The Pennsylvania State University

The Graduate School

Department of Food Science

THE COMPLEX INVOLVEMENT OF PROPHAGE AND PROPHAGE- ENCODED GENES IN THE BIOLOGY AND PATHOGENESIS OF ESCHERICHIA COLI O157:H7

A Dissertation in

Food Science

By

Chun Chen

© 2012 Chun Chen

Submitted in Partial Fulfillment

of the Requirements

for the Degree of

Doctor of Philosophy

December 2012 ii

The dissertation of Chun Chen was reviewed and approved* by the following:

Edward G. Dudley Associate Professor of Food Science Dissertation Advisor Chair of the Committee

Stephen J. Knabel Professor of Food Science

Robert F. Roberts Professor of Food Science Interim Head of the Department of Food Science

Kenneth C. Keiler Associate Professor of Biochemistry and Molecular Biology

*Signatures are on file in the Graduate School.

iii

Abstract

Enterohemorrhagic Escherichia coli (EHEC) O157:H7 is an important foodborne

pathogen, notorious for its low infectious dose and its potential to cause serious

diseases such as hemorrhagic colitis and hemolytic uremic syndrome. The cattle

gastrointestinal tract is the major biological reservoir of E. coli O157:H7. Whole genome

sequencing of this organism identified a total of 18 prophage and 6 prophage-like

elements, which make up 16% of the chromosome. These horizontally transferred

genetic elements encode most of the recognized virulence factors in E. coli O157:H7,

including the phage-encoded Shiga toxin (Stx) and locus of enterocyte effacement (LEE), and the pre- and post-transcriptional regulators for the expression of these virulence genes. Meanwhile, prophage regions are hot spots for genomic rearrangement in this pathogen. Therefore, the overall goal of the present study was to understand the various contributions of these prophage to the virulence and epidemiologic character of

E. coli O157:H7.

Stx is responsible for the serious clinical manifestations of infections in humans, and Stx2 is a subgroup that is associated with highly pathogenic strains. It has been hypothesized that both the O157:H7 strain and the susceptibility of intestinal E. coli to its phage impacts Stx2 accumulation in vivo. I quantified the phage and Stx2 production by 13 E. coli O157:H7 strains and observed dramatic strain-to-strain variability.

Transduction of the stx2-encoding phage from E. coli strain EDL933 into a non-toxin producing E. coli strain (C600) demonstrated that the host background affects phage iv and toxin production. Coincubation of E. coli O157:H7 or its lytic phage pools with E. coli

C600 could increase the production of Stx2 and stx2-encoding phage particles. This effect varied with the O157:H7 strain, the stx2-encoding prophage, and the presence of the phage inducing agent ciprofloxacin. Of note, phage from two E. coli O157:H7 clade 8 strains were the most infectious of those screened, while an stx2c-encoding phage possessed limited infectivity. Additionally, one clade 8 strain designated PA2 produced limited Stx2 as a pure culture, but accumulated the highest toxin level among strains tested when coincubated with C600. These results suggest that the intestinal microflora may impact the outcome of an O157:H7 infection, and that toxin production observed in pure culture might not accurately reflect the levels produced in vivo.

Sp11 and Sp12 are two tandem integrated and putatively defective prophage carried by E. coli O157:H7 strain Sakai. I identified 3 classes of deletions that occur within the Sp11-Sp12 region at a frequency of ca. 7.74 × 10-4. One deletion involved a precise excision of Sp11 and the other two spanned the junction of Sp11 and Sp12. All deletions resulted in shifts in the XbaI fragment pattern observed by PFGE. Alignment of the Sp11-Sp12 DNA sequence with its corresponding regions in other E. coli O157:H7 and O55:H7 strains suggested that homologous recombination rather than integrase- mediated excision is the mechanism behind these deletions. These observations explain in part a mechanism behind the previously reported genetic instability of this genomic region of E. coli O157:H7.

Data from our group suggested that the E. coli O157:H7 human isolates and isolates belonging to O serogroups that are frequently associated with foodborne v

outbreaks carry more copies of ileZ and argO than others. This observation supports the

hypothesis that the lambdoid prophage-encoded ileZ-argN-argO operon has a

regulatory effect on EHEC virulence. For the first time, I demonstrated promoter activity

upstream of all seven ileZ-argN-argO operons in E. coli O157:H7 Sakai and the

transcription of ileZ and argO independent of the phage late promoter. I also

determined that ileZ2 encodes a functional tRNA and suggested that argN is functionally

‘redundant’. Unexpectedly, inactivation of the ileZ2-argN2-argO2 operon did not affect

the production of Stx2 and the stx2-encoding phage in Sakai and phage-converted C600.

These observations do not support the widespread belief that ileZ-argN-argO are

required for efficient production of Stx2 and phage particles.

Streptomycin binds to the ribosome of bacteria and can inhibit translation by

promoting misreading of mRNA. Restrictive streptomycin-resistant (Strr) mutations

increase the accuracy of the decoding process; while concomitantly decrease the rate of

translation in many cases. Streptomycin is commonly used to repress the colonization

resistance from intestinal microflora during investigation of the colonization and

pathogenesis of E. coli O157:H7 in animal models. LEE-encoded EspA and EspB play

important roles in attachment to intestinal epithelia and colonization by E. coli O157:H7.

I observed a striking decrease in the secretion levels of EspA and EspB with E. coli

O157:H7 Strr restrictive mutants, which carry K42T or K42I mutations in the S12 protein.

However, strains carrying mutations previously defined as mildly restrictive (K87R) and

non-restrictive (K42R) showed slight and indistinguishable changes in EspA and EspB

secretion, respectively. Therefore, I propose that restrictive Strr mutations alter the EspA vi and EspB secretion by the bacteria and results in reduced capacity in colonizing and cause human diseases.

vii

TABLE OF CONTENTS

List of Figures………………………………………………………………………………………………………………xiii

List of Tables……………………………………………..……………………………………………………………….xvii

List of Abbreviations……………………………………………………………………………………………..….…xix

Acknowledgements……………………………………………………………………………………………………xxi

Chapter One. Statement of the problems……………...... ….…………………1

Chapter Two. Literature Review……………….……………………………………………………………………3

2.1 Escherichia coli O157:H7………………….….………………………...... ….………………..4

2.1.1 An Overview of enterohemorrhagic E. coli…...... ….….……….4

2.1.2 Clinical features of E. coli O157:H7……………...... ….………….5

2.1.3 Epidemiology of E. coli O157:H7……………...... …...….……………6

2.1.4 Transmission of E. coli O157:H7…………...... ….…...... ………………8

2.1.5 Subtyping methods for E. coli O157:H7……...... ….…...... ………..9

2.1.5.1 Pulse-field gel electrophoresis…………...... …...... …..10

2.1.5.2 Octamer-based genome scanning and Lineage-specific

polymorphism assay…...... ….…...... ….…...... ….10 viii

2.1.5.3 Clade classification system………...... ….…...... …………..11

2.1.6 Pathogenesis and virulence factors of E. coli O157:H7…………….……12

2.1.6.1 The Locus for Enterocyte Effacement…...... ….…...... 13

2.1.6.2 Shiga toxins……………………………………….…...... ….…...... 16

2.1.6.3 p O157…………………………………………………...... ….…...... 17

2.2 Bacteriophage in E. coli O157:H7…………………………………...... ….…...... ….18

2.2.1 An overview of bacteriophage………………………...... ….…...... 18

2.2.2 stx-encoding pha ge…………………………………………...... ….…...... 21

2.2.2.1 VT2-Sakai: an example for stx2-encoding phage….………..22

2.2.2.2 The role of stx-encoding phage in the pathogenesis of E.

coli O157:H7…………...... ….…...... ….…...... ….…...... 25

2.2.2.3 Quantification for stx-encoding phage...... 26

2.2.2.3.1 Pl aque assay……………………………...... ….…...... 26

2.2.2.3.2 E lectronic microscopy………………...... ….…...... 27

2.2.2.3.3 Quantitative PCR………………………...... ….…...... 27

2.2.3 Phage in the phylogeny of E. coli O157:H7………...... ….…...... 28

2.2.3.1 The evolution of E. coli O157:H7…………………….….…...... 28 ix

2.2.3.2 Prophage regions as hot spots for genomic

Rearrangements…………………………………………………………….30

2.3 R are c odon t RNAs……………………………...... ….…...... ….…………………………33

2.3.1 An overview of codon bias…………...... ….…...... ……………………33

2.3.2 Rare codon and bacterial virulence…...... ….…...... 34

2.3.2.1 The influence of leuX on the virulence of uropathogenic E.

coli……...... ….…...... ….…...... ….…...... ….….....37

2.3.2.2 The influence of fimU on the virulence of S. enterica

serovar Typhimurium……...... ….…...... ….….....37

2.3.3 ileZ-argN-argO tRNA gene operons………………...... ….…...... 38

2.4 Using streptomycin in E. coli O157:H7 animal study…...... ….…...... ….42

2.4.1 A b rief review of prokaryotic translation………...... ….…...... 42

2.4.2 S treptomycin a nd s treptomycin-resistance……...... ….…...... 43

2.4.2.1 An introduction to streptomycin…….…...... ….…...... 43

2.4.2.2 Different streptomycin-resistant mutations in E. coli….45

2.4.3 Application of Strr E. coli O157:H7 in animal infection study…………47

2.5 C onclusion…………………………………...... ….…...... ….………………………………..50

2.6 Ref erences…………………………………………...... ….…...... ….……………………….52 x

Chapter Three. Shiga toxin 2-encoding bacteriophage and host background impact the

accumulation of stx2 in Escherichia coli O157:H7 strains…….…...... …74

3.1 A bstract…..…………………...... ….…...... ….……………………………………………….75

3.2 In troduction.………………………………………...... ….…...... ….……………………….76

3.3 Ma terials a nd m ethods…………………...... ….…...... ….……………………………79

3.4 R esults………………………………………………………...... ….…...... ….………………..84

3.5 Di scussion………………………………………………………...... ….…...... ….……………90

3.6 A cknowledgement……………………………………………...... ….…...... ….…………97

3.7 R eference……………………………………………………………...... ….…...... ….………99

Chapter Four. Identification a nd c haracterization of spontaneous de letions wi thin the

Sp11-Sp12 prophage region of Escherichia coli O157:H7 Sakai…...... …121

4.1 A bstract…..………………………………………………...... ….…...... ….……………….122

4.2 In troduction.………………………………………………...... ….…...... ….……………123

4.3 Materials and methods…………………………………...... ….…...... ….……………125

4.4 R esults………………………………………………………………...... ….…...... ….…...... 132

4.5 Di scussion………………………………………………………………...... ….…...... ….…138

4.6 A cknowledgement……………………………………………………...... ….…...... …..144

4.7 Reference…………………………………………………………………...... ….…...... ….145 xi

Chapter Five. Inactivation of ileZ2-argN2-argO2 operon does not affect the production

of Stx2 and VT2-Sakai in Escherichia coli O157:H7 Sakai and VT2-Sakai-

converted E. coli C600……………………………...... ….…...... …………………..165

5.1 A bstract…..…………………………………………………...... ….…...... ….……………166

5.2 In troduction.……………………………………………………...... ….…...... ….………..167

5.3 Materials and methods………………………………………...... ….…...... ….……..170

5.4 R esults…………………………………………………………………...... ….…...... ….…..180

5.5 Di scussion………………………………………………………………...... ….…...... ….…186

5.6 A cknowledgement……………………………………………………...... ….…...... …..195

5.7 R eference…………………………………………………………………...... ….…...... ….196

Chapter Six. Restrictive streptomycin-resistant mutations decrease the secretion of

EspA and EspB in Escherichia coli O157:H7 strains………………...... ……………226

6.1 A bstract…..………………………………………………………………...... ….…...... ….227

6.2 In troduction.………………………...... ….…...... ….……………………………………228

6.3 Materials and methods………………...... ….…...... …….……………………………233

6.4 Results…………………………………………………...... ….…...... ….…………………….235

6.5 Di scussion……………………………………………………...... ….…...... ….……………236

6.6 A cknowledgement……………………………………………...... ….…...... ….……….238 xii

6.7 R eference……………………………………………………………...... ….…...... ….…….240

Chapter Seven. Conclusions and future directions………………….………………...... ……………248

7.1 C onclusions………………………………………………………………...... ….…...... ….248

7.2 F uture directions…………………...... ….…...... ….……………………………………250

7.2.1 The genetic diversity of stx2-encoding phage……………………..………250

7.2.2 Evaluating the virulence potential of E. coli O157:H7 strains “in

vivo”…………………………………………………………………………………..………251

7.2.3 Effects of deletions within Sp11-Sp12 on the biology of the

host..………….……………………….………………………...... ….…...... ….251

7.2.4 The function of argO.....….…...... ….…………………………………………252

7.2.5 Effects of restrictive Strr mutation on the virulence of E. coli

O157:H7.....….…...... ….……………………………………………………………253

7.2.6 Mechanism of the decreased EspA and EspB secretion………………253

xiii

LIST OF FIGURES

Figure 2.1 The lysogenic and lytic cycle of lambda-like phage...... ………...... ….……20

Figure 2.2 Regulation of VT2-Sakai life cycles…………………………...... ……..…...... ….….23

Figure 2.3 Evolutionary scenario for E. coli O157:H7…………………...... ….…...... ….….29

Figure 2.4 Codon usage analysis of the E. coli O157:H7 Sakai chromosomal genes……...39

Figure 3.1 stx2-encoding phage quantification in 2-fold serial diluted EDL933 lysate.109

Figure 3.2 Phage (A) and Stx2 (B) production from different E. coli O157:H7 strains 6

hours post-induction with 45 ng/ml ciprofloxacin. ……………...... …………….110

Figure 3.3 Quantification of phage and Stx2 from two host strains lysogenized with

933W…………………..…………...... ….…...... ….…...... ….….....…………………111

Figure 3.4 The effect of coincubation with E. coli C600 on the stx2-encoding phage yield

(A) and Stx2 production (B, C) of E. coli O157:H7 strains after overnight

incubation in the presence of 45 ng/ml ciprofloxacin……………...... ………….…112

Figure 3.5 The effect of coincubation with E. coli C600 on the stx2-encoding phage yield

(A) and Stx2 production (B, C) of E. coli O157:H7 after overnight incubation in

absence of ciprofloxacin………………...... ………………………………………...... ……113

Figure 3.6 Phage (A) and Stx2 (B, C) quantities from phage lysates 6 hours post-induction

with 45 ng/ml ciprofloxacin, and after overnight infection of E. coli C600…114

Figure 3.7 Factors affecting Stx2 accumulation during an E. coli O157:H7 infection……115

Figure S3.1 Fluorescence intensity of Stx2 in 2-fold serial diluted EDL933 lysate……..…116 xiv

Figure S3.2 Induction curves of EDL933 and C600::933W with 45 ng/ml

ciprofloxacin……………………………………………………………………………………………117

Figure S3.3 OD620 development of C600 and C600::933W when incubated with 45

ng/ml c iprofloxacin…………...... ….…...... ….…...... ….…...... ……….118

Figure S3.4 Quantifying phage in coincubation assay and phage infection assay using

qPCR……………………….…….....….…...... ….…...... ….…...... ………119

Figure 4.1 Spontaneous deletions within Sp11-Sp12 prophage region of Sakai………….154

Figure 4.2 Sequencing depth inconstancy in the Sp11-Sp12 region…………………………….155

Figure 4.3 Comparison of PFGE profiles of E. coli O157:H7 Sakai with its derivatives….156

Figure 4.4 Aligning sequencing results from induced phage pool of E. coli O157:H7 PA10

(upper) against Sakai genome (lower) using ACT………………………………………..157

Figure 4.5 The effect of pchB on the secretion of Esp proteins..…………………………………158

Figure S4.1 Sequence alignment between prophage Sp11 (upper) and Sp12 (lower) of E.

coli O157:H7 Sakai using ACT……………………………………………………………………159

Figure S4.2 Aligning the sequences of Sakai tandem prophage Sp11 and Sp12 (upper)

against the genomes of E. coli O157:H7 strains EC4115 (A), TW14395 (B) and

EDL933 (C) (lower) using ACT…………………………………………..………………………160

Figure S4.3 Sequence alignment showed high similarity between E. coli O157:H7 EC4115

(upper) and E. coli O157:H7 TW14359 (lower) genomes in their tandem

prophage homologous to Sakai Sp11-Sp12 and the flanking regions…………161

Figure S4.4 Prophage Cp8 from E. coli O55:H7 RM12579 (GenBank accession number:

NC017656) occupies the s ame i nsertion s ite a s S p11-Sp12 do es i n E. coli xv

O157:H7 Sakai..…………………………………………………………………………………………162

Figure 5.1 Relative abundance of ileZ (A), argOa (B) and argOb (C) in E. coli O157:H7 that

vary in sources and O types..…………………………………………………………………….206

Figure 5.2 Transcription of the ileZ-argN-argO operons. ………………………………………..….207

Figure 5.3 ileZ2 complemented the expression of 2ATA-Hfq…………………………..………….208

Figure 5.4 4 tandem CGA codons did not inhibit the translation of the corresponding Hfq

derivative..………………………………………………………………………………………………209

Figure 5.5 argO2 failed in restoring the expression of 3AGA-Hfq…………….…………………210

Figure 5.6 Quantification of Stx2 and phage from Sakai and SakaiΔtDNA..…………………211

Figure 5.7 Quantification of Stx2 and phage from C600::VT2-Sakai and C600::VT2-

SakaiΔtDNA……………………………………………………………………………………………….212

Figure 5.8 Effects of pRARE on the biology of Sakai when induced with ciprofloxacin..213

Figure S5.1 Quantifying abundance of ileZ, argOa and argOb in 10‐fold serial diluted

Sakai cultures using qPCR. ………………………………………………………………………214

Figure S5.2 A scheme of the cloning/expression region of pET-28a(+)…………………..…..215

Figure S5.3 Alignment of argO2 and argU..…………………………………………………………..……216

Figure S5.4 The sequence of the synthesized DNA fragment for ileZ2-argN2-argO2

anticodon knockout..………………………….……………………………………………………217

Figure S5.5 Effects of tandem arginine codons on the expression of the corresponding

Hfq derivative………………………………..……………………………………………….……….218

Figure S5.6 The 7 alleles of ileZ-argN-argO of Sakai are aligned using MEGA 4..…………219

xvi

Figure 6.1 Secretion of EspA and EspB from E. coli O157:H7 strains and their respective

Strr mutants….…………………………………………………………………………………………….244

xvii

LIST OF TALBES

Table 2.1 Centers for Disease Control and Prevention (CDC) reported E. coli O157:H7

foodborne outbreaks in US between 2002-2011……………….……………………………7

Table 2.2 Examples of tRNA-dependent gene expression in bacteria……………….………….36

Table 2.3 Copy numbers of ileZ‐argN‐argO tRNA genes in different E. coli pathogens

and commensals …………………………………………………………………………………….……41

Table 3.1 Strains, plasmids and phage used in this study……………………………………………108

Table S3.1 Primers used in this study………………………………..……………………………………….120

Table 4.1 Strains and plasmids used in this study………………………………………………..……..152

Table 4.2 Frequencies of reversion to Sucr in different merodiploid strains………………153

Table S4.1 Primers using in this study…………………………………………………………………………163

Table 5.1 Strains and plasmids used in this study………………………………………………………204

Table S5.1 Copy number of ileZ-argN-argO tRNA genes in different E. coli pathogens and

Commensals…………………………………………………………………………………………….220

Table S5.2 Strains used in ileZ, argO copy number assay……………………………………………221

Table S5.3 Primers used in this study…………………………………………………………………………224

Table 6.1 Strains used in this study…………………………………………………………………………….245

r Table 6.2 Point mutations identified in E. coli O157:H7 Str strains…………………….………246

xviii

Table S5.4 Rare codon tRNA usage in E. coli O157:H7 Sakai, and Table S5.5 Tandem rare codons in the E. coli O157:H7 Sakai genome are stored in

http://foodscience.psu.edu/directory/egd100.

xix

LIST OF ABBREVIATIONS

Amp Ampicilline

ANOVA Analysis of Variance

BLAST Basic Local Alignment Search Tool

⁰C Degree Celsius

Cam Chloramphenicol

Cef Cefixime

CFU Colony Forming Unit

DNA Deoxyribonucleic Acid

EHEC Enterohemorrhagic Escherichia coli O157:H7

GUD β-glucuronidase

HUS Hemolytic Uremic Syndrome

HC Hemorrhagic Colitis

Kan Kanamycin

LB media Lysogeny Broth media

LEE Locus of Enterocyte Effacement

LSPA Lineage Specific Polymorphism Assay ml Milliliter

µl Microliter xx ng Nanogram

OD Optical Density

PAI Pathogenicity Island

PCR Polymerase Chain Reaction

PFGE Pulsed-Field Gel Electrophoresis qPCR Quantitative PCR

RT-qPCR Reverse transcriptional qPCR

SD Standard Deviation

SDS-PAGE Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis

SNP Single Nucleotide Polymorphism

Str Streptomycin

STEC Shiga Toxin-producing E. coli

Stx Shiga Toxin rRNA Ribosomal Ribonucleic Acid

Tel potassium Tellurite tRNA Transfer Ribonucleic Acid

xxi

ACKNOWLEDGEMENTS

I would like to express my sincere appreciation to my advisor, Dr. Edward Dudley,

for his excellent guidance, caring, patience and encouragement on my research. He trained me how to critique papers, how to raise hypotheses, how to design experiments, and how to write scientific papers. More importantly, even when I was encountering the biggest chanllenges in my research, Dr. Dudley never gave up his confidence in me and was always encouraging and supportive. Without his guidance and help, this dissertation would not be possible.

I want to give my thanks to my committee members, Dr. Steve Knabel, Dr.

Robert Roberts and Dr. Kenneth Keiler, for their precious advices on my research for the past years and for helping me developing my knowledge in food science, microbiology and genetics. All these are essential to the projects I presented in this dissertation. I would also like to thank Elisabeth Roberts and Dr. Chitrita DebRoy for their input in the pulsed-field gel electrophoresis experiments.

Many thanks go to my previous and current lab mates, Amrita Puri, Kuanqing Liu,

Annette Hartzell, Carrie Lewis, Kakolie Goswami, Shuang Yin, Emily McIntyre, Michael

DiMarzio, Dr. Nikki Shariat, Margaret Kirchner, and Lingzi Xiaoli for their support and friendship. I also appreciate the many help from the faculty, staff and graduate students in the Food Science Department.

Most importantly, I would like to thank my parents, Liping Qiu and Zhiliang Chen.

I would never be able to finish my PhD degree without their love, understanding and support. xxii

Finally, I want to thank USDA-NIFA grant 2009-03611, the start-up funds through the Penn State University Department of Food Science and College of Agricultural

Sciences, and the Casida Development Professorship to E.G.D for the financial support. 1

Chapter One

STATEMENT OF THE PROBLEMS

Enterohemorrhagic Escherichia coli (EHEC) O157:H7 is an important foodborne pathogen, notorious for its low infectious dose and its potential to cause serious diseases such as hemorrhagic colitis and hemolytic uremic syndrome. Whole genome

sequencing of this organism previously identified a total of 18 prophage and 6 prophage-like elements, which make up 16% of the chromosome. These horizontally transferred genetic elements encode most of the recognized virulence factors in E. coli

O157:H7, including the phage-encoded Shiga toxin (Stx) and locus of enterocyte

effacement, and the pre- and post-transcriptional regulators for the expression of these

virulence genes. Meanwhile, prophage regions are hot spots for genomic

rearrangement in this pathogen. Therefore, the overall goal of the present study was to

understand the various contributions of these prophage to the virulence and

epidemiologic character of E. coli O157:H7.

A previous study using a collection of clinical E. coli O157:H7 isolates suggested

that stx‐encoding phage vary in their host range and the ability to amplify Stx

production during lytic infection of non-pathogenic host. Yet the strain collection was

limited in size and genetic variation. Hence, the first objectives of this study were to

develop a time-efficient, high-throughput and high-accuracy method for stx2‐encoding

phage quantification, and applying it to the investigation of Stx2 accumulation by phage

from diverse background during lytic infection. 2

During our study, spontaneous large-scale deletions were observed within

tandem prophage designated Sp11 and Sp12 of E. coli O157:H7 Sakai. These two

prophage are tandem integrated into the Sakai genome and share high sequence

identity. Previous studies documented the genomic instability of E. coli O157:H7, yet the

genetics behind these observations were never fully explained. My second objective was

to understand the mechanism and implication of Sp11-Sp12 deletion events.

EHEC strains possess 5 to 8 lambdoid prophage each carrying a copy of the

putative ileZ-argN-argO operon, while only 2 to 3 prophage encoding this operon were

found in other pathogenic E. coli. On the contrary, this operon is not found in any

sequenced laboratory model E. coli strains. Previous studies inferred that tRNA genes

encoded by ileZ-argN-argO operon recognize codons that are more frequently used by

horizontally acquired genes than those encoded within the backbone genome, yet no

experimental data support such prediction. Therefore, my third objective was to

investigate the potential regulatory effects of these tRNA gene operons on the Stx2 and

Stx2 production of EHEC.

Lastly, streptomycin resistant mutants of E. coli O157:H7 have been widely used for studying the in vivo colonization and pathogenesis of this pathogen. Nevertheless, the diversity of mechanisms that promote the streptomycin resistant phenotype has been generally overlooked in these animal studies. Therefore, the fourth objective of this project was to investigate the potential effects of different mutations leading to streptomycin resistance on the virulence of E. coli O157:H7. 3

Chapter Two

LITERATURE REVIEW

Over the past three decades, the foodborne pathogen Escherichia coli O157:H7

has attracted the attention of many researchers for its remarkably low infectious dose

and the potential to cause severe diseases. Many articles focusing on the pathogenesis

and epidemiology of this pathogen have been published. A variety of subtyping methods

have been developed for rapid and accurate investigation to control the ongoing

outbreak, to prevent the future outbreak and to understand the phylogeny of E. coli

O157:H7. By means of whole genome sequencing, the contribution of horizontally

acquired genes in the virulence of this pathogen has been gradually revealed. The

prophage encode not only toxins, but also the genes regulating the expression of other

virulence factors. In addition, the importance of prophage, as entities, in the

development of pathogenesis and genomic instability of E. coli O157:H7 has also been

reported. Furthermore, streptomycin-resistant mutants of E. coli O157:H7 were commonly used in animal studies, yet the potential influences of this mutation on the bacterial physiology have also been well documented. Chapter Two is a brief summary of previous publications on the biology and epidemiology of E. coli O157:H7, the diverse involvement of prophage in the pathogenesis and evolution of this pathogen, the mechanisms of streptomycin as an antibiotic, and mutations leading to streptomycin resistance.

4

2. 1 Escherichia coli O157:H7

2. 1.1 An Overview of enterohemorrhagic E. coli

The human intestinal tract contains a complex and dynamic microbial ecosystem

comprising approximately 1014 bacterial cells (91, 237, 264), which represent 500 to

1000 bacterial species (220). Escherichia coli and related bacteria make up approximately 0.1% of this total population (62). Though most strains of E. coli, a gram- negative, facultative anaerobic species, are non-pathogenic, some can cause diseases in their hosts. Based on their pathogenic mechanisms, diarrheagenic E. coli can be divided into at least six categories, including enterotoxigenic E. coli, enterohemorrhagic E. coli

(EHEC), enteroaggregative E. coli, enteropathogenic E. coli, enteroinvasive E. coli and diffusely adherent E. coli (171).

EHEC infection leads to diseases such as hemorrhagic colitis (HC), also known as bloody diarrhea, and hemolytic uremic syndrome (HUS), which is characterized by hemolytic anemia, low platelet count and renal impairment (87, 206). EHEC is a particularly dangerous pathogen because of its low infectious dose (221), and high incidence of causing renal failure, especially in children (193). Shiga toxins (Stx) are important virulence factors for EHEC, and are strongly associated with the development of HUS in patients (87). Therefore, EHEC belong to a larger group of E. coli designated as

Stx-producing E. coli (STEC). The term EHEC is commonly used to describe STEC serotypes that are commonly associated with clinical isolates and instances of HUS. 5

STEC include more than 100 serotypes (27, 104, 117), among which O157:H7 (O: somatic antigen, H: flagella antigen) is most commonly associated with human diseases

(26). Details of this sorbitol negative (267) and GUD (β-glucuronidase) negative (165) serotype will be discussed in the following sections. In addition to O157, recent clinical reports show an increasing incidence of infection with EHEC belonging to serotypes O26,

O111, O103, O145, O45 and O121 (27). Collectively, these non-O157 STEC serotypes are referred to as the ‘big six’. They were declared as adulterants in non-intact raw beef products and product components by the USDA (256). Scallan et al. (214) estimated that

O157:H7 causes 63,153 cases every year in the US, while this number of non-O157 STEC is approximately 112,752. STEC serotype O104:H4 was recently linked to a multi-country outbreak in 2011, which caused a total of 3,910 clinical cases and 46 deaths (61).

2.1.2 Clinical features of E. coli O157:H7

The infectious dose for E. coli O157:H7 appears to be less than 100 organisms

(221, 252), much lower that of other foodborne pathogens such as Salmonella (1× 105)

(20) or V. cholerae (1× 104) (126). The average incubation period of E. coli O157:H7 is 3 days, while the reported interval between exposure and illness ranges from 1 to 8 days.

The clinical manifestations of E. coli O157:H7 infection range from symptom-free carriage to non-bloody diarrhea, HC, HUS, and death (158). Children aged less than 5 years and the elderly are at higher risk for developing severe complications due to their compromised immune systems (158, 171).

After exposure to E. coli O157:H7, 3 to 9% of patients (in sporadic infections) to up to 20% of patients (in epidemic forms) progress to develop HUS (12, 158). HUS is a 6

thrombotic microangiopathy condition characterized by hemolytic anemia with

fragmentocytes, thrombocytopenia, and acute renal failure, which is indicated by

increased serum creatinine (217). Of the patients who develop HUS, 70% require red blood cell transfusion, 50% need dialysis (66% in children), and 25% cases involve neurologic disorder, including stroke, seizure and coma (177, 216). HUS mortality is reported to be between 3% and 5%, and deaths are nearly always associated with severe extra-renal complications (177, 216). Strains containing Stx2 (a subgroup of Stx) are strongly associated with the development of HUS (87).

So far no specific therapy has been proven to reverse the course of HUS and the

treatments are usually symptomatic (177, 217). Keeping fluid balance, erythrocyte

transfusions, thrombocyte transfusions, plasmapheresis, dialysis and kidney transplant

are considered as effective and safe treatments for HUS patients (177, 216, 217). Stx-

neutralizing monoclonal antibodies were proposed as useful therapeutic agents, yet

further research is needed before the clinical application of this strategy (19, 84). On the

other side, choice of antibiotic treatment must be carefully considered because a wide

spectrum of antibiotics has been shown to promote the acute release of large amount

of Stx. The abundance of Stx released is strain-dependent (86, 98, 281).

2. 1.3 Epidemiology of E. coli O157:H7

E. coli O157:H7 was first recognized as a foodborne pathogen in 1982 (196). Bart et al. reported that E. coli O157:H7 causes 63,153 clinical cases, resulting in $272 million in healthcare costs every year in the United States (13). From 1982 to 2002, a total of

350 outbreaks were reported in the US, accounting for 8,598 clinical cases. Among these 7

cases, there were 1,493 (17.4%) hospitalizations, 354 (4.1%) HUS cases and 40 (0.5%) deaths (194). A summary for the more recent O157:H7 outbreaks is shown in Table 2.1.

E. coli O157:H7 outbreaks have also been reported in China (275), Canada (7, 150, 266),

Germany (140), United Kingdom (67) and Japan (161, 265). It was suggested that

industrialization of agriculture, the expanding scale of food production and the

complicated food distribution chain have contributed to the increasing occurrence of E.

coli O157:H7 outbreaks (15, 178).

Table 2.1 E. coli O157:H7 foodborne outbreaks in the US between 2002 – 2011

reported by Centers for Disease Control and Prevention (CDC) *

Number Number Reported Year Food Source of of HUS deaths illnesses cases 2002 Ground beef 28 5 1 2006 Lettuce 71 8 0 2006 Fresh spinach 199 31 3 2007 Ground beef patties 40 2 0 2007 Frozen pizza 21 4 0 2008 Ground beef 49 1 0 2009 Raw cookie dough 72 10 0 2009 Ground beef 23 2 0 2009 Ground beef 26 5 2 2010 Beef 21 1 0 2010 Cheese 38 1 0 2011 Hazelnuts 8 0 0 2011 Romaine Lettuce 58 3 0 2011 Strawberry 15 NA** 1

*: All information is collected from CDC website.

**: Not available.

8

In addition to the outbreaks, a significant number of E. coli O157:H7 sporadic

infections have also been reported (146, 147, 189, 204). Swimming in contaminated

recreational water (5) and contact with livestock are two of the leading causes of these

sporadic cases (146, 189). In northern countries, the peak incidence of E. coli O157:H7

infections occurs from June through October (188, 204, 266). This can be correlated

with the shedding pattern of this pathogen from animals (95, 211).

2.1.4 Transmission of E. coli O157:H7

The gastrointestinal tract of cattle is the major biological reservoir for E. coli

O157:H7 (119). The recovery of E. coli O157:H7 from dairy farms ranges from 0.28% (95)

to 60% (8) and is greatly methodology-dependent. Inappropriate carcass opening

processes are the major cause of the hide-to-beef contamination. Ever since the first

reported case in 1982 (196), ground beef has been the most common food associated

with E. coli O157:H7 infection (194), and this is also shown in Table 2.1. Other ruminants

including sheep (99), buffalo (44), and deer (120) can also be potential reservoirs for E.

coli O157:H7. Although they are currently believed to play a minor role in E. coli

O157:H7 transmission within the food supply, lab tests confirmed that deer feces found in strawberry fields were the source of E. coli O157:H7 leading to an outbreak in 2011

(Table 2.1) (203).

E. coli O157:H7 shed by cattle contaminate farmland surface and drinking waters as well (176, 181). Wang et al. (263) showed that at 8 ⁰C, E. coli O157:H7 can survive in water for longer than 13 weeks. Furthermore, fresh produce was implicated in recent outbreaks as a result of direct contact with manure or irrigation with the contaminated 9

water. Between 1995 and 2008, a total of 27 E. coli O157:H7 outbreaks were linked to leafy produce (69), including the two major multi-state E. coli O157:H7 outbreaks in

2006 (Table 2.1), which involved contaminated spinach (268) and lettuce (36). In 1996, E. coli O157:H7 contaminated radish sprouts caused a huge outbreak in primary schools in

Sakai, Japan (265). The total number of symptomatic patients was estimated to be

12,680 (77), which made it one of the most devastating foodborne outbreaks in recorded history.

2.1.5 Subtyping methods for E. coli O157:H7

In order to identify the sources and routes of transmission of E. coli O157:H7 into the food supply, a variety of subtyping methods were developed. Subtyping is defined as the process of characterizing bacteria to the strain level (236). In addition to its application in epidemiologic investigations, subtyping is also used to study the long-term

evolutionary history and population genetics of bacteria. A few criteria proposed to

evaluate subtyping schemes include discriminatory power, an estimate of the ability to

differentiate between two unrelated strains (105); epidemiologic concordance, the

probability that epidemiologically related strains derived from presumably single-clone

outbreak(s) are determined to be similar enough to be classified into the same clones

(236); reproducibility, the proportion of strains that are typed the same on repeat testing (105); typeability, the proportion of strains that are assigned a type by that subtyping method (236). Among them, discriminatory power and epidemiologic concordance are the most two important criteria. A balance between them should be achieved so as to best serve the specific goal of the study. 10

2.1.5.1 Pulse-field gel electrophoresis

Pulse-field gel electrophoresis (PFGE) was originally described by Schwartz and

Cantor in 1984 for the separation of large DNA fragments of yeast up to 2000 kb (219).

The process involves digesting bacterial genomic DNA using a rare-cutting restriction

endonuclease (typically XbaI or BlnI for E. coli O157:H7), and separating the agarose-

imbedded DNA fragments in an electric field whose orientation is changed periodically

(106). Due to great discriminatory power, PFGE remains the gold standard approach for

subtyping E. coli O157:H7 in epidemiologic studies (72, 106, 239). The establishment of

PulseNet (the National Molecular Subtyping Network for Foodborne Disease

Surveillance), which facilitated the sharing of database, and the increasing number of

participating laboratories throughout the world both added to the merit of this method

(106, 239, 240).

However, problems with PFGE have also been reported, and most criticisms arise

from unstable banding patterns, as a single genetic event may cause up to a three- fragment change in PFGE banding pattern (83). Shima et al. reported continual shifts in

PFGE patterns when three E. coli O157:H7 strains were analyzed over the course of repeated subculture and prolonged storage (226). A similar observation was made by

Iguchi et al., who inoculated cattle with E. coli O157:H7 and isolated this pathogen from feces over 45 days (279). As a result, 12 distinct PFGE profiles were identified and deletion of chromosomal regions were indicated as the cause (279).

2.1.5.2 Octamer-based genome scanning and Lineage-specific polymorphism assay 11

Octamer-based genome scanning (OBGS), first proposed in 1999, is a large-scale

genome comparison method based on the analysis of the banding pattern of PCR

products generated using overrepresented octamer sequences as primers (122). Studies

using OBGS revealed two ecologically and epidemiologically distinct lineages of E. coli

O157:H7, designated Lineage I and Lineage II. Strains of Lineage I were more frequently isolated from humans than Lineage II strains (122, 123). In 2004, the lineage-specific

polymorphism assay (LSPA) was developed as a more efficient alternative to the laborious OBGS typing. LSPA is based on amplifying six loci in E. coli O157:H7 genome that results in different sized amplicons between the two lineages (277). The application of LSPA revealed another major lineage, Lineage I/II, which is also more likely be isolated from humans (96, 282).

Ever since then, many studies have investigated the genomic diversity among different lineages of E. coli O157:H7 (232, 282, 285). Though differences were found in genomic content (232, 282), in phage type (285) as well as in the production of Stx

(tested strains belong to Lineage I or Lineage I/II produce more Stx than Lineage II ones)

(283, 285), no mechanistic explanation has yet been provided to associate genotype with phenotype (i.e. virulence potential). Therefore, further studies are necessary to clarify this.

2.1.5.3 Clade classification system

In 2008, Manning et al. (152) developed an assay that detects single nucleotide polymorphisms (SNP) in 96 loci in the E. coli O157:H7 genome and applied it to > 500 12

clinical isolates. This system separated these isolates into 9 distinct clades that varied by

Stx genes as well as clinical severity. Particularly, they identified that patients infected with strains belonging to clade 8, which includes the two strains individually related to the 2006 spinach outbreak (268) and lettuce outbreak (36), had significantly higher incidences of HUS than those infected with strains of other clades (152). Recent studies

suggested that clade 8 is a subset of Lineage I/II (96, 144). A quantitative PCR (qPCR)-

based method whose result depends on a single SNP pattern was developed for quick

identification of clade 8 strains (197).

A few subsequent studies compared the strains belonging to different clades.

Abu-Ali et al. (2, 3) reported higher expression of virulence genes, including Stx2, and

enhanced adhesion to epithelial cells in clade 8 strains, compared to others. However,

this trend was not observed when a larger panel of E. coli O157:H7 isolates were tested

(173). The possible link between genetic diversity and epidemiology of E. coli O157:H7

still remains to be elucidated.

2.1.6 Pathogenesis and virulence factors of E. coli O157:H7

EDL933 (190) and Sakai (97) were the first two E. coli O157:H7 strains to be fully sequenced. Both of them have genomes of 5.5 megabases (Mb), and share a 4.1 Mb

‘backbone’ sequence with the E. coli laboratory strain K-12 MG1655 (97, 190), whose genome is 4.6 Mb in size (21). The 1.4 Mb O157:H7-specific DNA (97, 190) encodes

around 1500 genes (273), which are distributed throughout the genome. These regions

are referred to as ‘O-islands’ in EDL933 (190) and ‘S-loops’ in Sakai (97). Subsequently, 13

the genomic content of many E. coli O157:H7 strains has been investigated with various methods including microarrays (115, 183, 280, 282), whole genome PCR scanning

(WGPS) (183, 187), optical mapping (125), and whole genome sequencing (66). These studies revealed remarkable diversity in gene composition among E. coli O157:H7 strains, particularly within the prophage regions (66, 183, 273).

Most of the characterized virulence-related E. coli O157:H7 genes are located within these O-islands or S-loops (97, 190). These include the genetic elements that are necessary for the development of HC and HUS, including the locus of enterocyte effacement (LEE), Shiga toxins and enterohemolysin (34). These virulence factors are commonly located on mobile genetic elements including prophage, integrative elements and plasmids that were acquired by E. coli O157:H7 through horizontal gene transfer (1,

34, 66, 269).

2.1.6.1 The Locus for Enterocyte Effacement

LEE is encoded within a pathogenicity island that is found in E. coli O157:H7, enteropathogenic E. coli (EPEC) (154, 155, 171) and a mouse pathogen Citrobacter rodentium (53). The term pathogenicity island refers to large genomic regions ( ≥ 10 –

200 kb) that were acquired by horizontal transfer, and contribute to the rapid evolution of bacterial virulence (56). Features commonly used to define pathogenicity islands include: a GC percentage distinct from the rest of the chromosome, being flanked by direct repeats and encoding mobility-associated genes (56, 79). Pathogenicity islands often insert into tRNA loci of the chromosome (94), and the one encoding LEE in E. coli 14

O157:H7 is integrated at the tRNA gene selC (97). LEE facilitates the intimate adherence

between bacteria and epithelial cells and the effacement of microvilli, which is referred

to as the attaching and effacing (A/E) lesion (59). The protein products of LEE include an

outer membrane protein (intimin), a type three secretion system (T3SS) and secreted

effector proteins (74). In the process of LEE-mediated A/E, the T3SS forms a molecular

syringe that translocates secreted proteins from the bacterial cytoplasm to the epithelial

cell membrane. Translocated intimin receptor (TIR) is one of these secreted proteins. It

incorporates into the epithelial cell membrane and its domain exposed on the cell

surface acts as the receptor of intimin, leading to the intimate attachment of bacteria

(45, 52). Meanwhile, through the cytoplasmic domains of TIR, the binding of intimin and

TIR triggers a marked rearrangement of the host actin cytoskeleton into pedestals

beneath the adherent bacteria, which disrupts the structure of the eukaryotic cell (90,

255).

