research. -
Cytogenetic Analysis of a Pseudoangiomatous Pleomorphic/Spindle Cell Lipoma
ANTICANCER RESEARCH 37 : 2219-2223 (2017) doi:10.21873/anticanres.11557 Cytogenetic Analysis of a Pseudoangiomatous Pleomorphic/Spindle Cell Lipoma IOANNIS PANAGOPOULOS 1, LUDMILA GORUNOVA 1, INGVILD LOBMAIER 2, HEGE KILEN ANDERSEN 1, BODIL BJERKEHAGEN 2 and SVERRE HEIM 1,3 1Section for Cancer Cytogenetics, Institute for Cancer Genetics and Informatics, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway; 2Department of Pathology, The Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway; 3Faculty of Medicine, University of Oslo, Oslo, Norway Abstract. Background: Pseudoangiomatous pleomorphic/ appearance’ (1). To date, only 20 patients have been described spindle cell lipoma is a rare subtype of pleomorphic/spindle in the literature with this diagnosis, 15 of whom were males cell lipoma. Only approximately 20 such tumors have been (1-10). The pseudoangiomatous pleomorphic/spindle cell described. Genetic information on pseudoangiomatous lipomas were mostly found in the neck (seven patients) and pleomorphic/spindle cell lipoma is restricted to a single case shoulders (four patients), but have also been seen in the in which deletion of the forkhead box O1 (FOXO1) gene was cheek, chest, chin, elbow, finger, subscapular region, and found, using fluorescence in situ hybridization (FISH). thumb. Genetic information on pseudoangiomatous Materials and Methods: G-banding and FISH analyses were pleomorphic/ spindle cell lipoma is restricted to one case only performed on a pseudoangiomatous pleomorphic/spindle cell (8) in which fluorescence in situ hybridization (FISH) with a lipoma. Results: G-banding of tumor cells showed complex probe for the forkhead box O1 ( FOXO1 ) gene, which maps karyotypic changes including loss of chromosome 13. FISH to chromosome sub-band 13q14.11, showed a signal pattern analysis revealed that the deleted region contained the RB1 indicating monoallelic loss of the gene in 57% of the gene (13q14.2) and the part of chromosome arm 13q (q14.2- examined cells. -
Tag-SNP Analysis of the GFI1-EVI5-RPL5-FAM69 Risk Locus
Tag-SNP analysis of the GFI1-EVI5-RPL5-FAM69 risk locus for multiple sclerosis Fuencisla Matesanz, Antonio Alcina, Oscar Fernández, Juan R González, Antonio Catalá-Rabasa, Maria Fedetz, Dorothy Ndagire, Laura Leyva, Miguel Guerrero, Carmen Arnal, et al. To cite this version: Fuencisla Matesanz, Antonio Alcina, Oscar Fernández, Juan R González, Antonio Catalá-Rabasa, et al.. Tag-SNP analysis of the GFI1-EVI5-RPL5-FAM69 risk locus for multiple sclerosis. Eu- ropean Journal of Human Genetics, Nature Publishing Group, 2010, n/a (n/a), pp.n/a-n/a. 10.1038/ejhg.2009.240. hal-00504138 HAL Id: hal-00504138 https://hal.archives-ouvertes.fr/hal-00504138 Submitted on 20 Jul 2010 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. 1 Tag-SNP analysis of the GFI1-EVI5-RPL5-FAM69 risk 2 locus for multiple sclerosis 3 A Alcina 1, O Fernández 2 , JR Gonzalez3, A Catalá-Rabasa 1, M Fedetz 1, D Ndagire 1, L 4 Leyva2, M Guerrero 2, C Arnal 4, C Delgado5, M Lucas 6, G Izquierdo 7, F Matesanz 1 5 Authors’ Affiliation: 6 1 Instituto de Parasitología y Biomedicina “López Neyra”. -
Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo -
Genetic and Functional Approaches to Understanding Autoimmune and Inflammatory Pathologies
University of Vermont ScholarWorks @ UVM Graduate College Dissertations and Theses Dissertations and Theses 2020 Genetic And Functional Approaches To Understanding Autoimmune And Inflammatory Pathologies Abbas Raza University of Vermont Follow this and additional works at: https://scholarworks.uvm.edu/graddis Part of the Genetics and Genomics Commons, Immunology and Infectious Disease Commons, and the Pathology Commons Recommended Citation Raza, Abbas, "Genetic And Functional Approaches To Understanding Autoimmune And Inflammatory Pathologies" (2020). Graduate College Dissertations and Theses. 1175. https://scholarworks.uvm.edu/graddis/1175 This Dissertation is brought to you for free and open access by the Dissertations and Theses at ScholarWorks @ UVM. It has been accepted for inclusion in Graduate College Dissertations and Theses by an authorized administrator of ScholarWorks @ UVM. For more information, please contact [email protected]. GENETIC AND FUNCTIONAL APPROACHES TO UNDERSTANDING AUTOIMMUNE AND INFLAMMATORY PATHOLOGIES A Dissertation Presented by Abbas Raza to The Faculty of the Graduate College of The University of Vermont In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Specializing in Cellular, Molecular, and Biomedical Sciences January, 2020 Defense Date: August 30, 2019 Dissertation Examination Committee: Cory Teuscher, Ph.D., Advisor Jonathan Boyson, Ph.D., Chairperson Matthew Poynter, Ph.D. Ralph Budd, M.D. Dawei Li, Ph.D. Dimitry Krementsov, Ph.D. Cynthia J. Forehand, Ph.D., Dean of the Graduate College ABSTRACT Our understanding of genetic predisposition to inflammatory and autoimmune diseases has been enhanced by large scale quantitative trait loci (QTL) linkage mapping and genome-wide association studies (GWAS). However, the resolution and interpretation of QTL linkage mapping or GWAS findings are limited. -