LEE comprises 5 major operons, LEE1, LEE2, LEE3, LEE4 and tir (LEE5), and these

operons are subject to complex regulatory mechanisms. In both EPEC and EHEC, ler is

the first gene of the LEE1 operon and is essential in activating the transcription of both

LEE2 and LEE3 operons (231). Meanwhile, many other LEE regulators, such as pch genes

(101, 114, 276), psr genes (250), and rgdR (71), are carried by prophage integrated at

distant locations in the genome. Of note, the positive regulator pchB (ECs2182 of Sakai,

GenBank accession number: BA000007) (114) and negative regulator psrC (ECs2191)

(250) are both encoded within prophage Sp11. This prophage will be the focus of

Chapter Four. 15

LEE-dependent mucosal adherence is essential for E. coli O157:H7 colonization of cattle, sheep and other species, and intimin plays an important role in this process (60,

156). Donnenberg et al. (60) reported that the E. coli O157:H7 carrying the intimin- encoding eae deletion mutation was defective in inducing f-actin accumulation in HEp-2 cells and was incapable of attaching intimately to colonic epithelial cells. Using ferrets as an animal model, Woods et al. (271) reported that E. coli O157:H7 containing an intact eae gene caused significantly greater weight loss than the isogenic eae- strain. Through

intimate attachment, intimin enhances intestinal colonization, increases bacterial counts

in the colonic contents and feces and prolongs fecal shedding of the organism (50).

Proteins called Esp (E. coli-secreted protein) are also expressed by genes within

LEE and play major roles in the development of the A/E lesion. For example, espA

encodes a filament that is connected to the T3SS syringe. Together they form the

physical conduit between the bacterium and the infected eukaryotic cell surface (124).

At the distal end of this conduit, EspB and EspD make 3 to 5 nm pores in the host

epithelial cell membrane, which makes the protein translocation and the formation of

A/E lesion possible (82, 270). EspG is involved in intestinal colonization (65); MAP

localizes to mitochondria (121); and EspF contributes to the disassembly of intestinal

epithelial cell junctions (157). Recent studies have identified T3SS effector proteins that

are outside of the LEE (non-LEE-encoded effector, Nles) (247). Among them NleG

represents a well-documented protein family, which demonstrates autoubiquitination activity in vitro (272). Interestingly, the majority of Nles are encoded within mobile genetic regions such as prophage (247). 16

2.1.6.2 Shiga toxins

Shiga toxins are the critical virulence factors in E. coli O157:H7 and other STEC,

and are necessary for the development of HUS in patients (221). The prophage-encoding

toxins comprise two allelic types, Stx1 and Stx2 (235), which share ca. 55% in amino acid sequence identity and are immunologically distinct (93, 131, 160). Stx1 is identical to the

Shiga toxin carried by S. dysenteriae type 1 (179), while Stx2 variants are found in E. coli strains only. Basing on minor differences in their nucleotide sequences, the stx2 family is further divided into stx2, stx2c, stx2d, stx2e and stx2f (16, 17). Among them, stx2 and stx2c are most commonly found in the isolates from human (16, 66, 96, 152), and E. coli

O157:H7 isolates belong to clade 8 tend to encode both of them (152). The effective dose at which Stx2 inhibits protein synthesis is lower than that of Stx2c, suggesting a higher potential for Stx2 to cause diseases (78).

Both Stx1 and Stx2 have A1B5 structures. The 32 kDa A subunit is non-covalently associated with a pentamer of B subunits (7.7 kDa each). The B subunits of the toxin mediate the binding to the specific glycolipid receptor, globotriaosylceramide (Gb3).

Next, a receptor-mediated endocytic mechanism internalizes the toxin molecules. The enzymatically active subunit A cleaves a specific adenine base from eukaryotic 28S rRNA, which stops protein synthesis and causes cell death (34).

Microvascular endothelial cells tend to express more Gb3 receptors and are highly susceptible to Stx (180, 185). Stx internalized into renal microvascular cells including glomerular endothelial, mesangial (200) and tubular epithelial cells (253) can 17

induce inflammation (153) and further lead to endothelial blood cell interaction and

platelet thrombosis (205). These processes all account for the complex characteristics of

HUS.

2.1.6.3 pO157

Most E. coli O157:H7 possess a virulence plasmid termed pO157. The pO157 is a

non-conjugative F-like plasmid of approximately 92 kb in size (31, 278). Curing this plasmid compromises biofilm formation ability of E. coli O157:H7 (141), as well as colonization of the bovine rectoanal junction mucosa (11, 142, 225). A regulatory effect of pO157 on chromosomal genes has also been suggested (142).

Among approximately 100 pO157-encoded genes, 19 are putative virulence genes (31). For example, the RTX-family-toxin enterohaemolysin (E-hly) is encoded in the hly operon of pO157. This toxin contributes to haemolysis (93), and hemoglobin release after erythrocytes lysis can serve as an iron source for E. coli O157:H7 (132). toxB is another virulence gene commonly carried on pO157 (249). It is involved in

adherence through regulating the expression of LEE-encoding type III secreted proteins

(243). Other documented virulence factors include KatP, a catalase peroxidase that

provides bacteria with a defense mechanism against oxidative stress from host immune

cells (29), and EspP, a protease that cleaves pepsin A and human coagulation factor V,

which contribute to the development of HC (28).

18

2.2 Bacteriophage in E. coli O157:H7

2.2.1 An overview of bacteriophage

A bacteriophage (from bacteria and Greek phagein ‘to devour’) is a virus that infects bacteria. Most phage contain double-stranded (ds)DNA, but there are small phage groups with single-stranded (ss)DNA, ssRNA or dsRNA as their genetic materials.

The genetic material is then enclosed by an outer protein capsid that may or may not

contain lipid. So far a total of one order, 13 families, and 31 genera of phage have been recognized; and great diversities in morphology and physiology have been seen among them (32).

Not all phage kill their susceptible host upon infection. Once injected inside the bacterium, the nucleic acid of certain phage can integrate into the host’s genome, and thus divide and replicate along with the chromosome. This process is defined as

“lysogeny”, or the “lysogenic cycle”. Bacteria harboring the latent phage are “lysogenic”, and the latent form of the phage is called a “prophage”. Phage that can enter such a latent state are called “temperate”, though they are also referred to as “lysogenic” in the literature. A later event, typically associated with damage to the bacterial cell’s DNA, which induces the SOS response, can lead to the derepression of the prophage genome.

This remarkable “lytic cycle” is featured by the replication of the phage genome, expression of the viral coat proteins and the lysozyme for bacterial cell lysis. Eventually, the lysozyme destroys the bacterial cell wall and allows the newly formed phage particles to escape and renew their growth cycle in other bacteria (32, 230). 19

The lambda family is among the best studied temperate phage. Figure 2.1 illustrates the two distinct life cycles of lambda-like phage. The integration of λ into the

E. coli chromosome occurs by recombination between two unique sites on the phage

(attP) and bacterial chromosomes (attB), and is catalyzed by the phage-encoded integrase (Int) (75). The attP sequence and the corresponding attB sequence usually share some sequence identity. For lambda phage, the attB sites are typically 20-30 bp in length and exhibit an imperfect interrupted dyad symmetry. Since such structures are presented by the chromosome-encoded tRNA genes in their anticodon loop, these tRNA genes can be ideal crossover points for the phage DNA. Indeed, very often the lambda prophage are found inside tRNA genes (33). In addition to the homology between attP and attB, their pairing must be recognized by the specific Int to initiate the recombination (33, 207). This explains why prophage encoding homologous Int are usually found in similar insertion sites.

20

FIG. 2.1. The lysogenic and lytic cycles of lambda-like phage. Acquired from http://allbiologytutorsup.blogspot.com/.

Apart from those fully functional prophage that can be induced into the lytic cycle, bacterial genomes are known to encode 4 additional types of prophage-related entities. i) Defective prophage (sometimes called ‘cryptic prophage’) are in a state of mutational decay. ii) Satellite phage, are prophage that do not carry their virion structural protein genes, and have chromosomes which have been evolutionary designed to be encapsidated by the capsid protein from other specific phage. iii) Phage tail-encoding genetic loci are utilized by the host as bacteriocins to kill other bacteria. iv) gene transfer agents are tailed phage-like particles that encapsidate random fragments of the bacterial genome (35). Interestingly, the potential interaction between different 21

prophage in the same host blurs the boundary between “fully functional” and “defective” phage. For instance, E. coli O157:H7 encodes a total of 18 prophage, of which 11 belong to lambda family. Though in silico analysis suggested that most of these prophage carry major genetic decay, many still excise, undergo packaging, and can be transduced to a recipient (9).

2.2.2 stx-encoding phage

Whole genome sequencing identified 18 prophage or phage remnants in both E. coli O157:H7 strains Sakai and EDL933, including the two that encode Stx1 and Stx2 (97,

190). Typically, E. coli O157:H7 strains carry one or two stx-encoding prophage (16, 17,

66). These lambda-like prophage range from 48 to 62 kb in size (151, 192, 212). The locus yehV, encoding a transcriptional regulator, is the preferred integration sites for

stx1-encoding phage, while wrbA, which encodes a Trp repressor binding protein, and

argW, a tRNA gene, are favored by the stx2-encoding phage (66, 222). The exposure to

antibiotics (86), H2O2 or neutrophils (259) triggers the lytic cycle of these phage and

results in increased Stx production (see below). This is why the use of antibiotics in

treating E. coli O157:H7 infection is contraindicated.

Sequencing of stx-encoding phage revealed a mosaic structure and high variability in gene content (116). For example, the two stx1-encoding phage of Sakai and

EDL933, VT1-Sakai and 933V, respectively, are very distinct from each other in DNA sequence (97, 190). In contrast, the stx2-encoding phage from these two strains, VT2-

Sakai and 933W, are highly conserved in their lytic cycle-related genes but less similar in

their lysogenic cycle-related genes (30, 151). On the other hand, prophage encoding 22

stx1 and stx2 from O157:H7 strain Morioka V256 are nearly identical except for the stx-

flanking regions (212). These results suggested the complex evolution of the stx-

encoding phage family.

2.2.2.1 VT2-Sakai: an example of a stx2-encoding phage

VT2-Sakai is the stx2-encoding prophage carried by E. coli O157:H7 Sakai.

Sequencing of VT2-Sakai identified a total of 90 open reading frames (ORFs) (151). Like

other lambdoid phage, VT2-Sakai encodes the transcriptional anti-terminator Q and cis-

acting DNA elements such as late promoter PR’, qut, terminators tR1’ and tR2’. This

suggests that the late gene transcription is activated by the anti-termination function of

Q, a critical step in the lytic cycle of lambda (30, 35, 151, 261).

In this system, bacterial DNA damage caused by certain physical or chemical

agents results in an SOS response, which leads to increased production and activation of

RecA. Activated RecA facilitates the autocleavage of a repressor protein CI, which

initiates the expression of protein N and then protein Q. The binding between Q and qut

site eventually allows PR’-initiated transcription through the terminator region (tR1’, tR2’)

(Figure 2.2). PR’ regulates the expression of lytic cycle-related genes including S (holin), R

(endolysin), as well as other late genes including stx2AB. The activation of PR’ will thus

lead to the production of viable phage, as well as Stx2, and lysis of the host cell (30, 35,

151, 261).

23

FIG. 2.2. Regulation of the VT2-Sakai life cycles. (a) Repressed prophage: In lysogenic cycle, CI represses transcription from PL and PR, and Q is not expressed. In the absence of Q, transcription from PR’ terminates at the downstream terminator (tR1’, tR2’). (b) Induced prophage: SOS response of the host activates RecA, which stimulates CI autocleavage. Activation of PL allows the transcription of N, which facilitates the expression of anti-terminator Q. Q binds the qut site in the DNA and then transfers onto the initiating RNA polymerase. This modification on RNA polymerase complex allows the transcription through terminator (tR1’, tR2’) and thus starts the expression of late genes including stx2AB. Red question mark indicates that the promoter and the terminator for ileZ2-argN2-argO2 operon have not been experimentally characterized. This scheme is adapted and simplified from Figure 1 of Phage regulatory circuits and virulence gene expression by Waldor and Friedman (262). Permission of using this figure was obtained from the publisher.

24

However, RecA-independent spontaneous induction also occurs in stx2-encoding phage (145). Free stx2-encoding phage particles were observed in the culture of 933W lysogenized recA-negative E. coli strain DH5α (110). The stability of CI depends on a complicated kinetics, and is affected by many factors (10); yet if CI levels are sufficiently reduced, phage lytic cycle ensues. It should be noticed that it is the degradation of CI rather than a leaky nature of the PR’ system that results in the spontaneous induction of the phage (145).

stx2AB is the first set of ORFs downstream of the VT2-Sakai PR’ (Figure 2.2), and the same observation has been made with all sequenced stx2-encoding prophage so far

(66, 184, 192). Studies using stx2-encoding prophage 933W (227) and Φ361 (261) as models indicated that the transcription of stx2AB depends exclusively on the phage late promoter. Given the high similarity in DNA sequence and genetic components between lytic cycle-related regions of VT2-Sakai and 933W, the same theory should also apply to

VT2-Sakai. Stx2 is released to the extracellular fraction because host lysis occurs simultaneously. On the other hand, stx1 genes are found under control of iron- dependent promoters in stx1-encoding phage (227, 260).

Another interesting characteristic of VT2-Sakai is the ileZ-argN-argO tRNA gene operon in between pR’ and stx2AB (Figure 2. 2) (151). This operon is proposed to encode tRNAs that recognize codons ATA (ileZ), CGA (argN) and AGA and AGG (argO)

(151, 192), which are the four rarest codons in the whole Sakai genome (97). A putative promoter and a putative terminator were suggested at the 5’ end of ileZ and at the 3’ 25

end of argO, respectively, suggesting that this tDNA operon regulates its own expression

(151). However, transcription from this putative promoter has not yet been reported.

2.2.2.2 The role of stx-encoding phage in the pathogenesis of E. coli O157:H7

As discussed above, the Stx released from the bacteria spontaneously or under induced condition is the primary concern after E. coli O157:H7 infection. In addition, the stx-encoding phage are likely to play more profound roles in the pathogenesis of E. coli

O157:H7.

In 2001, Strauch et al. reported that the stx-encoding phage from a Shigella sonnei strain is capable of lysogenizing non-toxigenic S. sonnei and laboratory E. coli K-

12 strains, thus converting them into Stx-producing strains (234). Later in 2004, Muniesa et al. identified great diversities in host range, infectious frequency and transduction efficiency when testing a collection of stx-encoding phage from different E. coli O157:H7 isolates (166). Using E. coli K-12 phage-cured strain C600 as a host, Gemage et al. demonstrated that stx2-encoding phage 933W could cause lytic infection, and therefore result in an accumulation of Stx2 as well as the infectious phage particles (80).

Interestingly, the authors suggested that this could explain why some sick individuals progress to more advanced stages of the disease, as they may carry gastrointestinal flora that is susceptible to phage lytic infection, which amplifies toxin production, while others do not, due to their resistant gut flora (80).

Some other researchers have also examined the stx-encoding phage-mediated transduction events under more “real world” conditions using segments of mammalian 26

intestinal tract. Acheson et al. (4) found that a constructed stx1-encoding phage

transduced susceptible strains in the murine intestinal tract and that these new

lysogenic bacteria could produce new infective particles. Other in vivo experiments

examining the rate of transduction within E. coli populations suggest that it may be even

higher than the in vitro literature rates, as conditions in vivo may be more conducive to

transduction events (248). Therefore, it is suggested that in the course of E. coli

O157:H7 infection, apart from the Stx directly produced by this pathogen, the released

stx-encoding phage are also like to convert the commensal E. coli into Stx-producing;

however, more research is needed to confirm this hypothesis.

2.2.2.3 Quantification for stx-encoding phage

Given the importance of stx-encoding phage, many methods have been

proposed for their quantification. Some of the most common methods are listed below.

2.2.2.3.1 Plaque assay

Plaque assays are regarded as standard method for phage quantification (210).

Being able to enumerate infectious (live) virions is a very important merit of this method.

However, its application for stx‐encoding phage is limited, because of their often poor

plaque-forming ability (148, 166, 202). This is because stx-encoding phage, especially

short-tailed stx2-encoding phage, enter the lysogenic cycle at a very high frequency

(113). Even though lytic infection still occurs, the plaques are very often too small to be visible since the newly produced phage cannot efficiently lyse their surrounding indicator bacteria. Therefore, two approaches have been used to improve plaque formation. One is to include antibiotics like ampicillin (148) or cefotaxime (42) at a sub- 27

inhibitory concentration in the agar to slow down the growth of the indicator bacteria,

which results in an increase in phage burst size. A second strategy involves using the

SOS-inducing agent mitomycin C to prevent the lysogenization of stx-encoding phage

and/or compel the phage to follow the lytic cycle (113). However, neither method has

been reported to be applicable to a diverse collection of stx-encoding phage.

Additionally, E. coli O157:H7 encoded other prophage that belong to lambda (9),

P2 or P4 family (K. Goswami, C. Chen, and E. G. Dudley, ongoing project). These prophage can also be induced after antibiotic treatment. Therefore, the counts of clearance from plaque assays for lysate of E. coli O157:H7 may not specifically indicate the quantities of stx2‐encoding phage.

2.2.2.3.2 Electronic microscopy

Electron microscopy is another approach in phage quantification (24). This

method was also used by Imamovic et al. as a justification for their quantitative PCR

(qPCR)-based stx-encoding phage enumeration method (111) (see below). However, this

method is laborious and a communication with Missy Hazen at the Penn State

Microscopy and Cytometry Facility (University Park, PA) suggested that confounding

variables can be easily introduced into the complex sample preparation process, which

would impair the accuracy and consistency of this method.

2.2.2.3.3 Quantitative PCR

Quantitative PCR (qPCR) is a polymerase chain reaction-based laboratory technique for quantifying a targeted DNA molecule. It measures the number of cycles 28

needed for the DNA product to accumulate to a designated level, and thus convert this

information to the relative quantity of the template present in the reaction. Soon after the emergence of this technique, qPCR was used for phage enumeration (63). Accuracy

and efficiency both add to the merits of this method. More recently, qPCR‐based

quantification methods have been applied to stx‐encoding phage (111, 202). However,

both published protocols (111, 202) required using extracted phage DNA as template,

which involves steps such as phage precipitation and organic extraction of DNA;

however, these steps can potentially affect the repeatability of the assay. Meanwhile, the tedious procedure for phage DNA extraction also limited the application of this method as a high throughput way for quantifying stx‐encoding phage. In Chapter Three I

propose a method to simplify qPCR quantification of stx2-encoding phage.

2.2.3 Phage in the phylogeny of E. coli O157:H7

2.2.3.1 The evolution of E. coli O157:H7

Based upon a sequence analysis of uidA genes, Feng et al. proposed that E. coli

O157:H7 serotype was derived from E. coli O55:H7 (70). This model was also supported

by a study analyzing SNPs throughout the backbone genomes of an E. coli collection

including O157:H7, O157:H- and O55:H7 (138). Though many details are still missing,

phage are found to played important and interesting roles in the evolution (Figure 2.3).

29

FIG 2.3. Model for the evolution of the main clusters of E. coli O157:H7. Blue cycles depict main clusters of different E. coli strains. Orange curves or lines show the inter- and intra- cluster evolutionary events. The hypothetical strains (cluster founders) are shown in green, while the existing isolates are shown in red. The scheme is adapted and simplified from Figure 1 of A precise reconstruction of the emergence and constrained radiations of Escherichia coli O157 portrayed by backbone concatenomic analysis by Leopold et al. (138). Permission of using this figure was automatically granted by the publisher. Some other publications were referred to for minor modifications (66, 130, 284).

At least 2 different types of stx2-encoding phage contributed to the emergence of E. coli O157:H7 (138). That is why the stx2-encoding phage are found in wrbA locus and argW locus in lineage I strains (EDL933 and Sakai) and lineage I/II strains (EC4115 and TW14395), respectively (66). Indeed, the integrase used by these two types of phage are phylogenetically unrelated (66). On the other side, the founder of O157:H7 cluster 3 (Figure 2.3) is considered to be the first E. coli O157:H7 which carries a stx1- 30

encoding prophage in its yehV locus. Before the emergence of this cluster, yehV was

occupied by a truncated prophage remnant which did not encode stx1. Therefore, it is

plausible that stx1 was acquired by cluster 3 O157:H7 by homologous recombination rather than by direct phage integration (138).

In addition to the stx-encoding phage, many other prophage were acquired by E. coli O157:H7 during its evolution. For example, 6 out of Sakai’s 18 prophage are absent in its O55:H7 counterpart CB9615 (284). Noticeably, many non-LEE-encoded type III secretion effectors are found within these newly acquired prophage (247).

In their 2009 publication, Ogura et al. constructed a neighbor-joining tree using concatenated nucleotide sequences of 345 orthologous genes from 25 fully sequenced E. coli strains in a variety of serotypes. The tree revealed remarkably distinct evolutionary histories of these EHEC strains. In contrast, analysis of the entire gene repertoires clustered all E. coli O157:H7 and non-O157 STEC together. Therefore, it was proposed that STEC of different serotypes underwent convergent evolution, and acquisition of similar phage was identified as one of the major driving forces in this process (184).

2.2.3.2 Prophage regions as hot spots for genomic rearrangements

High discriminatory power has been seen with XbaI PFGE when subtyping E. coli

O157:H7. Kudva et al. (128) reported that the observed pattern diversities among E. coli

O157:H7 strains are caused by discrete insertions or deletions of segments of DNA in the

genome, rather than point mutations in the XbaI sites. They also reported that the

majority of genomic differences among E. coli O157:H7 strains occurred in O-island 31

sequences, suggesting that phage-associated events were responsible for this diversity

(128). Ohnishi et al. (186) analyzed the genomic structure of E. coli O157:H7 strains by whole-genome PCR scanning, and revealed that a high level variation occurred in the prophage among the E. coli O157:H7 chromosomes, while the backbone DNA was highly conserved between the strains. Wick et al. (269) reported similar conclusions using a

DNA array-based approach. These results confirmed that prophage are the most dynamic genetic elements in E. coli O157:H7.

The influence of prophage on the instability of the E. coli O157:H7 genome was also observed when PFGE was applied to a single strain over a time course. Shima et al.

(226) reported continual shifts in PFGE patterns over the course of repeated subculture and prolonged storage. A similar observation was made by Iguchi et al. (107), who inoculated cattle with a single E. coli O157:H7 strain and identified 12 distinct PFGE profiles over the following 45 days. Homologous recombination-mediated spontaneous excision and rearrangements within prophage regions were identified as causing these differences.

In addition to the excisions within prophage region, spontaneous excision of phage-like elements were also observed in E. coli O157:H7. Strain EDL933 contains two identical 87 kb phage-like elements, O-island 43 and O-island 48 (Sakai has only one copy, designated SpLE1). Bielaszewska et al.(18) reported complete excision of O-island

43 and O-island 48 at 1.81×10-3 and 1.97 ×10-4 in culture, respectively, due to the recombination between the direct repeats flanking these islands. More importantly,

because each O-island encodes tellurite resistance, as well as the adhesion and 32

siderophore receptor Iha, the excision of the O-islands would compromise resistance to tellurite and the adherence of the host bacteria to human intestinal epithelial cells (18).

This example demonstrated the profound influence of prophage or phage-like element- mediated genomic rearrangement on the biology and pathogenesis of E. coli O157:H7. 33

2.3 Rare codon tRNAs

2.3.1 An overview of codon bias

Transfer RNA (tRNA)-mediated translation, from the tri-nucleotide genetic codon

to an amino acid, is one of the essential components of the central dogma of molecular

biology (46). Apart from the three stop signals, there are most commonly 61 different triplet codon combinations that are each assigned to one of the twenty amino acids.

However, the usage of synonymous codons is biased in bacterial genomes, and importantly, the abundance of cognate tRNA is proportional to the frequency of codon usage (58, 118). The codons present at relatively higher concentrations (major codons) are preferred by the highly expressed proteins of rapid growing bacteria (108, 109). On the contrary, less frequently used codons are referred to as “rare codons” or “minor

codons” (224). Due to limited availability of charged cognate tRNAs, protein translation

may slow down at rare codons. This results in the stalling of ribosomes at rare codons and the release of peptidyl-tRNA (37, 47).

Factors contributing to codon selectivity include i) codon/anticodon interaction strength. Efficient translation requires intermediate codon/anticodon interaction strength (optimal energy) rather than very strong or very weak ones (89). ii) site-specific codon biases. Different synonymous codons are used in the same gene to avoid saturation of one particular codon (228) iii) time of replication. Chromosomal regions distant from replication origin are more AT-rich than early replicating regions, which

limits the choice of codon (54). iv) codon context. The frequency of one codon is

affected by the compatibility of adjacent tRNA isoacceptor molecules on the surface of a 34

translating ribosome (112). v) Evolutionary age. The recently imported genes (mostly

through horizontal gene transfer) may show divergent codon usage from the host gene

repertoire (97, 134, 159, 184). Indeed, Medigue et al. divided 780 genes of E. coli into 3 classes based on their codon usage. Correlation between codon usage and the level of gene expression was observed in two classes, and the authors suggested that the genes of the third class were introduced into E. coli genomes by recent horizontal gene transfer (159). Similar diversities in codon bias between backbone genes and those acquired through horizontal gene transfer was also observed in sequenced STEC genomes (97, 184) .

2.3.2 Rare codon and bacterial virulence

Codon bias, together with the availability of tRNA isoacceptors, is part of an evolutionary strategy to control the expression rate of certain genes, to optimize the efficiency of translation, and consequently, to maximize their growth rates (58, 64, 129).

The effect of such post-transcriptional regulation becomes more significant when the

rare codons are used within the first 25 codons from the initiation codon and when

tandem rare codons are used (37, 47). Indeed, certain transfer RNAs are considered as

possible regulatory molecules participating in the regulation of gene expression at the

post-transcriptional level (139, 209). Najafabadi et al. proposed that bias on gene codon

usage and control of tRNA isoacceptors availability are bacterial strategies to regulate

protein translation efficiency in response to environmental and physiological changes

(169). Table 2.3.1 summarized some examples of tRNA-dependent gene expression in

bacteria. The availability of rare codon cognate tRNA can also be important for the 35

expression of virulence factors of some pathogens. Two notable examples of how rare

codons affect the expression of virulence genes in E. coli and Salmonella are discussed below. 36

Table 2.2 Examples of tRNA-dependent gene expression in bacteria*

Amino acid Function Organism Codon Reference specificity GCU Ala Photosynthesis Rhodobacter capsulatus (274) GUC Val AAU Asn Fructose utilization R. capsulatus (274) UGU Cys Production of acetone Clostridium acetobutylicum ACG Thr (213) and butanol Production of aerial Streptomyces coelicolor, S. UUA Leu (92, 133, 244) mycelium, conidiospores lividans, S. alboniger UCU Ser Expression of type 1- Salmonella Typhimurium, AGA Arg (41) fimbriae S. Enteritidis AGG Arg AGA Arg (38) Global gene expression E. coli AGG Arg (37) Expression of type 1- fimbriae-, enterobactin E. coli 536 (uropathogenic) UUG Leu (198, 199) and flagella serum resistance, virulence Persistence in stationary phage in cecal or bladder E. coli F-18, E. coli 536 UUG Leu (55, 175) mucus of CD-1 mice UCA Ser (242) UCG Ser (39, 136) Cell division E. coli CUA Leu (170) UUG Leu DNA-Replication E. coli AGA Arg (81) Resistance to calmodulin- E. coli CUA Leu (25, 39) inhibitor Temperature sensitivity E. coli CUA Leu (25, 39) AUG Met Production of protease Pseudomonas syringae CUU Leu (195) and syringomycin CUC Leu Virulence Shigella flexneri CUG Leu (103) UAC Tyr *: This table was reproduced from Influence of the leuX-Encoded tRNA5 Leu on the

regulation of gene expression in pathogenic Escherichia coli by Dobrindt et al. (57). Permission of

using this figure was obtained from the publisher. 37

2.3.2.1 The influence of leuX on the virulence of uropathogenic E. coli

Uropathogenic E. coli (UPEC) is a genetically heterogeneous pathotype of E. coli

that is the most common cause of urinary tract infections (73). The UPEC strain 536

carries two pathogenicity islands, Pai I and Pai II. The 109 kb Pai II comprises the P-

related fimbriae (prf), and is integrated into an ancestral leucine-cognate tRNA gene

leuX. The 3’ end of this tRNA gene was duplicated during the integration, therefore a

copy of leuX remains intact at one end of Pai II. However, a two-nucleotide deletion has

occurred to the non-coding 3’ end fragment of leuX at the other end of Pai II. Therefore, the spontaneous deletion of Pai II, of which the frequency is relatively high (10-3 - 10-4),

leads to the truncation of leuX. This mutation decreases the production of the type 1

fimbriae of UPEC 536, which is essential for motility, enterobactin production, serum

resistance and in vivo virulence in this pathogen (22, 198, 238).

The tRNA encoded by leuX recognizes the rare leucine codon UUG. Its expression facilitates the translation of fimB and fimE, which contain 5 and 2 UUG codons, respectively. Interestingly, FimB positively regulates the expression of type 1 fimbriae- encoding fimA while FimE is a negative regulator. Since the loss of leuX affects the translation of FimB more than FimE, this leads to a reduction in fimA transcription (199).

Also, an experiment using two-dimensional polyacrylamide gel electrophoresis revealed about 39 different intracellular proteins whose expression was markedly altered as a result of the deletion of leuX. These data collectively demonstrated the important role of a minor tRNA gene in the expression of a broad variety of genes in E. coli (191).

2.3.2.2 The influence of fimU on the virulence of S. enterica serovar Typhimurium 38

Type 1 fimbriae also contribute to the pathogenicity of S. enterica, as these

fimbriae have been found to aid in the binding to and the invasion of human epithelial cells (14). These proteinaceous appendages have been implicated in the initiation and persistence of infections in vivo (68). In S. Typhimurium, structural genes that encode type 1 fimbriae are all clustered together in one operon and this operon also carries 3 regulatory genes (fimZ, fimY and fimW) and a tRNA gene fimU, which recognizes the rare arginine codons AGA and AGG. Interestingly, the positive regulator fimY contains a total of 5 rare arginine codons and 3 of them are found within the first 14 codons after the initiation codon (245, 246). Tinker and Clegg (242) reported that plasmid-encoded fimU was required to complement the overexpression of fimY. This explained the essential effect of fimU on the expression of S. Typhimurium type 1 fimbriae (241).

2.3.3 ileZ-argN-argO tRNA gene operons

Whole genome sequencing of the E. coli O157:H7 Sakai genome revealed different codon usage between the genes encoded in the backbone and those on the S- loops (97). The four rarest encoding codons in the backbone genes (i.e., arginine codons

AGG, AGA, CGA, and isoleucine codon ATA) are more frequently used in the S-loop genes (Figure 2.4). The atypical codon usage in the S-loop genes suggested their foreign source (97). Interestingly, the biased usage of these rare codons between the backbone genome and horizontally acquired genetic regions (including stx-encoding phage and

LEE) is also observed in other sequenced EHEC strains (184, 190).

39

FIG. 2.4. Codon usage analysis of the E. coli O157:H7 Sakai chromosomal genes. The genes were divided into four groups: those in the conserved backbone (conserved), in the prophage carrying tRNA genes (tRNA(+) phages), in the prophage not carrying tRNA genes

(tRNA(−) phages), and in the other S-loops (other loops). Then the codon frequency was calculated for each group. Codons are put in the order of frequency for genes in the conserved backbone. The corresponding amino acids were listed below each codon and asterisks represent stop codons. This Figure was adapted from Figure 3 of Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strainK-

12 by Hayashi et al. (97). Permission of using this figure was obtained from the publisher.

Meanwhile, Sakai encodes a total of 102 tRNA genes, of which 82 are conserved in K-12 but 20 are absent in K-12. Conversely, out of the 86 tRNA genes identified in K-

12, 4 are absent in Sakai (97). Particularly, as discussed in section 2.2.2.1, the ileZ-argN- argO tRNA gene operon in VT2-Sakai was proposed to recognize the four rarest codons 40

(151): ileZ, argN and argO were predicted to recognize ATA, CGA and AGA/AGG,

respectively. Therefore, it has been hypothesized that these putative tRNAs will facilitate the translation of the genes located in the mobile genetic elements (97, 276).

Interestingly, all stx2-encoding phage sequencing studies have suggested the presence

of this tri-tRNA operon between the genes encode Q and Stx2. Therefore it is considered

the first set of transcripts downstream of the phage late promoter (167, 184, 192, 218,

276).

Apart from VT2-Sakai, 6 other lambda prophage in Sakai were found to encode the ileZ-argN-argO operon, though extensive base changes have occurred to three argN cognate tRNA genes (97). Similar observations have also been made in other O157 and non-O157 EHEC strains (184, 190). All O157 and non-O157 EHEC strains fully sequenced

so far carry 5 to 8 prophage that each encode an ileZ-argN-argO operon, while only 2 to

3 prophage that encode this operon were found in other pathogenic E. coli such as

enteroaggregative E. coli (EAEC) and extraintestinal pathogenic E. coli (ExPEC) (66, 184).

On the contrary, to our knowledge, this operon is not found in any sequenced laboratory strains of E. coli (Table 2.3.2). All these observations suggest potential roles for rare codon usage and the presence of the ileZ-argN-argO tDNA operon in the

regulation of EHEC virulence. Chapter Five will investigate the function of this operon.

41

Table 2.3 Copy numbers of ileZ-argN-argO tRNA genes in different E. coli pathogens and commensals

Labora- EHEC EAEC EPEC ExPEC commensal tory MG Strain O157 O26 O111 O103 55989 E2348 CFT073 536 APEC HS SE11 1655

ileZ 7 6 8 (1) 5 3 2 1 0 2 0 0 0

argN 7 (3) 6 (2) 7 (2) 5 (1) 2 (1) 2 (2) 1 0 2 (1) 0 0 0

argO 7 6 7 5 3 2 1 0 1 0 0 0

EAEC: Enteroaggregative E. coli, EPEC: Enteropathogenic E. coli, ExPEC: Extracellular

pathogenic E. coli, APEC: Avian pathogenic E. coli. Number in parenthesis: predicted

pseudogenes. The table was reproduced from the Supplementary Table 6 of Comparative

genomics reveal the mechanism of the parallel evolution of O157 and non-O157

enterohemorrhagic Escherichia coli, Ogura et al., PNAS, 2009 (184). Permission of using this

table was automatically granted by the publisher.

42

2.4 Using streptomycin in E. coli O157:H7 animal study

2.4.1 A brief review of prokaryotic translation

In prokaryotes, the ribosomal complex device contains 2 subunits, each composed of ribosomal RNA (rRNA) and proteins. The large subunit (50S) comprises one copy of the 23S, one copy of 5S rRNA and 31 proteins (designated L1 to L31); while the small subunit (30S) comprises a copy of 16S rRNA and 21 proteins (designated S1 to S21).

The assembled ribosome (70S) has three sites: the A site, the P site, and the E site. The A site is the entry point for the aminoacyl-tRNA (except for the initiation aminoacyl-tRNA, formyl-methionyl-tRNA (fMet-tRNA), which enters at the P site). The P site holds the formed peptidyl-tRNA. And the E site is the exit site of the now uncharged tRNA after it gives its amino acid to the growing peptide chain (230).

Upon the initiation of translation, the fMet-tRNA enters the P site, causing a conformational change which opens the A site for the new aminoacyl-tRNA to bind. This binding is facilitated by elongation factor-Tu (EF-Tu), a small GTPase. Catalyzed by a ribozyme (the 23S rRNA), the fMet is detached from the tRNA at the P site and is bound to the aminoacyl-tRNA in the A site, forming a peptide bond. Now, the A site has the newly formed peptidyl-tRNA, while the P site has an uncharged tRNA. In the next stage, the uncharged tRNA translocates to the E site and thus leaves ribosome, while the peptidyl-tRNA moves from the A site to the P site, allowing the incorporation of a next aminoacyl-tRNA at the A site. The ribosome continues this process and translates the remaining codons on mRNA until it reaches a stop codon (UAA, UGA, or UAG). These 43

nonsense codons are not recognized by any tRNAs. Instead, they are recognized by

proteins called release factors. These factors enter the A site, trigger the hydrolysis of

the ester bond in peptidyl-tRNA, and thus release the newly synthesized protein from

the ribosome. Meanwhile, the 70S ribosome disassociates into the 30S and 50S subunits,

and all components are now free for additional rounds of translation. This completes

the recycling of ribosomes (230).

2.4.2 Streptomycin and streptomycin-resistance

2.4.2.1 An introduction to streptomycin

A variety of ribosome-targeting antibiotics, such as streptomycin, kanamycin, tetracycline and chloramphenicol, are commonly used in biological experiments.

Streptomycin (Str), derived from the actinobacterium Streptomyces griseus, was the first discovered antibiotic drug of the aminoglycosides class (215). Since its first isolation in

1942, Str has been used in the treatment of tuberculosis (43). Str is a protein synthesis inhibitor primarily applied against Gram-negative bacteria. A few different mechanisms have been established to explain the bactericidal effect of Str, and most of them involve inhibition of protein synthesis.

Luzzatto et al. (149) investigated the recycling of ribosomes in cultures treated with Str. They proposed that the normal interaction of sensitive 30S and 50S subunits on mRNA can be altered after adding Str to intact cells. The two subunits are then locked on the 5’ end of mRNA but do not move along the mRNA or synthesize new peptides, which also prevents the recycling of ribosomes. Therefore, as Str traps more and more 44

70S monomer upon translational initiation, the number of free 30S and 50S subunits in the cell decrease until there is only one 70S monomer (yet pseudo-initiation complex) on each mRNA chain. Later, Lelong et al. (137) identified that Str binds to the small 16S rRNA of the 30S subunit of the bacterial ribosome, interfering with the binding of fMet- tRNA to the 30S subunit. In their model, the drug does not inhibit the primary assembling step, during which the fMet-tRNA is positioned on a 30S-mRNA complex, but causes immediate release of fMet-tRNA from the preformed initiation complex.

Misreading of the mRNA is another well-documented mechanism of Str- mediated inhibition of translation. Using cell-free extract from Str-sensitive (Strs) E. coli

strains, Davies et al. (48) showed that Str stimulates the incorporation of isoleucine, and

to a much lesser extent serine and leucine in the translation of synthetic poly U (UUU

encodes phenylalanine). Miscoding was small or negligible with extracts prepared from

Str-resistant (Strr) strains. Using synthetic polynucleotide templates containing two

nucleotides in alternating sequence, Davies et al.(49) further concluded that Str

stimulates the misreading of the first two nucleotides from the 5’ end of the codon, of

only one base at a time, and of pyrimidines more frequently than purines. However,

neomycin, another antibiotic from the aminoglycosides class, promotes the Str coding

errors as well as misreading of the 3'-terminal nucleoside and sometimes of two bases

of a codon at one time. Moreover, they suggested that reading frame shifts is not

always invoked in the Str-induced misreading phenomena. Kinetic explanations for

these observations have been later proposed. It has been shown that streptomycin

lowers the forward rates of GTPase activation, which therefore increases the 45

accommodation for the near-cognate tRNA at the A site, leading to an increased error rate (88, 201).

2.4.2.2 Different streptomycin-resistant mutations in E. coli

Strr bacteria were discovered as soon as this antibiotic was used clinically (162,

174). It was subsequently established that in E. coli, these mutations are mostly

associated with different structural alterations of the 30S ribosomal subunit protein S12

(23, 100). The rpsL-encoded S12 is involved in the inspection of codon-anticodon parings

in the A site, as well as in the subsequent domain rearrangements of the 30S subunit,

which is essential for the accommodation of the new aminoacyl-tRNA (6). Some

mutations on S12 confer bacterial resistance against Str by increasing the accuracy of

the decoding process, yet some others have the same or slightly higher error rates than

normal (23, 233). Basing on their influences on translational error rates, Bohman et al.

divided E. coli Strr mutants into two classes: restrictive and non-restrictive (23).

Error rates of translation in vivo have been estimated to be on the order of 10−3 –

10−4 (127), while in restrictive mutants, Bohman et al. (23) reported a 20% to 70%

decrease of this rate. As mentioned above, Str promotes a suboptimal state for GTP

hydrolysis, which stabilize the binding of near-cognate tRNA to the A site. Restrictive Strr

mutations disrupt the contacts between S12 and rRNA and therefore destabilize the

tRNA-A site binding and also increase the energy barrier to the formation of such

binding. This results in the increase in accuracy (182). 46

Importantly, such mutations with restrictive decoding accuracy concomitantly

decrease the rate of translation in most cases (6, 23, 182, 233). Indeed, Bohman et al.

(23) regarded the loss of translational speed as the price paid for the accuracy

enhancement. They reported that elongation rates of β-galactosidase range from 7.8 to

12 amino acids per second in restrictive mutants in the absence of Str, compared to 14

in the wild-type strain (23). Using a cell-free protein synthesis system, Chumpolkulwong

et al. (40) reported that restrictive mutations on S12 (K42N or K42I) decreased

translational efficiency of an mRNA template encoding chloramphenicol

acetyltransferase, while such decrease was not observed with mutant carrying K87R on

S12, which is regarded as “mildly restrictive” (85). Surprisingly, they also saw increased

translational efficiency with another restrictive S12 mutation K42T, though this

observation was contrary to another publication from the same group (102). It is

noteworthy that no significant restrictive mutation-associated alteration in the growth

profile was observed in these two studies (40, 102), yet such difference in growth rate

comparing to the wild-type strain was indicated in some other papers (64, 208).

The mutations that do not result in a hyper-accurate phenotype during

translation are referred to as non-restrictive (23). K42R on S12 was identified to cause

non-restrictive mutation in both E. coli and S. Typhimurium (251). Bohman et al. (23)

reported that Strr mutants of this group are phenotypically indistinguishable from the wild-type in their pattern of suppression and the rate of peptide elongation, yet their

translation error rates were slightly higher than the wild-type strain. 47

Streptomycin-dependency is a third subgroup of Strr mutation. P90L and G91D

mutation on S12 can result in Str-dependent (Strd) phenotype (40). Strd ribosomes require the binding of Str to S12 in order to properly function during protein synthesis

(135). In vitro experiment in the absence of Str showed that Strd ribosomes have a partly reduced ability to bind fMet-tRNA; and more importantly, these mutant ribosomes failed to bind the fMet from the P site to the aminoacyl-tRNA analogue puromycin at the A site, leading to the stall of the translation process (135). Interestingly, mutants bearing P90Q (100) and K42A (223) substitution on S12 grow faster in the presence of

Str than in its absence, therefore these mutations are referred to as Str- pseudodependent.

2.4.3 Application of Strr E. coli O157:H7 in animal infection study

As discussed earlier, E. coli O157:H7 colonize the large intestines of cattle,

especially the cecum and tissues of the rectoanal junction (51, 172). This colonization

pattern is essential for the epidemiology for E. coli O157:H7 as a foodborne pathogen

(see section 2.1.4). Therefore, many animal studies have been dedicated into

understanding the genetic elements contributing to the colonizing ability E. coli O157:H7.

Animal models are also used to investigate the pathogenesis of E. coli O157:H7.

In addition to cattle, small animal model systems (i.e. mouse) have been

preferred by many investigators for their lower requirement for veterinary skill, space

and cost (164). However, many studies have suggested that these animals are not

amenable to EHEC colonization and mostly due to colonization resistance (164, 229,

258). The term “colonization resistance” was used by van der Waaij (257) to describe a 48

phenomenon whereby “the resistance which a potentially pathogenic microorganisms

encounters when it tries to colonize a ‘landing site’ on the mucosa in one of the three

tracts (see below) that have an open communication with the outside world”. Different

from that in the respiratory and urinary tracts, the colonization resistance in the

intestinal tract mostly results from the complex intestinal microflora (257). To improve

the intestinal colonization of E. coli O157:H7 and thus provide better animal disease

models, antibiotic treatment has been employed in many studies to reduce the complexity of the resident microflora.

The first murine system described for study of E. coli O157:H7 was the Str-

treated mouse model developed by Wadolkowski et al. (258). This E. coli O157:H7

mouse model used Str-treated drinking water as a means of reducing the animals’

normal intestinal facultative flora, so as to decrease bacterial competition for the

infecting E. coli O157:H7 strain. This methodology was based on the work of Myhal et al.

as described in 1982 (168). Myhal et al. compared the colonization abilities of E. coli

strains, which are individually resistant to streptomycin, rifampicin, nalidixic acid,

tetracycline, ampillicin, chloramphenicol and novobiocin, in the mice treated with the

corresponding antibiotic. They found that Str treatment only leaves the obligate

anaerobe population undisturbed, and also does not alter the basic distribution of E. coli

in the untreated mouse intestine. More importantly, they concluded that Str resistance

stems from a change in ribosomes and that it is “unlikely that such alteration would

affect the surface properties of the strains and, therefore, presumably would not alter 49

their colonizing abilities”, while defects were observed with other antibiotic resistant E. coli derivatives (168).

Wadolkowski et al. followed a very similar methodology to that described by

Myhal et al. for their E. coli O157:H7 infection studies in Str-treated mice (258). The lack of further characterization of the spontaneously derived Strr mutant in this study implied that the authors assumed this mutation to be neutral. Since then, the combination of spontaneously derived Strr EHEC mutant and Str-treated animal have been employed in many different studies (76, 143, 163, 229, 254), yet none of them has investigated the variety of mutations that can cause the same resistance phenotype.

r Chapter Six of this thesis provides the first evidence that spontaneously-derived Str

mutations are not necessarily phenotypically neutral, and brings into question the

reliability of the Str-treated animal model of infection.

50

2.5 Conclusion

Since its first report in 1983, E. coli O157:H7 has emerged as one of the most

important foodborne pathogens for its low infectious dose and the potential to cause

severe diseases including HS and HUS. The clinical and industrial cost caused by this pathogen is huge every year. Recent studies have suggested the important contributions

of prophage and other horizontally acquired genetic elements in the pathogenesis and

evolution of E. coli O157:H7. For instance, the lambdoid stx2-encoding prophage is not

only responsible for the direct production of Stx2, which is essential to the development

of HUS, but is also suggested to be capable of lytically infect the generic E. coli in human

intestine, accumulate additional Stx2, and worsen the progress of the disease.

Many other prophage in E. coli O157:H7 are also identified to encode virulence-

related genes and the regulator of these genes. These regulators can be both as the pre-

and post-transcriptional. One example is the putative ileZ-argN-argO operon. The three

putative tRNA genes encoded by this operon was proposed to recognize the 4 codons

that are rarely used in the backbone of the chromosome but more frequently in the

genetic regions acquired from horizontal gene transfer. Therefore, these putative tRNAs

were speculated as positive regulators for the expression of virulence genes.

The prophage regions have also been identified as hot spots for genomic rearrangement of this E. coli O157:H7. Different mechanisms for these observed instabilities have been proposed, yet the genetics behind them were never fully explained. More importantly, as virulence-related structural and regulatory genes are 51

encoded by prophage, the influence of these genomic events on the physiology and

pathogenesis of E. coli O157:H7 can be fundamental.

Furthermore, streptomycin resistant mutants of E. coli O157:H7 coupled with

Str-treated animals have been widely used for colonization and pathogenesis study of this pathogen. Meanwhile, diverse mechanisms that trigger this antibiotic resistant phenotype have also been reported. However, few studies have discussed the influence of this resistant mutation on the biology of E. coli O157:H7.

Therefore I include four objectives in this study. i) Investigate the impacts of stx2-encoding phage and the host background on the accumulation of Stx2 in E. coli

O157:H7 strains. ii) Characterize the spontaneous deletion within the Sp11-Sp12 prophage region of E.coli O157:H7 Sakai. iii) Investigate the effects of VT2-Sakai encoded putative ileZ-argN-argO operon to the biology of its host. iv) Investigate the impacts of different streptomycin resistant mutations on the secretion of LEE effectors.

52

2.6 References

1. Abe, H., A. Miyahara, T. Oshima, K. Tashiro, Y. Ogura, S. Kuhara, N. Ogasawara, T. Hayashi, and T. Tobe. 2008. Global regulation by horizontally transferred regulators establishes the pathogenicity of Escherichia coli. DNA Res. 15:25-38. 2. Abu-Ali, G. S., L. M. Ouellette, S. T. Henderson, D. W. Lacher, J. T. Riordan, T. S. Whittam, and S. D. Manning. 2010. Increased adherence and expression of virulence genes in a lineage of Escherichia coli O157:H7 commonly associated with human infections. PLoS One 5:e10167. 3. Abu-Ali, G. S., L. M. Ouellette, S. T. Henderson, T. S. Whittam, and S. D. Manning. 2010. Differences in adherence and virulence gene expression between two outbreak strains of enterohaemorrhagic Escherichia coli O157:H7. Microbiology 156:408-419. 4. Acheson, D. W., J. Reidl, X. Zhang, G. T. Keusch, J. J. Mekalanos, and M. K. Waldor. 1998. In vivo transduction with Shiga toxin 1-encoding phage. Infect. Immun. 66:4496-4498. 5. Ackman, D., S. Marks, P. Mack, M. Caldwell, T. Root, and G. Birkhead. 1997. Swimming-associated haemorrhagic colitis due to Escherichia coli O157: H7 infection: evidence of prolonged contamination of a fresh water lake. Epidemiol. Infect. 119:1-8. 6. Agarwal, D., S. T. Gregory, and M. O'Connor. 2011. Error-prone and error- restrictive mutations affecting ribosomal protein S12. J. Mol. Biol. 410:1-9. 7. Ali, S. H. 2004. A socio-ecological autopsy of the E. coli O157:H7 outbreak in Walkerton, Ontario, Canada. Soc. Sci. Med. 58:2601-2612. 8. Amagliani, G., A. Petruzzelli, E. Omiccioli, F. Tonucci, M. Magnani, and G. Brandi. 2012. Microbiological Surveillance of a Bovine Raw Milk Farm Through Multiplex Real-Time PCR. Foodborne Pathog. Dis. 9:406-411. 9. Asadulghani, M., Y. Ogura, T. Ooka, T. Itoh, A. Sawaguchi, A. Iguchi, K. Nakayama, and T. Hayashi. 2009. The defective prophage pool of Escherichia coli O157: prophage-prophage interactions potentiate horizontal transfer of virulence determinants. PLoS Pathog. 5:e1000408. 10. Aurell, E., S. Brown, J. Johanson, and K. Sneppen. 2002. Stability puzzles in phage lambda. Phys. Rev. E 65:051914. 11. Bai, J., S. P. McAteer, E. Paxton, A. Mahajan, D. L. Gally, and J. J. Tree. 2011. Screening of an E. coli O157:H7 bacterial artificial chromosome library by Comparative Genomic Hybridization to identify genomic regions contributing to growth in bovine gastrointestinal mucus and epithelial cell colonization. Front Microbiol. 2:168. 12. Banatvala, N., P. M. Griffin, K. D. Greene, T. J. Barrett, W. F. Bibb, J. H. Green, and J. G. Wells. 2001. The United States National Prospective Hemolytic Uremic Syndrome Study: microbiologic, serologic, clinical, and epidemiologic findings. J. Infect. Dis. 183:1063-1070. 53

13. Batz, M. B., S. A. Hoffmann, and J. G. Morris. 2011. Ranking the risks: the 10 pathogen-food combinations with the greatest burden on public Health. Emerging Pathogens Institute, University of Florida www.rwjf.org/files/research/72267report.pdf. 14. Baumler, A. J., R. M. Tsolis, and F. Heffron. 1996. Contribution of fimbrial operons to attachment to and invasion of epithelial cell lines by Salmonella Typhimurium. Infect. Immun. 64:1862-1865. 15. Beutin, L. 2006. Emerging enterohaemorrhagic Escherichia coli, causes and effects of the rise of a human pathogen. J. Vet. Med. 53:299-305. 16. Beutin, L., G. Krause, S. Zimmermann, S. Kaulfuss, and K. Gleier. 2004. Characterization of Shiga toxin-producing Escherichia coli strains isolated from human patients in Germany over a 3-year period. J. Clin. Microbiol. 42:1099- 1108. 17. Beutin, L., A. Miko, G. Krause, K. Pries, S. Haby, K. Steege, and N. Albrecht. 2007. Identification of human-pathogenic strains of Shiga toxin-producing Escherichia coli from food by a combination of serotyping and molecular typing of Shiga toxin genes. Appl. Environ. Microbiol. 73:4769-4775. 18. Bielaszewska, M., B. Middendorf, P. I. Tarr, W. Zhang, R. Prager, T. Aldick, U. Dobrindt, H. Karch, and A. Mellmann. 2011. Chromosomal instability in enterohaemorrhagic Escherichia coli O157:H7: impact on adherence, tellurite resistance and colony phenotype. Mol. Microbiol. 79:1024-1044. 19. Bitzan, M. 2009. Treatment options for HUS secondary to Escherichia coli O157:H7. Kidney Int. 75:62-66. 20. Blaser, M. J., and L. S. Newman. 1982. A review of human salmonellosis: I. Infective dose. Rev. Infect. Dis. 4:1096-1106. 21. Blattner, F. R., G. Plunkett, 3rd, C. A. Bloch, N. T. Perna, V. Burland, M. Riley, J. Collado-Vides, J. D. Glasner, C. K. Rode, G. F. Mayhew, J. Gregor, N. W. Davis, H. A. Kirkpatrick, M. A. Goeden, D. J. Rose, B. Mau, and Y. Shao. 1997. The complete genome sequence of Escherichia coli K-12. Science 277:1453-1462. 22. Blum, G., M. Ott, A. Lischewski, A. Ritter, H. Imrich, H. Tschape, and J. Hacker. 1994. Excision of large DNA regions termed pathogenicity islands from tRNA- specific loci in the chromosome of an Escherichia coli wild-type pathogen. Infect. Immun. 62:606-614. 23. Bohman, K., T. Ruusala, P. C. Jelenc, and C. G. Kurland. 1984. Kinetic impairment of restrictive streptomycin-resistant ribosomes. Mol. Gen. Genet. 198:90-99. 24. Borsheim, K. Y., G. Bratbak, and M. Heldal. 1990. Enumeration and biomass estimation of planktonic bacteria and viruses by transmission electron microscopy. Appl. Environ. Microbiol. 56:352-356. 25. Bouquin, N., M. X. Chen, S. Kim, F. Vannier, S. Bernard, I. B. Holland, and S. J. Seror. 1996. Characterization of an Escherichia coli mutant, feeA, displaying resistance to the calmodulin inhibitor 48/80 and reduced expression of the rare Leu tRNA3 . Mol. Microbiol. 20:853-865. 54

26. Boyce, T. G., D. L. Swerdlow, and P. M. Griffin. 1995. Escherichia coli O157:H7 and the hemolytic-uremic syndrome. N. Engl. J. Med. 333:364-368. 27. Brooks, J. T., E. G. Sowers, J. G. Wells, K. D. Greene, P. M. Griffin, R. M. Hoekstra, and N. A. Strockbine. 2005. Non-O157 Shiga toxin–producing Escherichia coli infections in the United States, 1983–2002. J. Infect. Dis. 192:1422-1429. 28. Brunder, W., H. Schmidt, and H. Karch. 1997. EspP, a novel extracellular serine protease of enterohaemorrhagic Escherichia coli O157:H7 cleaves human coagulation factor V. Mol. Microbiol. 24:767-778. 29. Brunder, W., H. Schmidt, and H. Karch. 1996. KatP, a novel catalase-peroxidase encoded by the large plasmid of enterohaemorrhagic Escherichia coli O157:H7. Microbiology 142:3305-3315. 30. Brussow, H., C. Canchaya, and W. D. Hardt. 2004. Phages and the evolution of bacterial pathogens: from genomic rearrangements to lysogenic conversion. Microbiol. Mol. Biol. Rev. 68:560-602. 31. Burland, V., Y. Shao, N. T. Perna, G. Plunkett, F. R. Blattner, and H. J. Sofia. 1998. The complete DNA sequence and analysis of the large virulence plasmid of Escherichia coli O157:H7. Nucleic. Acids Res. 26:4196-4204. 32. Calendar, R. 2006. The Bacteriophages. Oxford University Press, USA. 33. Campbell, A. 2003. Prophage insertion sites. Res. Microbiol. 154:277-282. 34. Caprioli, A., S. Morabito, H. Brugere, and E. Oswald. 2005. Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Vet. Res. 36:289-311. 35. Casjens, S. 2003. Prophages and bacterial genomics: what have we learned so far? Mol. Microbiol. 49:277-300. 36. CDC. 2006. Multistate outbreak of E. coli O157 infections, November-December 2006. http://www.cdc.gov/ecoli/2006/december/121406.htm Accessed August 3, 2012. 37. Chen, G. T., and M. Inouye. 1994. Role of the AGA/AGG codons, the rarest codons in global gene expression in Escherichia coli. Genes Dev. 8:2641-2652. 38. Chen, K. S., T. C. Peters, and J. R. Walker. 1990. A minor arginine tRNA mutant limits translation preferentially of a protein dependent on the cognate codon. J. Bacteriol. 172:2504-2510. 39. Chen, M., N. Bouquin, V. Norris, S. Casaregola, S. Seror, and I. Holland. 1991. A single base change in the acceptor stem of tRNA (3Leu) confers resistance upon Escherichia coli to the calmodulin inhibitor, 48/80. EMBO J. 10:3113-3122. 40. Chumpolkulwong, N., C. Hori-Takemoto, T. Hosaka, T. Inaoka, T. Kigawa, M. Shirouzu, K. Ochi, and S. Yokoyama. 2004. Effects of Escherichia coli ribosomal protein S12 mutations on cell-free protein synthesis. Eur. J. Biochem. 271:1127- 1134. 41. Clouthier, S. C., S. K. Collinson, A. P. White, P. A. Banser, and W. W. Kay. 1998. tRNAArg (fimU) and expression of SEF14 and SEF21 in Salmonella enteritidis. J. Bacteriol. 180:840-845. 55

42. Comeau, A. M., F. Tetart, S. N. Trojet, M. F. Prere, and H. M. Krisch. 2007. Phage-Antibiotic Synergy (PAS): beta-lactam and quinolone antibiotics stimulate virulent phage growth. PloS One 2:e799. 43. Comroe, J. H., Jr. 1978. Pay dirt: the story of streptomycin. Part I. From Waksman to Waksman. Am. Rev. Respir. Dis. 117:773-781. 44. Conedera, G., P. Dalvit, M. Martini, G. Galiero, M. Gramaglia, E. Goffredo, G. Loffredo, S. Morabito, D. Ottaviani, and F. Paterlini. 2004. Verocytotoxin- producing Escherichia coli O157 in minced beef and dairy products in Italy. Int. J. Food Microbiol. 96:67-73. 45. Creuzburg, K., B. Middendorf, A. Mellmann, T. Martaler, C. Holz, A. Fruth, H. Karch, and H. Schmidt. 2011. Evolutionary analysis and distribution of type III effector genes in pathogenic Escherichia coli from human, animal and food sources. Environ. Microbiol. 13:439-452. 46. Crick, F. 1970. Central dogma of molecular biology. Nature 227:561-563. 47. Cruz-Vera, L. R., M. A. Magos-Castro, E. Zamora-Romo, and G. Guarneros. 2004. Ribosome stalling and peptidyl-tRNA drop-off during translational delay at AGA codons. Nucleic Acids Res. 32:4462-4468. 48. Davies, J., W. Gilbert, and L. Gorini. 1964. Streptomycin, suppression, and the code. Proc. Natl. Acad. Sci. U. S. A. 51:883-890. 49. Davies, J., D. Jones, and H. Khorana. 1966. A further study of misreading of codons induced by streptomycin and neomycin using ribopolynucleotides containing two nucleotides in alternating sequence as templates. J. Mol. Biol. 18:48-57. 50. Dean-Nystrom, E., B. Bosworth, A. O’Brien, and H. Moon. 1999. Bovine infection with Escherichia coli O157:H7 p. 51-58. Escherichia coli O157 in farm animals CAB International, Wallingford, United Kingdom. 51. Dean-Nystrom, E. A., B. T. Bosworth, and H. W. Moon. 1999. Pathogenesis of Escherichia coli O157:H7 in weaned calves. Adv. Exp. Med. Biol. 473:173-177. 52. Delahay, R. M., G. Frankel, and S. Knutton. 2001. Intimate interactions of enteropathogenic Escherichia coli at the host cell surface. Curr. Opin. Infect. Dis. 14:559-565. 53. Deng, W., Y. Li, B. A. Vallance, and B. B. Finlay. 2001. Locus of enterocyte effacement from Citrobacter rodentium: sequence analysis and evidence for horizontal transfer among attaching and effacing pathogens. Infect. Immun. 69:6323-6335. 54. Deschavanne, P., and J. Filipski. 1995. Correlation of GC content with replication timing and repair mechanisms in weakly expressed E.coli genes. Nucleic. Acids Res. 23:1350-1353. 55. Dobrindt, U., P. S. Cohen, M. Utley, I. Mühldorfer, and J. Hacker. 1998. The Leu leuX‐encoded tRNA5 but not the pathogenicity islands I and II influence the survival of the uropathogenic Escherichia coli strain 536 in CD‐1 mouse bladder mucus in the stationary phase. FEMS Microbiol. Lett. 162:135-141. 56. Dobrindt, U., B. Hochhut, U. Hentschel, and J. Hacker. 2004. Genomic islands in pathogenic and environmental microorganisms. Nat. Rev. Microbiol. 2:414-424. 56

57. Dobrindt, U., K. Piechaczek, A. Schierhorn, G. Fischer, M. Hecker, and J. Hacker. 2002. Influence of the leuX-encoded tRNA5 (Leu) on the regulation of gene expression in pathogenic Escherichia coli. J. Mol. Microbiol. Biotechnol. 4:205- 209. 58. Dong, H., L. Nilsson, and C. G. Kurland. 1996. Co-variation of tRNA abundance and codon usage in Escherichia coli at different growth rates. J. Mol. Biol. 260:649-663. 59. Donnenberg, M. S., J. B. Kaper, and B. B. Finlay. 1997. Interactions between enteropathogenic Escherichia coli and host epithelial cells. Trends Microbiol. 5:109-114. 60. Donnenberg, M. S., S. Tzipori, M. L. McKee, A. D. O'Brien, J. Alroy, and J. B. Kaper. 1993. The role of the eae gene of enterohemorrhagic Escherichia coli in intimate attachment in vitro and in a porcine model. J. Clin. Invest. 92:1418-1424. 61. ECDC. 2011. Shiga toxin-producing E. coli (STEC): Update on outbreak in the EU. http://ecdc.europa.eu/en/activities/sciadvice/Lists/ECDC%20Reviews/ECDC_Dis pForm.aspx?List=512ff74f-77d4-4ad8-b6d6- bf0f23083f30&ID=1166&RootFolder=%2Fen%2Factivities%2Fsciadvice%2FLists% 2FECDC%20Reviews Accessed August 2, 2012. 62. Eckburg, P. B., E. M. Bik, C. N. Bernstein, E. Purdom, L. Dethlefsen, M. Sargent, S. R. Gill, K. E. Nelson, and D. A. Relman. 2005. Diversity of the human intestinal microbial flora. Science 308:1635-1638. 63. Edelman, D. C., and J. Barletta. 2003. Real-time PCR provides improved detection and titer determination of bacteriophage. Biotechniques 35:368-375. 64. Ehrenberg, M., and C. G. Kurland. 1984. Costs of accuracy determined by a maximal growth rate constraint. Quart. Rev. Biophys. 17:45-82. 65. Elliott, S. J., E. O. Krejany, J. L. Mellies, R. M. Robins-Browne, C. Sasakawa, and J. B. Kaper. 2001. EspG, a novel type III system-secreted protein from enteropathogenic Escherichia coli with similarities to VirA of Shigella flexneri. Infect. Immun. 69:4027-4033. 66. Eppinger, M., M. K. Mammel, J. E. Leclerc, J. Ravel, and T. A. Cebula. 2011. Genomic anatomy of Escherichia coli O157:H7 outbreaks. Proc. Natl. Acad. Sci. U. S. A. 108:20142-20147. 67. Evans, H. S., P. Madden, C. Douglas, G. K. Adak, S. J. O'Brien, T. Djuretic, P. G. Wall, and R. Stanwell-Smith. 1998. General outbreaks of infectious intestinal disease in England and Wales: 1995 and 1996. Commun. Dis. Public. Health. 1:165-171. 68. Ewen, S. W., P. J. Naughton, G. Grant, M. Sojka, E. Allen-Vercoe, S. Bardocz, C. J. Thorns, and A. Pusztai. 1997. Salmonella enterica var Typhimurium and Salmonella enterica var Enteritidis express type 1 fimbriae in the rat in vivo. FEMS Immunol. Med. Microbiol. 18:185-192. 69. Fan, X., B. A. Niemira, C. J. Doona, F. E. Feeherry, R. B. Gravani, and R. E. Mandrell. 2009. Microbial safety of fresh produce vol. 41. Wiley-Blackwell. 57

70. Feng, P., K. A. Lampel, H. Karch, and T. S. Whittam. 1998. Genotypic and phenotypic changes in the emergence of Escherichia coli O157:H7. J. Infect. Dis. 177:1750-1753. 71. Flockhart, A. F., J. J. Tree, X. Xu, M. Karpiyevich, S. P. McAteer, R. Rosenblum, D. J. Shaw, C. J. Low, A. Best, V. Gannon, C. Laing, K. C. Murphy, J. M. Leong, T. Schneiders, R. La Ragione, and D. L. Gally. 2012. Identification of a novel prophage regulator in Escherichia coli controlling the expression of type III secretion. Mol. Microbiol. 83:208-223. 72. Foley, S. L., S. Simjee, J. Meng, D. G. White, P. F. McDermott, and S. Zhao. 2004. Evaluation of molecular typing methods for Escherichia coli O157:H7 isolates from cattle, food, and humans. J. Food Prot. 67:651-657. 73. Foxman, B. 2002. Epidemiology of urinary tract infections: incidence, morbidity, and economic costs. Am. J. Med. 113 Suppl 1A:5S-13S. 74. Frankel, G., A. D. Phillips, I. Rosenshine, G. Dougan, J. B. Kaper, and S. Knutton. 1998. Enteropathogenic and enterohaemorrhagic Escherichia coli: more subversive elements. Mol. Microbiol. 30:911-921. 75. Friedman, D. I. 1992. Interaction between bacteriophage lambda and its Escherichia coli host. Curr. Opin. Genet. Dev. 2:727-738. 76. Fujii, J., T. Kita, S. Yoshida, T. Takeda, H. Kobayashi, N. Tanaka, K. Ohsato, and Y. Mizuguchi. 1994. Direct evidence of neuron impairment by oral infection with verotoxin-producing Escherichia coli O157:H- in mitomycin-treated mice. Infect. Immun. 62:3447-3453. 77. Fukushima, H., T. Hashizume, Y. Morita, J. Tanaka, K. Azuma, Y. Mizumoto, M. Kaneno, M. Matsuura, K. Konma, and T. Kitani. 1999. Clinical experiences in Sakai City Hospital during the massive outbreak of enterohemorrhagic Escherichia coli O157 infections in Sakai City, 1996. Pediatr. Int. 41:213-217. 78. Fuller, C. A., C. A. Pellino, M. J. Flagler, J. E. Strasser, and A. A. Weiss. 2011. Shiga toxin subtypes display dramatic differences in potency. Infect. Immun. 79:1329-1337. 79. Gal-Mor, O., and B. B. Finlay. 2006. Pathogenicity islands: a molecular toolbox for bacterial virulence. Cell Microbiol. 8:1707-1719. 80. Gamage, S. D., J. E. Strasser, C. L. Chalk, and A. A. Weiss. 2003. Nonpathogenic Escherichia coli can contribute to the production of Shiga toxin. Infect. Immun. 71:3107-3115. 81. Garcia, G. M., P. K. Mar, D. A. Mullin, J. R. Walker, and N. E. Prather. 1986. The E. coli dnaY gene encodes an arginine transfer RNA. Cell 45:453-459. 82. Gauthier, A., J. L. Puente, and B. B. Finlay. 2003. Secretin of the enteropathogenic Escherichia coli type III secretion system requires components of the type III apparatus for assembly and localization. Infect. Immun. 71:3310- 3319. 83. Goering, R. V. 1993. Molecular epidemiology of nosocomial infection: analysis of chromosomal restriction fragment patterns by pulsed-field gel electrophoresis. Infect. Control. Hosp. Epidemiol. 14:595-600. 58

84. Goldwater, P. N., and K. A. Bettelheim. 2012. Treatment of enterohemorrhagic Escherichia coli (EHEC) infection and hemolytic uremic syndrome (HUS). BMC Med. 10:12. 85. Gregory, S. T., J. H. D. Cate, and A. E. Dahlberg. 2001. Streptomycin-resistant and streptomycin-dependent mutants of the extreme thermophile Thermus thermophilus1. J. Mol. Biol. 309:333-338. 86. Grif, K., M. P. Dierich, H. Karch, and F. Allerberger. 1998. Strain-specific differences in the amount of Shiga toxin released from enterohemorrhagic Escherichia coli O157 following exposure to subinhibitory concentrations of antimicrobial agents. Eur. J. Clin. Microbiol. Infect. Dis. 17:761-766. 87. Griffin, P. M., and R. V. Tauxe. 1991. The epidemiology of infections caused by Escherichia coli O157:H7, other enterohemorrhagic E. coli, and the associated hemolytic uremic syndrome. Epidemiol. Rew. 13:60-98. 88. Gromadski, K. B., and M. V. Rodnina. 2004. Kinetic determinants of high-fidelity tRNA discrimination on the ribosome. Mol. Cell 13:191-200. 89. Grosjean, H., and W. Fiers. 1982. Preferential codon usage in prokaryotic genes: the optimal codon-anticodon interaction energy and the selective codon usage in efficiently expressed genes. Gene 18:199-209. 90. Gruenheid, S., R. DeVinney, F. Bladt, D. Goosney, S. Gelkop, G. D. Gish, T. Pawson, and B. B. Finlay. 2001. Enteropathogenic E. coli Tir binds Nck to initiate actin pedestal formation in host cells. Nat. Cell Biol. 3:856-859. 91. Guarner, F., and J.-R. Malagelada. 2003. Gut flora in health and disease. Lancet 361:512-519. 92. Guthrie, E. P., and K. F. Chater. 1990. The level of a transcript required for production of a Streptomyces coelicolor antibiotic is conditionally dependent on a tRNA gene. J. Bacteriol. 172:6189-6193. 93. Gyles, C. L. 2007. Shiga toxin-producing Escherichia coli: an overview. J. Anim. S. 85:E45-E62. 94. Hacker, J., G. Blum Oehler, I. Mühldorfer, and H. Tschäpe. 1997. Pathogenicity islands of virulent bacteria: structure, function and impact on microbial evolution. Mol. Microbiol. 23:1089-1097. 95. Hancock, D. D., T. E. Besser, M. L. Kinsel, P. I. Tarr, D. H. Rice, and M. G. Paros. 1994. The prevalence of Escherichia coli O157.H7 in dairy and beef cattle in Washington State. Epidemiol. Infect. 113:199-207. 96. Hartzell, A., C. Chen, C. Lewis, K. Liu, S. Reynolds, and E. G. Dudley. 2011. Escherichia coli O157:H7 of genotype lineage-specific polymorphism assay 211111 and clade 8 are common clinical isolates within Pennsylvania. Foodborne Pathog. Dis. 8:763-768. 97. Hayashi, T., K. Makino, M. Ohnishi, K. Kurokawa, K. Ishii, K. Yokoyama, C. G. Han, E. Ohtsubo, K. Nakayama, T. Murata, M. Tanaka, T. Tobe, T. Iida, H. Takami, T. Honda, C. Sasakawa, N. Ogasawara, T. Yasunaga, S. Kuhara, T. Shiba, M. Hattori, and H. Shinagawa. 2001. Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12. DNA Res. 8:11-22. 59

98. Herold, S., J. Siebert, A. Huber, and H. Schmidt. 2005. Global expression of prophage genes in Escherichia coli O157:H7 strain EDL933 in response to norfloxacin. Antimicrob. Agents Chemother. 49:931-944. 99. Heuvelink, A. E., F. L. van den Biggelaar, E. de Boer, R. G. Herbes, W. J. Melchers, J. H. Huis in 't Veld, and L. A. Monnens. 1998. Isolation and characterization of verocytotoxin-producing Escherichia coli O157 strains from Dutch cattle and sheep. J. Clin. Microbiol. 36:878-882. 100. Holberger, L. E., and C. S. Hayes. 2009. Ribosomal protein S12 and aminoglycoside antibiotics modulate A-site mRNA cleavage and transfer- messenger RNA activity in Escherichia coli. J. Biol. Chem. 284:32188-32200. 101. Honda, N., S. Iyoda, S. Yamamoto, J. Terajima, and H. Watanabe. 2009. LrhA positively controls the expression of the locus of enterocyte effacement genes in enterohemorrhagic Escherichia coli by differential regulation of their master regulators PchA and PchB. Mol. Microbiol. 74:1393-1341. 102. Hosaka, T., N. Tamehiro, N. Chumpolkulwong, C. Hori-Takemoto, M. Shirouzu, S. Yokoyama, and K. Ochi. 2004. The novel mutation K87E in ribosomal protein S12 enhances protein synthesis activity during the late growth phase in Escherichia coli. Mol. Genet. Genomics. 271:317-324. 103. Hromockyj, A. E., S. C. Tucker, and A. T. Maurelli. 1992. Temperature regulation of Shigella virulence: identification of the repressor gene virR, an analogue of hns, Tyr and partial complementation by tyrosyl transfer RNA (tRNA1 ). Mol. Microbiol. 6:2113-2124. 104. Hughes, J. M., M. E. Wilson, K. E. Johnson, C. M. Thorpe, and C. L. Sears. 2006. The emerging clinical importance of Non-O157 Shiga toxin—producing Escherichia coli. Clin. Infect. Dis. 43:1587-1595. 105. Hunter, P. R. 1990. Reproducibility and indices of discriminatory power of microbial typing methods. J. Clin. Microbiol. 28:1903-1905. 106. Hunter, S. B., P. Vauterin, M. A. Lambert-Fair, M. S. Van Duyne, K. Kubota, L. Graves, D. Wrigley, T. Barrett, and E. Ribot. 2005. Establishment of a universal size standard strain for use with the PulseNet standardized pulsed-field gel electrophoresis protocols: converting the national databases to the new size standard. J. Clin. Microbiol. 43:1045-1050. 107. Iguchi, A., S. Iyoda, J. Terajima, H. Watanabe, and R. Osawa. 2006. Spontaneous recombination between homologous prophage regions causes large-scale inversions within the Escherichia coli O157:H7 chromosome. Gene 372:199-207. 108. Ikemura, T. 1981. Correlation between the abundance of Escherichia coli transfer RNAs and the occurrence of the respective codons in its protein genes: a proposal for a synonymous codon choice that is optimal for the E. coli translational system. J. Mol. Biol. 151:389-409. 109. Ikemura, T., and H. Ozeki. 1983. Codon usage and transfer RNA contents: organism-specific codon-choice patterns in reference to the isoacceptor contents. Cold Spring Harb. Symp. Quant. Biol. 47 Pt 2:1087-1097. 60

110. Imamovic, L., and M. Muniesa. 2012. Characterizing RecA-independent induction of Shiga toxin2-encoding phages by EDTA treatment. PLoS One 7:e32393. 111. Imamovic, L., R. Serra-Moreno, J. Jofre, and M. Muniesa. 2010. Quantification of Shiga toxin 2-encoding bacteriophages, by real-time PCR and correlation with phage infectivity. J. Appl. Microbiol. 108:1105-1114. 112. Irwin, B., J. D. Heck, and G. W. Hatfield. 1995. Codon pair utilization biases influence translational elongation step times. J. Biol. Chem. 270:22801-22806. 113. Islam, M. R., Y. Ogura, M. Asadulghani, T. Ooka, K. Murase, Y. Gotoh, and T. Hayashi. 2011. A sensitive and simple plaque formation method for the Stx2 phage of Escherichia coli O157: H7, which does not form plaques in the standard plating procedure. Plasmid 67:227-235. 114. Iyoda, S., and H. Watanabe. 2004. Positive effects of multiple pch genes on expression of the locus of enterocyte effacement genes and adherence of enterohaemorrhagic Escherichia coli O157:H7 to HEp-2 cells. Microbiology 150:2357-2371. 115. Jackson, S. A., M. K. Mammel, I. R. Patel, T. Mays, T. J. Albert, J. E. LeClerc, and T. A. Cebula. 2007. Interrogating genomic diversity of E. coli O157:H7 using DNA tiling arrays. Forensic Sci. Int. 168:183-199. 116. Johansen, B. K., Y. Wasteson, P. E. Granum, and S. Brynestad. 2001. Mosaic structure of Shiga-toxin-2-encoding phages isolated from Escherichia coli O157:H7 indicates frequent gene exchange between lambdoid phage genomes. Microbiology 147:1929-1936. 117. Johnson, R. P., R. C. Clarke, J. B. Wilson, S. C. Read, K. Rahn, S. A. Renwick, K. A. Sandhu, D. Alves, M. A. Karmali, and H. Lior. 1996. Growing concerns and recent outbreaks involving non-O157:H7 serotypes of verotoxigenic Escherichia coli. J. Food Prot. 59:1112-1122. 118. Kane, J. F. 1995. Effects of rare codon clusters on high-level expression of heterologous proteins in Escherichia coli. Curr. Opin. Biotechnol. 6:494-500. 119. Karmali, M. A. 1989. Infection by verocytotoxin-producing Escherichia coli. Clin. Microbiol. Rev. 2:15-38. 120. Keene, W. E., E. Sazie, J. Kok, D. H. Rice, D. D. Hancock, V. K. Balan, T. Zhao, and M. P. Doyle. 1997. An outbreak of Escherichia coli O157: H7 infections traced to jerky made from deer meat. JAMA 277:1229-1231. 121. Kenny, B., and M. Jepson. 2000. Targeting of an enteropathogenic Escherichia coli (EPEC) effector protein to host mitochondria. Cell. Microbiol. 2:579-590. 122. Kim, J., J. Nietfeldt, and A. K. Benson. 1999. Octamer-based genome scanning distinguishes a unique subpopulation of Escherichia coli O157:H7 strains in cattle. Proc. Natl. Acad. Sci. U. S. A. 96:13288-13293. 123. Kim, J., J. Nietfeldt, J. Ju, J. Wise, N. Fegan, P. Desmarchelier, and A. K. Benson. 2001. Ancestral divergence, genome diversification, and phylogeographic variation in subpopulations of sorbitol-negative, beta-glucuronidase-negative enterohemorrhagic Escherichia coli O157. J. Bacteriol. 183:6885-6897. 61

124. Knutton, S., I. Rosenshine, M. J. Pallen, I. Nisan, B. C. Neves, C. Bain, C. Wolff, G. Dougan, and G. Frankel. 1998. A novel EspA-associated surface organelle of enteropathogenic Escherichia coli involved in protein translocation into epithelial cells. EMBO J. 17:2166-2176. 125. Kotewicz, M. L., S. A. Jackson, J. E. LeClerc, and T. A. Cebula. 2007. Optical maps distinguish individual strains of Escherichia coli O157:H7. Microbiology 153:1720- 1733. 126. Kothary, M. H., and U. S. Babu. 2001. Infective dose of foodborne pathogens in volunteers: a review. J. Food Saf. 21:49-73. 127. Kramer, E. B., and P. J. Farabaugh. 2007. The frequency of translational misreading errors in E. coli is largely determined by tRNA competition. Rna 13:87-96. 128. Kudva, I. T., P. S. Evans, N. T. Perna, T. J. Barrett, F. M. Ausubel, F. R. Blattner, and S. B. Calderwood. 2002. Strains of Escherichia coli O157:H7 differ primarily by insertions or deletions, not single-nucleotide polymorphisms. J. Bacteriol. 184:1873-1879. 129. Kurland, C. G. 1993. Major codon preference: theme and variations. Biochem. Soc. Trans. 21:841-846. 130. Kyle, J. L., C. A. Cummings, C. T. Parker, B. Quinones, P. Vatta, E. Newton, S. Huynh, M. Swimley, L. Degoricija, M. Barker, S. Fontanoz, K. Nguyen, R. Patel, R. Fang, R. Tebbs, O. Petrauskene, M. Furtado, and R. E. Mandrell. 2012. Escherichia coli serotype O55:H7 diversity supports parallel acquisition of bacteriophage at Shiga toxin phage insertion sites during evolution of the O157:H7 lineage. J. Bacteriol. 194:1885-1896. 131. Law, D. 2000. Virulence factors of Escherichia coli O157 and other Shiga toxin producing E. coli. J. Appl. Microbiol. 88:729-745. 132. Law, D., and J. Kelly. 1995. Use of heme and hemoglobin by Escherichia coli O157 and other Shiga-like-toxin-producing E. coli serogroups. Infect. Immun. 63:700-702. 133. Lawlor, E. J., H. A. Baylis, and K. F. Chater. 1987. Pleiotropic morphological and antibiotic deficiencies result from mutations in a gene encoding a tRNA-like product in Streptomyces coelicolor A3(2). Genes Dev. 1:1305-1310. 134. Lawrence, J. G., and H. Ochman. 1998. Molecular archaeology of the Escherichia coli genome. Proc. Natl. Acad. Sci. U. S. A. 95:9413-9417. 135. Lazar, M., and F. Gros. 1973. Translation initiation defects in ribosomes from streptomycin dependent strains. Biochimie 55:171-181. 136. Leclerc, G., C. Sirard, and G. R. Drapeau. 1989. The Escherichia coli cell division mutation ftsM1 is in serU. J. Bacteriol. 171:2090-2095. 137. Lelong, J. C., D. Gros, M. A. Cousin, M. Grunberg-Manago, and F. Gros. 1971. Streptomycin induced release of fMet-tRNA from the ribosomal initiation complex. Biochem. Biophys. Res. Commun. 42:530-537. 138. Leopold, S. R., V. Magrini, N. J. Holt, N. Shaikh, E. R. Mardis, J. Cagno, Y. Ogura, A. Iguchi, T. Hayashi, A. Mellmann, H. Karch, T. E. Besser, S. A. Sawyer, T. S. Whittam, and P. I. Tarr. 2009. A precise reconstruction of the emergence and 62

constrained radiations of Escherichia coli O157 portrayed by backbone concatenomic analysis. Proc. Natl. Acad. Sci. U. S. A. 106:8713-8718. 139. Leskiw, B., M. Bibb, and K. Chater. 1991. The use of a rare codon specifically during development? Mol. Microbiol. 5:2861-2867. 140. Liesegang, A., U. Sachse, R. Prager, H. Claus, H. Steinruck, S. Aleksic, W. Rabsch, W. Voigt, A. Fruth, H. Karch, J. Bockemuhl, and H. Tschape. 2000. Clonal diversity of Shiga toxin-producing Escherichia coli O157:H7/H- in Germany--a ten-year study. Int. J. Med. Microbiol. 290:269-278. 141. Lim, J. Y., H. J. La, H. Sheng, L. J. Forney, and C. J. Hovde. 2010. Influence of plasmid pO157 on Escherichia coli O157: H7 Sakai biofilm formation. Appl. Environ. Microbiol. 76:963-966. 142. Lim, J. Y., H. Sheng, K. S. Seo, Y. H. Park, and C. J. Hovde. 2007. Characterization of an Escherichia coli O157:H7 plasmid O157 deletion mutant and its survival and persistence in cattle. Appl. Environ. Microbiol. 73:2037-2047. 143. Lindgren, S. W., A. R. Melton, and A. D. O'Brien. 1993. Virulence of enterohemorrhagic Escherichia coli O91:H21 clinical isolates in an orally infected mouse model. Infect. Immun. 61:3832-3842. 144. Liu, K., S. J. Knabel, and E. G. Dudley. 2009. rhs genes are potential markers for multilocus sequence typing of Escherichia coli O157:H7 strains. Appl. Environ. Microbiol. 75:5853-5862. 145. Livny, J., and D. I. Friedman. 2004. Characterizing spontaneous induction of Stx encoding phages using a selectable reporter system. Mol. Microbiol. 51:1691- 1704. 146. Locking, M. E., S. J. O'Brien, W. J. Reilly, E. M. Wright, D. M. Campbell, J. E. Coia, L. M. Browning, and C. N. Ramsay. 2001. Risk factors for sporadic cases of Escherichia coli O157 infection: the importance of contact with animal excreta. Epidemiol. Infect. 127:215-220. 147. Locking, M. E., K. G. J. Pollock, L. J. Allison, L. Rae, M. F. Hanson, and J. M. Cowden. 2011. Escherichia coli O157 infection and secondary spread, Scotland, 1999–2008. Emerg. Infect. Dis. 17:524-527. 148. Los, J. M., P. Golec, G. Wegrzyn, A. Wegrzyn, and M. Los. 2008. Simple method for plating Escherichia coli bacteriophages forming very small plaques or no plaques under standard conditions. Appl. Environ. Microbiol. 74:5113-5120. 149. Luzzatto, L., D. Apirion, and D. Schlessinger. 1968. Mechanism of action of streptomycin in E. coli: interruption of the ribosome cycle at the initiation of protein synthesis. Proc. Natl. Acad. Sci. U. S. A. 60:873-880. 150. MacDonald, D. M., M. Fyfe, A. Paccagnella, A. Trinidad, K. Louie, and D. Patrick. 2004. Escherichia coli O157:H7 outbreak linked to salami, British Columbia, Canada, 1999. Epidemiol. Infect. 132:283-289. 151. Makino, K., K. Yokoyama, Y. Kubota, C. H. Yutsudo, S. Kimura, K. Kurokawa, K. Ishii, M. Hattori, I. Tatsuno, H. Abe, T. Iida, K. Yamamoto, M. Onishi, T. Hayashi, T. Yasunaga, T. Honda, C. Sasakawa, and H. Shinagawa. 1999. Complete nucleotide sequence of the prophage VT2-Sakai carrying the verotoxin 2 genes of 63

the enterohemorrhagic Escherichia coli O157:H7 derived from the Sakai outbreak. Genes Genet. Syst. 74:227-239. 152. Manning, S. D., A. S. Motiwala, A. C. Springman, W. Qi, D. W. Lacher, L. M. Ouellette, J. M. Mladonicky, P. Somsel, J. T. Rudrik, and S. E. Dietrich. 2008. Variation in virulence among clades of Escherichia coli O157:H7 associated with disease outbreaks. Proc. Natl. Acad. Sci. U.S.A. 105:4868-4873. 153. Matussek, A., J. Lauber, A. Bergau, W. Hansen, M. Rohde, K. E. Dittmar, M. Gunzer, M. Mengel, P. Gatzlaff, M. Hartmann, J. Buer, and F. Gunzer. 2003. Molecular and functional analysis of Shiga toxin-induced response patterns in human vascular endothelial cells. Blood 102:1323-1332. 154. McDaniel, T. K., K. G. Jarvis, M. S. Donnenberg, and J. B. Kaper. 1995. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc. Natl. Acad. Sci. U. S. A. 92:1664-1668. 155. McDaniel, T. K., and J. B. Kaper. 1997. A cloned pathogenicity island from enteropathogenic Escherichia coli confers the attaching and effacing phenotype on E. coli K-12. Mol. Microbiol. 23:399-407. 156. McKee, M. L., A. R. Melton-Celsa, R. A. Moxley, D. H. Francis, and A. D. O'Brien. 1995. Enterohemorrhagic Escherichia coli O157:H7 requires intimin to colonize the gnotobiotic pig intestine and to adhere to HEp-2 cells. Infect. Immun. 63:3739-3744. 157. McNamara, B. P., A. Koutsouris, C. B. O'Connell, J. P. Nougayrede, M. S. Donnenberg, and G. Hecht. 2001. Translocated EspF protein from enteropathogenic Escherichia coli disrupts host intestinal barrier function. J. Clin. Invest. 107:621-629. 158. Mead, P. S., and P. M. Griffin. 1998. Escherichia coli O157:H7. Lancet 352:1207- 1212. 159. Medigue, C., T. Rouxel, P. Vigier, A. Henaut, and A. Danchin. 1991. Evidence for horizontal gene transfer in Escherichia coli speciation. J. Mol. Biol. 222:851-856. 160. Melton-Celsa, A. R., and A. D. O'Brien. 1998. Structure, biology, and relative toxicity of Shiga toxin family members for cells and animals, p.121-128. Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. ASM Press, Washington, D.C. 161. Michino, H., K. Araki, S. Minami, S. Takaya, N. Sakai, M. Miyazaki, A. Ono, and H. Yanagawa. 1999. Massive outbreak of Escherichia coli O157:H7 infection in schoolchildren in Sakai City, Japan, associated with consumption of white radish sprouts. Am. J. Epidemiol. 150:787-796. 162. Miller, C. P., and M. Bohnhoff. 1947. Two streptomycin-resistant variants of meningococcus. J. Bacteriol. 54:467-481. 163. Miranda, R. L., T. Conway, M. P. Leatham, D. E. Chang, W. E. Norris, J. H. Allen, S. J. Stevenson, D. C. Laux, and P. S. Cohen. 2004. Glycolytic and gluconeogenic growth of Escherichia coli O157:H7 (EDL933) and E. coli K-12 (MG1655) in the mouse intestine. Infect. Immun. 72:1666-1676. 164. Mohawk, K. L., and A. D. O'Brien. 2011. Mouse models of Escherichia coli O157:H7 infection and Shiga toxin injection. J. Biomed. Biotechnol. 2011:258185. 64