Longitudinal Genome-Wide Methylation Study of PTSD Treatment Using Prolonged Exposure and Hydrocortisone ✉ Ruoting Yang 1,4 , Changxin Xu2,4, Linda M
Translational Psychiatry www.nature.com/tp ARTICLE OPEN Longitudinal genome-wide methylation study of PTSD treatment using prolonged exposure and hydrocortisone ✉ Ruoting Yang 1,4 , Changxin Xu2,4, Linda M. Bierer2, Janine D. Flory2,3, Aarti Gautam1, Heather N. Bader2, Amy Lehrner2,3, Iouri Makotkine3, Frank Desarnaud3, Stacy A. Miller1, Marti Jett 1, Rasha Hammamieh1,5 and Rachel Yehuda2,3,5 © The Author(s) 2021 Epigenetic changes are currently invoked as explanations for both the chronicity and tenacity of post-traumatic stress disorder (PTSD), a heterogeneous condition showing varying, sometimes idiosyncratic responses to treatment. This study evaluated epigenetic markers in the context of a randomized clinical trial of PTSD patients undergoing prolonged-exposure psychotherapy with and without a hydrocortisone augmentation prior to each session. The purpose of the longitudinal epigenome-wide analyses was to identify predictors of recovery (from pretreatment data) or markers associated with symptom change (based on differences between pre- and post-therapy epigenetic changes). The results of these analyses identified the CREB–BDNF signaling pathway, previously linked to startle reaction and fear learning and memory processes, as a convergent marker predicting both symptom change and severity. Several previous-reported resilience markers were also identified (FKBP5, NR3C1, SDK1, and MAD1L1) to associate with PTSD recovery in this study. Especially, the methylation levels of FKBP5 in the gene body region decreased significantly as CAPS score decreased in responders, while no changes occurred in nonresponders. These biomarkers may have future utility in understanding clinical recovery in PTSD and potential applications in predicting treatment effects. Translational Psychiatry (2021) 11:398 ; https://doi.org/10.1038/s41398-021-01513-5 INTRODUCTION association with recovery, or that themselves change in associa- Plasticity of the epigenome is a mechanism through which tion with symptom severity. -
1 Fibrillar Αβ Triggers Microglial Proteome Alterations and Dysfunction in Alzheimer Mouse 1 Models 2 3 4 Laura Sebastian
bioRxiv preprint doi: https://doi.org/10.1101/861146; this version posted December 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Fibrillar triggers microglial proteome alterations and dysfunction in Alzheimer mouse 2 models 3 4 5 Laura Sebastian Monasor1,10*, Stephan A. Müller1*, Alessio Colombo1, Jasmin König1,2, Stefan 6 Roth3, Arthur Liesz3,4, Anna Berghofer5, Takashi Saito6,7, Takaomi C. Saido6, Jochen Herms1,4,8, 7 Michael Willem9, Christian Haass1,4,9, Stefan F. Lichtenthaler 1,4,5# & Sabina Tahirovic1# 8 9 1 German Center for Neurodegenerative Diseases (DZNE) Munich, 81377 Munich, Germany 10 2 Faculty of Chemistry, Technical University of Munich, Garching, Germany 11 3 Institute for Stroke and Dementia Research (ISD), Ludwig-Maximilians Universität München, 12 81377 Munich, Germany 13 4 Munich Cluster for Systems Neurology (SyNergy), Munich, Germany 14 5 Neuroproteomics, School of Medicine, Klinikum Rechts der Isar, Technical University of Munich, 15 Munich, Germany 16 6 Laboratory for Proteolytic Neuroscience, RIKEN Center for Brain Science Institute, Wako, 17 Saitama 351-0198, Japan 18 7 Department of Neurocognitive Science, Nagoya City University Graduate School of Medical 19 Science, Nagoya, Aichi 467-8601, Japan 20 8 Center for Neuropathology and Prion Research, Ludwig-Maximilians-Universität München, 81377 21 Munich, Germany 22 9 Biomedical Center (BMC), Ludwig-Maximilians Universität München, 81377 Munich, Germany 23 10 Graduate School of Systemic Neuroscience, Ludwig-Maximilians-University Munich, Munich, 24 Germany. 25 *Contributed equally 26 #Correspondence: [email protected] and [email protected] 27 28 Running title: 29 Microglial proteomic signatures of AD 30 Keywords: Alzheimer’s disease / microglia / proteomic signatures / neuroinflammation / 31 phagocytosis 32 1 bioRxiv preprint doi: https://doi.org/10.1101/861146; this version posted December 2, 2019. -
Supplementary Tables S1-S3
Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)