165. Monday, S. R., T. S. Whittam, and P. C. H. Feng. 2001. Genetic and evolutionary analysis of mutations in the gusA gene that cause the absence of β- glucuronidase activity in Escherichia coli O157:H7. J. Infect. Dis. 184:918-921. 166. Muniesa, M., J. E. Blanco, M. De Simon, R. Serra-Moreno, A. R. Blanch, and J. Jofre. 2004. Diversity of stx2 converting bacteriophages induced from Shiga- toxin-producing Escherichia coli strains isolated from cattle. Microbiology 150:2959-2971. 167. Muniesa, M., J. Recktenwald, M. Bielaszewska, H. Karch, and H. Schmidt. 2000. Characterization of a Shiga toxin 2e-converting bacteriophage from an Escherichia coli strain of human origin. Infect. Immun. 68:4850-4855. 168. Myhal, M. L., D. C. Laux, and P. S. Cohen. 1982. Relative colonizing abilities of human fecal and K-12 strains of Escherichia coli in the large intestines of streptomycin-treated mice. Eur. J. Clin. Microbiol. 1:186-192. 169. Najafabadi, H. S., H. Goodarzi, and R. Salavati. 2009. Universal function- specificity of codon usage. Nucleic Acids Res. 37:7014-7023. 170. Nakayashiki, T., and H. Inokuchi. 1998. Novel temperature-sensitive mutants of Leu Escherichia coli that are unable to grow in the absence of wild-type tRNA6 . J. Bacteriol. 180:2931-2935. 171. Nataro, J. P., and J. B. Kaper. 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11:142-201. 172. Naylor, S. W., A. Flockhart, P. Nart, D. G. E. Smith, J. Huntley, D. L. Gally, and J. C. Low. 2007. Shedding of Escherichia coli O157:H7 in calves is reduced by prior colonization with the homologous strain. Appl. Environ. Microbiol. 73:3765-3767. 173. Neupane, M., G. S. Abu-Ali, A. Mitra, D. W. Lacher, S. D. Manning, and J. T. Riordan. 2011. Shiga toxin 2 overexpression in Escherichia coli O157:H7 strains associated with severe human disease. Microb. Pathog. 51:466-470. 174. Newcombe, H. B., and R. Hawirko. 1949. Spontaneous mutation to streptomycin resistance and dependence in Escherichia coli. J. Bacteriol. 57:565-572. 175. Newman, J. V., R. Kolter, D. C. Laux, and P. S. Cohen. 1994. Role of leuX in Escherichia coli colonization of the streptomycin-treated mouse large intestine. Microb. Pathog. 17:301-311. 176. Nicholson, F. A., S. J. Groves, and B. J. Chambers. 2005. Pathogen survival during livestock manure storage and following land application. Bioresour. Technol. 96:135-143. 177. Noris, M., and G. Remuzzi. 2005. Hemolytic uremic syndrome. J. Am. Soc. Nephrol. 16:1035-1050. 178. Nyachuba, D. G. 2010. Foodborne illness: is it on the rise? Nutr. Rev. 68:257-269. 179. O'Brien, A. D., G. D. LaVeck, M. R. Thompson, and S. B. Formal. 1982. Production of Shigella dysenteriae type 1-like cytotoxin by Escherichia coli. J. Infect. Dis. 146:763-769. 180. Obrig, T. G., C. B. Louise, C. A. Lingwood, B. Boyd, L. Barley-Maloney, and T. O. Daniel. 1993. Endothelial heterogeneity in Shiga toxin receptors and responses. J. Biol. Chem. 268:15484-15488. 65

181. Ogden, I. D., D. R. Fenlon, A. J. A. Vinten, and D. Lewis. 2001. The fate of Escherichia coli O157 in soil and its potential to contaminate drinking water. Int. J. Food Microbiol. 66:111-117. 182. Ogle, J. M., and V. Ramakrishnan. 2005. Structural insights into translational fidelity. Annu. Rev. Biochem. 74:129-177. 183. Ogura, Y., K. Kurokawa, T. Ooka, K. Tashiro, T. Tobe, M. Ohnishi, K. Nakayama, T. Morimoto, J. Terajima, H. Watanabe, S. Kuhara, and T. Hayashi. 2006. Complexity of the genomic diversity in enterohemorrhagic Escherichia coli O157 revealed by the combinational use of the O157 Sakai oligoDNA Microarray and the Whole Genome PCR Scanning. DNA Res. 13:3-14. 184. Ogura, Y., T. Ooka, A. Iguchi, H. Toh, M. Asadulghani, K. Oshima, T. Kodama, H. Abe, K. Nakayama, K. Kurokawa, T. Tobe, M. Hattori, and T. Hayashi. 2009. Comparative genomics reveal the mechanism of the parallel evolution of O157 and non-O157 enterohemorrhagic Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 106:17939-17944. 185. Ohmi, K., N. Kiyokawa, T. Takeda, and J. Fujimoto. 1998. Human microvascular endothelial cells are strongly sensitive to Shiga toxins. Biochem. Biophys. Res. Commun. 251:137-141. 186. Ohnishi, M., J. Terajima, K. Kurokawa, K. Nakayama, T. Murata, K. Tamura, Y. Ogura, H. Watanabe, and T. Hayashi. 2002. Genomic diversity of enterohemorrhagic Escherichia coli O157 revealed by whole genome PCR scanning. Proc. Natl. Acad. Sci. U.S.A. 99:17043. 187. Ooka, T., Y. Ogura, M. Asadulghani, M. Ohnishi, K. Nakayama, J. Terajima, H. Watanabe, and T. Hayashi. 2009. Inference of the impact of insertion sequence (IS) elements on bacterial genome diversification through analysis of small-size structural polymorphisms in Escherichia coli O157 genomes. Genome Res. 19:1809-1816. 188. Ostroff, S. M., J. M. Kobayashi, and J. H. Lewis. 1989. Infections with Escherichia coli O157: H7 in Washington state. JAMA 262:355-359. 189. Pearce, M. C., M. E. Chase-Topping, I. J. McKendrick, D. J. Mellor, M. E. Locking, L. Allison, H. E. Ternent, L. Matthews, H. I. Knight, and A. W. Smith. 2009. Temporal and spatial patterns of bovine Escherichia coli O157 prevalence and comparison of temporal changes in the patterns of phage types associated with bovine shedding and human E. coli O157 cases in Scotland between 1998-2000 and 2002-2004. BMC Microbiol. 9:276. 190. Perna, N. T., G. Plunkett, 3rd, V. Burland, B. Mau, J. D. Glasner, D. J. Rose, G. F. Mayhew, P. S. Evans, J. Gregor, H. A. Kirkpatrick, G. Posfai, J. Hackett, S. Klink, A. Boutin, Y. Shao, L. Miller, E. J. Grotbeck, N. W. Davis, A. Lim, E. T. Dimalanta, K. D. Potamousis, J. Apodaca, T. S. Anantharaman, J. Lin, G. Yen, D. C. Schwartz, R. A. Welch, and F. R. Blattner. 2001. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature 409:529-533. 191. Piechaczek, K., U. Dobrindt, A. Schierhorn, G. S. Fischer, M. Hecker, and J. Hacker. 2000. Influence of pathogenicity islands and the minor leuX-encoded 66

Leu tRNA5 on the proteome pattern of the uropathogenic Escherichia coli strain 536. Int. J. Med. Microbiol. 290:75-84. 192. Plunkett III, G., D. J. Rose, T. J. Durfee, and F. R. Blattner. 1999. Sequence of Shiga toxin 2 phage 933W from Escherichia coli O157: H7: Shiga toxin as a phage late-gene product. J. Bacteriol. 181:1767-1778. 193. Pollock, K. G. J., T. J. Beattie, B. Reynolds, A. Stewart, and J. M. Cowden. 2007. Clinical management of children with suspected or confirmed E. coil O157 infection. Scott. Med. J. 52:5-7. 194. Rangel, J. M., P. H. Sparling, C. Crowe, P. M. Griffin, and D. L. Swerdlow. 2005. Epidemiology of Escherichia coli O157:H7 outbreaks, United States, 1982-2002. Emerg. Infect. Dis. 11:603-609. 195. Rich, J. J., and D. K. Willis. 1997. Multiple loci of Pseudomonas syringae pv. syringae are involved in pathogenicity on bean: restoration of one lesion- deficient mutant requires two tRNA genes. J. Bacteriol. 179:2247-2258. 196. Riley, L. W., R. S. Remis, S. D. Helgerson, H. B. McGee, J. G. Wells, B. R. Davis, R. J. Hebert, E. S. Olcott, L. M. Johnson, and N. T. Hargrett. 1983. Hemorrhagic colitis associated with a rare Escherichia coli serotype. N. Engl. J. Med. 308:681- 685. 197. Riordan, J. T., S. B. Viswanath, S. D. Manning, and T. S. Whittam. 2008. Genetic differentiation of Escherichia coli O157:H7 clades associated with human disease by real-time PCR. J. Clin. Microbiol. 46:2070-2073. 198. Ritter, A., G. Blum, L. Emody, M. Kerenyi, A. Bock, B. Neuhierl, W. Rabsch, F. Scheutz, and J. Hacker. 1995. tRNA genes and pathogenicity islands: influence on virulence and metabolic properties of uropathogenic Escherichia coli. Mol. Microbiol. 17:109-121. 199. Ritter, A., D. L. Gally, P. B. Olsen, U. Dobrindt, A. Friedrich, P. Klemm, and J. Hacker. 1997. The Pai associated leuX specific tRNALeu5 affects type 1 fimbriation in pathogenic Escherichia coli by control of FimB recombinase expression. Mol. Microbiol. 25:871-882. 200. Robinson, L. A., R. M. Hurley, C. Lingwood, and D. G. Matsell. 1995. Escherichia coli verotoxin binding to human paediatric glomerular mesangial cells. Pediatr. Nephrol. 9:700-704. 201. Rodnina, M. V., T. Daviter, K. Gromadski, and W. Wintermeyer. 2002. Structural dynamics of ribosomal RNA during decoding on the ribosome. Biochimie 84:745- 754. 202. Rooks, D. J., Y. Yan, J. E. McDonald, M. J. Woodward, A. J. McCarthy, and H. E. Allison. 2010. Development and validation of a qPCR-based method for quantifying Shiga toxin-encoding and other lambdoid bacteriophages. Environ. Microbiol. 12:1194-1204. 203. Rothschild, M. 2011. Deer Confirmed as Source of Strawberry Outbreak, Food Safety News, http://www.foodsafetynews.com/2011/08/deer-feces-confirmed- as-source-of-strawberry-outbreak/. 67

204. Rounds, J., D. Boxrud, S. Jawahir, and K. Smith. 2011. Dynamics of Escherichia coli O157:H7 outbreak detection and investigation, Minnesota 2000–2008. Epidemiol. Infect. 1:1-9. 205. Ruggenenti, P. 2002. Post-transplant hemolytic-uremic syndrome. Kidney Int. 62:1093-1104. 206. Ruggenenti, P., M. Noris, and G. Remuzzi. 2001. Thrombotic microangiopathy, hemolytic uremic syndrome, and thrombotic thrombocytopenic purpura. Kidney Int. 60:831-846. 207. Rutkai, E., L. Dorgai, R. Sirot, E. Yagil, and R. A. Weisberg. 2003. Analysis of insertion into secondary attachment sites by phage lambda and by int mutants with altered recombination specificity. J. Mol. Biol. 329:983-996. 208. Ruusala, T., D. Andersson, M. Ehrenberg, and C. G. Kurland. 1984. Hyper- accurate ribosomes inhibit growth. EMBO J. 3:2575-2580. 209. Saier, M. H., Jr. 1995. Differential codon usage: a safeguard against inappropriate expression of specialized genes? FEBS Lett. 362:1-4. 210. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y, 2nd ed. 211. Sargeant, J. M., M. R. Amezcua, A. Rajic, and L. Waddell. 2007. Pre-harvest interventions to reduce the shedding of E. coli O157 in the faeces of weaned domestic ruminants: a systematic review. Zoonoses Public Health 54:260-277. 212. Sato, T., T. Shimizu, M. Watarai, M. Kobayashi, S. Kano, T. Hamabata, Y. Takeda, and S. Yamasaki. 2003. Genome analysis of a novel Shiga toxin 1 (Stx1)- converting phage which is closely related to Stx2-converting phages but not to other Stx1-converting phages. J. Bacteriol. 185:3966-3971. Thr 213. Sauer, U., and P. Durre. 1992. Possible function of tRNAACG in regulation of solvent formation in Clostridium acetobutylicum. FEMS Microbiol. lett. 100:147- 153. 214. Scallan, E., R. M. Hoekstra, F. J. Angulo, R. V. Tauxe, M. A. Widdowson, S. L. Roy, J. L. Jones, and P. M. Griffin. 2011. Foodborne illness acquired in the United States—major pathogens. Emerg. Infect. Dis. 17:7-15. 215. Schatz, A., E. Bugle, and S. A. Waksman. 1944. Streptomycin, a substance exhibiting antibiotic activity against Gram-positive and Gram-negative bacteria. Proc. Soc. Exp. Biol. Med. 55:66-69. 216. Scheiring, J., S. P. Andreoli, and L. B. Zimmerhackl. 2008. Treatment and outcome of Shiga-toxin-associated hemolytic uremic syndrome (HUS). Pediatr. Nephrol. 23:1749-1760. 217. Scheiring, J., A. Rosales, and L. B. Zimmerhackl. 2010. Clinical practice. Today's understanding of the haemolytic uraemic syndrome. Eur. J. Pediatr. 169:7-13. 218. Schmidt, H., J. Scheef, C. Janetzki Mittmann, M. Datz, and H. Karch. 1997. An ileX tRNA gene is located close to the Shiga toxin II operon in enterohemorrhagic Escherichia coli O157 and non O157 strains. FEMS Microbiol. lett. 149:39-44. 219. Schwartz, D. C., and C. R. Cantor. 1984. Separation of yeast chromosome-sized DNAs by pulsed field gradient gel electrophoresis. Cell 37:67. 68

220. Sears, C. L. 2005. A dynamic partnership: celebrating our gut flora. Anaerobe 11:247-251. 221. Serna Iv, A., and E. C. Boedeker. 2008. Pathogenesis and treatment of Shiga toxin-producing Escherichia coli infections. Curr. Opin. Gastroenterol. 24:38-47. 222. Serra-Moreno, R., J. Jofre, and M. Muniesa. 2007. Insertion site occupancy by stx2 bacteriophages depends on the locus availability of the host strain chromosome. J. Bacteriol. 189:6645-6654. 223. Sharma, D., A. R. Cukras, E. J. Rogers, D. R. Southworth, and R. Green. 2007. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome. J. Mol. Biol. 374:1065-1076. 224. Sharp, P. M., and W. H. Li. 1986. Codon usage in regulatory genes in Escherichia coli does not reflect selection for ‘rare’codons. Nucleic Acids Res. 14:7737-7749. 225. Sheng, H., J. Y. Lim, H. J. Knecht, J. Li, and C. J. Hovde. 2006. Role of Escherichia coli O157:H7 virulence factors in colonization at the bovine terminal rectal mucosa. Infect. Immun. 74:4685-4693. 226. Shima, K., Y. Wu, N. Sugimoto, M. Asakura, K. Nishimura, and S. Yamasaki. 2006. Comparison of a PCR-restriction fragment length polymorphism (PCR-RFLP) assay to pulsed-field gel electrophoresis to determine the effect of repeated subculture and prolonged storage on RFLP patterns of Shiga toxin-producing Escherichia coli O157:H7. J. Clin. Microbiol. 44:3963-3968. 227. Shimizu, T., Y. Ohta, and M. Noda. 2009. Shiga toxin 2 is specifically released from bacterial cells by two different mechanisms. Infect. Immun. 77:2813-2823. 228. Smith, J. M., and N. H. Smith. 1996. Synonymous nucleotide divergence: What is ''saturation''? Genetics 142:1033-1036. 229. Snider, T. A., A. J. Fabich, K. E. Washburn, W. P. Sims, J. L. Blair, P. S. Cohen, T. Conway, and K. D. Clinkenbeard. 2006. Evaluation of a model for Escherichia coli O157:H7 colonization in streptomycin-treated adult cattle. Am. J. Vet. Res. 67:1914-1920. 230. Snyder, L., and W. Champness. 2007. Molecular genetics of bacteria. American Society for Microbiology. 231. Sperandio, V., J. L. Mellies, R. M. Delahay, G. Frankel, J. A. Crawford, W. Nguyen, and J. B. Kaper. 2000. Activation of enteropathogenic Escherichia coli (EPEC) LEE2 and LEE3 operons by Ler. Mol. Microbiol. 38:781-793. 232. Steele, M., K. Ziebell, Y. Zhang, A. Benson, P. Konczy, R. Johnson, and V. Gannon. 2007. Identification of Escherichia coli O157:H7 genomic regions conserved in strains with a genotype associated with human infection. Appl. Environ. Microbiol. 73:22-31. 233. Stelzl, U., S. Connell, K. H. Nierhaus, and B. Wittmann‐Liebold. 2009. Ribosomal Proteins: Role in Ribosomal Functions p. 1-12. Encyclopedia of Life Sciences. John Wiley & Sons, Ltd. 234. Strauch, E., R. Lurz, and L. Beutin. 2001. Characterization of a Shiga toxin- encoding temperate bacteriophage of Shigella sonnei. Infect. Immun. 69:7588- 7595. 69

235. Strockbine, N. A., L. R. Marques, J. W. Newland, H. W. Smith, R. K. Holmes, and A. D. O'Brien. 1986. Two toxin-converting phages from Escherichia coli O157:H7 strain 933 encode antigenically distinct toxins with similar biologic activities. Infect. Immun. 53:135-140. 236. Struelens, M. 1996. Consensus guidelines for appropriate use and evaluation of microbial epidemiologic typing systems. Clin. Microbiol. Infect. 2:2-11. 237. Suau, A., R. Bonnet, M. Sutren, J. J. Godon, G. R. Gibson, M. D. Collins, and J. Dore. 1999. Direct analysis of genes encoding 16S rRNA from complex communities reveals many novel molecular species within the human gut. Appl. Environ. Microbiol. 65:4799-4807. 238. Susa, M., B. Kreft, G. Wasenauer, A. Ritter, J. Hacker, and R. Marre. 1996. Influence of cloned tRNA genes from a uropathogenic Escherichia coli strain on adherence to primary human renal tubular epithelial cells and nephropathogenicity in rats. Infect. Immun. 64:5390-5394. 239. Swaminathan, B., T. J. Barrett, S. B. Hunter, and R. V. Tauxe. 2001. PulseNet: the molecular subtyping network for foodborne bacterial disease surveillance, United States. Emerg. Infect. Dis. 7:382-389. 240. Swaminathan, B., P. Gerner-Smidt, L. K. Ng, S. Lukinmaa, K. M. Kam, S. Rolando, E. P. Gutierrez, and N. Binsztein. 2006. Building PulseNet International: an interconnected system of laboratory networks to facilitate timely public health recognition and response to foodborne disease outbreaks and emerging foodborne diseases. Foodborne Pathog. Dis. 3:36-50. 241. Swenson, D. L., K. J. Kim, E. W. Six, and S. Clegg. 1994. The gene fimU affects expression of Salmonella typhimurium type 1 fimbriae and is related to the Escherichia coli tRNA gene argU. Mol. Gen. Genet. 244:216-218. 242. Tamura, F., S. Nishimura, and M. Ohki. 1984. The E. coli divE mutation, which differentially inhibits synthesis of certain proteins, is in tRNASer1. EMBO J. 3:1103- 1107. 243. Tatsuno, I., M. Horie, H. Abe, T. Miki, K. Makino, H. Shinagawa, H. Taguchi, S. Kamiya, T. Hayashi, and C. Sasakawa. 2001. toxB gene on pO157 of Escherichia coli O157:H7 is required for full epithelial cell adherence phenotype. Infect. Immun. 69:6660-6669. 244. Tercero, J. A., J. C. Espinosa, and A. Jimenez. 1998. Expression of the Streptomyces alboniger pur cluster in Streptomyces lividans is dependent on the bldA-encoded tRNALeu. FEBS Lett. 421:221-223. 245. Tinker, J. K., and S. Clegg. 2000. Characterization of FimY as a coactivator of type 1 fimbrial expression in Salmonella enterica serovar Typhimurium. Infect. Immun. 68:3305-3313. 246. Tinker, J. K., and S. Clegg. 2001. Control of FimY translation and type 1 fimbrial production by the arginine tRNA encoded by fimU in Salmonella enterica serovar Typhimurium. Mol. Microbiol. 40:757-768. 247. Tobe, T., S. A. Beatson, H. Taniguchi, H. Abe, C. M. Bailey, A. Fivian, R. Younis, S. Matthews, O. Marches, and G. Frankel. 2006. An extensive repertoire of type III 70

secretion effectors in Escherichia coli O157 and the role of lambdoid phages in their dissemination. Proc. Natl. Acad. Sci. U.S.A. 103:14941-14946 248. Toth, I., H. Schmidt, M. Dow, A. Malik, E. Oswald, and B. Nagy. 2003. Transduction of porcine enteropathogenic Escherichia coli with a derivative of a shiga toxin 2-encoding bacteriophage in a porcine ligated ileal loop system. Appl. Environ. Microbiol. 69:7242-7247. 249. Tozzoli, R., A. Caprioli, and S. Morabito. 2005. Detection of toxB, a plasmid virulence gene of Escherichia coli, in enterohemorrhagic and enteropathogenic E. coli. J. Clin. Microbiol. 43:4052-4056. 250. Tree, J. J., A. J. Roe, A. Flockhart, S. P. McAteer, X. Xu, D. Shaw, A. Mahajan, S. A. Beatson, A. Best, S. Lotz, M. J. Woodward, R. La Ragione, K. C. Murphy, J. M. Leong, and D. L. Gally. 2011. Transcriptional regulators of the GAD acid stress island are carried by effector protein-encoding prophages and indirectly control type III secretion in enterohemorrhagic Escherichia coli O157:H7. Mol. Microbiol. 80:1349-1365. 251. Tubulekas, I., R. H. Buckingham, and D. Hughes. 1991. Mutant ribosomes can generate dominant kirromycin resistance. J. Bacteriol. 173:3635-3643. 252. Tuttle, J., T. Gomez, M. P. Doyle, J. G. Wells, T. Zhao, R. V. Tauxe, and P. M. Griffin. 1999. Lessons from a large outbreak of Escherichia coli O157:H7 infections: insights into the infectious dose and method of widespread contamination of hamburger patties. Epidemiol. Infect. 122:185-192. 253. Uchida, H., N. Kiyokawa, H. Horie, J. Fujimoto, and T. Takeda. 1999. The detection of Shiga toxins in the kidney of a patient with hemolytic uremic syndrome. Pediatr. Res. 45:133-137. 254. Uhlich, G. A., J. E. Keen, and R. O. Elder. 2002. Variations in the csgD promoter of Escherichia coli O157:H7 associated with increased virulence in mice and increased invasion of HEp-2 cells. Infect. Immun. 70:395-399. 255. Unsworth, K. E., P. Mazurkiewicz, F. Senf, M. Zettl, M. McNiven, M. Way, and D. W. Holden. 2007. Dynamin is required for F‐actin assembly and pedestal formation by enteropathogenic Escherichia coli (EPEC). Cell. Microbiol. 9:438-449. 256. USDA-FSIS. 2011. Shiga Toxin-producing Escherichia coli in certain raw beef products, vol. 58157, http://www.fsis.usda.gov/OPPDE/rdad/FRPubs/2010- 0023.pdf Accessed August 2, 2012. 257. Van der Waaij, D., and H. G. de Vries-Hospers. 1986. Colonization resistance of the digestive tract; mechanism and clinical consequences. Ann. Ist. Super. Sanita 22:875-882. 258. Wadolkowski, E. A., J. A. Burris, and A. D. O'Brien. 1990. Mouse model for colonization and disease caused by enterohemorrhagic Escherichia coli O157:H7. Infect. Immun. 58:2438-2445. 259. Wagner, P. L., D. W. K. Acheson, and M. K. Waldor. 2001. Human neutrophils and their products induce Shiga toxin production by enterohemorrhagic Escherichia coli. Infect. Immun. 69:1934-1937. 71

260. Wagner, P. L., J. Livny, M. N. Neely, D. W. Acheson, D. I. Friedman, and M. K. Waldor. 2002. Bacteriophage control of Shiga toxin 1 production and release by Escherichia coli. Mol. Microbiol. 44:957-970. 261. Wagner, P. L., M. N. Neely, X. Zhang, D. W. Acheson, M. K. Waldor, and D. I. Friedman. 2001. Role for a phage promoter in Shiga toxin 2 expression from a pathogenic Escherichia coli strain. J. Bacteriol. 183:2081-2085. 262. Waldor, M. K., and D. I. Friedman. 2005. Phage regulatory circuits and virulence gene expression. Curr. Opin. Microbiol. 8:459-465. 263. Wang, G., and M. P. Doyle. 1998. Survival of enterohemorrhagic Escherichia coli O157:H7 in water. J. Food Prot. 61:662-667. 264. Wang, X., S. P. Heazlewood, D. O. Krause, and T. H. J. Florin. 2003. Molecular characterization of the microbial species that colonize human ileal and colonic mucosa by using 16S rDNA sequence analysis. J. Appl. Microbiol. 95:508-520. 265. Watanabe, H., A. Wada, Y. Inagaki, K. Itoh, and K. Tamura. 1996. Outbreaks of enterohaemorrhagic Escherichia coli O157: H7 infection by two different genotype strains in Japan, 1996. Lancet 348:831-832. 266. Waters, J. R., J. C. M. Sharp, and V. J. Dev. 1994. Infection caused by Escherichia coli O157:H7 in Alberta, Canada, and in Scotland: a five-year review, 1987–1991. Clin. Infect. Dis. 19:834-843. 267. Wells, J. G., B. R. Davis, I. K. Wachsmuth, L. W. Riley, R. S. Remis, R. Sokolow, and G. K. Morris. 1983. Laboratory investigation of hemorrhagic colitis outbreaks associated with a rare Escherichia coli serotype. J. Clin. Microbiol. 18:512-520. 268. Wendel, A. M., D. H. Johnson, U. Sharapov, J. Grant, J. R. Archer, T. Monson, C. Koschmann, and J. P. Davis. 2009. Multistate outbreak of Escherichia coli O157:H7 infection associated with consumption of packaged spinach, August- September 2006: the Wisconsin investigation. Clin. Infect. Dis. 48:1079-1086. 269. Wick, L. M., W. Qi, D. W. Lacher, and T. S. Whittam. 2005. Evolution of genomic content in the stepwise emergence of Escherichia coli O157:H7. J. Bacteriol. 187:1783-1791. 270. Wolff, C., I. Nisan, E. Hanski, G. Frankel, and I. Rosenshine. 2002. Protein translocation into host epithelial cells by infecting enteropathogenic Escherichia coli. Mol. Microbiol. 28:143-155. 271. Woods, J. B., C. K. Schmitt, S. C. Darnell, K. C. Meysick, and A. D. O'Brien. 2002. Ferrets as a model system for renal disease secondary to intestinal infection with Escherichia coli O157: H7 and other Shiga toxin-producing E. coli. J. Infect. Dis. 185:550-554. 272. Wu, B., T. Skarina, A. Yee, M. C. Jobin, R. Dileo, A. Semesi, C. Fares, A. Lemak, B. K. Coombes, C. H. Arrowsmith, A. U. Singer, and A. Savchenko. 2010. NleG Type 3 effectors from enterohaemorrhagic Escherichia coli are U-Box E3 ubiquitin ligases. PLoS Pathog. 6:e1000960. 273. Wu, G., B. Carter, M. Mafura, E. Liebana, M. J. Woodward, and M. F. Anjum. 2008. Genetic diversity among Escherichia coli O157:H7 isolates and identification of genes linked to human infections. Infect. Immun. 76:845-856. 72

274. Wu, L. F., and M. Saier. 1991. Differences in codon usage among genes encoding proteins of different function in Rhodobacter capsulatus. Res. Microbiol. 142:943-949. 275. Xiong, Y., P. Wang, R. Lan, C. Ye, H. Wang, J. Ren, H. Jing, Y. Wang, Z. Zhou, X. Bai, Z. Cui, X. Luo, A. Zhao, S. Zhang, H. Sun, L. Wang, and J. Xu. 2012. A novel Escherichia coli O157:H7 clone causing a major hemolytic uremic syndrome outbreak in China. PLoS One 7:e36144. 276. Yang, Z., J. Kim, C. Zhang, M. Zhang, J. Nietfeldt, C. M. Southward, M. G. Surette, S. D. Kachman, and A. K. Benson. 2009. Genomic instability in regions adjacent to a highly conserved pch prophage in Escherichia coli O157:H7 generates diversity in expression patterns of the LEE pathogenicity island. J. Bacteriol. 191:3553-3568. 277. Yang, Z., J. Kovar, J. Kim, J. Nietfeldt, D. R. Smith, R. A. Moxley, M. E. Olson, P. D. Fey, and A. K. Benson. 2004. Identification of common subpopulations of non-sorbitol-fermenting, beta-glucuronidase-negative Escherichia coli O157:H7 from bovine production environments and human clinical samples. Appl. Environ. Microbiol. 70:6846-6854. 278. Yokoyama, K., K. Makino, Y. Kubota, M. Watanabe, S. Kimura, C. H. Yutsudo, K. Kurokawa, K. Ishii, M. Hattori, I. Tatsuno, H. Abe, M. Yoh, T. Iida, M. Ohnishi, T. Hayashi, T. Yasunaga, T. Honda, C. Sasakawa, and H. Shinagawa. 2000. Complete nucleotide sequence of the prophage VT1-Sakai carrying the Shiga toxin 1 genes of the enterohemorrhagic Escherichia coli O157:H7 strain derived from the Sakai outbreak. Gene 258:127-139. 279. Yoshii, N., Y. Ogura, T. Hayashi, T. Ajiro, T. Sameshima, M. Nakazawa, M. Kusumoto, T. Iwata, and M. Akiba. 2009. Pulsed-field gel electrophoresis profile changes resulting from spontaneous chromosomal deletions in enterohemorrhagic Escherichia coli O157:H7 during passage in cattle. Appl. Environ. Microbiol. 75:5719-5726. 280. Zhang, W., W. Qi, T. J. Albert, A. S. Motiwala, D. Alland, E. K. Hyytia-Trees, E. M. Ribot, P. I. Fields, T. S. Whittam, and B. Swaminathan. 2006. Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms. Genome Res. 16:757-767. 281. Zhang, X., A. D. McDaniel, L. E. Wolf, G. T. Keusch, M. K. Waldor, and D. W. Acheson. 2000. Quinolone antibiotics induce Shiga toxin-encoding bacteriophages, toxin production, and death in mice. J. Infect. Dis. 181:664-670. 282. Zhang, Y., C. Laing, M. Steele, K. Ziebell, R. Johnson, A. K. Benson, E. Taboada, and V. P. Gannon. 2007. Genome evolution in major Escherichia coli O157:H7 lineages. BMC Genomics 8:121. 283. Zhang, Y., C. Laing, Z. Zhang, J. Hallewell, C. You, K. Ziebell, R. P. Johnson, A. M. Kropinski, J. E. Thomas, M. Karmali, and V. P. Gannon. 2010. Lineage and host source are both correlated with levels of Shiga toxin 2 production by Escherichia coli O157:H7 strains. Appl. Environ. Microbiol. 76:474-482. 73

284. Zhou, Z., X. Li, B. Liu, L. Beutin, J. Xu, Y. Ren, L. Feng, R. Lan, P. R. Reeves, and L. Wang. 2010. Derivation of Escherichia coli O157:H7 from its O55:H7 precursor. PLoS One 5:e8700. 285. Ziebell, K., M. Steele, Y. Zhang, A. Benson, E. N. Taboada, C. Laing, S. McEwen, B. Ciebin, R. Johnson, and V. Gannon. 2008. Genotypic characterization and prevalence of virulence factors among Canadian Escherichia coli O157:H7 strains. Appl. Environ. Microbiol. 74:4314-4323.

74

Chapter Three

SHIGA TOXIN 2-ENCODING BACTERIOPHAGE AND HOST BACKGROUND IMPACT THE ACCUMULATION OF STX2 IN ESCHERICHIA COLI O157:H7 STRAINS

Chun Chen, Kakolie Goswami§, Edward G. Dudley*

Department of Food Science, the Pennsylvania State University, University Park,

Pennsylvania 16802

* Corresponding author. Mailing address: 326 Food Science Building, The Pennsylvania State University, University Park, PA16802, US. Phone: (814)-867-0439; Email: [email protected]

§Kakolie Goswami prepared the sample in the experiment to quantify Stx2 and stx2- encoding prophage from E. coli O157:H7 library.

75

3.1 Abstract

The foodborne pathogen Escherichia coli O157:H7 expresses one or more Shiga toxins (Stx), which are responsible for the serious clinical manifestations of infections in humans. Stx2, which is associated with highly pathogenic strains, is encoded within the genome of a lambdoid prophage and expressed upon prophage induction. It has been hypothesized that both the O157:H7 strain and the susceptibility of intestinal E. coli to its phage impacts Stx2 accumulation in vivo. In this study, we quantified phage and Stx2 production by 13 E. coli O157:H7 strains and observed dramatic strain-to-strain variability. Transduction of the stx2-encoding phage from E. coli strain EDL933 into a non-toxin producing E. coli strain (C600) demonstrated that the host background affects phage and toxin production. Coincubation of E. coli O157:H7 or its lytic phage pools with

E. coli C600 could increase the production of Stx2 and stx2-encoding phage particles.

This effect varied with the O157:H7 strain, the stx2-encoding prophage, and the presence of the phage inducing agent ciprofloxacin. Of note, phage from two E. coli

O157:H7 clade 8 strains were the most infectious of those screened, while an stx2c- encoding phage possessed limited infectivity. Additionally, one clade 8 strain designated

PA2 produced limited Stx2 as a pure culture, but accumulated the highest toxin level among strains tested when coincubated with C600. Therefore, this study suggests that the intestinal microflora may impact the outcome of an O157:H7 infection, and that toxin production observed in pure culture might not accurately reflect the levels produced in vivo. 76

3.2 Introduction

Since the first report in 1983 (43), Escherichia coli O157:H7 has emerged as one

of the most devastating foodborne pathogens. It is notorious for its low infectious dose

(51, 58) and for causing serious diseases including hemorrhagic colitis and hemolytic uremic syndrome (HUS) (23). HUS may lead to renal failure, particularly in children (42).

It was reported that E. coli O157:H7 causes 63,153 clinical cases, resulting in $272 million in healthcare costs every year in the United States (5). Different subtyping methods have been proposed to characterize E. coli O157:H7 isolates. Kim et al. (29) and Zhang et al. (67) identified 3 lineages of E. coli O157:H7, namely Lineage I, Lineage II and Lineage I/II, which have distinct ecologic and epidemiologic characteristics. Lineage I

(29) and Lineage I/II (25) are more frequently isolated from humans than Lineage II strains. Manning et al. (35) identified 9 genetically distinct clades of E. coli O157:H7

using a SNP-based subtyping system. The strains belonging to clade 8 were suggested to

be associated with HUS development at a higher frequency than isolates from other

clades (2, 3, 35).

Shiga toxins (Stx) are important virulence factors for E. coli O157:H7, and are strongly associated with the development of HUS in patients (23). This prophage-

encoded toxin has an A1B5 structure. The 32 kDa A subunit is non-covalently associated

with a pentamer of five B subunits (7.7 kDa each). The B subunits of the toxin mediate

binding to the specific glycolipid receptor, globotriaosylceramide (Gb3). Next, a

receptor-mediated endocytic mechanism internalizes the toxin molecules (11). Once 77

internalized, the enzymatically active subunit A cleaves a specific adenine base from 28S

rRNA, stopping protein synthesis, which results in cell death. There are two allelic types

of Stx, namely Stx1 and Stx2 (56), which share ca. 55% in amino acid sequence identity

and are immunologically distinct (56, 64). Both Stx1 and Stx2 families are further divided

into multiple subtypes basing on differences in their nucleotide sequences (8, 9). Stx2

and Stx2c are the most commonly found in isolates from human (8, 17, 25, 35). The

effective dose at which Stx2 inhibits protein synthesis is lower than that of Stx2c,

suggesting a higher potential for Stx2 to cause diseases (18).

The genes for Stx are carried by lambdoid prophage that have genomes between

48 and 62 kb in size (34, 41, 49, 65). The E. coli locus yehV, which encodes a transcriptional regulator, and wrbA, which encodes the Trp repressor binding protein, are the preferred integration sites for stx2-encoding phage (7, 17, 54). Like other lambda phage, stx-encoding phage are temperate, and transition from lysogeny to the lytic cycle is mediated by derepression of the late promoter PR’ (10, 34, 41, 61). Exposure

to antibiotics (22), H2O2, or neutrophils (60) can lead to the induction of PR’, while

spontaneous derepression can also occur (32, 47). PR’ is the only known promoter for

stx2 expression (55, 61), and other genes under the regulation of PR’ include S (holin), R

(endolysin) and those responsible for phage packaging. Derepression of PR’ ultimately

leads to the lysis of host cell, and the release of both viable phage particles and Stx into

the environment (10, 34, 41). 78

Many recent studies have quantified Stx production from pure cultures as a

correlate for the virulence of E. coli O157:H7 strains (2, 3, 13, 38, 44, 45, 68).

Nevertheless, during an E. coli O157:H7 infection, the stx2-encoding phage released can

potentially infect susceptible commensal E. coli in the human intestine thus leading to

an increased production of phage particles and Stx (19–21). Therefore, the level of production of stx-encoding phage by the lysogen may also be a potential risk factor for increased disease severity. Previous studies (19) describing these phenomena used a small number of E. coli O157:H7 isolates from the same hospital that all carried stx1- and stx2-encoding phage. Given the genetic diversity of this pathogen (17, 35, 67) as well as the modular nature of the bacteriophage (10, 34, 41, 49), we hypothesized that phage and toxin production in the presence of commensal E. coli would be dependent on genetic features of both the host and phage.

Though the plaque assay is the standard method for phage quantification (48), its application for stx-encoding phage is limited because of their poor plaque forming ability (33, 37, 46). Additionally, other temperate phage belonging to the P2 and P4 family can also be induced after antibiotic treatment (K. Goswami, C. Chen, and E. G.

Dudley, unpublished data), and therefore plaque assays may not specifically quantify stx2-encoding phage. Another approach for phage enumeration is quantitative PCR

(qPCR) (16), and more recently, PCR-based methods have been used for stx-encoding phage quantification (27, 46), and detection (36). These methods provided the potential for quantifying stx-encoding phage in a high-throughput manner. 79

In this study, we developed a rapid qPCR-based stx2-encoding phage quantification method that requires minimal sample preparation prior to amplification.

Using this tool, we investigated the relationship between phage and Stx2 production in a library of 13 E. coli O157:H7 isolates that were previously characterized (25). We also examined the roles of infectious stx2-encoding phage on the accumulation of phage particles and Stx2 in the presence of the host strain E. coli C600. As a result, we observed remarkable variation in Stx2 and stx2-encoding phage production within our strain library and from stx2-encoding prophage-transduced E. coli C600. Importantly, our results also highlight that stx2-encoding prophage vary greatly in their ability to propagate on E. coli C600, and that this impacts the production of Stx2 in a mixed culture. Therefore, we propose that stx2-encoding phage production by E. coli O157:H7 as well as the infectivity and host specificity of the phage produced should be considered in evaluation of the virulence potential of E. coli O157:H7 strains.

3.3 Material and Methods

Bacterial strains and culture media. The bacterial strains and plasmids used in this study are described in Table 3.1. Strains were grown routinely in liquid or solid

Lysogeny Broth medium (LB) (6, 48), and all culture stocks were maintained at -80 °C in

10% glycerol. Chloramphenicol (Cam; 25 µg/ml), cefixime (Cef; 0.05 µg/ml) and/or potassium tellurite (Tel; 2.5 µg/ml) were added to the media where indicated. When selecting for pDS132 loss, LB agar with 5% (w/v) sucrose and without NaCl was used (40). 80

LB-modified agar (21) for phage transduction, phage infection and coincubation assays

was prepared by supplementing LB agar with CaCl2 to a final concentration of 10 mM.

Phage induction and lysate sample collection. Bacteria were grown from frozen

stocks in liquid LB overnight at 37 °C with shaking. The cultures were diluted to an OD600

of 0.05 in either LB (control) or LB supplemented with 45 ng/ml ciprofloxacin (66). They

were grown with shaking at 37 °C and the OD600 was taken every hour to profile the changes in cell densities. After 6 hours, the cultures were centrifuged (4,000 × g, 10

minutes, 4 °C) and the supernatants were filtered through 0.2 µm acetate cellulose

filters (VWR, Philadelphia, PA). The sterile lysates were used immediately or stored at -

80 °C.

Culture supernatant sample preparation and qPCR. In order to quantify stx2-

encoding phage using qPCR, the supernatant samples were first diluted 1:1 (v/v) with

sterile H2O. Incubation for 2 hours at 37 °C with DNase (final concentration 5U/ml)

(Promega, Madison, WI) was conducted to eliminate free DNA that was not encapsulated in a phage particle. The digest was then heated to 90 °C for 15 minutes to inactivate the Dnase. To digest the phage capsule, proteinase K (EMD, Darmtadt,

Germany) was added to a final concentration of 20 µg/ml and the samples were incubated at 60 °C for 1 hour, followed by another 15-minute incubation at 95 °C for enzyme inactivation.

PCR primer pairs that amplify both stx2 and stx2c (stx2A-F/R), and 16S ribosomal

RNA genes (rrsH-F/R) (Table S3.1) have been described previously (3). Each reaction (20 81

µl) contained 10 µl PerfeCta™ SYBR® Green FastMix™ for iQ™ (Quanta, Gaithersburg,

MD), forward and reverse primer (0.1 µM) and 2.5 µl of treated supernatant as template.

Each qPCR assay was run in triplicate, and extracted E. coli O157:H7 Sakai genome DNA

(positive control), as well as no template (negative control) reactions were included.

Slot blot for Stx2 quantification. Slot blot was conducted with a 48-well

Manifold I™ System (Whatman, Piscataway, NJ), after removing cellular debris from the collected supernatant samples by filtration through a 100K Da Amicon Ultra-0.5 ml centrifugal filter (Millipore, Billerica, MA). Supernatant proteins were bound to 0.45 µm

PVDF membranes (Millipore, Billerica, MA) following the manufacturer’s instruction.

Mouse anti-Stx2 mAb targeting the A subunit (Santa Cruz, Santa Cruz, CA), diluted to

1:200 (v/v), was added, followed by 1:15,000 (v/v) diluted IRDye 800CW goat anti- mouse IgG (LI-COR, Lincoln, NE). The Odyssey Infrared Imaging System (LI-COR, Lincoln,

NE) was used for fluorescence detection. Signal intensity from each sample was analyzed using the Odyssey Application Software Version 3.0 and the data are presented as arbitrary units. A linear relationship was observed after plotting fold-dilution of

EDL933 lysate samples against fluorescence intensity (Fig. S3.1).

Transduction of the stx2-encoding phage 933W into E. coli C600. Phage transduction was accomplished by first integrating an antibiotic resistance-encoding suicide plasmid (pDS132) (40) into the prophage genome. A 400 bp internal fragment from stx2a of E. coli O157:H7 strain EDL933 was amplified using stx2INF/R (Table S3.1) and cloned into pDS132. The integrity of the insert was confirmed by sequencing. The 82

constructed plasmid (pDS132::stx2’) was transformed by electroporation into E. coli

SM10λpir, permissive for the replication of the suicide plasmid. Conjugation was

conducted between E. coli SM10λpir(pDS132::stx2’) and EDL933 in the same manner as

previously described (14, 40), and selection for recombinants was performed on LB agar

with Cam, Cef and Tel. Putative EDL933::(pDS132::stx2’) colonies were re-streaked on the same media for purification.

An overnight culture of EDL933::(pDS132::stx2’) was diluted to an OD600 of 0.05

with LB broth and ciprofloxacin was added to 45 ng/ml. The lysate containing the

constructed phage 933W::(pDS132::stx2’) was collected after 6 hour shaking incubation

at 37 °C, and was sterilized by centrifugation (4,000 × g, 10 minutes, 4 °C) and filtration

(0.2 µm acetate cellulose filter). A total of 1.4 ml lysate was then mixed with 7 ml of an overnight E. coli C600 culture (in LB), and poured onto modified LB agar. After overnight static incubation at 37 °C, 500 µl of the mixture was plated onto LB agar with Cam for another overnight incubation. A few Cam resistant transductants were harvested for further experiments.

Selection for spontaneous excision of pDS132 was conducted as previously described (14, 40). Briefly, 0.5 µl of an overnight transduced C600 culture was diluted into 10 ml fresh LB broth and grown with shaking at 37 °C for 8 hours. Selection for plasmid excision was performed on LB agar with 5% sucrose and without NaCl. The integrity of stx2a in the putative lysogens C600::933W was confirmed using PCR with primer pair stx2a-verify-F/R (Table S3.1); the C600 host background was confirmed by 83

PCR followed by sequencing with primer pair uidA-F/R (Table S3.1). In order to

determine the insertion site of 933W in chromosome of C600, a PCR-based method was

performed as previously described (54). The primers involved in this assay (wrbA2-lp,

wrbA2-LJ, wrbA1-up and wrbA1-RJ) are listed in Table S3.1.

Coincubation assays and phage infection. The coincubation and phage infection

assays were derived from those previously described by Gamage at el. (21). For

coincubation, overnight cultures of E. coli O157:H7 and C600 were diluted with fresh LB

broth to an OD600 of 0.05. After shaking incubation at 37 °C for 6 hours, a cocktail was

made with 1 ml E. coli O157:H7 culture, 1 ml C600 culture (both adjusted to OD600 of 2.0)

and 4 ml fresh LB broth. After supplementation with CaCl2 to a final concentration of 10

mM, the cocktail was overlaid onto LB-modified agar. In mono-culture controls, the 1 ml

C600 culture was replaced with 1 ml LB broth. When induction of the stx2-encoding phage was performed, the culture cocktails were supplemented to 45 ng/ml ciprofloxacin. After static overnight incubation at 37 °C, the supernatants were centrifuged (4,000 × g, 10 minutes, 4 °C), filter sterilized (0.2 µm acetate cellulose filter) and quantified for phage and Shiga toxin production. qPCR was used to quantify the phage from coincubation culture (CtO157+C600) and the related mono-culture (CtO157)

control, and the changes were calculated using the following formula: ΔCt = CtO157 –

CtO157+C600.

For phage infection, overnight cultures of E. coli O157:H7 and C600 were diluted

with fresh LB broth to an OD600 of 0.05. Ciprofloxacin was added to E. coli O157:H7 84

cultures to a final concentration of 45 ng/ml. After 6-hour shaking incubation at 37°C,

the lysate from the induced E. coli O157:H7 was collected, centrifuged and filtered. Next,

1 ml lysate, 1 ml C600 culture (OD600 = 2.0) and 4 ml fresh LB broth were combined, supplemented with 10 mM CaCl2, and overlaid onto LB-modified agar. Overnight

incubation and supernatant sampling was performed in the same manner as the coincubation assay described above. As the set up for the phage infection assay involved a 6-fold dilution of the phage lysate, the Ct calculated for the initial phage lysate was adjusted by adding 2.72 cycles (1.055 * log26, See Results for the slope). The changes in

phage level in the lysate before (Ctlysate) and after (Ctlysate+C600) infecting C600 were

calculated as: ΔCt = (Ctlysate + 2.72) – Ctlysate+C600.

Statistical analysis. All Stx2 and stx2-encoding phage quantification experiments

were performed with three biological replicates. Statistical analyses (Student’s t-Test,

one-way ANOVA and Tukey’s Multiple Comparisons) were conducted using Minitab®

16.2.0.

3.4 Results

Design and validation of a qPCR-based method for stx2-encoding phage

quantification. Previous qPCR-based phage quantification methods (27, 46) used steps

such as phage precipitation and organic extraction of DNA that can potentially affect the

repeatability of the assay. Therefore, we developed a new procedure as described in the 85

Material and Methods that does not require extensive phage or DNA purification prior

to qPCR.

In order to validate the reliability of the protocol, a culture supernatant of

EDL933 was sampled 6-hours post-induction with 45 ng/ml ciprofloxacin. Serial 2-fold

dilutions of the lysate were prepared in fresh LB. After sample processing, qPCR was

conducted with primer pair stx2a-F/R (3). This amplified a 108 bp gene fragment from the A subunit of stx2 that is conserved in both Stx2 and Stx2C. For each diluted sample,

the Ct was measured and plotted against the fold-dilution of the lysate, and linear

regression analysis was performed (Fig. 3.1). As expected, this protocol was able to

accurately quantify the 2-fold difference in template concentration between the EDL933

lysate samples (slope = 1.0434), and a linear correlation was observed in all experiments

2 (R = 0.9939). The experiment was repeated for two additional times, and an average

slope of 1.055 and R2 ranging from 0.9917 to 0.9983 was observed, indicating that this

protocol is robust. A primer pair targeting a fragment of the 16S ribosomal RNA genes, with the same amplification efficiency as the previous stx2 reaction (data not shown), was used to detect any remaining chromosomal DNA in processed lysate samples.

Although residual 16S rDNA was observed (Fig. 3.1), the Ct obtained was always at least

10.9 cycles higher than that from stx2 primers. Given that the EDL933 genome carries 7 copies of the 16S rRNA genes (39), the adjusted minimal Ct difference would actually be

10.9 + log27 = 13.7. This result suggested that the remaining chromosome-encoded stx2

did not affect the accuracy of this assay. The no template reaction was consistently

negative for both primer pairs. 86

Quantifying stx2-encoding phage and Stx2 production from E. coli O157:H7 clinical isolates. We evaluated Stx2 production from a collection of previously characterized E. coli O157:H7 clinical isolates (25). We quantified Stx2 and stx2-encoding phage production of each strain 6 hours post-ciprofloxacin induction. A total of 13

strains were compared, which carry different Stx2 variants; PA3 encodes both Stx2 and

Stx2c, PA10 encodes Stx2c and all others encode Stx2 only. PA4, PA16, PA18, PA27,

PA36, PA37, PA46, PA51, and EDL933 also carry stx1. Given that neither our qPCR

primers nor antibody for slot blot differentiates between Stx2 or Stx2c, both alleles will be collectively referred to as stx2 in the following text.

Phage released from each strain was normalized against that from the prototypical strain EDL933 (Fig. 3.2A). The variation in total phage number was

remarkable; a 2600-fold difference was observed between the highest phage producer

(EDL933) and the lowest (PA3). Nevertheless, the variation in Stx2 yield was much

narrower among tested strains (Fig. 3.2B). Additionally, the trend in Stx2 yield didn’t always follow that of phage quantity. For instance, PA11 and PA16 produced very similar amount of phage (Fig. 3.2A), but their total Stx2 yield differed by 11-fold (Fig. 3.2B). This

observation was unexpected, given the fact that genes responsible for Stx2 production,

phage assembly and cell lysis are under control of the same promoter (34, 41, 55, 61).

Production of 933W and Stx2 vary between different 933W lysogens. In order

to investigate the effects of different host backgrounds on the production of phage

particles and Stx2, we designed a protocol for marker-less phage lysogenization. The 87

construction of stx2-carrying lysogen of E. coli C600 was described in the Materials and

Methods. Using a PCR-based method (54), we identified that insertion of 933W occurred within wrbA in C600 (data not shown). Additionally, we attempted to transfer stx2-encoding phage from EDL933, PA4 and PA11 into E. coli C600, E. coli DH5α, and E. coli HS (Table 3.1) using this protocol. No colonies could be seen, however, after plating for lysogens from any of the other phage-host combinations, even when we used different Cam concentrations (5 µg/ml or 12.5 µg/ml) in the plates and various lysate/host ratios (1:35 or 1:70; v/v) in the infection step. This difficulty in obtaining stable lysogens of stx2-encoding phage has been observed before (37).

To compare phage and Stx2 production from EDL933 and C600::933W, the two strains were incubated with or without ciprofloxacin. The OD600 was measured every

hour to profile the changes in cell densities (Fig. S3.2). The growth curves in the absence

of induction were very similar among both lysogens (data not shown). When induced,

bell-shaped induction curves were observed with EDL933 and C600::933W, and both

strains reached a maximal OD600 around hour 3. At this time point, the OD600 of EDL933

was higher than that of C600::933W and the rate of reduction afterwards was faster.

We also incubated the wild-type E. coli C600 with ciprofloxacin. Although the antibiotic inhibited the growth and slowed the OD600 development of the strain, the curve

observed was clearly different from the bell-shape indicative of phage induction (Fig.

S3.3). 88

The amount of 933W released from each strain was quantified by qPCR 6-hours post-induction (Fig. 3.3A). Both EDL933 (p < 0.03, Student’s t-Test) and C600::933W (p <

0.01) produced significantly more phage with induction than without. Yet there was no significant difference in phage yield between the two strains under either inducing or uninducing condition (Fig. 3.3A). Nevertheless, an approximately 12-fold difference in

Stx2 accumulation was observed between EDL933 and C600::933W after induction (Fig.

3.3B, 3.3C). Notably, Stx2 from the uninduced samples were below the detection limit.

Stx2-encoding phage and Stx2 production from E. coli O157:H7 is affected by coincubation with E. coli C600. Gamage et al. (21) suggested that the stx-encoding phage released from E. coli O157:H7 has the potential to infect other intestinal E. coli, leading to amplification of both Stx and stx-encoding phage. In order to characterize this amplification process in a quantitative manner, we performed coincubation assays with

E. coli O157:H7 and E. coli C600. Along with EDL933, Pennsylvania clinical isolates PA2,

PA3, PA10, PA11 and PA51 were selected for this experiment given their diverse host and phage genetic characteristics (Table 3.1).

E. coli O157:H7 was mixed with an equivalent amount of C600 (or liquid LB for mono-culture controls). Ciprofloxacin was added into the mixture prior to overnight incubation to trigger phage induction. The effect of coincubation on the total yield of stx2-encoding phage was determined by calculating the difference between the Ct values from coincubation and mono-culture samples (Fig. 3.4A). A positive ΔCt indicated an increase in phage production during strain coincubation. Variations in phage 89

quantities were observed among strains both in the presence and absence of C600 (Fig.

S3.4), yet none of the differences in Ct values were statistically significant (Minimal p

was seen with PA3, p = 0.087, Paired Student’s t-Test) (Fig. 3.4A). Stx2 quantification

from the coincubation samples and their mono-culture controls were also determined

by slot blot (Fig. 3.4B, 3.4C). Comparing coincubation experiments with mono-culture

controls, an increase in Stx2 was observed with all strains tested except for PA10,

although none of the differences were statistically significant. Therefore, coincubating these E. coli O157:H7 strains with C600 in the presence of ciprofloxacin did not

significantly increase quantities of stx2-encoding phage or Stx2.

The same experiment was also performed without ciprofloxacin induction. In this experiment, yields of stx2-encoding phage from PA2 (p = 0.008), PA3 (p = 0.015), PA51

(p = 0.017) and EDL933 (p = 0.008) were significantly higher in coincubation experiments than from mono-culture controls (Paired Student’s t-Test) (Fig. 3.5A). As for Stx2 (Fig.

3.5B, C), toxin production was only observed upon coincubation of C600 with PA2, PA51 and EDL933 and the yield from PA2 was the highest. No Stx2 could be detected in mono-culture controls.

Infecting E. coli C600 with stx2-encoding phage results in phage and Stx2 production. We hypothesized that stx2-encoding phage were directly responsible for the change in Stx2 yield during the coincubation. In order to test this, a phage infection assay was performed. After 6-hour incubation with ciprofloxacin, culture supernatants from E. coli O157:H7 strains were collected, filter sterilized and mixed with the indicator 90

strain C600. No attempt was made to normalize the number of plaque forming units added in each assay. The quantities of phage were measured before and after infections and the differences were calculated as previously described. A positive ΔCt, indicating multiplication of phage after infecting C600, was observed with all strains tested (Fig.

3.6A). The increase was statistically significant (p < 0.05) for PA2, PA3, PA11 and EDL933

(Paired Student’s t-Test). Notably, the trend in phage accumulation was very similar to that observed during the uninduced coincubation assay (Fig. 3.5A).

Production of Stx2 after phage infection was also determined (Figure 3.6B, C).

Detectable quantities of Stx2 were observed after infecting C600 with the phage from

PA2, PA11, PA51 and EDL933. This assay used ciprofloxacin-induced lysates of O157:H7 as the sources of stx2-encoding phage. Therefore, as much as 1/6 of the Stx2 observed could be due to carryover from the lysate (See Materials and Methods). In instances when the quantity of Stx2 measured after phage infection was less than that before

(PA11, EDL933 and PA3), those levels were approximately 50% different, which indicated that some toxin was still produced during the lytic infection.

3.5 Discussion

The human intestinal tract contains a complex and dynamic microbial ecosystem

14 comprising approximately 10 bacterial cells (24, 57, 63) that represent 500 to 1000

bacterial species (50). E. coli and related bacteria make up around 0.1% of the total

population (15). In addition, the intestinal tract may be colonized concurrently by 91

multiple strains of E. coli and the abundance and ratio of strains to one another may change in a temporal manner (4, 12). It was previously suggested that commensal E. coli may be susceptible to stx-encoding phage (19, 21). Therefore, in addition to the well- documented strain-to-strain variation in Stx production observed with E. coli O157:H7 (2,

3, 13, 38, 44, 45, 68), toxin production may also be driven by the abundance of phage- sensitive E. coli colonizing the intestines. The goals of this current study included: i ) to determine the amount of phage and Stx2 produced by previously characterized strains of E. coli O157:H7 (25); ii ) to determine whether phage and toxin production by an stx2- encoding prophage is affected by the host background; and iii ) to determine whether E. coli O157:H7 strains produce different levels of toxin in the presence of a putatively susceptible E. coli host.

Both phage (Fig. 3.7 part c) and Stx2 (Fig. 3.7 part d) production may contribute to the virulence of E. coli O157:H7. To study these further, we developed a rapid and high throughput qPCR-based method to quantify stx2-encoding phage, and utilized slot blot to quantify Stx2 production. We compared the production of stx2-encoding phage after ciprofloxacin induction among a number of clinical isolates of E. coli O157:H7 and observed a 2600-fold variation in phage yields (Fig. 3.2A). However, the range of Stx2 production from the same sample set was much narrower (Fig. 3.2B), which was in line with a previous report (38). More surprisingly, a discrepancy between phage and Stx2 quantities was observed with several strains. For instance, the Stx2 recovery from PA2 and PA16 were not significantly different, but the phage yield from PA16 was 109-fold higher (Fig. 3.2). Given that the genes responsible for the expression of Stx2 and phage 92

capsular proteins (i.e. late genes) are all under the control of the late promoter PR’, this suggested that phage and/or Stx2 levels may be regulated post-transcriptionally in some strains. Previous studies have investigated phage production (27) and Stx2 production

(22, 38, 44, 68) of induced E. coli O157:H7 individually, yet to our knowledge no study to date has provided an explanation for the disassociation in between them.

Additional mechanisms driving the strain-to-strain variation in Stx2 production are complex and include mechanisms both intrinsic and extrinsic to the O157:H7 strain respectively (Fig. 3.7). Both Stx2 and phage production may be modulated by agents such as antibiotics or nitric oxide that induce or repress the prophage, respectively (Fig.

3.7 part a) (59, 66). We can also hypothesize that differential permeability to these

agents might impact toxin accumulation. Other factors affecting Stx2 production include trans-acting lambda repressor proteins encoded by other prophage within the same host (52). Notably, while similar levels of phage production were observed by EDL933 and C600::933W, their levels of toxin production were dramatically different (Fig. 3.3), implicating additional host-specific factors in Stx2 production. Differences in spontaneous phage induction could also contribute in part to the varying levels of toxin production previously observed in the absence of antibiotics or other agents (69) (Fig.

3.7 part b). Although the mechanisms behind these observations are poorly understood, they may be related to host factors known to impact lambdoid phage induction, such as

RecA (32, 62). 93

Using a collection of clinical E. coli O157:H7 isolates, Gamage et al. demonstrated

that stx2-encoding phage vary in their host range and ability to amplify Stx2 production

during lytic infection (19). In addition, when coincubating C600::933W with C600, the

phage released from the lysogen could lytically infect C600, resulting in increased Stx2

and phage accumulation (21). Since these publications, many studies have shown a

remarkable genetic diversity among E. coli O157:H7 strains (17, 35, 67) as well as their stx-encoding prophage (10, 34, 41, 49). One objective of this project therefore was to extend this work of Gamage et al. (21) using a previously characterized collection of E. coli O157:H7 (25) that are from different lineages or clades, and carry different alleles of stx. This collection included two isolates that carry both stx1 and stx2-encoding phage, two that carry stx2 only, one that carries stx2c only, and one that carries both stx2 and stx2c (Table 3.1). Two strains (PA2 and PA3) in this collection were classified phylogenetically as clade 8, a group previously associated with a higher incidence of HUS

(35). PA51 and EDL933, are both stx1+, stx2+ and therefore similar to the isolates studied

by Gamage et al. (21). When coincubated with C600, strain-to-strain differences in

phage amplification were observed. An ca. 500-fold increase in phage particles was

observed with PA2 and PA3, but changes in phage quantities with PA10 (stx2c only) and

PA11 (stx2 only) were not significant (Fig. 3.5A). Similar trends in phage increase were also observed comparing the uninduced coincubation assay (Fig. 3.5A) and the phage infection assay (Fig. 3.6A), which suggested that lytic infection was the cause of phage amplification (Fig. 3.7 parts e and f). These results suggest that not all stx2-encoding phage have the same host range, infectivity, and/or burst size. 94

Interestingly, the highest levels of phage amplification were seen with the two

clade 8 strains, PA2 (stx2 only) and PA3 (stx2, stx2c), although our assay does not allow us to distinguish whether only one or both phage carried by PA3 were produced. It

would be interesting to know whether the stx2c-encoding phage of PA3 and PA10 both have limited ability to amplify during lytic infection of E. coli C600, or whether they have different host ranges compared to stx2-encoding phage. Therefore, one of our future objectives is to sequence different stx2-encoding phage and investigate the genetic components that are responsible for phage amplification during lytic infection.

Lytic infection of C600 may also increase the production of Stx2. Numerous studies have investigated Stx2 production from O157:H7 strains in the presence and absence of phage-inducing agents (2, 3, 13, 38, 44, 45, 68), and some have used these data as an indicator of virulence potential (2, 3, 13, 44, 68). Clearly, there is validity to this approach, as strains of the phylogenetic group designated lineage II are commonly lower Stx2 producers (68), and are also less frequently associated with human disease

(25, 29). Yet as suggested by Gamage et al. (21), Stx2 can accumulate during a lytic infection (Fig. 3.7 part h), and our data indicated that coincubation of O157:H7 strains with C600 in the absence of ciprofloxacin increased Stx2 production as well (Fig. 3.5).

Most notable was PA2, which produced the highest level of Stx2 among the strains tested, even though this was one of the weakest toxin producers when grown as a pure culture under antibiotic-inducing condition (Fig. 3.2, 3.4). Also, increased toxin production correlated with amplification of phage (Fig. 3.5A). Conversely, our highest toxin producer as a pure culture in the presence of ciprofloxacin, PA11, did not produce 95

detectable levels of Stx2 during coincubation experiments when not induced (Fig. 3.5).

In the same experiment, Stx2 accumulation from PA51 and EDL933 was also lower than

that from PA2. Therefore, the stx2-encoding phage exhibit not only different abilities to

propagate on C600, but also different abilities to produce toxin during these

coincubation experiments. In agreement with the phage quantification experiments (Fig.

3.5A), PA10 also did not produce detectable levels of toxin (Fig. 3.5B). While one of or

both stx2-encoding phage from PA3 replicated well using C600 as a host (Fig. 3.5A), no

detectable Stx2 was produced (Fig. 3.5B), however, this was likely caused by the low

level of phage that spontaneously induce in this strain (Fig. S3.4).

We also noticed that more Stx2 was recovered when coincubating PA2 and C600 in the absence of ciprofloxacin (Fig. 3.6B) than presence (Fig. 3.5B), even though we

expected more phage to be released from PA2 in the latter case (Fig. S3.4). We reason

that the combined infectivity of this phage and high titer after induction can lead to

“lysis from without” (1, 26, 28). In this pathway, multiple phage adsorb to bacteria

simultaneously and lyse the bacterial cell without proliferation or expression of late

genes. This postulation was supported by the fact that no significant increase in phage

quantity was seen when PA2 and C600 were coincubated in the presence of

ciprofloxacin (Fig. 3.4A).

Gamage et al. (21) suggested that susceptibility of intestinal E. coli to stx2- encoding phage plays an important role during toxin production. Our study made the significant observation that phage originating from phylogenetically distinct O157:H7 exhibited great differences in their ability to propagate on a host, and undoubtedly as 96

observed previously (19, 53), this would be host-strain specific (Fig. 3.7 part g). Future

studies will investigate whether the trend of phage production observed here holds true

for other E. coli hosts as well.

This work has important implications for assessing the virulence of O157:H7.

Although strain defined as “clade 8”, a subset of lineage I/II (25, 31), were previously

suggested to be highly virulent (35), these strains are not consistently high Stx2

producer (2, 3, 38). Our study suggests, most notably with clade 8 strain PA2, that the

hierarchy of Stx2 production may be dramatically shifted in the presence of host E. coli

(Fig. 3.7 part h). Our results comparing Stx2 and phage production between EDL933 and

C600::933W (Fig. 3.3) also suggested that toxin accumulation is determined not only by host susceptibility to phage, but also by other undefined features from the host background (Fig. 3.7 part h). As individuals may carry multiple strains of genetically distinct E. coli in their intestines (4, 12), we hypothesize that the susceptibility of these commensals to phage and intrinsic ability of the host strain to amplify toxin production may influence the propensity for infection to proceed to more serious forms of the disease. Temporal shifts (4, 12) in strain composition may play a role as well.

Efforts to evaluate the virulence potential of E. coli O157:H7 strains have generally relied on the in vitro expression of virulence genes (2, 3, 13, 38, 44, 45, 68).

However, results presented here and elsewhere (21) provided reason to believe that

Stx2 production may be significantly altered by the in vivo microflora. Previous studies also quantified Stx2 production by E. coli O157:H7 after phage induction, however, our 97

results suggested that the uninduced condition may be more relevant for some strains

(Fig. 3.5). Therefore, the propensity for a strain to produce Shiga toxin may depend

upon induction of the prophage (Fig. 3.7 parts a and b), the production of Stx2 and

phage post-induction (Fig. 3.7 parts c and d), as well as the nature of the phage itself (Fig.

3.7 parts e, f and h). Elucidating the impact of each of these factors during in vivo infection may be necessary to understand the true virulence potential of an E. coli

O157:H7 strain. As suggested previously (21), the composition of the intestinal

microflora would also affect the severity of disease after O157:H7 colonization (Fig. 3.7

part g).

Our results suggested that a minimal number of infectious phage can lead to

significant production of Stx2. In the absence of inducing antibiotic, the majority of Stx2

accumulation for some strains may occur as the result of lytic infection of susceptible

commensal E. coli. This may explain in part the low infectious dose of this pathogen (51,

58). The genetic mechanisms behind the variations in phage infectivity and host

specificity are subjective to future studies.

3.6 Acknowledgement

This work was funded by USDA-NIFA grant 2009-03611, by start-up funds through the

Penn State University Department of Food Science and College of Agricultural Sciences,

and by the Casida Development Professorship to E.G.D. We would like to thank the help

of t he Penn St ate G enomics C ore Fac ility ( University P ark, P A) f or g enerating D NA 98

sequence i nformation, and Missy H azen fo r her advice o n electronic mic roscopy. W e would a lso like to tha nk Dr. Wei Z hang fo r pr oviding bacterial strains a nd Dr . R obert

Roberts for his comments on the manuscript.

99

3.7 References

1. Abedon, S. T. 2011. Lysis from without. Bacteriophage. 1:46-49 2. Abu-Ali, G. S., L. M. Ouellette, S. T. Henderson, D. W. Lacher, J. T. Riordan, T. S. Whittam, and S. D. Manning. 2010. Increased adherence and expression of virulence genes in a lineage of Escherichia coli O157:H7 commonly associated with human infections. PLoS One 5:e10167. 3. Abu-Ali, G. S., L. M. Ouellette, S. T. Henderson, T. S. Whittam, and S. D. Manning. 2010. Differences in adherence and virulence gene expression between two outbreak strains of enterohaemorrhagic Escherichia coli O157:H7. Microbiology (Reading, Engl.) 156:408-419. 4. Adlerberth, I., F. Jalil, B. Carlsson, L. Mellander, L. A. Hanson, P. Larsson, K. Khalil, and A. E. Wold. 1998. High turnover rate of Escherichia coli strains in the intestinal flora of infants in Pakistan. Epidemiol. Infect. 121:587-598. 5. Batz, M. B., S. A. Hoffmann, and J. G. Morris. 2011. Ranking the risks: the 10 pathogen-food combinations with the greatest burden on public health. Emerging Pathogens Institute, University of Florida, Gainesville. www.rwjf.org/files/research/72267report.pdf 6. Bertani, G. 1951. Studies on lysogenesis. I. The mode of phage liberation by lysogenic Escherichia coli. J. Bacteriol. 62:293-300. 7. Besser, T. E., N. Shaikh, N. J. Holt, P. I. Tarr, M. E. Konkel, P. Malik-Kale, C. W. Walsh, T. S. Whittam, and J. L. Bono. 2007. Greater diversity of Shiga toxin- encoding bacteriophage insertion sites among Escherichia coli O157:H7 isolates from cattle than in those from humans. Appl. Environ. Microbiol. 73:671-679. 8. Beutin, L., G. Krause, S. Zimmermann, S. Kaulfuss, and K. Gleier. 2004. Characterization of Shiga toxin-producing Escherichia coli strains isolated from human patients in Germany over a 3-year period. J. Clin. Microbiol. 42:1099-1108. 9. Beutin, L., A. Miko, G. Krause, K. Pries, S. Haby, K. Steege, and N. Albrecht. 2007. Identification of human-pathogenic strains of Shiga toxin-producing Escherichia coli from food by a combination of serotyping and molecular typing of Shiga toxin genes. Appl. Environ. Microbiol. 73:4769-4775. 10. Brussow, H., C. Canchaya, and W. D. Hardt. 2004. Phages and the evolution of bacterial pathogens: from genomic rearrangements to lysogenic conversion. Microbiol. Mol. Biol. Rev. 68:560-602. 11. Caprioli, A., S. Morabito, H. Brugère, and E. Oswald. 2005. Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Vet. Res. 36:289-311. 12. Caugant, D. A., B. R. Levin, and R. K. Selander. 1981. Genetic diversity and temporal variation in the E. coli population of a human host. Genetics 98:467-490. 13. Dowd, S. E., and J. B. Williams. 2008. Comparison of Shiga-like toxin II expression between two genetically diverse lineages of Escherichia coli O157:H7. J. Food Prot. 71:1673–1678. 14. Dudley, E. G., N. R. Thomson, J. Parkhill, N. P. Morin, and J. P. Nataro. 2006. Proteomic and microarray characterization of the AggR regulon identifies a pheU 100

pathogenicity island in enteroaggregative Escherichia coli. Mol. Microbiol. 61:1267-1282. 15. Eckburg, P. B., E. M. Bik, C. N. Bernstein, E. Purdom, L. Dethlefsen, M. Sargent, S. R. Gill, K. E. Nelson, and D. A. Relman. 2005. Diversity of the human intestinal microbial flora. Science 308:1635-1638. 16. Edelman, D. C., and J. Barletta. 2003. Real-time PCR provides improved detection and titer determination of bacteriophage. Biotechniques 35:368-375. 17. Eppinger, M., M. K. Mammel, J. E. Leclerc, J. Ravel, and T. A. Cebula. 2011. Genomic anatomy of Escherichia coli O157:H7 outbreaks. Proc. Natl. Acad. Sci. U.S.A. 108:20142-20147. 18. Fuller, C. A., C. A. Pellino, M. J. Flagler, J. E. Strasser, and A. A. Weiss. 2011. Shiga toxin subtypes display dramatic differences in potency. Infect. Immun. 79:1329- 1337. 19. Gamage, S. D., A. K. Patton, J. F. Hanson, and A. A. Weiss. 2004. Diversity and host range of Shiga toxin-encoding phage. Infect. Immun. 72:7131-7139. 20. Gamage, S. D., A. K. Patton, J. E. Strasser, C. L. Chalk, and A. A. Weiss. 2006. Commensal bacteria influence Escherichia coli O157:H7 persistence and Shiga toxin production in the mouse intestine. Infect. Immun. 74:1977-1983. 21. Gamage, S. D., J. E. Strasser, C. L. Chalk, and A. A. Weiss. 2003. Nonpathogenic Escherichia coli can contribute to the production of Shiga toxin. Infect. Immun. 71:3107-3115. 22. Grif, K., M. P. Dierich, H. Karch, and F. Allerberger. 1998. Strain-specific differences in the amount of Shiga toxin released from enterohemorrhagic Escherichia coli O157 following exposure to subinhibitory concentrations of antimicrobial agents. Eur. J. Clin. Microbiol. Infect. Dis. 17:761-766. 23. Griffin, P. M., and R. V. Tauxe. 1991. The epidemiology of infections caused by Escherichia coli O157:H7, other enterohemorrhagic E. coli, and the associated hemolytic uremic syndrome. Epidemiol. Rev. 13:60-98. 24. Guarner, F., and J.-R. Malagelada. 2003. Gut flora in health and disease. Lancet 361:512-519. 25. Hartzell, A., C. Chen, C. Lewis, K. Liu, S. Reynolds, and E. G. Dudley. 2011. Escherichia coli O157:H7 of genotype lineage-specific polymorphism assay 211111 and clade 8 are common clinical isolates within Pennsylvania. Foodborne Pathog. Dis. 7:763-768 26. Hu, N.-T., T. Thiel, T. H. G. Jr., and C. P. Wolk. 1981. New Anabaena and Nostoc cyanophages from sewage settling ponds. Virology 114:236-246. 27. Imamovic, L., R. Serra-Moreno, J. Jofre, and M. Muniesa. 2010. Quantification of Shiga toxin 2-encoding bacteriophages, by real-time PCR and correlation with phage infectivity. J. Appl. Microbiol. 108:1105-1114. 28. Jones, L., G. Merz, and J. Wilson. 1968. A lytic factor associated with brucellaphage causing “lysis-from-without”. Cell. Mol. Life Sci. 24:20-22. 29. Kim, J., J. Nietfeldt, and A. K. Benson. 1999. Octamer-based genome scanning distinguishes a unique subpopulation of Escherichia coli O157:H7 strains in cattle. Proc. Natl. Acad. Sci. U.S.A. 96:13288-13293. 101

30. Levine, M. M., E. J. Bergquist, D. R. Nalin, D. H. Waterman, R. B. Hornick, C. R. Young, and S. Sotman. 1978. Escherichia coli strains that cause diarrhoea but do not produce heat-labile or heat-stable enterotoxins and are non-invasive. Lancet 1:1119-1122. 31. Liu, K., S. J. Knabel, and E. G. Dudley. 2009. rhs genes are potential markers for multilocus sequence typing of Escherichia coli O157:H7 strains. Appl. Environ. Microbiol. 75:5853-5862. 32. Livny, J., and D. I. Friedman. 2004. Characterizing spontaneous induction of Stx encoding phages using a selectable reporter system. Mol. Microbiol. 51:1691- 1704. 33. Loś, J. M., P. Golec, G. Wegrzyn, A. Wegrzyn, and M. Loś. 2008. Simple method for plating Escherichia coli bacteriophages forming very small plaques or no plaques under standard conditions. Appl. Environ. Microbiol. 74:5113-5120. 34. Makino, K., K. Yokoyama, Y. Kubota, C. H. Yutsudo, S. Kimura, K. Kurokawa, K. Ishii, M. Hattori, I. Tatsuno, and H. Abe. 1999. Complete nucleotide sequence of the prophage VT2-Sakai carrying the verotoxin 2 genes of the enterohemorrhagic Escherichia coli O157:H7 derived from the Sakai outbreak. Genes Genet. Syst. 74:227-239. 35. Manning, S. D., A. S. Motiwala, A. C. Springman, W. Qi, D. W. Lacher, L. M. Ouellette, J. M. Mladonicky, P. Somsel, J. T. Rudrik, and S. E. Dietrich. 2008. Variation in virulence among clades of Escherichia coli O157:H7 associated with disease outbreaks. Proc. Natl. Acad. Sci. U.S.A. 105:4868-4873. 36. McDonald, J. E., D. L. Smith, P. C. M. Fogg, A. J. McCarthy, and H. E. Allison. 2010. High-throughput method for rapid induction of prophages from lysogens and its application in the study of Shiga toxin-encoding Escherichia coli strains. Appl. Environ. Microbiol. 76:2360-2365. 37. Muniesa, M., J. E. Blanco, M. De Simón, R. Serra-Moreno, A. R. Blanch, and J. Jofre. 2004. Diversity of stx2 converting bacteriophages induced from Shiga-toxin- producing Escherichia coli strains isolated from cattle. Microbiology (Reading, Engl.) 150:2959-2971. 38. Neupane, M., G. S. Abu-Ali, A. Mitra, D. W. Lacher, S. D. Manning, and J. T. Riordan. 2011. Shiga toxin 2 overexpression in Escherichia coli O157:H7 strains associated with severe human disease. Microb. Pathog. 51:466-470. 39. Perna, N. T., G. Plunkett, V. Burland, B. Mau, J. D. Glasner, D. J. Rose, G. F. Mayhew, P. S. Evans, J. Gregor, H. A. Kirkpatrick, G. Pósfai, J. Hackett, S. Klink, A. Boutin, Y. Shao, L. Miller, E. J. Grotbeck, N. W. Davis, A. Lim, E. T. Dimalanta, K. D. Potamousis, J. Apodaca, T. S. Anantharaman, J. Lin, G. Yen, D. C. Schwartz, R. A. Welch, and F. R. Blattner. 2001. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature 409:529-533. 40. Philippe, N., J.-P. Alcaraz, E. Coursange, J. Geiselmann, and D. Schneider. 2004. Improvement of pCVD442, a suicide plasmid for gene allele exchange in bacteria. Plasmid 51:246-255. 102

41. Plunkett Iii, G., D. J. Rose, T. J. Durfee, and F. R. Blattner. 1999. Sequence of Shiga toxin 2 phage 933W from Escherichia coli O157:H7: Shiga toxin as a phage late-gene product. J. Bacteriol. 181:1767-1778. 42. Pollock, K. G. J., T. J. Beattie, B. Reynolds, A. Stewart, and J. M. Cowden. 2007. Clinical management of children with suspected or confirmed E. coli O157 infection. Scott. Med. J. 52:5-7. 43. Riley, L. W., R. S. Remis, S. D. Helgerson, H. B. McGee, J. G. Wells, B. R. Davis, R. J. Hebert, E. S. Olcott, L. M. Johnson, and N. T. Hargrett. 1983. Hemorrhagic colitis associated with a rare Escherichia coli serotype. N. Engl. J. Med. 308:681- 685. 44. Ritchie, J. M., P. L. Wagner, D. W. K. Acheson, and M. K. Waldor. 2003. Comparison of Shiga toxin production by hemolytic-uremic syndrome-associated and bovine-associated Shiga toxin-producing Escherichia coli isolates. Appl. Environ. Microbiol. 69:1059-1066. 45. Rocha, L. B., and R. M. F. Piazza. 2007. Production of Shiga toxin by Shiga toxin- expressing Escherichia coli (STEC) in broth media: from divergence to definition. Lett. Appl. Microbiol. 45:411-417. 46. Rooks, D. J., Y. Yan, J. E. McDonald, M. J. Woodward, A. J. McCarthy, and H. E. Allison. 2010. Development and validation of a qPCR-based method for quantifying Shiga toxin-encoding and other lambdoid bacteriophages. Environ. Microbiol. 12:1194-1204. 47. Rozanov, D. V., R. D’Ari, and S. P. Sineoky. 1998. RecA-independent pathways of lambdoid prophage induction in Escherichia coli. J. Bacteriol. 180:6306-6315. 48. Sambrook, J., and D. W. Russell. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y, 2nd ed. 49. Sato, T., T. Shimizu, M. Watarai, M. Kobayashi, S. Kano, T. Hamabata, Y. Takeda, and S. Yamasaki. 2003. Genome analysis of a novel Shiga toxin 1 (Stx1)- converting phage which is closely related to Stx2-converting phages but not to other Stx1-converting phages. J. Bacteriol. 185:3966-2971. 50. Sears, C. L. 2005. A dynamic partnership: celebrating our gut flora. Anaerobe 11:247-251. 51. Serna Iv, A., and E. C. Boedeker. 2008. Pathogenesis and treatment of Shiga toxin-producing Escherichia coli infections. Curr. Opin. Gastroenterol. 24:38-47. 52. Serra-Moreno, R., J. Jofre, and M. Muniesa. 2008. The CI repressors of Shiga toxin-converting prophages are involved in coinfection of Escherichia coli strains, which causes a down regulation in the production of Shiga toxin 2. J. Bacteriol. 190:4722-4735. 53. Serra-Moreno, R., S. Acosta, J. P. Hernalsteens, J. Jofre, and M. Muniesa. 2006. Use of the lambda Red recombinase system to produce recombinant prophages carrying antibiotic resistance genes. BMC Mol. Biol. 7:31. 54. Serra-Moreno, R., J. Jofre, and M. Muniesa. 2007. Insertion site occupancy by stx2 bacteriophages depends on the locus availability of the host strain chromosome. J. Bacteriol. 189:6645-6654. 103

55. Shimizu, T., Y. Ohta, and M. Noda. 2009. Shiga toxin 2 is specifically released from bacterial cells by two different mechanisms. Infect. Immun. 77:2813-2823. 56. Strockbine, N. A., L. R. Marques, J. W. Newland, H. W. Smith, R. K. Holmes, and A. D. O’Brien. 1986. Two toxin-converting phages from Escherichia coli O157:H7 strain 933 encode antigenically distinct toxins with similar biologic activities. Infect. Immun. 53:135-140. 57. Suau, A., R. Bonnet, M. Sutren, J. J. Godon, G. R. Gibson, M. D. Collins, and J. Doré. 1999. Direct analysis of genes encoding 16S rRNA from complex communities reveals many novel molecular species within the human gut. Appl. Environ. Microbiol. 65:4799-4807. 58. Tuttle, J., T. Gomez, M. P. Doyle, J. G. Wells, T. Zhao, R. V. Tauxe, and P. M. Griffin. 1999. Lessons from a large outbreak of Escherichia coli O157:H7 infections: insights into the infectious dose and method of widespread contamination of hamburger patties. Epidemiol. Infect. 122:185-192. 59. Vareille, M., T. de Sablet, T. Hindré, C. Martin, and A. P. Gobert. 2007. Nitric oxide inhibits Shiga-toxin synthesis by enterohemorrhagic Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 104:10199-10204. 60. Wagner, P. L., D. W. K. Acheson, and M. K. Waldor. 2001. Human neutrophils and their products induce Shiga toxin production by enterohemorrhagic Escherichia coli. Infect. Immun. 69:1934-1937. 61. Wagner, P. L., M. N. Neely, X. Zhang, D. W. K. Acheson, M. K. Waldor, and D. I. Friedman. 2001. Role for a phage promoter in Shiga toxin 2 expression from a pathogenic Escherichia coli strain. J. Bacteriol. 183:2081-2085. 62. Waldor, M. K., and D. I. Friedman. 2005. Phage regulatory circuits and virulence gene expression. Curr. Opin. Microbiol. 8:459-465. 63. Wang, X., S. P. Heazlewood, D. O. Krause, and T. H. J. Florin. 2003. Molecular characterization of the microbial species that colonize human ileal and colonic mucosa by using 16S rDNA sequence analysis. J. Appl. Microbiol. 95:508-520. 64. Weinstein, D. L., M. P. Jackson, J. E. Samuel, R. K. Holmes, and A. D. O’Brien. 1988. Cloning and sequencing of a Shiga-like toxin type II variant from Escherichia coli strain responsible for edema disease of swine. J. Bacteriol. 170:4223-4230. 65. Yokoyama, K., K. Makino, Y. Kubota, M. Watanabe, S. Kimura, C. H. Yutsudo, K. Kurokawa, K. Ishii, M. Hattori, and I. Tatsuno. 2000. Complete nucleotide sequence of the prophage VT1-Sakai carrying the Shiga toxin 1 genes of the enterohemorrhagic Escherichia coli O157:H7 strain derived from the Sakai outbreak. Gene 258:127-139. 66. Zhang, X., A. D. McDaniel, L. E. Wolf, G. T. Keusch, M. K. Waldor, and D. W. Acheson. 2000. Quinolone antibiotics induce Shiga toxin-encoding bacteriophages, toxin production, and death in mice. J. Infect. Dis. 181:664-670. 67. Zhang, Y., C. Laing, M. Steele, K. Ziebell, R. Johnson, A. K. Benson, E. Taboada, and V. P. J. Gannon. 2007. Genome evolution in major Escherichia coli O157:H7 lineages. BMC genomics 8:121. 68. Zhang, Y., C. Laing, Z. Zhang, J. Hallewell, C. You, K. Ziebell, R. P. Johnson, A. M. Kropinski, J. E. Thomas, M. Karmali, and V. P. J. Gannon. 2010. Lineage and host 104

source are both correlated with levels of Shiga toxin 2 production by Escherichia coli O157:H7 strains. Appl. Environ. Microbiol. 76:474-482. 69. Ziebell, K., M. Steele, Y. Zhang, A. Benson, E. N. Taboada, C. Laing, S. McEwen, B. Ciebin, R. Johnson, and V. Gannon. 2008. Genotypic characterization and prevalence of virulence factors among Canadian Escherichia coli O157:H7 strains. Appl. Environ. Microbiol. 74:4314-4323.

105

Figure Legends

FIG. 3.1. stx2-encoding phage quantification in 2-fold serial diluted EDL933 lysate.

Solid circles represent Ct (threshold cycles) reads from qPCR analysis of the stx2 gene and open circles represent the 16S ribosomal RNA genes. Error bars indicating 1 SD from triplicate experiments are included but are too small to be visualized.

FIG. 3.2. Phage (A) and Stx2 (B) production from different E. coli O157:H7 strains 6 hours post-induction with 45 ng/ml ciprofloxacin. (A) Phage quantity from each strain was determined by qPCR, and results presented are relative to that of EDL933 (ΔCt =

CtEDL933 - CtPA isolate). (B) Stx2 quantities were determined using slot blot and analyzed

using the Odyssey Application Software. The Stx2 band intensity was compared with

EDL933. All results were the averages from three biological repeats and error bars

represent 1 SD. Values assigned with different letters were significantly different (p <

0.05, ANOVA with Tukey’s Multiple Comparisons Test).

FIG. 3.3. Quantification of phage and Stx2 from two host strains lysogenized with

933W. (A) 933W was quantified from each lysogen by qPCR after 6 hours incubation

with (solid boxes) and without (open boxes) ciprofloxacin induction. §: Both EDL933 (p <

0.03) and C600::933W (p < 0.01) produced more 933W phage with induction than

without (Student’s t-Test). (B) Representative slot blot result for Stx2 production after

ciprofloxacin induction. Stx2 levels for uninduced cultures were below the detection

limit. (C) The intensity of each Stx2 band was analyzed using the Odyssey Application

Software and is presented in arbitrary units. *: significantly more Stx2 was recovered

from the EDL933 lysate (p < 0.0001, Student’s t-Test). Results for phage and Stx2 106

quantification are the average from three biological repeats and error bars represent 1

SD.

FIG. 3.4. The effect of coincubation with E. coli C600 on the stx2-encoding phage yield

(A) and Stx2 production (B, C) of E. coli O157:H7 strains after overnight incubation in the presence of 45 ng/ml ciprofloxacin. (A) The changes in phage quantities are presented as ΔCt = CtO157 – CtO157+C600. (B) Representative slot blot results of Stx2

production from E. coli O157:H7 strains in the presence (upper panel) or in absence of

C600 (lower panel) are shown. (C) The intensities of Stx2 bands (closed boxes: O157 +

C600, open boxes: O157 alone) were analyzed using the Odyssey Application Software and presented in arbitrary units. All results for phage and Stx2 quantification are the average from three biological repeats and error bars represent 1 SD.

FIG. 3.5. The effect of coincubation with E. coli C600 on the stx2-encoding phage yield

(A) and Stx2 production (B, C) of E. coli O157:H7 after overnight incubation in absence of ciprofloxacin. (A) The changes in phage quantities are presented as ΔCt = CtO157 –

CtO157+C600. *: significantly higher phage yield from coincubation (maximal p < 0.017,

Paired Student’s t-Test). (B) Stx2 production from E. coli O157:H7 strains could only be detected in the presence of C600. Representative slot blot results are shown. (C) The intensities of Stx2 bands were analyzed using the Odyssey Application Software and presented in arbitrary units. All results for phage and Stx2 quantification are the average from three biological repeats and error bars represent 1 SD. 107

FIG. 3.6. Phage (A) and Stx2 (B, C) quantities from phage lysates 6 hours post-induction

with 45 ng/ml ciprofloxacin, and after overnight infection of E. coli C600. (A) The

changes in phage quantities are presented as ΔCt = (Ctlysate +2.72) – Ctlysate+C600. *:

statistically significant difference in phage yield after infecting C600 comparing to before

(p < 0.05, Paired Student’s t-Test). (B) Representative slot blot results of Stx2 production

from E. coli O157:H7 strains before (left column) and after infecting C600 (right column).

(C) The intensities of Stx2 bands (closed boxes: lysate, open boxes: lysate + C600) were

analyzed using Odyssey Application Software and presented in arbitrary units. All results

for phage and Stx2 quantification are the average from three biological repeats and

error bars represent 1 SD.

FIG. 3.7. Factors affecting Stx2 accumulation during an E. coli O157:H7 infection. After

E. coli O157:H7 enters the intestinal tract, the stx2-encoding prophage can initiate the

lytic cycle spontaneously or in response to inducing agents. Phage and Stx2 are produced and released in this process. The stx2-encoding phage can infect susceptible intestinal E. coli and accumulate more phage and Stx2 in a repeated manner. Factors that should be considered in evaluating the virulence potential of E. coli O157:H7 strains are underscored.

108

Table 3.1 Strains, plasmids and phage used in this study

Strain, plasmid or phage Relevant Characteristics Source or Referencea E. coli Strains

Host for maintenance and conjugation of pDS132 SM10λpir Lab collection derivatives C600 K-12 derivative CGSC Sakai O157:H7; stx1, stx2; clade 1; lineage I W. Zhang EDL933 O157:H7; stx1, stx2; clade 3; lineage I STEC Center Partial-merodiploid derivative of EDL933, carry EDL933::(pDS132::stx2') This study fragment of stx2 in pDS132 C600::933W C600 lysogenized with stx2-encoding phage 933W This study PA2 O157:H7; stx2, clade 8; lineage I/II (25) PA3 O157:H7; stx2,stx2c; clade 8; lineage I/II 25) PA4 O157:H7; stx1,stx2; lineage I 25) PA10 O157:H7; stx2c; lineage I/II 25) PA11 O157:H7; stx2; lineage I 25) PA16 O157:H7; stx1,stx2; lineage I 25) PA18 O157:H7; stx1,stx2; lineage I 25) PA27 O157:H7; stx1,stx2; lineage I 25) PA36 O157:H7; stx1,stx2; lineage I 25) PA37 O157:H7; stx1,stx2; lineage I 25) PA46 O157:H7; stx1,stx2; lineage I 25) PA51 O157:H7; stx1,stx2; lineage I 25) DH5α lab strain, high transformation efficiency Lab collection HS Commensal human isolate (30)

Plasmids pDS132 Suicide vector, CamR, KanR, sucrose sensitive (40) pDS132::stx2' pDS132 cloned with a fragment of stx2 This study

Phage

933W stx2-encoding phage from EDL933 (41) 933W::(pDS132::stx2') 933W inserted with pDS132::stx2' This study

1 aCGSC: E. coli Genetic Resources at Yale, the Coli Genetic Stock Center; W. Zhang: Dr. 2 Wei Zhang, Division of Biology; Illinois Institute of Technology; STEC Center: Shiga Toxin 3 Escherichia coli Center at Michigan State University; ATCC: American Type Culture 4 Collection. 109

35

30

y = 0.976log2(x) + 28.019 R² = 0.9908

25 Ct

20

y = 1.0434log2(x)+ 16.632 15 R² = 0.9939

10 1 2 4 8 16 32 Dilution Fold of Lysate

Figure 3.1 110

A B 300.0 a PA2 PA3 PA4 PA10 PA11 PA16 PA18 PA27 PA36 PA37 PA46 PA51 0.00 250.0

-2.00 d c, d

c, d 200.0 c, d -4.00 c, d c, d b c, d c, d c b, c

-6.00 150.0 e d, c, b, c, d, e, f e, d, c, d, e, e, f d, b, c, d, e d, c, b,

Ct EDL933 d, e, e, f d, Δ b -8.00 100.0 b -10.00 e, f e, f f f Percentage Stx2 production 50.0 -12.00 0.0

-14.00 a PA2 PA3 PA4 PA10 PA11 PA16 PA18 PA27 PA36 PA37 PA46 PA51

Figure 3.2 111

A B C 25.00 4.5 * 4

20.00 3.5 § § EDL933 3 15.00 2.5

Ct 2 10.00 C600::933W 1.5

Fluorescence Intensity Fluorescence 1 5.00 0.5

0.00 0 EDL933 C600::933W EDL933 C600::933W

Figure 3.3 10.00 8.00 112 A 6.00 Figure 3.4 4.00 Ct

Δ 2.00 0.00 -2.00 -4.00 PA2 PA3 PA10 PA11 PA51 EDL933

B O157+C600 O157 PA2 PA3 PA10 PA11 PA51 EDL933

C 1.40 1.20

1.00

0.80

0.60

0.40

0.20

Fluorescence Intensity Fluorescence 0.00 PA2 PA3 PA10 PA11 PA51 EDL933 12.00 * * 113 10.00 A Figure 3.5 8.00 * 6.00 *

Ct 4.00 Δ 2.00

0.00

-2.00

-4.00 PA2 PA3 PA10 PA11 PA51 EDL933

B C 2.50

PA2 2.00 PA3 1.50 PA10

PA11 1.00

PA51 0.50

EDL933 Intensity Fluorescence 0.00 PA2 PA3 PA10 PA11 PA51 EDL933 114 A 25.00 * Figure 3.6 20.00 *

15.00 *

Ct 10.00 Δ

5.00 *

0.00

-5.00 PA2 PA3 PA10 PA11 PA51 EDL933 B lysate lysate+C600 C 6.00 PA2 5.00 PA3 4.00 PA10 3.00 PA11 2.00 PA51 1.00 EDL933 0.00 Fluorescence Intensity Fluorescence 115

stx2-encoding phage e) Phage host range and infectivity a) Sensitivity to Intestinal agents that induce c) Phage Intestinal production E. coli or inhibit Stx2 E. coli production strain B strain A f) Phage E. coli amplification Intestinal O157:H7 E. coli strain C b) Spontaneous d) Stx2 h) Stx2 induction production accumulation g) Susceptibility to phage infection Stx2

Figure 3.7 2.5 116 y = 2.055x + 0.1483 R² = 0.9874 2

1.5

1

Fluorescence Intensity Fluorescence 0.5

0 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1

Dilution fold FIG. S3.1. Fluorescence intensity of Stx2 in 2-fold serial diluted EDL933 lysate. After slot-blot, the intensity of Stx2 band from each dilute was analyzed using Odyssey Application Software and presented in arbitrary units. Data presented were the averages from two technical repeats. 117 1

0.8 EDL933 600 0.6 C600::933W OD 0.4

0.2

0 0 1 2 3 4 5 6 7 8 hours

Ciprofloxacin Sampling FIG. S3.2. Induction curves of EDL933 and C600::933W with 45 ng/ml

ciprofloxacin. The incubation lasted for 8 hours and OD600 was measured every hour. All cultures were sampled 6 hours post-ciprofloxacin induction for phage and Stx2 quantification. Data presented are the averages from three biological repeats and error bars represent 1 SD. 118

0.4000

0.3500

0.3000

0.2500 C600 620 0.2000 OD 0.1500 C600::933W

0.1000

0.0500

0.0000 Minutes 0 100 200 300 400 500 600

FIG. S3.3. OD620 development of C600 and C600::933W when incubated with 45 ng/ml ciprofloxacin. The incubation lasted for 10 hours and OD620 was measured every 10 minutes. 119 35.00

30.00

25.00 PA2 20.00 PA3 Ct PA10 15.00 PA11 10.00 PA51 EDL933 05.00

00.00 lysate uninduced lysate+C600 O157+C600 O157+C600 O157 mono- O157 mono- supernatant induced uninduced culture induced culture uninduced FIG. S3.4. Quantifying phage in coincubation assay and phage infection assay using qPCR. Lysate: 6 hours post-ciprofloxacin induction; uninduced supernatant: 6 hours post-incubation; lysate + C600: overnight phage infection; O157 + C600 induced: overnight coincubation of O157 and C600 in presence of ciprofloxacin; O157 + C600 uninduced: overnight coincubation of O157 and C600 in absence of ciprofloxacin; O157 mono-culture induced: overnight incubation of O157 in presence of ciprofloxacin; O157 mono-culture uninduced: overnight incubation of O157 in absence of ciprofloxacin. Data presented are the averages from three biological repeats and error bars represent 1 SD. Table S3.1. Primers used in this study120

Primer Name Sequence Source Annealing Temperature stx2INF AAAAAATCTAGATACACATATATCAGTGCCCG This study 60 °C stx2INR AAAAAATCTAGATATATTATTAAAGGATATTC This study stx2a-verify-F TGTATATTATTTAAATGGGTACTGTGC This study 55 °C stx2a-verify-R CTTTCCCATAATGTATTGTTTATTTTT This study stx2a-F TATATCAGTGCCCGGTGTGA 1 55 °C stx2a-R TGACGACTGATTTGCATTCC 1 rrsH-F CGATGCAACGCGAAGAACCT 1 55 °C rrsH-R CCGGACCGCTGGCAACAAA 1 wrbA2-lp CGAATCGCTACGGAATAGAGA 2 55 °C wrbA2-LJ CCGACCTTTGTACGGATGTAA 2 wrbA1-up AGGAAGGTACGCATTTGACC 2 55 °C wrbA1-RJ ATCGTTCGCAAGAATCACAA 2 uidA-F GAGAGGTTAAAGCCGACAGC This study 55 °C uidA-R CATCGCAGCGTAATGCTCTA This study

1. Abu-Ali, G. S., L. M. Ouellette, S. T. Henderson, T. S. Whittam, and S. D. Manning. 2010. Differences in adherence and virulence gene expression between two outbreak strains of enterohaemorrhagic Escherichia coli O157:H7. Microbiology (Reading, Engl.) 156:408-419. 2. Serra-Moreno, R., J. Jofre, and M. Muniesa. 2007. Insertion site occupancy by stx2 bacteriophages depends on the locus availability of the host strain chromosome. J. Bacteriol. 189:6645-6654. 121

Chapter Four

IDENTIFICATION AND CHARACTERIZATION OF SPONTANEOUS DELETIONS WITHIN THE

SP11-SP12 PROPHAGE REGION OF ESCHERICHIA COLI O157:H7 SAKAI

Chun Chen1, Carrie R. Lewis1†, Kakolie Goswami1§, Elisabeth L. Roberts2※, Chitrita DebRoy2※ and Edward G. Dudley1*

Department of Food Science, the Pennsylvania State University, University Park, Pennsylvania 168021 and E. coli Reference Center, Department of Veterinary Science, The Pennsylvania State University, University Park, Pennsylvania 168022

* Corresponding author. Mailing address: 326 Food Science Building, The Pennsylvania State University, University Park, PA 16802, US. Phone: (814)867‐0439; Email: [email protected]

† Carrie R. Lewis designed the primers for deletion boundary identification and quantified the frequency of spontaneous deletions. §Kakolie Goswami isolated the DNA from the induced lysate of E. coli O157:H7 Sakai and PA10 for sequencing, and performed the data analysis. ※Elisabeth L. Roberts and Chitrita DebRoy provided helps with PFGE.

122

4.1 Abstract

Prophage make up 12% of the enterohemorrhagic Escherichia coli genome, and

they play a prominent role in the evolution and virulence of this foodborne pathogen.

Acquisition, loss and rearrangements within prophage region are the primary causes of

differences in pulsed-field gel electrophoresis (PFGE) patterns among strains of E. coli

O157:H7. Sp11 and Sp12 are two tandem integrated and putatively defective prophage

carried by E. coli O157:H7 strain Sakai. In this study, we identified 3 classes of deletions

that occur within the Sp11-Sp12 region at a frequency of ca. 7.74 × 10-4. One deletion

involved a precise excision of Sp11 and the other two spanned the junction of Sp11 and

Sp12. All deletions resulted in shifts in the XbaI fragment pattern observed by PFGE.

Interestingly, we identified DNA sequencing reads that align with the Sp11-Sp12 region

from the inducible prophage pool of E. coli O157:H7 clinical isolate PA10, suggesting

that the deleted regions may be packaged into mature phage particles. Unexpectedly, deletion containing pchB and psrC, which are Sp11-encoded regulators of type III

secretion, did not affect the secretion levels of the EspA or EspB effectors. Alignment of

the Sp11-Sp12 DNA sequence with its corresponding regions in other E. coli O157:H7

and O55:H7 strains suggested that homologous recombination rather than integrase-

mediated excision is the mechanism behind these deletions. Therefore, this study

explains, in part, a mechanism behind the previously observed genetic instability of this genomic region of E. coli O157:H7.

123

4.2 Introduction

Enterohemorrhagic Escherichia coli (EHEC) O157:H7 is a devastating food-borne pathogen that causes diarrhea, hemorrhagic colitis and hemolytic uremic syndrome

(HUS) (20). The industrialization of agriculture, the expanding scale of food production

and the complicated food distribution chain have been suggested to contribute to the

increased occurrence and scale of E. coli O157:H7 outbreaks (3, 39). One of the best studied strains, designated Sakai, was responsible for a massive outbreak in 1996 that was linked to contaminated radish sprouts and resulted in approximately 12,680 clinical

cases (19, 47). During such outbreaks, molecular subtyping methods including pulse field

gel electrophoresis (PFGE) are used to identify sources and routes of transmission of the

pathogen to the food supply. Although this method has high discriminatory power (5, 9),

one drawback is that the banding patterns can often be unstable due to rearrangements

and deletions within the prophage-containing regions of the genome (25, 26, 45, 52).

The well-studied E. coli O157:H7 strains carry approximately 18 prophage or prophage remnants (15, 22, 41). In the genome of strain Sakai, 11 of its 18 annotated prophage (designated Sp1 through Sp18) are lambdoid, and encode numerous genes related to virulence (1). For instance, Sp5 encodes stx2, which is a toxin strongly associated with the development of HUS (17, 48). Although in silico analysis suggested that many of these prophage are defective, Asadulghani et al. demonstrated that some can be induced, packaged, and may even transduce other E. coli (1). The constant loss and acquisition of prophage are identified as the major mechanisms in the evolution of 124

this pathogen (1, 15, 31, 32, 40, 52). In addition to integrase-mediated phage integration

and excision, homologous recombination between related prophage can also contribute

to the genomic instability of E. coli O157:H7 (26, 52).

E. coli O157:H7 also encodes non-prophage-associated virulence genes that were

acquired by horizontal gene transfer, such as the locus for enterocyte effacement (LEE)

(22). The LEE island is also present in the genome of enteropathogenic E. coli and a mouse pathogen Citrobacter rodentium (11, 35, 36). LEE in Sakai is integrated at the tRNA gene selC; it encodes for an outer membrane protein (intimin), the structural and regulatory genes for a type III secretion system (T3SS), and the effector proteins secreted by the T3SS (22). When E. coli O157:H7 attach to enterocytes, the LEE-

associated protein Tir is translocated from the bacterial cytoplasm across the epithelial

cell membrane, where it serves as a receptor for intimin, an additional LEE-encoded

protein expressed on the bacterial surface. This process leads to the intimate

attachment of bacteria and the effacement of microvilli (7, 10), designated the attaching

and effacing (A/E) phenotype (12, 14).

A variety of virulence functions for LEE-encoding type III secretion effectors have

been described. For example, EspA is involved in forming a physical bridge between the bacterium and the eukaryotic cell surface (29), and EspB is essential for the protein

translocation process and A/E lesion formation (50). Genes within the LEE are regulated

by a number of factors including those that are carried by prophage (16, 27, 28, 46). Of 125

note, the positive regulator pchB (ECs2182) (28) and negative regulator psrC (ECs2191)

(46) are both encoded within Sp11.

In this study, we identified three classes of rare deletion events within the tandem prophage Sp11 and Sp12 of Sakai, and suggest that homologous recombination rather than integrase-mediated excision causes these deletions. These deletions affect the fragment patterns observed by PFGE, which could complicate epidemiologic investigations. Unexpectedly, although the deletions excised pchB and/or psrC from the genome, we did not observe an effect on EspA/B secretion compared to the wild-type strains. Our observation adds to the previous publications (25, 26, 45, 52) that

demonstrate the genomic instability of E. coli O157:H7, while also using high throughout sequencing to define the precise deletion event. Future studies are needed to ascertain the impact of these deletions on host biology.

4.3 Materials and Methods

Bacterial strains and culture media. The bacterial strains and plasmids used in

this study are described in Table 4.1. Strains were routinely grown in liquid or solid

Lysogeny Broth medium (LB) (2). All stocks were maintained at -80 °C in 10% glycerol.

Chloramphenicol (Cam; 25 µg/ml), streptomycin (Str; 100 µg/ml), kanamycin (Kan; 50

µg/ml), cefixime (Cef; 0.05 µg/ml) and/or potassium tellurite (Tel; 2.5 µg/ml) were added to the media if indicated. When selecting for the loss of pDS132-encoded sacB, LB agar with 5% (w/v) sucrose and without NaCl (LB-sucrose agar) was used (42). A Str- 126

resistant (Strr) mutant of E. coli O157:H7 Sakai was selected for by plating overnight

culture of the wild-type strain on LB agar supplemented with Str. Putative Strr colonies

were streaked on the same media for purification.

Screening for spontaneous deletion mutation within the Sp11-Sp12 region of E. coli O157:H7 Sakai. A suicide plasmid-based method, similar to that previously

described (13), was used to detect and quantify the frequency of spontaneous deletions

within Sp11 and Sp12. Using the Sakai genome as a template, PCRs were designed with

primer pairs tDNA5-LL/tDNA5-LR and tDNA5-RL/tDNA5-RR (Table S4.1), which amplified

330 bp upstream (positions 2,189,181-2,189,510 in Sakai genome (GenBank accession

number: BA000007)) and 399 bp (2,189,759-2,190,157) downstream fragments of the

Sp11-encodeded tRNA genes ileZ5-argO5 (tDNA5), respectively. The two amplicons

overlapped by 28 bp, and an NotI site was located within this overlap. Approximately 20

ng of each PCR product and primers tDNA5-LL/tDNA5-RR were used in a second round of PCR. The resulting PCR product was digested with XbaI and cloned into the

corresponding site in pDS132 (42). The constructed plasmid (pDS132::ΔtDNA5) was transformed into E. coli SM10λpir, permissive for the replication of the suicide vector.

Conjugation was conducted between E. coli SM10λpir(pDS132::ΔtDNA5) and Sakai in the

same manner as previously described (13), and the selection for recombinants was performed on LB agar with Cam, Cef and Tel. Putative Sakai::(pDS132::ΔtDNA5) colonies were re-streaked on the same media for purification. 127

Selection for the spontaneous loss of pDS132-encoded sacB, which encodes

levansucrase and results in a sucrose-sensitive phenotype, was preformed as previously

described (13). Briefly, 0.5 µl of an overnight Sakai::(pDS132::ΔtDNA5) culture was

diluted into 10 ml fresh LB broth and grown with shaking at 37 °C for 8 hours. The

selection for plasmid excision was performed by plating aliquots of broth on LB-sucrose

agar. Colonies were harvested, and their sensitivity to Cam was confirmed by replica-

plating on plain LB agar and LB agar supplemented with Cam. For each isolate, PCRs

using primer pairs shown in Table S4.1 were used to estimate the left- and right-

boundaries of each deletion event.

Illumina sequencing and data analysis. Genomic DNA from SK-11 and SK-17

(Table 4.1) was extracted using the Wizard® Genomic DNA Purification Kit (Promega,

Madison, WI) and was submitted to the Institute for Genome Sciences at the School of

Medicine, University of Maryland. The high throughput sequencing was performed using

HiSeq™2000 Sequencing System (Illumina, Hayward, CA). The reads were assembled

using the genome sequence of Sakai as template by SeqMan NGen® (DNASTAR,

Madison, WI), and the sequencing depth reports were generated using SeqMan Pro™

(DNASTAR, Madison, WI). Primer pairs SK11-L/SK11-R and SK17-L/SK17-R (Table S4.1) were designed based on the sequencing result.

Quantifying the frequency of the spontaneous loss of sacB.

Sakai::(pDS132::ΔtDNA1) and Sakai::(pDS132::ΔtDNA3) (Table 4.1) were constructed in

the same manner as described above. Briefly, primer pairs tDNA1-LL/tDNA1-LR and 128

tDNA1-RL/tDNA1-RR were used to generate DNA fragments that flank ileZ1-argN1-

argO1 (530 bp and 700 bp, respectively); and tDNA3-LL/tDNA3-LR and tDNA3-

RL/tDNA3-RR (Table S4.1) were used to generate DNA fragments that flank ileZ3-argO3

(811 bp and 858 bp, respectively). The respective amplicons were concatenated by overlap PCR and cloned into pDS132 in a manner similar to that above for pDS132::ΔtDNA5. The resulting plasmids were transformed into E. coli SM10λpir and transferred into Sakai by conjugation.

The frequency of spontaneous loss of sacB was compared among

Sakai::(pDS132::ΔtDNA5), Sakai::(pDS132::ΔtDNA1) and Sakai::(pDS132::ΔtDNA3).

Bacteria were grown overnight in liquid LB from frozen stocks at 37 °C with shaking. The

cultures were diluted 1:20,000 (v/v) in fresh LB. After another overnight shaking

incubation at 37 °C, each culture was serial diluted and plated on LB agar and LB-sucrose agar. CFUs were determined on both media, and the frequency of sucrose resistant

r (Suc ), which indicated the loss of sacB, was calculated as CFULB-sucrose agar /CFULB agar. For each comparison, two experimental replicates with two biological replicates each were performed.

Primer pairs tDNA1out-L/tDNA1out-R and tDNA3out-L/tDNA3out-R (Table S4.1)

flanked ileZ1-argN1-argO1 and ileZ3-argN3-argO3, respectively. PCRs using these

primers were performed to confirm that Sucr was only caused by homologous recombination-mediated resolution of the plasmid from strains Sakai::(pDS132::ΔtDNA1)

and Sakai::(pDS132::ΔtDNA3). 129

PFGE. PFGE analyses using XbaI or AvrII (isoschizomer of BlnI) (NEB, Ipswich, MA) were performed using the standardized protocol from the Centers for Disease Control and Prevention (24).

Phage DNA isolation and sequencing. Bacteria were grown from frozen stocks in

liquid LB overnight at 37 °C with shaking. The cultures were diluted to an OD600 of 0.05

in LB supplemented with 45 ng/ml ciprofloxacin (53). After 8 hours incubation with

shaking at 37 °C, lysate was collected from the culture supernatants by centrifugation

(4,000 × g, 10 minutes, 4 °C) and filtration (0.2 μm acetate cellulose filter, VWR,

Philadelphia, PA). Phage DNA was then isolated from each lysate using a method similar

to one previously described (1). Briefly, the supernatant samples were incubated with

0.6 U/ml DNase I (Promega, Madison, WI) and 1.8 µg/ml RNase (Promega, Madison, WI)

at 37 °C for 1 hour. Polyethylene glycol 8000 (Promega, Madison, WI) and NaCl were

added to the samples to the final concentrations of 10% (w/v) and 1 M, respectively.

After overnight incubation at 4 °C, the samples were centrifuged at 5,000 × g for 2 hours

(4 °C). The pellet was resuspended in SM buffer (0.58% NaCl, 0.2% MgSO4 7H2O, 1 M

Tris-Cl (pH 7.5) and 0.01% gelatin) and was incubated at 65 °C for 1 hour with⋅ 50 μg/ml

(final concentration) of proteinase K (EMD, Darmtadt, Germany). A phenol-chloroform

extraction was carried out to extract phage DNA. DNA was further purified using the

Clean and Concentrator ™ kit (Zymo Research, Irvine, CA).

The extracted total DNA was submitted to the Penn State Genome Core Facility for sequencing using a Roche GS 454 FLX+ system. The raw reads were assembled using

SeqMan Pro™ (DNASTAR, Madison, WI). The contigs generated from each strain were 130

then aligned against the whole genome sequence of Sakai using the Artemis

Comparison Tool (ACT) (6).

Construction of pchB knockout mutants. Deletion of pchB (ECs2191) in Sakai was performed using a one-step inactivation method (28, 37). Briefly, the Kanr gene aph was amplified using pKD4 (Table 4.1) as template and the primer pair pchBKO-

L/pchBKO-R (Table S4.1), each containing 50 bp homologous region to the 5’ or 3’ end of pchB. The PCR product was electroporated into Sakai harboring pKM200, which encodes

λ Red, Gam and Bet (38), and plated onto LB supplemented with Kan. The pchB mutants were screened from the harvested Kan resistant colonies by PCR using primer pair pchB-

L/pchB-R (Table S4.1). The replacement of pchB with aph increases the size of this

amplicon from 772 bp to 1935 bp as expectation.

Analysis of secreted proteins. Quantification of EspA and EspB secreted from

Sakai and its derivatives was performed using a method adapted from those previously

described (28, 46). Bacteria were grown statically overnight at 37 °C in DMEM (with 4.5

g/L glucose and L-glutamine, without sodium pyruvate, Cellgro, Manassas, VA) from

frozen stocks. A total of 2 ml was diluted into 28 ml of fresh DMEM and incubated

statically at 37 °C until an OD600 of 0.8. The bacteria were removed by centrifugation

(4,000 × g, 30 minutes) and filtration through 0.2 µm acetate cellulose filters (VWR,

Philadelphia, PA). BSA (NEB, Ipswich, MA) was added to the culture supernatant to a final concentration of 2 µg/ml as a co-precipitant, and the secreted proteins in each sample were precipitated with 10% (v/v) trichloroacetic acid. Supernatants were incubated overnight at 4 °C, followed by 30 minutes centrifugation at 4,000 × g. Protein 131

pellets were carefully dried with a Kimwipe (Kimberly-Clark, Neenah, WI), and then dissolved in 120 µl of 1 M Tris-Cl (pH 8.0).

Western blot analysis was performed for protein quantification. A mixture of 8 μl of the resuspended sample and 2 μl 5 × Laemmli buffer (60 mM Tris-Cl pH 6.8, 2% SDS,

10% glycerol, 5% β-mercaptoethanol and 0.01% bromophenol blue) was loaded onto a 4

– 20% precast linear gradient polyacrylamide gel (Bio-Rad, Hercules, CA).

Electrophoresis was conducted in a Mini-PROTEAN® system (Bio-Rad, Hercules, CA) at

180 V for 45 minutes. The same system (40 V, 16 hours, 4 °C) was also used to transfer protein from the polyacrylamide gel to a 0.45 μm PVDF membrane (Millipore, Billerica,

MA). Rabbit anti-EspB, anti-EspA (kindly provided by Dr. James Kaper) and rabbit anti-

BSA (LI-COR, Lincoln, NE) primary and IRDye 680RD goat anti-rabbit IgG (LI-COR, Lincoln,

NE) secondary antibodies were used to probe each membrane. The Odyssey Infrared

Imaging System (LI-COR, Lincoln, NE) was used for fluorescence detection. Signal intensity from each sample was analyzed using the Odyssey Application Software

Version 3.0 and the data are presented as arbitrary units. The percentage of EspA or

EspB secretion (in arbitrary units) from Sakai derivatives, compared with the wild-type

(WT) strain, was calculated as: (Espmutant/BSAmutant)/(EspWT/BSAWT).

Statistical analysis. All protein quantification experiments were preformed with three biological repeats. Data were analyzed using one-way ANOVA by Minitab® 16.2.0.

132

4.4 Results

Identifying spontaneous deletions within tandem prophage Sp11 and Sp12. As

part of a separate study, we attempted to construct chromosomal deletions of the rare

codon tRNA genes (ileZ5 and argO5) encoded within the prophage that was previously

designated Sp11 from E. coli O157:H7 Sakai (22). The protocol, as described before (42),

started with the cloning of DNA fragments that are 5’ and 3’ of the tRNA genes into the suicide vector pDS132. The resulting plasmid, designated pDS132::ΔtDNA5 (Table 4.1), was integrated into the Sakai chromosome as described in the Materials and Methods.

Next, a second crossover involving homologous recombination-mediated excision of the

plasmid was selected for on LB-sucrose agar. We expected this protocol would generate either an ileZ5-argO5 deletion mutant or a WT revertant. We harvested 20 second crossover isolates, and screened for mutants and WT-revertants by PCR using primer

pair tDNA5-LL/ tDNA5-RR (Table S4.1). The sizes of the amplicons were expected to be

either 759 bp (ileZ5-argO5 deletion mutant) or 1001 bp (WT revertant). However, out of

the 20 isolates, 3 appeared to be WT while no amplicon was observed with the other 17

isolates. Given the potential instability of the prophage region where ileZ5-argO5 was

located, we reasoned that the latter isolates may have resulted from genomic deletion(s)

that included one or both of the primer binding sites. PCR reactions involving 11 primer

pairs (Fig. 4.1, Table S4.1) were performed to define the limits of the deleted region(s).

We first hypothesized that the initial PCR failures were due to the excision of the entire Sp11. However, when using primer pair SpLJ-L/SpRJ-R (Table S4.1, Fig. 4.1), which 133

anneal at the 5’ and the 3’ ends of the reported Sp11 integration site, an amplicon was only generated using DNA from SK-18 (Table 4.1) as template. Sequencing of the

amplicon confirmed this strain had a precise deletion of Sp11 (data not shown), and we

designated this event a Type I deletion (Fig. 4.1).

We were also able to identify 2 additional classes of mutants (Fig. 4.1). For the 7

isolates designated as Type II, PCR results were positive when using primer pairs 2185-

F/R and 2274-F/R, but negative when using primer pairs 2189-F/R, 2243-F/R or any that target regions in between (Fig. 4.1). The distances between primers 2185-R/2274-F and

2189-F/2243-R are 60 kb and 38 kb, respectively, providing an estimate of the size of the

deletion. A third class of deletions (Type III) was observed with the remaining 9 isolates,

which were PCR positive when using primer pairs SpLJ-F/R and 2234-F/R, but no

amplification was observed using primer pairs GpH-F/R, SpRJ-F/R or any that targeted

regions in between (Fig. 4.1). The size of the deletion in this case was estimated to be

between 35 kb (distance between GpH-F and SpRJ-R) and 55 kb (SpLJ-R and 2234-F).

Attempts to more precisely define the limits of the DNA deletion using PCR were

hindered by the extensive sequence identity between Sp11 and Sp12 (Fig. S4.1).

This entire experiment was also repeated with Sakai-Strr (Table 4.1). After conjugation and selection for the second crossover, 20 isolates were obtained and screened. Using the PCR-based method described above, we identified that three carried the ileZ5-argO5 deletion, one carried the Sp11 deletion (Type I), 12 were categorized as Type II deletion, and 4 as Type III. 134

Identifying the boundaries of deletions in Sakai derivatives SK-11 and SK-17. In

order to further narrow down the boundaries of SK-11 (Type II deletion) and SK-17 (Type

III deletion) (Table 4.1), we sequenced these two strains using Illumina sequencing. As a

result, we observed average sequencing depths of 235.7 and 279.7 throughout the

genomes of SK-11 and SK-17, respectively. As expected, inconsistency of sequencing

depth was seen within the Sp11-Sp12 region when aligning the reads from whole genomic sequencing of each mutant against the whole genome sequence of wild-type

Sakai (GenBank accession number: BA000007, Fig. 4.2). We therefore suspected

chromosomal gaps in SK-11 and SK-17.

To test the hypothesis above, a PCR was set up using primer pair SK11-L (binding

nucleotide 2,184,026 bp to 2,184,045 bp in Sakai genome) and SK11-R (2,237,331 bp to

2,237,312 bp) (Table S4.1). At an annealing temperature of 64 °C, the PCR resulted in an

amplicon of 2.3 kb when using SK-11 genome as a template; no product was seen when

using the WT Sakai genome as temple (data not shown). An alignment between

2,184,045 bp to 2,186,356 bp (ca. 2.3 kb downstream the left primer) and 2,235,008 bp

to 2,237,320 bp (ca. 2.3 kb upstream the right primer) showed a 99% identity

(2,292/2,314). The two boundaries of the deletion in SK-11 therefore are likely to be

located within these two homologous regions. The estimated total deletion size in this

case was 51.0 kb.

Similar analysis was conducted to identify the boundaries of deletion in SK-17.

Primer pair SK17-L (2,160,569 bp to 2,160,588 bp) and SK17-R (2,213,863 bp to 135

2,213,844 bp) (Table S4.1) amplified a product of 2.5 kb using SK-17 genome as

template (data not shown). The sequences between 2,160,621 bp to 2,163,138 bp in

Sakai genome (2.5 kb downstream the left primer) and 2,211,344 bp to 2,213,863 bp

(2.5 kb upstream the right primer) are 98% identical (2,460/2,523). Therefore, the two

boundaries of the deletion in SK-17 locate within these two homologous regions; the

estimated size of this deletion was 50.8 kb.

Frequency of deletion events involving prophage Sp11 and Sp12. The combined

frequency of these deletions within Sp11 and Sp12 was quantified by measuring the loss

of the counter-selective marker sacB from Sakai::(pDS132::ΔtDNA5).

After an overnight incubation of Sakai::(pDS132::ΔtDNA5), the average frequency of reversion to Sucr was 9.1 × 10-4 (Table 4.2). As 34 out of the 40 deletions

characterized above were Type I, II or III, we estimated the rate of spontaneous deletion to be 7.74 × 10-4, while that of a plasmid-mediated second crossover to be 1.37 × 10-4. In order to determine whether large deletions also occur surrounding tRNA genes encoded within other lambdoid prophage found within the Sakai genome, we performed similar experiments using Sakai::(pDS132::ΔtDNA1) and Sakai::(pDS132::ΔtDNA3) (Table 4.1).

These two strains contain pDS132 derivatives integrated at the Sp4-encoding ileZ1-

argN1-argO1 operon and Sp9-encoding ileZ3-argO3 operon. Similar to ileZ5-argO5, these genes are localized immediately downstream of the predicted prophage late promoter (22). The frequencies of reversion to Sucr in Sakai::(pDS132::ΔtDNA1) and

Sakai::(pDS132::ΔtDNA3) after overnight incubation in LB were 4.9 × 10-5 and 2.1 × 10-4, 136

respectively (Table 4.2). Ten Sucr colonies derived from Sakai::(pDS132::ΔtDNA1) and 10

from Sakai::(pDS132::ΔtDNA3) were picked and PCR amplified with primer pairs

tDNA1outL/R and tDNA3outL/R (Table S4.1), respectively. The PCR results indicated that all 20 Sucr isolates underwent plasmid-mediated second crossover, resulting in either deletions of the tRNA genes or WT revertants (data not shown).

Type I, II, and III deletions change the XbaI pulsotype of strain Sakai. WT Sakai

and derivative strains SK-18 (Type I), SK-11 (Type II) and SK-17 (Type III) (Table 4.1) were

analyzed by PFGE using the restriction enzyme XbaI. In the vicinity of Sp11 and Sp12

within the Sakai genome, there are 3 XbaI sites positioned at nucleotides 2,014,272,

2,199,534, and 2,357,116 (5’ ends of the restriction sites). The PCR results described

above predicted that the middle restriction site would be absent in all deletion mutants

(Fig. 4.1), resulting in the disappearance of 187 kb and the 157 kb bands seen by XbaI-

PFGE analysis of WT, and the appearance of 298 kb (for SK-18) or 293 kb (for SK-11 and

SK-17) bands in the deletion derivatives. As expected (Fig. 4.3), the 187 kb band clearly disappeared from all three mutants, though we were unable to identify the disappearance of the 157 kb band or the emergence of new 298 or 293 kb bands. This was probably due to the presence of overlapping bands of similar sizes (Fig. 4.3).

Presence of Sp11-Sp12 chimerical inducible phage. Our next question was whether excised Sp11-Sp12 DNA might be packaged inside phage particles. We

performed high throughout sequencing on the ciprofloxacin-induced prophage pools

from Sakai and other E. coli O157:H7 strains including a clinical isolate previously 137

designated PA10 (K. Goswami, C. Chen and E. Dudley, unpublished data, (21)). A total of

34,324 and 20,695 reads from Sakai and PA10 lysates were assembled into contigs,

respectively. No assembled contigs from the sequencing of Sakai lysate could be aligned

within this region; we observed that 93.8% of the Sakai reads could be mapped within

Sp5, its stx2-encoding phage. Interestingly, among the 119 contigs generated from the

sequencing of the PA10 phage pool, 8 were mapped within Sp11 and Sp12 using Sakai

genome as a template (Fig. 4.4). The 8 contigs comprised 66,219 bp at an average

sequencing depth of 58 ×, and aligned best between nucleotide 2,184,067 and

2,233,139 in the Sakai chromosome. Notably, contig 20 contains the sequence of the

junction of Sp11 and Sp12 (Fig. 4.4).

The effect of pchB deletion on the expression of EspA and EspB. Iyoda et al. (28) reported that a strain of E. coli O157:H7 Sakai lacking the Sp11-encoded pchB had an

approximately 50% reduction in EspB expression. Among our mutants, this gene is

present in strains with Type II deletion but absent in Type I and III deletion strains. In

order to determine whether these deletions impacted Esp secretion, we evaluated

protein accumulation in supernatants using a Western blot assay (Fig. 4.5A). The three strains, SK-18 (Type I), SK-11 (Type II) and SK-17 (Type III) (Table 4.1) were chosen as

representatives of each deletion class. WT Sakai and the pchB knockout mutant,

SKΔpchB (Table 4.1) were included as controls. We normalized the secretion of Esp

proteins from each mutant strain against that of WT Sakai (Fig. 4.5B). Although slight

differences in Esp secretion levels were seen among the Sp11-Sp12 deletion mutants,

the differences were not significant (p = 0.54, One-way ANOVA). 138

4.5 Discussion

Prophage make up of a significant fraction of the EHEC genome, and their

contribution to both evolution and virulence has been well documented (15, 40). Sakai,

one of prototypical strains of E. coli O157:H7, carries a total of 18 prophage and 6

prophage-like elements, which make up 16% of the chromosome (22). Though in silico

analysis suggested that most of these prophage are defective, many still excise, undergo packaging, and can be transduced into a recipient (1). The high sequence similarity among prophage provides the potential for large-scale recombination within the

bacterial chromosome (25, 26, 52), which also contributes to the genetic instability of

the bacterial genome. In the current study, we identified and characterized a group of

deletion events within the tandem prophage Sp11 and Sp12 in Sakai, and evaluated the effects of these mutations on PFGE patterns and on the secretion of two T3SS proteins.

Both Sp11 and Sp12 are lambdoid prophage of approximately 46 kb in size (22).

Previously in silico analysis (1) of these two prophage identified disruptions in both of their integrase genes. Integrase is essential to phage integration and excision. Therefore, both Sp11 and Sp12 were predicted to be defective for mobilization (1). Two very intriguing features of these two prophage are i) their concatenated organization (22), and ii) their high DNA sequence identity within regions that regulate phage replication and encode viral morphogenesis proteins (Fig. S4.1). Tandem prophage could result from either two phage targeting one common integration site, or integration of an incoming phage into an existing prophage by homologous recombination. The former 139

mechanism likely occurred at the thrW site in E. coli O157:H7 Sakai, the reported

integration site for both the lambdoid prophage Sp1 and the P4-like prophage Sp2 (22).

Recombination between a full-length stx1-encoding phage and a homologous prophage

was suggested to be an important step in the emergence of stx1+, stx2+ strains of

O157:H7 (33, 44).

Tandem integration of prophage analogous to Sp11-Sp12 is also observed in two other fully sequenced E. coli O157:H7 strains, EC4115 (GenBank accession number:

NC011353) and TW14395 (GenBank accession number: NC013008) (Fig. S4.2A and B).

Notably, there is high sequence identity between the tandem phage regions in EC4115 and TW14395 (Fig. S4.3). However, in the corresponding region of another fully sequenced E. coli O157:H7 strain EDL933 (GenBank accession number: NC002655, Fig.

S4.2C), we only observed remnants of two truncated prophage (41). This observation indicated the genetic instability of this region, as Sakai is phylogenetically closer to

EDL933 than it is to EC4115 or TW14395 (34). Additionally, we did not observe tandem prophage with high sequence similarity to Sp11 and Sp12 in the corresponding genomic region of E. coli O55:H7 (Fig. S4.4), the predecessor of O157:H7 (32, 33, 49, 54). These observations collectively highlighted the dynamic changes within this region that have occurred during the course of O157:H7 evolution.

Genomic instability involving the Sp11-Sp12 prophage region has been reported

previously, though few reports provided detailed insight into the mechanism(s) behind

this. For example, Iguchi et al. (26) and Kotewicz et al. (30) identified several 140

chromosomal inversions that were between 250 kb and 1.4 Mb in size within regions

corresponding to Sp11-Sp12. In the present study, we identified 3 different deletion

events within the Sp11-Sp12 prophage region: one led to the deletion of entire Sp11

prophage (Type I); a second occurred approximately between ECs2185 and ECs2274

(Type II); and a third occurred approximately between ECs2154 and ECs2234 (Type III)

(Fig. 4.1). By performing biological repeats, we observed that these deletion events are repeatable and most often occur within regions of DNA homology shared between Sp11 and Sp12 (Fig. 4.1, Fig. S4.1). All three classes of deletions resulted in altered XbaI PFGE patterns compared to the WT (Fig. 4.3). Another restriction enzyme often used in the

PFGE assay for E. coli O157:H7 is BlnI (24). According to the published Sakai genome sequence (GenBank accession number: BA000007), the two BlnI sites located in

1,690,887 and 2,561,471 (5’ ends of the restriction sites) flank the entire Sp11-Sp12 region. Therefore, all deletions characterized here would alter an 871 kb WT band to one between 811 kb and 836 kb (depending on the size of the deletions). However, this shift could not have been resolved in our PFGE system.

In order to quantify the frequency of deletion events within the Sp11-Sp12

region, we examined the rate of reversion to Sucr isolates after overnight growth of

Sakai::(pDS132::ΔtDNA5). The Sucr phenotype requires the loss of the counter-selective

marker sacB; for Sakai::(pDS132::ΔtDNA5), this could occur through either a second

crossover event that resolves the integrated plasmid, or large deletions as described

above. Sakai::(pDS132::ΔtDNA1) and Sakai::(pDS132::ΔtDNA3) were included as controls,

which were constructed similarly by integrating the sacB-encoding pDS132 into the 141

tRNA genes encoded within the prophage Sp4 and Sp9 (22). Importantly, these two prophage were previously shown to be capable of excision, however, the rates were

never quantified (1). For Sakai::(pDS132::ΔtDNA1) and Sakai::(pDS132::ΔtDNA3), all Sucr

colonies arose through resolution of the integrated plasmid, and the frequency of obtaining Sucr colonies was approximately 4 - 15 fold lower than that observed with

Sakai::(pDS132::ΔtDNA5). Therefore the Sp11-Sp12 region excises much more frequently than Sp4 or Sp9. Of note, this frequency of excision (7.74 × 10-4) observed

within the Sp11-Sp12 is similar to that reported for the complete excision of O-island 43

and O-island 48 in EDL933 (4).

The two mechanisms that could explain the observed deletion events are

recombination between homologous regions of Sp11 and Sp12 and integrase-mediated

phage excision. Sequences of high similarity can be found in different prophage

(explaining the scattered matching within Sp11-Sp12 region when aligning the reads

from the genomic sequencing of SK-11 or SK-17 against WT Sakai, Fig. 4.2). Homologous recombination between prophage was reported to be one of the primary causes of

genomic deletions and rearrangements in E. coli O157:H7 (26, 30, 45, 52). Several

observations from the current study support this assumption. First, the predicted or known boundaries of each class of the deletions are located within the homologous

DNA regions between Sp11 and Sp12 (Fig. 4.1, Fig. S4.1). For example, Sp11 and Sp12 share identical sequences in the first 284 bp of their 5’ end (indicated by the vertical red bar in the ACT alignment on the left side of Fig. S4.1), which we speculate could promote the formation of Type I deletions. Similar arguments can be made to explain 142

Type II and Type III deletions (Fig. S4.1). First the 5’ and 3’ ends of deletions observed in

strains SK-11 (Type II) and SK-17 (Type III) were all internal to regions longer than 2 kb

that are homologous between Sp11 and Sp12 (Fig. 4.2). Second, neither Sp11 nor Sp12

is predicted to encode functional integrase (1), which is essential for phage excision. Last

but not least, we repeatedly observed a lower frequency of Type I deletions compared with the other two classes (Fig. 4.1, Fig. S4.1), which is in line with the previously reported correlation between the frequency of homologous recombination and the length of homologous sequence (18).

Asadulghani et al. (1) suggested through in silico analysis that neither Sp11 nor

Sp12 were capable of excising from the genome. Interestingly, using high throughput

sequencing of the inducible prophage pool, we assembled a series of contigs from E. coli

O157:H7 clinical isolate PA10 that could be mapped onto the Sp11-Sp12 region of Sakai

(Fig. 4.4). This observation suggested the presence of an encapsulated phage whose

genome is a chimera of Sp11 and Sp12. Without further genomic sequence information

regarding PA10, it is difficult to determine whether this hypothetical phage derived from two tandem prophage that are similar to Sp11 and Sp12 in sequence and organization, or whether it originated from a single lambdoid prophage of approximately 66 kb (Fig.

4.4). We noticed that 93.8% of the sequence reads generated from the Sakai lytic phage pools were mapped within the stx2-encoding Sp5. Therefore, if the excision of a chimerical phage did occur in Sakai, it would have been difficult to identify without a higher depth of sequencing. 143

E. coli O157:H7 acquired many of its virulence-related genes through phage-

mediated horizontal gene transfer (40, 43). Some of these prophage-encoded genes are transcriptional regulators of other virulence genes. Examples include the pch genes (23,

28, 51), psr genes (46), and rgdR (16), which were shown to regulate the expression of

genes within the LEE island. Interestingly, Sp11 encodes both a positive LEE regulator

(pchB) and a putative negative regulator (psrC) (Fig. 4.1). Therefore, we chose SK-18

(pchB-, psrC-), SK-11 (pchB+, psrC-), and SK-17 (pchB-, psrC-) and compared secretion

levels of EspA and EspB in each (Fig. 4.5A). A pchB knockout mutant (SKΔpchB) was also constructed. Iyoda et al. (28) reported that this mutation results in an approximately 50% reduction in the secretion of EspB/EspD (their methodology did not permit differentiation of EspB and EspD). However, we did not observe a difference in EspA or

EspB secretion levels among our mutants and the wild-type (Fig. 4.5B). These results

were contrary to the previous report (28), and may be due to the difference between E.

coli Sakai strains used within different laboratories. We also noticed some difference

between our experimental settings that may explain the difference. For example, when evaluating EspB secretion level, we performed a Western blot assay using EspB-specific antibody, but the previous study used Coomassie Brilliant Blue staining. By SDS-PAGE,

EspB and EspD have the same apparent electrophoretic mobility. Given that our

approach more specifically quantifies EspB, we conclude that the deletion events within

Sp11-Sp12 region do not significantly affect the secretion of either EspB or EspA.

In conclusion, this study provides mechanistic insight into the previously

reported genomic instability within the Sp11-Sp12 prophage region. While the observed 144

deletions may excise regulators of the E. coli O157:H7 T3SS, we were unable to

demonstrate an effect on secretion, at least with EspA or EspB. However, the deletions

were shown to affect DNA fragment patterns observed by PFGE. This adds to a number

of previous reports (25, 26, 45, 52) describing mechanisms of genomic rearrangements

in E. coli O157:H7 that may limit the reliability of PFGE in epidemiology studies. The

genetic mechanisms promoting these deletions and their potential impacts on host biology are subjects for future study.

4.6 Acknowledgement

This work was funded by USDA‐NIFA grant 2009‐03611, by start‐up funds

through the Penn State University Department of Food Science and College of

Agricultural Sciences, and by the Casida Development Professorship to E.G.D. We would

like to thank the help of the Penn State Genomics Core Facility (University Park, PA) for

generating DNA Sequence information. We would also like to thank Dr. James Kaper and

Jane Michalski (University of Maryland, School of Medicine) for providing the antibodies,

Dr. Mark Eppinger (University of Maryland, School of Medicine, Institute for Genome

Sciences), and Dr. Wei Zhang (Illinois Institute of Technology, Division of Biology) for

providing bacterial strain.

145

4.7 Reference

1. Asadulghani, M., Y. Ogura, T. Ooka, T. Itoh, A. Sawaguchi, A. Iguchi, K. Nakayama, and T. Hayashi. 2009. The defective prophage pool of Escherichia coli O157: prophage-prophage interactions potentiate horizontal transfer of virulence determinants. PLoS Pathog. 5:e1000408. 2. Bertani, G. 1951. Studies on lysogenesis. I. The mode of phage liberation by lysogenic Escherichia coli. J. Bacteriol. 62:293–300. 3. Beutin, L. 2006. Emerging enterohaemorrhagic Escherichia coli, causes and effects of the rise of a human pathogen. J. Vet. Med. B 53:299–305. 4. Bielaszewska, M., B. Middendorf, P. I. Tarr, W. Zhang, R. Prager, T. Aldick, U. Dobrindt, H. Karch, and A. Mellmann. 2011. Chromosomal instability in enterohaemorrhagic Escherichia coli O157:H7: impact on adherence, tellurite resistance and colony phenotype. Mol. Microbiol. 79:1024–1044. 5. Byrne, C. M., I. Erol, J. E. Call, C. W. Kaspar, D. R. Buege, C. J. Hiemke, P. J. Fedorka-Cray, A. K. Benson, F. M. Wallace, and J. B. Luchansky. 2003. Characterization of Escherichia coli O157:H7 from Downer and Healthy Dairy Cattle in the Upper Midwest Region of the United States. Appl. Environ. Microbiol. 69:4683–4688. 6. Carver, T. J., K. M. Rutherford, M. Berriman, M.-A. Rajandream, B. G. Barrell, and J. Parkhill. 2005. ACT: the Artemis Comparison Tool. Bioinformatics 21:3422– 3423. 7. Creuzburg, K., B. Middendorf, A. Mellmann, T. Martaler, C. Holz, A. Fruth, H. Karch, and H. Schmidt. 2011. Evolutionary analysis and distribution of type III effector genes in pathogenic Escherichia coli from human, animal and food sources. Environ. Microbiol. 13:439–452. 8. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 97:6640–6645. 9. Davis, M. A., D. D. Hancock, T. E. Besser, and D. R. Call. 2003. Evaluation of pulsed-field gel electrophoresis as a tool for determining the degree of genetic relatedness between strains of Escherichia coli O157:H7. J. Clin. Microbiol. 41:1843–1849. 10. Delahay, R. M., G. Frankel, and S. Knutton. 2001. Intimate interactions of enteropathogenic Escherichia coli at the host cell surface. Curr. Opin. Infect. Dis. 14:559–565. 11. Deng, W., Y. Li, B. A. Vallance, and B. B. Finlay. 2001. Locus of enterocyte effacement from Citrobacter rodentium: sequence analysis and evidence for horizontal transfer among attaching and effacing pathogens. Infect. Immun. 69:6323–6335. 12. Donnenberg, M. S., J. B. Kaper, and B. B. Finlay. 1997. Interactions between enteropathogenic Escherichia coli and host epithelial cells. Trends Microbiol. 5:109–114. 146

13. Dudley, E. G., N. R. Thomson, J. Parkhill, N. P. Morin, and J. P. Nataro. 2006. Proteomic and microarray characterization of the AggR regulon identifies a pheU pathogenicity island in enteroaggregative Escherichia coli. Mol. Microbiol. 61:1267–1282. 14. Elliott, S. J., L. A. Wainwright, T. K. McDaniel, K. G. Jarvis, Y. Deng, L.-C. Lai, B. P. McNamara, M. S. Donnenberg, and J. B. Kaper. 1998. The complete sequence of the locus of enterocyte effacement (LEE) from enteropathogenic Escherichia coli E2348/69. Mol. Microbiol. 28:1–4. 15. Eppinger, M., M. K. Mammel, J. E. Leclerc, J. Ravel, and T. A. Cebula. 2011. Genomic anatomy of Escherichia coli O157:H7 outbreaks. Proc. Natl. Acad. Sci. U. S. A. 108:20142–20147. 16. Flockhart, A. F., J. J. Tree, X. Xu, M. Karpiyevich, S. P. McAteer, R. Rosenblum, D. J. Shaw, C. J. Low, A. Best, V. Gannon, C. Laing, K. C. Murphy, J. M. Leong, T. Schneiders, R. La Ragione, and D. L. Gally. 2012. Identification of a novel prophage regulator in Escherichia coli controlling the expression of type III secretion. Mol. Microbiol. 83:208–223. 17. Friedrich, A. W., M. Bielaszewska, W.-L. Zhang, M. Pulz, T. Kuczius, A. Ammon, and H. Karch. 2002. Escherichia coli harboring Shiga toxin 2 gene variants: frequency and association with clinical symptoms. J. Infect. Dis. 185:74–84. 18. Fujitani, Y., K. Yamamoto, and I. Kobayashi. 1995. Dependence of frequency of homologous recombination on the homology length. Genetics 140:797–809. 19. Fukushima, H., T. Hashizume, Y. Morita, J. Tanaka, K. Azuma, Y. Mizumoto, M. Kaneno, M. O. Matsu-Ura, K. Konma, and T. Kitani. 1999. Clinical experiences in Sakai City Hospital during the massive outbreak of enterohemorrhagic Escherichia coli O157 infections in Sakai City, 1996. Pediatr. Int. 41:213–217. 20. Griffin, P. M., and R. V. Tauxe. 1991. The epidemiology of infections caused by Escherichia coli O157: H7, other enterohemorrhagic E. coli, and the associated hemolytic uremic syndrome. Epidemiol. Rev. 13:60–98. 21. Hartzell, A., C. Chen, C. Lewis, K. Liu, S. Reynolds, and E. G. Dudley. 2011. Escherichia coli O157:H7 of genotype lineage-specific polymorphism assay 211111 and clade 8 are common clinical isolates within Pennsylvania. Foodborne Pathog. Dis. 8:763–768. 22. Hayashi, T., K. Makino, M. Ohnishi, K. Kurokawa, K. Ishii, K. Yokoyama, C. G. Han, E. Ohtsubo, K. Nakayama, and T. Murata. 2001. Complete genome sequence of enterohemorrhagic Escherichia coli O157: H7 and genomic comparison with a laboratory strain K-12. DNA Res. 8:11–22. 23. Honda, N., S. Iyoda, S. Yamamoto, J. Terajima, and H. Watanabe. 2009. LrhA positively controls the expression of the locus of enterocyte effacement genes in enterohemorrhagic Escherichia coli by differential regulation of their master regulators PchA and PchB. Mol. Microbiol. 74:1393–1411. 24. Hunter, S. B., P. Vauterin, M. A. Lambert-Fair, M. S. Van Duyne, K. Kubota, L. Graves, D. Wrigley, T. Barrett, and E. Ribot. 2005. Establishment of a universal size standard strain for use with the PulseNet standardized pulsed-field gel 147

electrophoresis protocols: converting the national databases to the new size standard. J. Clin. Microbiol. 43:1045–1050. 25. Iguchi, A., R. Osawa, J. Kawano, A. Shimizu, J. Terajima, and H. Watanabe. 2002. Effects of repeated subculturing and prolonged storage at room temperature of Enterohemorrhagic Escherichia coli O157:H7 on pulsed-field gel electrophoresis profiles. J. Clin. Microbiol. 40:3079–3081. 26. Iguchi, A., S. Iyoda, J. Terajima, H. Watanabe, and R. Osawa. 2006. Spontaneous recombination between homologous prophage regions causes large-scale inversions within the Escherichia coli O157:H7 chromosome. Gene 372:199–207. 27. Islam, M. S., L. E. H. Bingle, M. J. Pallen, and S. J. W. Busby. 2011. Organization of the LEE1 operon regulatory region of enterohaemorrhagic Escherichia coli O157:H7 and activation by GrlA. Mol. Microbiol. 79:468–483. 28. Iyoda, S., and H. Watanabe. 2004. Positive effects of multiple pch genes on expression of the locus of enterocyte effacement genes and adherence of enterohaemorrhagic Escherichia coli O157:H7 to HEp-2 cells. Microbiology 150:2357–2371. 29. Knutton, S., I. Rosenshine, M. J. Pallen, I. Nisan, B. C. Neves, C. Bain, C. Wolff, G. Dougan, and G. Frankel. 1998. A novel EspA-associated surface organelle of enteropathogenic Escherichia coli involved in protein translocation into epithelial cells. EMBO J. 17:2166–2176. 30. Kotewicz, M. L., S. A. Jackson, J. E. LeClerc, and T. A. Cebula. 2007. Optical maps distinguish individual strains of Escherichia coli O157:H7. Microbiology (Reading, Engl.) 153:1720–1733. 31. Kudva, I. T., P. S. Evans, N. T. Perna, T. J. Barrett, F. M. Ausubel, F. R. Blattner, and S. B. Calderwood. 2002. Strains of Escherichia coli O157:H7 differ primarily by insertions or deletions, not single-nucleotide polymorphisms. J. Bacteriol. 184:1873–1879. 32. Kyle, J. L., C. A. Cummings, C. T. Parker, B. Quiñones, P. Vatta, E. Newton, S. Huynh, M. Swimley, L. Degoricija, M. Barker, S. Fontanoz, K. Nguyen, R. Patel, R. Fang, R. Tebbs, O. Petrauskene, M. Furtado, and R. E. Mandrell. 2012. Escherichia coli serotype O55:H7 diversity supports parallel acquisition of bacteriophage at Shiga toxin phage insertion sites during evolution of the O157:H7 lineage. J. Bacteriol. 194:1885–1896. 33. Leopold, S. R., V. Magrini, N. J. Holt, N. Shaikh, E. R. Mardis, J. Cagno, Y. Ogura, A. Iguchi, T. Hayashi, A. Mellmann, H. Karch, T. E. Besser, S. A. Sawyer, T. S. Whittam, and P. I. Tarr. 2009. A precise reconstruction of the emergence and constrained radiations of Escherichia coli O157 portrayed by backbone concatenomic analysis. Proc. Natl. Acad. Sci. U. S. A. 106:8713–8718. 34. Manning, S. D., A. S. Motiwala, A. C. Springman, W. Qi, D. W. Lacher, L. M. Ouellette, J. M. Mladonicky, P. Somsel, J. T. Rudrik, and S. E. Dietrich. 2008. Variation in virulence among clades of Escherichia coli O157: H7 associated with disease outbreaks. Proc. Natl. Acad. Sci. U. S. A. 105:4868–4873. 148

35. McDaniel, T. K., K. G. Jarvis, M. S. Donnenberg, and J. B. Kaper. 1995. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc. Natl. Acad. Sci. U. S. A. 92:1664–1668. 36. McDaniel, T. K., and J. B. Kaper. 1997. A cloned pathogenicity island from enteropathogenic Escherichia coli confers the attaching and effacing phenotype on E. coli K-12. Mol. Microbiol. 23:399–407. 37. Murphy, K. C., and K. G. Campellone. 2003. Lambda Red-mediated recombinogenic engineering of enterohemorrhagic and enteropathogenic E. coli. BMC Mol. Biol. 4:11. 38. Murphy, K. C., and K. G. Campellone. 2003. Lambda Red-mediated recombinogenic engineering of enterohemorrhagic and enteropathogenic E. coli. BMC Mol. Biol. 4:11. 39. Nyachuba, D. G. 2010. Foodborne illness: is it on the rise? Nutr. Rev. 68:257–269. 40. Ogura, Y., T. Ooka, A. Iguchi, H. Toh, M. Asadulghani, K. Oshima, T. Kodama, H. Abe, K. Nakayama, and K. Kurokawa. 2009. Comparative genomics reveal the mechanism of the parallel evolution of O157 and non-O157 enterohemorrhagic Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 106:17939–17944. 41. Perna, N. T., G. Plunkett, V. Burland, B. Mau, J. D. Glasner, D. J. Rose, G. F. Mayhew, P. S. Evans, J. Gregor, H. A. Kirkpatrick, G. Pósfai, J. Hackett, S. Klink, A. Boutin, Y. Shao, L. Miller, E. J. Grotbeck, N. W. Davis, A. Lim, E. T. Dimalanta, K. D. Potamousis, J. Apodaca, T. S. Anantharaman, J. Lin, G. Yen, D. C. Schwartz, R. A. Welch, and F. R. Blattner. 2001. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature 409:529–33. 42. Philippe, N., J.-P. Alcaraz, E. Coursange, J. Geiselmann, and D. Schneider. 2004. Improvement of pCVD442, a suicide plasmid for gene allele exchange in bacteria. Plasmid 51:246–255. 43. Reid, S. D., C. J. Herbelin, A. C. Bumbaugh, R. K. Selander, and T. S. Whittam. 2000. Parallel evolution of virulence in pathogenic Escherichia coli. Nature 406:64–67. 44. Shaikh, N., and P. I. Tarr. 2003. Escherichia coli O157:H7 Shiga Toxin-Encoding Bacteriophages: Integrations, Excisions, Truncations, and Evolutionary Implications. J. Bacteriol. 185:3596–3605. 45. Shima, K., Y. Wu, N. Sugimoto, M. Asakura, K. Nishimura, and S. Yamasaki. 2006. Comparison of a PCR-restriction fragment length polymorphism (PCR-RFLP) assay to pulsed-field gel electrophoresis to determine the effect of repeated subculture and prolonged storage on RFLP patterns of Shiga toxin-producing Escherichia coli O157:H7. J. Clin. Microbiol. 44:3963–3968. 46. Tree, J. J., A. J. Roe, A. Flockhart, S. P. McAteer, X. Xu, D. Shaw, A. Mahajan, S. A. Beatson, A. Best, S. Lotz, M. J. Woodward, R. La Ragione, K. C. Murphy, J. M. Leong, and D. L. Gally. 2011. Transcriptional regulators of the GAD acid stress island are carried by effector protein-encoding prophages and indirectly control type III secretion in enterohemorrhagic Escherichia coli O157:H7. Mol. Microbiol. 80:1349–1365. 149

47. Watanabe, H., A. Wada, Y. Inagaki, K. Itoh, and K. Tamura. 1996. Outbreaks of enterohaemorrhagic Escherichia coli O157: H7 infection by two different genotype strains in Japan, 1996. Lancet 348:831–832. 48. Werber, D., A. Fruth, U. Buchholz, R. Prager, M. H. Kramer, A. Ammon, and H. Tschäpe. 2003. Strong association between Shiga toxin-producing Escherichia coli O157 and virulence genes stx2 and eae as possible explanation for predominance of serogroup O157 in patients with haemolytic uraemic syndrome. Eur. J. Clin. Microbiol. Infect. Dis. 22:726–730. 49. Wick, L. M., W. Qi, D. W. Lacher, and T. S. Whittam. 2005. Evolution of genomic content in the stepwise emergence of Escherichia coli O157:H7. J. Bacteriol. 187:1783–1791. 50. Wolff, C., I. Nisan, E. Hanski, G. Frankel, and I. Rosenshine. 1998. Protein translocation into host epithelial cells by infecting enteropathogenic Escherichia coli. Mol. Microbiol. 28:143–155. 51. Yang, Z., J. Kim, C. Zhang, M. Zhang, J. Nietfeldt, C. M. Southward, M. G. Surette, S. D. Kachman, and A. K. Benson. 2009. Genomic instability in regions adjacent to a highly conserved pch prophage in Escherichia coli O157:H7 generates diversity in expression patterns of the LEE pathogenicity island. J. Bacteriol. 191:3553– 3568. 52. Yoshii, N., Y. Ogura, T. Hayashi, T. Ajiro, T. Sameshima, M. Nakazawa, M. Kusumoto, T. Iwata, and M. Akiba. 2009. Pulsed-field gel electrophoresis profile changes resulting from spontaneous chromosomal deletions in enterohemorrhagic Escherichia coli O157:H7 during passage in cattle. Appl. Environ. Microbiol. 75:5719–5726. 53. Zhang, X., A. D. McDaniel, L. E. Wolf, G. T. Keusch, M. K. Waldor, and D. W. Acheson. 2000. Quinolone antibiotics induce Shiga toxin-encoding bacteriophages, toxin production, and death in mice. J. Infect. Dis. 181:664–670. 54. Zhou, Z., X. Li, B. Liu, L. Beutin, J. Xu, Y. Ren, L. Feng, R. Lan, P. R. Reeves, and L. Wang. 2010. Derivation of Escherichia coli O157:H7 from its O55:H7 precursor. PLoS One. 5:e8700.

150

Figure Legends

FIG. 4.1. Spontaneous deletions within Sp11-Sp12 prophage region of Sakai. Genomic

loci of Sp11 (light blue) and Sp12 (light red) are shown. Genes related to prophage

regulation (blue), to integration/excision (red), to bacterial host lysis (yellow) and

putatively to virulence (green) are marked by triangles. Primer pairs (Table S4.1) used to

estimate the range of deletions are indicated using black arrows. Three different classes

of deletions were identified. One included the entire Sp11 (46 kb), while the boundaries

of the other two deletion types were not definite (shown by dashed lines). The

estimated minimal and maximal sizes of each deletion type are listed. The designated

type of deletion and the frequency of observation (indicated in parentheses) out of 20

second crossover isolates are shown to the right of each deletion scheme.

FIG. 4.2. Sequencing depth inconstancy in the Sp11-Sp12 region. The reads from the whole genomic sequencing of SK-11 (A) and SK-17 (B) were aligned against the genome

of WT Sakai and the sequencing depth report was generated by SeqMan. In each case,

the coordinate in Sakai genome is shown on the top, and a bar graph presenting the

detailed sequencing depth (red > 120, green < 120) is show in the bottom. The overall

sequencing depth for each genome is shown in the internal box, with an arrow

highlighting the gap in the Sp11-Sp12 region.

FIG. 4.3. Comparison of PFGE profiles of E. coli O157:H7 Sakai with its derivatives. A

total of 4 strains were digested using XbaI in this assay. Salmonella serotype Braenderup reference standard (H9812), also restricted with XbaI, was used as size standard (M). 151

The approximated size of each marker band is presented in kilobases. White arrow highlights the 187 kb band only observed with WT Sakai.

FIG. 4.4. Aligning sequencing results from induced phage pool of E. coli O157:H7 PA10

(upper) against Sakai genome (lower) using ACT. A total of 8 contigs from PA10 was mapped within Sp11-Sp12 region of Sakai. The coordinates in Sakai genome are shown in the bottom. Alignments in forward orientation are presented in red and reverse are in blue. The arrows indicate the boundaries of Sp11 and Sp12.

FIG. 4.5. The effect of pchB on the secretion of Esp proteins. (A) Representative

Western blot results of BSA (top), EspB (middle) and EspA (lower) of Sakai and its derivatives. (B) The intensities of Esp protein bands (Closed boxes: EspB, Open boxes:

EspA) were analyzed using the Odyssey Application Software. The relative Esp secretion levels of the derivative strains comparing to wild-type Sakai are calculated as

(Espderivative/BSAderivative)/(EspWT/BSAWT). All results for Esp quantification are the average from three biological repeats and error bars represent 1 SD.

152

Table 4.1. Strains and plasmids used in this study

Strain or plasmid Relevant Characteristics Reference E. coli Strains

SM10λpir Host for maintenance and conjugation of pDS132 derivatives Lab Collection Sakai O157:H7; stx1+, stx2+ W. Zhang* Sakai-strr Streptomycin-resistant mutant of Sakai This study second-crossover derivatives from Sakai::(pDS132::tDNA5), ΔSp11, SK-18 This study Type I deletion mutant second-crossover derivatives from Sakai::(pDS132::tDNA5), Type II SK-11 This study deletion mutants second-crossover derivatives from Sakai::(pDS132::tDNA5), Type III SK-17 This study deletion mutants SKΔpchB Sakai with pchB deletion This study PA10 O157:H7; stx2c+ (21)

Plasmids pDS132 Suicide vector; Camr; levansucrase-encoding (42) pDS132::ΔtDNA5 pDS132 carrying concatenated fragments flanking ileZ5-argN5-argO5 This study pDS132::ΔtDNA1 pDS132 carrying concatenated fragments flanking ileZ1-argN1-argO1 This study pDS132::ΔtDNA3 pDS132 carrying concatenated fragments flanking ileZ3-argO3 This study pKD4 template plasmid for aph gene, Kanr (8) pKM200 Red recombinase expression plasmid, Camr (38)

*Dr. Wei Zhang. Division of Biology; Illinois Institute of Technology

153

Table 4.2 Frequencies of reversion to Sucr in different merodiploid strains

Strain Sakai::(pDS132::tDNA5) Sakai::(pDS132::tDNA1) Sakai::(pDS132::tDNA3)

Trial 1 a 6.23×10-04 b 3.95×10-05

Trial 2 8.59×10-04 5.77×10-05

Trial 3 1.30×10-03 2.96×10-04

Trial 4 8.51×10-04 1.33×10-04

a: Each trial was conducted with two technical repeats.

b: The frequencies of reversion to Sucr were calculated as: colony count on LB-sucrose agar/total colony count on LB agar.

154

2185 tDNA5 SpLJ GpH GpU pchB 2189 SpRJ 2234 2243 2274

nleG nleG pchB R S psrC Q cI int nleG lom R S Q cro cI int nleG lom ileZ5-argO5 cro nleG ileZ6-argN3-argO6 Type 2,158,174 2,203,952 2,250,093 46 kb I (1) 38/60 kb II (7) 35/55 kb III (9)

Figure 4.1 155

Figure 4.2 156

M Sakai SK-18 SK-11 SK-17 M (kb) (kb)

453 453 398 398 337 337 310 310

244 244 217 217

173/167 173/167 139 139 105 105

Figure 4.3 157

Sp11 Sp12

Figure 4.4 158 Figure 4.5 A

BSA

EspB

EspA

B

250

200

150 Sakai Esp expression 100

50 Percentage Percentage

0 SKΔpchB SK-18 SK-11 SK-17 159

2,158,174 2,203,951

nleG nleG pchB S psrC Q cro cI nleG lom R ileZ5-argO5

Sp11

Sp12

nleG lom R S Q cro cI nleG ileZ6-argN6-argO6 2,203,952 2,250,093

FIG. S4.1. Sequence alignment between prophage Sp11 (upper) and Sp12 (lower) of E. coli O157:H7 Sakai using ACT. Red blocks indicate the homologous regions between Sp11 and Sp12. Prophage regulator genes (blue), bacterial host lysis (yellow) and putatively virulence-related genes (green) are shown. A B Sp11 Sp12 Sp11 Sp12 160

C Sp11 Sp12 FIG. S4.2. Aligning the sequences of Sakai tandem prophage Sp11 and Sp12 (upper) against the genomes of E. coli O157:H7 strains EC4115 (A), TW14395 (B) and EDL933 (C) (lower) using ACT. The coordinate of each genome was shown in the bottom. A black bar was used in each figure to indicate the boundary between Sp11 and Sp12. Alignments in forward orientation are represented in red and reverse are in blue. Sp11 Sp12 161

Sp11 Sp12

FIG. S4.3. Sequence alignment showed high similarity between E. coli O157:H7 EC4115 (upper) and E. coli O157:H7 TW14359 (lower) genomes in their tandem prophage homologous to Sakai Sp11-Sp12 and the flanking regions. The analysis was preformed using ACT. The coordinate of each genome was shown. Black bars indicate the boundaries of each prophage. Alignments in forward orientation are represented in red and reverse are in blue. Cp8 162

Sp11 Sp12 FIG. S4.4. Prophage Cp8 from E. coli O55:H7 RM12579 (GenBank accession number: NC017656) occupies the same insertion site as Sp11-Sp12 does in E. coli O157:H7 Sakai. The alignment was performed using ACT and the coordinate of each genome was shown. Black bars indicate the boundaries of each prophage. Alignments in forward orientation are represented in red and reverse are in blue. This alignment indicates that prophage Cp8 occupies the same insertion site in the chromosome of RM12579 as Sp11-Sp12 does in Sakai, though the identity between Cp8 and Sp11 or Sp12 is rather low. Table S4.1 Primers used in this study 163

Primer name Sequence Region that is amplified in Sakai SpLJ-L ATAAAGCCGGGAATCGAACT 2,157,392-2,159,153 SpLJ-R CATCCAGATTGGCCTTCAAT GpH-L CGGTCAGTGAGACCGCGGGC 2,169,933-2,170,652 GpH-R GGCCGGAACCGTTGAACAAG GpU-L TCATCAAACGCCTGTTTCAG 2,173,837-2,174,602 GpU-R GAAACGATACGCGGGTACA pchB-L GGGGCAACATTATGTCATCA 2,182,447-2,183,218 pchB-R CCAGATATGATTTGCTTTTC 2185-L AAGAGCAACCAGCATTAGTG 2,184,063-2,185,014 2185-R GGGGAATCGACAGATAAGCA 2189-L TGCCATATAGAAGCAACATGTGA 2,186,352-2,187,134 2189-R GGCGGAATTCAGTTGTCAGA SpRJ-L AGCGCTCACCCTGAGTTTTA 2,203,151-2,204,858 SpRJ-R AAGGTCCGTACGACCATCAG 2234-L GCCACTGATATCCGCATTTT 2,214,287-2,215,181 2234-R GATAAACAGCTATGGCCAGCA 2243-L GAATCGGTCACCACACAGGT 2,224,012-2,224,563 2243-R GGACTGCACCATCAAGGAAG 2274-L TGGATAAGGGGATTGGCTTC 2,245,017-2,245,988 2274-R TATGAACAGCCATCGCAGAG tDNA5-LL AAAAAATCTAGAACGCAGTACCTGTTCGATCT 2,189,181-2,189,510 tDNA5-LR GGCCCTTTAGGCGGCCGCTATTTTCCAGGCTCGCTTC tDNA5-RL CTGGAAAATAGCGGCCGCCTAAAGGGCCGAGCCAAA 2,189,759-2,190,157 tDNA5-RR AAAAAATCTAGACAGATGAACGGATGTCATTGTTT tDNA1-LL AAAAAATCTAGAGACGTTCCGCTTTATCTGT 1,178,898-1,179,427 tDNA1-LR AGTGTGGCGCGCGGCCGCCTAAAGGGCTGGGTCAAA tDNA1-RL AGCCCTTTAGGCGGCCGCGCGCCACACTTATTTTCC 1,179,661-1,180,360 tDNA1-RR AAAAAATCTAGACACAACCACGTAGAACCAGT tDNA3-LL AAAAAATCTAGATAACGTGCTGAACCATATCA 1,773,133-1,773,943 tDNA3-LR GCGTTGTACTGCCGATTGCTGAATAATAAC tDNA3-RL AGCAATCGGCAGTACAACGCACCACACC 1,774,160-1,775,018 tDNA3-RR AAAAAATCTAGAACCCGGCGTAACTGTACT 164 Table S4.1 Primers used in this study (Cont’d)

Primer name sequence region that is amplified in Sakai TAAAGTCGCTTTTTTTATGGTAACAGGCAATAACGCTCTCAG pchBKO-L ATATTTTCATATGAATATCCTCCTTAGT 2,182,714-2,183,128* TAAGGACGGTAAATTCAGGATGGCAGTCTGTAGATAAACG pchBKO-R GAGGTTACTTGTGTAGGCTGGAGCTGCTTC tDNA5out-L CCACAGCAATACCACAATGC 2,188,786-2,190,191 tDNA5out-R CGGAGAGGTCACGGATATGT rpsL-L ACGTGGCATGGAAATACTCC 4,193,979-4,194,535 rpsL-R AATTCGGCGTCCTCATATTG tDNA1out-L GAAAAATGCGGTTATTCAAG 1,179,285-1,179,859 tDNA1out-R GGTGAATTCAGTACCAGCAC tDNA3out-L ATTCGTAACGGATGAGATTG 1,773,887-1,774,410 tDNA3out-R GAATTCTGCAATGACCAGAC SK17-L TGAAAAGCGCCCATTAGTAG 2,160,569-2,213,863** SK17-R ATAACTGGTATCCCACAGCA SK11-L CTGCCGAAGTCAACGCCATC 2,184,026-2,237,331** SK17-R ATACTTATGCCTGGCGGTAT

*: used to identify the boundaries of allelic exchange. **:presents the theoretic range of amplicon 165

Chapter Five

INACTIVATION OF ILEZ2-ARGN2-ARGO2 OPERON DOES NOT AFFECT THE PRODUCTION

OF STX2 AND VT2-SAKAI IN ESCHERICHIA COLI O157:H7 SAKAI AND VT2-SAKAI-

CONVERTED E. COLI C600

Chun Chen, Shuang Yin§ and Edward G. Dudley*

Department of Food Science, the Pennsylvania State University, University Park, Pennsylvania 16802

* Corresponding author. Mailing address: 326 Food Science Building, The Pennsylvania State University, University Park, PA 16802, US. Phone: (814)867‐0439; Email: [email protected]

§ Shuang Yin accomplished the quantification for ileZ and argO copy number among E. coli O157:H7 isolates and reverse transcription qPCR for ileZ and argO in E. coli O157:H7 Sakai. 166

5.1 Abstract

Enterohemorrhagic Escherichia coli (EHEC) strains possess 5 to 8 lambdoid prophage each encoding an putative ileZ-argN-argO operon downstream the late promoter, while 0 to 3 such prophage are present in other pathogenic E. coli or

laboratory strains. It has been proposed that these tRNA genes recognize ATA (ileZ),

CGA (argN), AGA/AGG (argO). Interestingly, these four codons are rarely used in genes

encoded within the backbone genome of EHEC but are present more frequently in the

horizontally acquired genetic elements, such as virulence genes. Therefore, it has been hypothesized that the ileZ-argN-argO operon has a regulatory effect on EHEC virulence.

In this study, we conclude that the E. coli O157:H7 human isolates and isolates

belonging to O serogroups that are frequently associated with foodborne outbreaks

carry more copies of the ileZ and argO than others. For the first time, we demonstrated

promoter activity upstream of all seven ileZ-argN-argO operons in E. coli O157:H7 Sakai

and the transcription of ileZ and argO independent of the phage late promoter. We also determined that ileZ2 encodes a functional tRNA and suggested that argN is functional

‘redundant’. Inactivation of ileZ2-argN2-argO2 operon did not affect the production of

Stx2 and the stx2-encoding phage in Sakai and phage-converted E. coli C600. Our

observations do not support the widespread belief that ileZ-argN-argO are required for

efficient synthesis of Stx2 and phage particles. Further research will be required to fully understand the function of these operons.

167

5.2 Introduction

Enterohemorrhagic Escherichia coli (EHEC) infections leads to diseases including hemorrhagic colitis, also known as bloody diarrhea, and hemolytic uremic syndrome

(HUS) (25), characterized by hemolytic anemia, low platelet count and renal impairment

(50). EHEC are particularly dangerous pathogens because of their low infectious dose

(51), and high incidence of causing renal failure, especially in children (47). O157:H7 is the most common serotype of EHEC. During an outbreak that was linked to contaminated radish sprouts in 1996, Sakai, one of the best studied strains of E. coli

O157:H7 caused approximately 12,680 clinical cases (23, 59).

Most virulence factors of EHEC are encoded by mobile genetic elements

including prophage, integrative elements and plasmids (22, 28, 44, 45). For example,

Shiga toxin (Stx) 1 and Stx2 are two prophage-encoded toxins that share ca. 55% in

amino acid sequence identity and are immunologically distinct (26, 38, 41). Stx is

necessary for the development of HUS in patients (51). Both Stx1 and Stx2 have A1B5

structures. The pentamer of five B subunits binds to the specific glycolipid receptor,

globotriaosylceramide (Gb3), which leads to internalization of the A subunit. The

enzymatically-active A subunit then cleaves a specific adenine base from 28S rRNA, and

therefore stops protein synthesis and causes cell death (10). In addition to O157, recent

clinical reports show an increasing incidence of infection with Stx-producing E. coli (STEC)

belonging to serotypes O26, O111, O103, O145, O45 and O121 (9). Collectively, these 168

non-O157 STEC serotypes are referred to as the ‘big six’. They were declared adulterants in non-intact raw beef products and product components by the USDA (57).

The locus of enterocyte effacement (LEE) is another well-characterized

horizontally-acquired genetic region that contains virulence factors. This genetic island

encodes for an outer membrane protein (intimin), the structural and regulatory genes for a type III secretion system (T3SS), and the effector proteins secreted by the T3SS (28,

45). When E. coli O157:H7 attaches to enterocytes, the LEE-associated protein Tir is

translocated from the bacterial cytoplasm across the epithelial cell membrane, where it

serves as a receptor for intimin, an additional LEE-encoded bacterial surface protein.

This process leads to the intimate attachment of bacteria and the effacement of

microvilli (15), designated the attaching and effacing (A/E) phenotype (18, 21).

The frequency of synonymous codon usage is biased in the genomes of bacteria.

Those codons that are used less frequently are referred to as ‘rare codons’ or ‘minor codons’. The abundance of cognate tRNA is proportional to the frequency of codon usage (17, 32). Therefore, the translation of the rare codon can lead to stalling of

ribosome at the rare codon and the releasing of peptidyl-tRNA as a result of limited

availability of charged cognate tRNAs (13). Najafabadi et al. (43) proposed that codon

bias along with controlled tRNA isoacceptors availability are used by bacteria as

strategies to regulate protein translation efficiency in response to environmental and physiological changes. 169

It has been demonstrated that the availability of tRNA recognizing rare codons can be important for the expression of virulence factors of some pathogens. For example, tRNA leuX recognizes the rare leucine codon TTG. The availability of leuX affects the expression of type 1 fimbriae in uropathogenic E. coli, and affects type 1 pili formation during urinary tract infection (16, 27, 48). Another example is the arginine-

cognate tRNA fimU, which recognizes the rare codon AGA. fimU is essential for type 1

fimbriae production of S. enterica Typhimurium, which is a critical factor for the

initiation and persistence of Salmonella infection (55).

Whole genome sequencing of E. coli O157:H7 revealed the bias in codon usage

between the mobile genetic elements and the backbone genome (28, 45). The rarest

codons in the Sakai backbone genome [AGG (Arg), AGA (Arg), CGA (Arg) and ATA (Ile)]

are frequently used within genes encoded in prophage. Interestingly, a total of 7 ileZ-

argN-argO operon-encoding lambdoid prophage (including VT2-Sakai, the stx2-encoding

prophage) are found within the Sakai genome (28). These operons were proposed to

encode 3 clustered tRNA genes that recognize ATA (ileZ), CGA (argN) and AGG/AGA

(argO). While the predicted anticodon of ileZ is CAU, the cytidine is post-

transcriptionally modified by lysidine synthetase, resulting in base-pairing with adenine

(54).

All of the ileZ-argN-argO operons found within the Sakai genome are located at

the 3’ end of phage late promoter (PR’) (28), which suggests they are the first set of genes transcribed when the prophage is induced (58). It has been hypothesized that 170

these putative tRNAs will facilitate the translation of the genes located in the mobile

genetic elements (28, 61). Furthermore, these ileZ-argN-argO operon-encoding

lambdoid prophage are also observed within genomes of other E. coli O157:H7 (45) and

non-O157 EHEC strains (44) (Table S5.1). By comparing the available fully-sequenced E.

coli genomes, Ogura et al. suggested that EHEC encodes more copies of ileZ-argN-argO

operons than E. coli belonging to other pathotypes (33) and non-pathogenic E. coli (44).

Nevertheless, our knowledge of these ileZ-argN-argO operons is still limited. It

has not been demonstrated yet whether all of the ileZ-argN-argO operons are

expressed or make functional tRNAs. In the current study, we compared the copy

number of these operons among Stx-producing E. coli (STEC) of different serotypes and

from variety of sources. We investigated the transcription of these tRNAs and

translational activity of the VT2-Sakai-encoded ileZ2, argN2 and argO2. Nevertheless,

this is an ongoing project and many details of these putative tRNA genes remains

unknown. We also report that the inactivation of ileZ2, argN2, and argO2 did not result in detectable effect on the production of Stx2 or VT2-Sakai, the two processes that

involve translation through rare codons, in Sakai or VT2-Sakai converted E. coli C600.

5.3 Materials and Methods

Bacterial strains and culture media. The bacterial strains and plasmids used in this study are described in Table 5.1. Strains were routinely grown in liquid or solid

Lysogeny Broth medium (LB) (5). All stocks were maintained at -80°C in 10% glycerol. 171

Chloramphenicol (Cam; 25 µg/ml), streptomycin (Str; 100 µg/ml), ampicillin (Amp; 100

µg/ml) were added to the media where indicated. When selecting for the loss of

pDS132-encoded sacB, LB agar with 5% (w/v) sucrose and without NaCl (LB-sucrose agar)

was used. Streptomycin resistant mutant of E. coli O157:H7 Sakai (28) were selected for

by plating overnight cultures on LB agar supplemented with Str. Putative Str-resistant

(Strr) colonies were streaked on the same media for purification and the resulting Strr

Sakai was used in the current study. LB-modified agar (24) for phage transduction was prepared by supplementing LB agar with CaCl2 to a final concentration of 10 mM.

Quantifying the copy number of ileZ and argO. A total of 117 STEC isolates were

included in this assay (Table S5.2). Isolates were categorized by Source (human or

environmental) and O type (high risk or low risk O type). ‘High risk O type’ was used to

refer serotype O26, O103, O111, O121, O145 and O157, while all other O serotypes

were designated as ‘low risk O type’. Primer pairs Stx1com-F/Stx1com-R and LP43/LP44

(6) (Table S5.3) were used to determined the stx1 and stx2 profile from each isolate

(Table S5.2). The expression of Stx in isolates that were negative for both stx1 and stx2

by PCR were confirmed using the Premier™ EHEC Kit (Meridian, Cincinnati, OH), which

detects both Stx1 and Stx2 using an ELISA-based method..

The copy number of ileZ and argO in each STEC strain was tested using quantitative PCR (qPCR). First, chromosomal DNA from each isolate was extracted using

Wizard® Genomic DNA Purification Kit (Promega, Madison, WI). Two pairs of primers argOa-L/argOa-R and argOb-L/argOb-R were designed based on the sequence consensus 172

of Sakai-encoded argO1 through argO4 (designated argOa) and argO5 through argO7

(designated argOb), respectively. Primers used for each qPCR reaction are listed in Table

S5.3. The 20 µl qPCR mix contains 10 µl PerfeCTa® SYBR® Green FastMix® for iQ™

(Quanta Biosciences, Gaithersburg, MD), 0.8 µl of each primer (10 µM), 2 µl template (4

ng/µl) and 6.4 µl water. The qPCRs were conducted using the following conditions: 2

minutes at 95 °C, followed by 35 cycles of 10 seconds at 95 °C, 20 seconds at annealing

temperature (67 °C for ileZ, 63 °C for argOa and argOb) and 20 seconds elongation at

72 °C. Ten‐fold serial diluted Sakai cultures were assayed using this method, which confirmed the linear co-response between the abundance of ileZ, argOa and argOb and

the resulting Ct (Fig. S5.1). The internal control 16S rRNA was also assayed by qPCR

using primer pair rrsA-L and rrsA-R (34) (Table S5.3). The Ct values of all tested genes

were normalized against 16S rRNA (ΔCt = CttRNA - CtrRNA). Each qPCR was conducted in

triplicates and mean ΔCt value of each source/O type combination was calculated.

β-galactosidase assay for promoters of rare tRNA operons. A suicide plasmid-

based method, similar to that has been previously described (19), was used to inactivate

lacZ from Sakai. Briefly, primer pairs SK-lac-LL/SK-lac-LR and SK-lac-RL/SK-lac-RR (Table

S5.3) were used generate DNA fragments that flank the Sakai lac operon (992 bp and

1043 bp in size). These fragments were fused by overlap PCR, digested with XbaI and cloned into the corresponding site of suicide vector pCVD442 (18) (Table 5.1). The resulting plasmid (pCVD442::Δlac) was then transformed by electroporation into E. coli

SM10λpir, permissive for the replication of the suicide vector. Conjugation was conducted between E. coli SM10λpir(pCVD442::Δlac) and Sakai in the same manner as 173

previously described (19), and the selection for recombinants was performed on LB agar

with Amp and Str. Putative Sakai::(pCVD442::Δlac) colonies were re-streaked on the

same media for purification. To select for spontaneous excision of pCVD442, 0.5 μl of an

overnight Sakai::(pCVD442::Δlac) culture was diluted into 10 ml fresh LB broth and

grown with shaking at 37 °C for 8 hours. The culture was then plated on LB agar with 5%

sucrose and without NaCl to select for isolates that underwent a second crossover event,

which results in a sucrose-resistant phenotype. The lac operon-knockout mutants

(SakaiΔlac, Table 5.1) were identified from the collected isolates using PCR with primer

pair lac-seq-L/lac-seq-R (Table S5.3).

The genomic regions upstream of the predicted transcriptional start sites of the

7 rare tRNA gene operons were amplified using primer pairs PtDNA1-L/R through

PtDNA6-L/R (Table S5.3). These products ranged from 171 bp to 289 bp in size. Each

amplicon was digested with EcoRI and BamHI and inserted into the corresponding site of pRS551 (Table 5.1). Sequencing reactions using primer pair pRS-seq-L/R (Table S5.3)

were performed to confirm the integrity of the putative tRNA operon promoters in the

resulting plasmids. Of note, primer pair PtDNA6-L and PtDNA6-R (Table S5.3) amplified

both the putative promoters for ileZ6-argN3-argO6 and ileZ7-argN4-argO7. These were

differentiated by sequencing.

β-galactosidase activity of each construct was then assayed using a previously

described method (19). Bacteria grown in liquid LB at 37 °C with shaking were harvested

at an OD600 of 0.3. All assays were repeated for three times. 174

RNA preparation and reverse transcription-qPCR. E. coli cultures were grown

from frozen stock, and shaken at 37 °C for overnight. After diluting to an OD600 of 0.05, the culture was incubated at 37 °C with shaking until early log phase (75 minutes) when harvested for RNA isolation. The mirVana™ miRNA Isolation Kit (Life Technologies,

Carlsbad, CA) was used for tRNA isolation. The instruction from the manufacture was generally followed with one exception: RLT buffer (Qiagen, Valencia, CA) + 1 % β-

mercaptoethanol was used instead of the original Lysis/Binding Solution for bacterial cell lysis. Reverse transcription was performed using the ThermoScript™ RT-PCR System

(Invitrogen, Grand Island, NY) and the reverse primers ileZ-R and argOa-R. The

manufacture’s instructions were followed except that the denaturing condition was

modified to 95 °C and 3 minutes. The qPCR quantification for ileZ and argOa was done in

the same manner as described earlier. Two biological replications, each with 2 technical

repeats were performed. The internal control rrsA was assayed with primer pair rrsA-L and rrsA-R (Table S5.3). A no reverse transcriptase control was conducted for each RNA

sample. We were not able to design primers specifically amplify argN.

Construction of a model system for testing tRNA functionality. Derivatives of

the E. coli K-12-encoded hfq were used to test whether ileZ, argN and/or argO encoded functional tRNAs. The previously constructed expression vector pET28::hfq (Table 5.1,

Fig. S5.2), which encodes hfq between NdeI and EcoRI sites, was obtained from Dr. K.

Keiler (Department of Biology and Molecular Biology, Penn State University). To insert 2 tandem ATA codons after the initiating ATG (Fig. S5.2), PCR was performed using the 5’ phosphorylated primer pair pET-hfq-2ATA/pET-hfq-R (Table S5.3) with pET28::hfq as a 175

template. After allowed self-ligation of the PCR product, the derived plasmid (pET-2ATA)

was transformed into BL21(DE3) (Table 5.1). A similar procedure was used to construct

pET-2ATT, pET-4CGA, pET-4CGC, pET-2AGA and pET-3ATA (encoding 2 – 4 tandem ATA,

ATT, CGA, CGC or AGA codons, Table 5.1); the corresponding primers used for each

construct are listed in Table S5.3. Sequencing reactions with primer pair pET28-seq-L

and pET28-seq-R (Table S5.3) confirmed the proper construction of the pET28::hfq derivatives.

The ileZ2-argN2-argO2 operon of Sakai was amplified using primer pair tDNA2-

clon-L/tDNA-clon-R (Table S5.3). The 474 bp amplicon was digested with HindIII/BamHI, and cloned into the corresponding site of pACYC184 (49) , generating pACYC-tDNA2

(Table 5.1). The integrity of ileZ2-argN2-argO2 operon in the plasmid was confirmed by

sequencing reactions using primer pair pACYC-seq-L/pACYC-seq-R (Table S5.3).

In order to replace the pRARE-encoded argU with argO2, PCR was performed

using primer pair argO-rare-L/argO-rare-R (Table S5.3) and pRARE (Novagen, Merck,

Darmstadt, Germany) as the template. Self-ligation of the amplicon resulted in the plasmid pRARE-argO2 (Table 5.1). The gene replacement was confirmed by sequencing

reactions using primer pair pRARE-seq-L/pRARE-seq-R (Table S5.3). An alignment

between argU and argO2 is shown in Figure S5.3.

IPTG-induction and SDS-PAGE. Bacterial cultures were grown from frozen stocks in liquid LB overnight at 37 °C with shaking. After 1:50 (v/v) dilution in fresh LB, each strain was incubated for 2 hour in the same conditions. Next, IPTG (Isopropyl β-D-1- 176

thiogalactopyranoside) was added to a final concentration of 0.4 mM to induce

transcription of the hfq derivatives. After another 5-hour incubation at 37 °C with

shaking, a 2 ml aliquot of each culture was harvested. The cultures were centrifuged

(16,000 × g, 2 minutes, 20 °C), and the pellets were resuspended in 100 μl 1 × Laemmli buffer (12 mM Tris-Cl pH 6.8, 0.4 % SDS, 2 % glycerol, 1 % β-mercaptoethanol and 0.002%

bromophenol blue). To lyse the bacterial cells, the samples were incubated at 100 °C for

10 minutes. For SDS-PAGE, 10 μl of each sample was loaded on a 4 – 20% precast linear

gradient polyacrylamide gel (Bio-Rad, Hercules, CA), and proteins were

electrophoretically separated in a Mini-PROTEAN® system (Bio-Rad, Hercules, CA) at 180

V for 45 minutes. Broad Range Pre-stained Protein Ladder (NEB, Ipswich, MA) was used

as a size standard. A Coomassie Brilliant Blue staining protocol was followed to visualize

the proteins. Briefly, the gel was incubated for 1 hour in the staining solution (0.025%

Coomassie Brilliant Blue R250, 40% methanol, 7% glacial acetic acid), 1 hour in the destaining solution I (40% methanol, 7% glacial acetic acid) and 1 hour in the destaining

solution II (5% methanol, 7% glacial acetic acid). The gel was then visualized and photographed using a transilluminator (UVP, Upland, CA).

Inactivation of the ileZ2, argN2 and argO2 anticodons in E. coli O157:H7 Sakai.

A DNA fragment of 1309 bp in size was synthesized by Epoch Life Science Inc, (Sugar

Land, TX). Its sequence is identical to that of Sakai genome (GenBank accession number:

BA000007) between position 1,266,101 and 1,267,400 except two differences: i) the

second nucleotides of anti-codon in ileZ2 (position 1,266,657), argN2 (position

1,266,743) and argO2 (position 1,266,733) were removed; ii) XbaI sites were added to 177

both ends of the fragment (Fig. S5.4). This fragment was digested with XbaI and ligated

with similarly digested pDS132 (46), generating pDS132::ΔtDNA (Table 5.1). Homologous

recombination-mediated exchange between this anticodon-deleted allele of ileZ2-argN2

-argO2 and the wild-type allele in Sakai was performed in the same manner as that

described above for the lac operon knockout except that Cam and Str were used to select for recombinants. After resolving pDS132 from the merodiploid, primer pair tDNA2-seq-L/tDNA2-seq-R (Table S5.3) was used in PCR followed by DNA sequencing to

identify isolates carrying the desired anticodon-deletion (SakaiΔtDNA, Table 5.1).

Quantification for Stx2 production. Bacteria were grown from frozen stocks in

liquid LB overnight at 37 °C with shaking. The cultures were diluted to an OD600 of 0.05 in

LB supplemented with 45 ng/ml ciprofloxacin (62). Cultures were grown with shaking at

37 °C and the OD600 was taken every hour to profile the changes in cell densities. After 6

hours, the cultures were centrifuged (4,000 × g, 10 minutes, 4 °C) and the supernatants

were filtered through 0.2 µm acetate cellulose filters (VWR, Philadelphia, PA). The

sterile lysates were used immediately or stored at -80 °C.

Slot blot was conducted with a 48-well Manifold I™ System (Whatman,

Piscataway, NJ) to quantify Stx2. Supernatant proteins were bound to 0.45 µm PVDF

membranes (Millipore, Billerica, MA) following the manufacturer’s instruction. Mouse

anti-Stx2 mAb targeting the A subunit (Santa Cruz, Santa Cruz, CA), diluted to 1:200 (v/v),

was added, followed by 1:15,000 (v/v) diluted IRDye 800CW goat anti-mouse IgG (LI-

COR, Lincoln, NE). The Odyssey Infrared Imaging System (LI-COR, Lincoln, NE) was used 178

for fluorescence detection. Signal intensity from each sample was analyzed using the

Odyssey Application Software Version 3.0 and the data is presented as arbitrary units.

All experiments were repeated for at least three times. The linear correlation between the fluorescence intensity and the Stx2 quantity has been shown in Chapter Three.

Construction of E. coli C600::VT2-Sakai and its ileZ2-argN2-argO2 anticodon-

inactivated mutant. In order to mobilize VT2-Sakai prophage derivatives into E. coli

C600, an approach similar to the one reported in Chapter Three was used. Phage transduction was accomplished by first integrating pDS132 (46) into the prophage

genome carried by O157:H7 strain Sakai. Fragments flanking ileZ2-argN2-argO2 operon

of E. coli O157:H7 strain Sakai, 989 bp and 1036 bp in size, were amplified using primer

pair tDNA2-LL/tDNA2-LR and tDNA2-RL/tDNA2-RR (Table S5.3). The amplicons were

fused by overlap PCR and cloned into pDS132. The ileZ2-argN2-argO2 operon is missing

in the resulting plasmid, and is designated pDS132::ΔtDNA-alt (Table 5.1). Through

transformation and conjugation as described for the lac operon inactivation, this

plasmid was integrated into the Sakai genome. Putative Sakai::(pDS132::ΔtDNA-alt)

colonies were re-streaked for purification.

Next, an overnight culture of Sakai::(pDS132::ΔtDNA-alt) was diluted to an OD600 of 0.05 with LB broth and ciprofloxacin was added to 45 ng/ml. The lysate containing the constructed phage VT2-Sakai::(pDS132::ΔtDNA-alt) was collected after 6 hour shaking

incubation at 37 °C, and was sterilized by centrifugation (4,000 × g, 10 minutes, 4 °C)

and filtration (0.2 µm acetate cellulose filter). A total of 1.4 ml lysate was then mixed 179

with 7 ml of an overnight E. coli C600 culture (in LB), and poured onto modified LB agar.

After overnight static incubation at 37 °C, 500 µl of the mixture was plated onto LB agar with Cam for another overnight incubation. A few Cam resistant transductants were harvested for further experiments.

Selection for pDS132-resolved merodiploids was also performed on LB-sucrose

agar as described in the lac operon inactivation protocol. The C600 derivatives that putatively carried intact prophage VT2-Sakai were differentiated from the ileZ2-argN2-

argO2 negative ones (as the allele carried by pDS132::ΔtDNA-alt) by PCR with primer

pair tDNA2-out-L/tDNA2-out-R: the sizes of amplicons were 2.3 kb for the former and

2.1 kb for the latter. The integrity of this region in the putative lysogens C600::VT2-Sakai

(Table 5.1) was confirmed by sequencing this 2.3 kb amplicon using primers tDNA2-seq-

L, tDNA2-seq-R, tDNA2-out-L, and tDNA2-out-R (Table S3); the C600 host background

was confirmed by PCR followed by sequencing with primer pair uidA-F/R (Table S5.3). In

order to determine the insertion site of VT2-Sakai in the chromosome of C600, a PCR-

based method was performed as previously described (52). The primers used in this

assay (wrbA2-lp, wrbA2-LJ, wrbA1-up and wrbA1-RJ) are also listed in Table S5.3.

To inactivate the ileZ2-argN2-argO2 in C600::VT2-Sakai, the second nucleotide of

the anticodon of each tRNA gene was deleted, generating C600::VT2-SakaiΔtDNA (Table

5.1). The procedure was same to that described above for the construction of

SakaiΔtDNA. 180

qPCR for stx2-encoding phage quantification. See Chapter Three for a detailed description of this method. The primers designed for 933W target on the conserved stx2a gene, therefore same method could be used for VT2-Sakai quantification in this

project.

Sequence alignment. The 7 copies of ileZ-argN-argO were aligned using

Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0.2 (36).

Statistic analyses. All statistic analyses (Student’s t‐Test, two‐way ANOVA) were

conducted using Minitab® 222 16.2.0.

5.4 Results

In silico analysis of codon usage within the O157:H7 Sakai genome. It has

previously been reported in EHEC that rare codons are more commonly found in genes

that have been acquired by horizontal gene transfer compared to the core genes

conserved in most E. coli analyzed to date (28, 44, 45). In order to further examine this

codon bias, a script was written to calculate the frequency of the 4 rarest codons, ATA

(Ile), CGA (Arg), AGA (Arg) and AGG (Arg) (28), in E. coli O157:H7 Sakai genome

(GenBank accession number: BA000007) (Table S5.4). ATA is used 9.53% of all isoleucine

codons throughout the Sakai genome, and the arginine codons CGA, AGA and AGG are

used 6.97%, 5.33% and 3.44%, respectively (Table S5.4). This codon usage is remarkably

higher in the virulence genes. For example, ATA, CGA, AGA and AGG are used 75%, 181

8.33%, 25% and 8.33% of the time for their corresponding amino acid residues in the A subunit of stx2 (ECs1025), and 26.41%, 11.53%, 20.14% and 11.02% for the LEE region

(ECs4534 to ECs4592). Another script was written to analyze the usage of 2 tandem rare codons (combination of ATA, CGA, AGA and AGG) and the position of their first presence in the gene (Table S5.5). Two-ATA is the most frequently observed pattern of tandem rare codons.

The distribution of ileZ and argO in STEC isolates. The relative abundance of ileZ

and argO genes in STEC isolates was examined by qPCR and analyzed using an unbalanced two-way factorial design (Fig. 5.1). The significantly lower mean ΔCts observed for ileZ (p = 0.032, two-way ANOVA), argOa (p = 0.001) and argOb (p < 0.001) with isolates of the high risk O types suggested that those isolates possess more genomic copies of ileZ and argO (including both argOa and argOb alleles) comparing to the isolates from the low risk O types. We were also interested in whether a difference in the abundance of these tRNAs existed between human and environmental isolates.

The calculated mean ΔCt values of human isolates for argOa and argOb were significantly lower than those of environmental isolates (p = 0.021 and p = 0.009, respectively, two-way ANOVA), but not ileZ (p = 0.339). This indicated that the human

isolates carry more genomic copies of argO compare to the environment isolates. Our

two-way ANOVA result showed that the source and O type were independently related

to the copy number of ileZ (p = 0.455, two-way ANOVA), argOa (p = 0.643) and argOb (p

= 0.640). 182

Promoter activities of the ileZ-argN-argO operons. Putative promoters were

identified at 5’ ends of all 7 ileZ-argN-argO operons in Sakai (data not shown). In order to determine whether these are functional, β-galactosidase assays were performed.

Sequences upstream of the operons were cloned into pRS551 (Table 5.1), and the

resulting vectors (pRS-PtDNA) were transformed into SakaiΔlacZ (Table 5.1). As a result

(Fig. 5.2A), β-galactosidase activities seen with hosts carrying pRS-PtDNA were 28 (pRS-

PtDNA5) to 304 (pRS-PtDNA7) folds higher than the control strain with empty vector.

The difference in β-galactosidase activities compared to Sakai(pRS551) was statistically

significant with all constructs (p < 0.05, Student’s t-Test) except for pRS-PtDNA5 (p =

0.063).

The transcription of ileZ and argO (belonging to the argOa allele) was confirmed using RT-qPCR (Fig. 5.2B). No amplification was detected after 35 cycles of qPCR from

RNA extract of E. coli MG1655.

ileZ2 facilitates the translation of 2ATA-Hfq. Tandem rare codons make a strong impact on protein expression especially when present within the first 75 nucleotides downstream of the initiating codon (11, 13). Therefore, in order to test the effects of

rare codons and cognate tRNAs (Sakai-encoded ileZ2, argN2 and argO2 in present study)

on protein translation in our model pET28::hfq system (Table 5.1), we inserted tandem

rare codons in between the initiation ATG (Met) and the following GGC (Gly) (Fig. S5.2).

Figure 5.3 shows the SDS-PAGE result of cell extracts from IPTG-induced

BL21(DE3) (Table 5.1) carrying a variety of constructs. An approximately 15 kDa Hfq 183

band was observed with the host carrying pET28-hfq (lane 1). However, the insertion of

2 tandem rare isoleucine codons ATA (lane 2) into pET28-hfq (resulting pET-2ATA, Table

5.1) led to the disappearance of the Hfq derivative band. In a control experiment, this

protein band was seen when 2 tandem frequent isoleucine codon ATT codons, more frequently used in E. coli for Ile (17, 28), were inserted (lane 5). This ensured that the

failure to overexpress 2ATA-Hfq is due to the inhibitory effect of tandem ATA codon on

translation efficiency rather than compromised stability of the new peptide with 2

tandem isoleucines at its N-terminal end.

The translation of 2ATA-Hfq was restored when cells were transformed with

pACYC-tDNA2 (Table 5.1, Fig. 5.3 lane 3), which encodes ileZ2, or the positive control pRARE (lane 4), which encodes ileX. Therefore, ileZ2 recognize and translate through

ATA codon.

4CGA-Hfq was overexpressed without supplementary tRNA. A similar system as

described above was used to test whether argN2 is a functional CGA-recognizing tRNA

(Fig. 5.4). Surprisingly, we observed overexpression of Hfq even when as many as 4

tandem CGA were inserted downstream of the start codon (pET-4CGA, Fig. 5.4 lane 2).

We did not test the effects of adding extra CGA codons on the protein translation because throughout Sakai genome (GenBank accession number: BA000007) no genes that encode 4 tandem CGA. CGC is the most frequent codon for arginine in E. coli, and pET-4CGC (Table 5.1) was included in this experiment as positive control. The presence 184

of this 4CGC-Hfq band (lane 3) in the gel also confirmed that Hfq derivative containing 4 tandem N-terminal arginines are stable.

argO2 does not restore the translation of 3AGA-Hfq. To test the hypothesis that

argO2 translates AGA, we assayed the effect of tandem AGA codons on protein

overexpression (Fig. 5.5A). We observed that the insertion of 3 (lane 3) but not 2 (lane 2)

tandem AGAs downstream of the start codon resulted in significant reduction in the

protein level of the Hfq derivative. Next, the argO2-encoding pACYC-tDNA2 (Table 5.1)

and the positive control plasmid pRARE (Table 5.1), which encodes an AGA-cognate tRNA argU (2), were introduced separately into BL21(DE3)(pET-3AGA). The expression of

3AGA-Hfq was restored in bacteria transformed with pRARE (lane 5) but not with

pACYC-tDNA2 (lane 4). argU and argO share 74% (57/77) sequence identity and same

anti-codons (Fig. S5.3).

To determine whether the difference observed between pACYC-tDNA2-encoded

argO2 and pRARE-encoded argU is due to differences in transcription levels, argO2 was

cloned into pRARE, precisely replacing the original argU. This new plasmid was

designated pRARE-argO2 (Table 5.1). Upon repeating the experiment above, the

expression of 3AGA-Hfq was still not observed after the introduction of pRARE-argO2

into BL21(DE3)(pET-3AGA) (Fig. 5.5B lane 4).

The effect of anti-codon inactivation on Stx2 and stx2-encoding phage

production. To test the previously suggested hypothesis that phage-encoded tRNAs

regulate toxin production, we replaced the wild-type copy of VT2-Sakai-encoded ileZ2- 185

argN2-argO2 with a mutant one which carries a point deletion at the second nucleotide of each tRNA gene. This was expected to inactivate these tRNA genes but minimize the

downstream effects on transcription from phage late promoter. The quantity of Stx2

and stx2-encoding phage was compared between the resulted SakaiΔtDNA (Table 5.1)

and the parental wild-type Sakai (Fig. 5.6). More Stx2 production was seen from Sakai than SakaiΔtDNA, but the difference was not statistically significant (p = 0.267, Student’s t-Test) (Fig. 5.6A). The production of VT2-Sakai was evaluated using qPCR (Fig. 5.6B) and

no significant different in phage quantity could be observed between Sakai and

SakaiΔtDNA. Additionally, no difference was seen between these strains when following phage induction by measuring OD600 over 6 hours post-ciprofloxacin addition (data not

shown).

Stx2 and VT2-Sakai production from C600::VT2-Sakai and C600::VT2-

SakaiΔtDNA. In order to investigate the effects of VT2-Sakai-encoding ileZ2-argN2-

argO2 on the production of Stx2 and VT2-Sakai in a different background, we

constructed C600::VT2-Sakai and C600::VT2-SakaiΔtDNA. E. coli C600 does not carry

prophage encoding ileZ-argN-argO (7). We sampled the culture supernatant from

C600::VT2-Sakai and C600::VT2-SakaiΔtDNA 6 hours after induction with 45 ng/ml

ciprofloxacin. No difference in the induction curves were seen (data not shown). A slot blot assay showed no significant difference in toxin production levels (p = 0.428,

Student’s t-Test, Fig. 5.7A). qPCR was used to evaluate the VT2-Sakai accumulation from

C600::VT2-Sakai and C600::VT2-SakaiΔtDNA; and no significant difference was observed

in phage production (p = 0.762, Student’s t-Test, Fig. 5.7B). 186

pRARE alters the biology of Sakai when induced with ciprofloxacin. pRARE encodes for a variety of rare codon tRNA genes (Table 5.1). In order to determine the effect of rare codon tRNA supplementation on the biology of host, we transformed

Sakai individually with pRARE and pACYC184, which share the same replication origins

(2). The growth curves in the absence of ciprofloxacin induction were very similar

between both transformants (data not shown), but remarkable differences were

observed upon ciprofloxacin induction (Fig. 5.8). Both strains exhibited bell-shaped

induction curves and reached similar maximal OD600. However, it took approximately 3

hours for Sakai(pACYC184) to reach this peak OD600 (same as wild type Sakai, data not

shown), yet it took Sakai(pRARE) 4 hours (Fig. 5.8A). qPCR revealed that after 6 hour induction, the quantity of VT2-Sakai was 3.7-fold lower in the culture supernatant of

Sakai(pRARE) than in that of Sakai(pACYC184), and this difference was statistically

significant (p =0.004, Student’s t-Test) (Fig. 5.8B). A more dramatic difference was seen

between the two strains when slot blot was used to quantify the Stx2 production (Fig.

5.8C). The Stx2 recovery from Sakai(pRARE) was approximately 24-fold lower than that

from Sakai(pACYC184) (p < 0.001, Student’s t-Test).

5.5 Discussion

This chapter is an ongoing project, where many details of the EHEC encoded ileZ-

argN-argO operon still remain unknown. While we do not even have evidence 187

supporting that argN2 or argO2 encode functional tRNAs, all will be referred to as genes

in the following text.

Prophage and prophage-like elements play major roles in the evolution of EHEC

(28, 39, 44). Previous studies using whole genome sequencing located most of the EHEC

virulence factors within these horizontally acquired genetic elements. An intriguing

characteristic of genes encoded within these regions is their differential codon usage

compared to those in the backbone genome (28, 44, 45). Bioinformatic analysis

demonstrated that imported genetic elements utilize rare codons such as AGG (Arg),

AGA (Arg), CGA (Arg) and ATA (Ile) more frequently than genes encoded within the

backbone genome (44). Meanwhile, tRNA genes (ileZ, argN and argO) that are proposed

to recognize these rare codons are found in multiple prophage regions within the EHEC

genome (44). All O157 and non-O157 EHEC strains fully sequenced so far contain 5 to 8

prophage each encoding an ileZ-argN-argO operon, while only 2 to 3 such prophage

were found in other pathogenic E. coli such as enteroaggregative E. coli (EAEC) and

extraintestinal pathogenic E. coli (ExPEC) (22, 44). On the contrary, to our knowledge,

this operon is not found in any sequenced laboratory strains of E. coli (Table S5.1). It

therefore has been suggested that ileZ-argN-argO regulates the expression of proteins

involved in EHEC virulence (28, 44, 61), through neither the transcription of these

putative tRNA genes nor their activities have been experimentally tested. The major

goals in this study included i) to determine the correlation between serotype/source of

EHEC isolates and the relative copy numbers of the rare codon tRNA genes; ii) to

investigate the transcription and translational activity of ileZ, argN and argO; iii) to 188

determine the effects of VT2-Sakai-encoded ileZ2-argN2-argO2 operon on the

production of Stx2 and stx2-encoding phage in E. coli O157:H7 Sakai and C600::VT2-

Sakai (Table 5.1).

The codon bias together with the availability of tRNA isoacceptors is an

evolutionary means for bacteria to control the expression rate of certain genes, to

optimize the efficiency of translation, and consequently, to maximize their growth rates

(17, 20, 37). Some pathogens also use the availability of rare-codon tRNA for post-

transcriptional regulation on the expression of their virulence gene. The rare leucine-

cognate leuX in uropathogenic E. coli (48) and rare arginine-cognate fimU in S.

Typhimurium (55) are two well-documented examples. Whole genome sequencing

revealed that EHEC strains possess more ileZ-argN-argO operons than E. coli belong to

other pathotypes and non-pathogenic E. coli (44) (Table S5.1). Using a qPCR-based

method, we further investigated the distribution of ileZ and argO within STEC strains

(Fig. 5.1). We conclude that strains belonging to high risk O type possess significantly

more copies of ileZ and argO than the STEC strains of other serotypes. In addition to

O157, more than 100 serotypes of STEC have been described (9, 29, 31), but strains

belonging to O26, O111, O103, O145, O121 and O45 [Big Six (57)] contribute 70% of the

non-O157 STEC infections (9). Other than the genes encoding Shiga toxin and

components of the LEE, little is known about which genes are conserved across these

serotypes. In the current study, we show for the first time that STEC strains belonging to

O26, O103, O111, O121, O145 and O157 carry more rare codon cognate tRNA genes than the others (Fig. 5.1). 189

We also compared the prevalence of ileZ and argO among the human and non-

human isolates. We determined that ileZ and argO are present at a higher copy number

in human isolates than in environmental isolates, though the difference was not statically significant for ileZ. This observation adds to the previously reported source-

associated differences among STEC isolates including prevalence of virulence genes (8),

single nucleotide and insertion/deletion polymorphisms (12), phage type and antimicrobial resistance (63). Meanwhile, our in silico analysis confirmed that in Sakai,

most of the virulence-related genes, including stx2 (51), LEE genes (18, 21), pO157-

encoded hly genes (26) and toxB (56) utilize rare codons more frequently than the

backbone genome (Table S5.4). All these observations supported the previous

hypothesis that rare codon tRNAs facilitate the translation of virulence genes and

therefore contribute to the virulence potential of STEC strains.

However, these putative tRNA genes within the same operon presented

complicated natures and the diversity in their functional abilities should not be overlooked. ileZ is the first gene of this operon and compared to argN and argO, it is also the most conserved throughout its 7 alleles in E. coli O157:H7 Sakai (Fig. S5.6).

Results from both β-galactosidase assay (Fig. 5.2A) and RT-qPCR (Fig. 5.2B, performed

without inducing the prophage) suggested that active promoters exist upstream of

these alleles, and surprisingly that the transcription may be independent of prophage PR’.

The translational ability of VT2-Sakai-encoded ileZ2 was demonstrated in a

BL21(DE3) model system. Chen and Inouye (11) suggested that the translation inhibitory

effect of rare codons become increasingly significant when these codons are present 190

within the first 25 codons in the gene. We observed inhibition of an Hfq reporter when

two tandem ATA codons were inserted 3’ of the initiating codon (Fig. 5.3), even though

BL21(DE3) encodes one chromosomal copy of the ATA-cognate tRNA ileX.

Overexpression of the protein was restored when pACYC-tDNA2 was supplied (Fig. 5.3).

This result demonstrated that ileZ2 can be properly processed and is translationally

active.

The same model system was used to examine the translational activity of argN2, whose anticodon is TCG (28). Surprisingly, we observed that as many as 4 tandem CGA codons were not sufficient to inhibit the translation of Hfq (Fig. 5.4), while bioinformatic analysis demonstrated that only 3 genes (ECs1201, ECs2782 and Ecs3503) in Sakai genome contains 3 tandem CGA codons, but none contain as many as 4 (Table. S5.5). E.

Arg coli encodes 4 tRNA genes that belong to Arg2 family (60). tRNA2 have an ACG

anticodon and are the most abundant tRNA in E. coli cell (17). In addition to CGU,

Arg tRNA2 can recognize CGC and CGA (17). This means, although CGA is one of the rarest

codon in Sakai genome, multiple alleles of tRNA can pair with this codon, which suggests that argN may not be necessary for the translation of its cognate rare codon. One observation supporting this hypothesis is that argN has undergone significantly more mutations in Sakai than ileZ and argO (Table S5.1, Fig. S5.6). Bailly-Bechet et al. (4) suggested that phage-encoded tRNAs are kept only when the evolutional advantage of carrying it overcomes the negative effect of increasing the genome size and the frequent deletion occur within phage and bacterial genome. 191

AGA is the second rarest encoding codon throughout the Sakai genome (28) and

we observed inhibition of Hfq overexpression when 3 tandem AGA codons were

inserted 3’ of the initiating codon of the gene (Fig. 5.5A). It is noteworthy that only two

genes (ECs2181 and ECs4393) contain 3 tandem AGA codons in Sakai genome (Table

S5.5). This inhibition was alleviated when cells were transformed with pRARE. This

plasmid is derived from pACYC184 (2) and encodes a variety of rare-codon cognate tRNA

genes including AGA/AGG-recognizing argU (Table 5.1) (2, 14). argU is present in the

genomes of Sakai, BL21(DE3) and E. coli K-12 and is 100% conserved in both structural

and promoter sequences among these strains. Our result suggested that increasing the expression of argU facilitates the translation of proteins that heavily use AGA codons. To the contrary, the inhibitory effect of 3 tandem AGA was not overcome by transforming cells within the pACYC-tDNA encoded argO2 (Fig. 5.5A). To control for possible

difference in expression levels due to promoter activity, we precisely replaced the

pRARE-encoded argU with argO2, and found that the new construct was still incapable

of restoring translation (Fig. 5.5B). The sequence difference between argO2 and argU is

limited and the nucleotide changes seen with argO2 are not predicted to affect the

folded structure of argO2 (Fig. S5.3).

One hypothesis we currently have is that argO2 is not efficiently charged by the

BL21(DE3)-encoded arginyl-tRNA synthetase. It has been previously documented that the recognition of tRNA by aminoacyl-tRNA synthetase involves not only the anticodon, but also nucleotides at other positions within the molecule (30). Given the sequence

diversity between argO2 and argU, it seems plausible that the two tRNAs are not 192

equally charged. In order to investigate the charging efficiency of argO2, we propose to

apply the acid urea polyacrylamide gel electrophoresis (acid urea PAGE) method developed by Köhrer et al. (35). Briefly, this protocol treats the extracted tRNA with high pH, which results in deacylatation. Next, the treated and untreated samples are examined with acid urea PAGE followed by Northern blot analysis. A comparison of migration rates could be used to determine the charged state of the tRNA molecule.

We also examined the effects of inactivating ileZ2, argN2 and argO2 on the

production of Stx2 and VT2-Sakai upon induction. ileZ2-argN2-argO2 is assumed the

most important allele for the biology of VT2-Sakai not only because it is located within

the prophage, but also because this allele is hypothetically co-regulated by the

prophage late promoter along with stx2AB, genes essential for host cell lysis and release

of phage particles (holin, ECs1212; endolysin, ECs1213), and genes encoding for phage

coat synthesis (40), which all use rare codons very frequently (Table S5.4). This

assumption needs to be tested by measuring the tRNA abundance after induction. Yet

we do not know whether these induced tRNA can be processed properly, in which many

different enzymes are involved (42).

However, there were no significant differences in Stx2 or phage production comparing wild-type to SakaiΔtDNA (Table 5.1, Fig. 5.6). In order to determine whether this is a result of the compensation by other ileZ-argN-argO alleles in Sakai, we

constructed C600::VT2-Sakai and C600::VT2-SakaiΔtDNA (Table 5.1). In these strains,

ileZ-argN-argO is only present in the transduced phage. Interestingly, no statistically

significant difference in Stx2 and phage quantity was observed between these two 193

strains either (Fig. 5.7). One explanation of our observation is the different phage content between Sakai and C600, the lambda phage-cured derivative of E. coli K-12 (3).

Sakai carries 18 prophage and at least 5 of them can be induced upon antibiotic

induction (1). All these phage would then require cognate-tRNA to gain advantage over

its competitors by translating its heavy-rare codon-using genes more efficiently, reducing its latency time (the average time it takes a phage to lyse the host after induction), and increasing the reproduction (4). This competition may not exist in

C600::VT2-SakaiΔtDNA. The tRNA transcribed from the backbone genome (i. e. ileX and

argU as discussed above) might be sufficient to sustain the translational need of the only prophage.

The position of the rare codons in VT2-Sakai late genes may also provide an

explanation for the lack of phenotypic change upon ileZ-argN-argO inactivation. The

regulatory effect of rare codons on the gene translation becomes highly significant

when such codons are near the initiation codon (11) and present in tandem copies (13).

This pattern is not found for ATA or AGA/AGG in any of the late genes encoded within

VT2-Sakai (Table S5.5).

The functionalities of ileZ and argO are supported by some of our observations.

Bailly-Bechet et al. (4) concluded that expressing the rare tRNA provide decisive benefit

to the phage if it corresponds to a high frequent codon in its own genes. Instead, the

tRNA genes not under positive selection are frequently lost, as our observation with

argN. It is also intriguing that though located downstream of regulation of phage PR’, all

ileZ-argN-argO operons in Sakai carry their own promoters (Fig. 5.2A). The constitutive 194

expression of ileZ and argO (Fig. 5.2B) is likely to affect the biology of the prophage and

the host in a manner that is not necessarily related to phage lytic cycle and translation

of late genes (i. e. Stx2), although only the later function has been suggested previously

(28, 44, 61). Clearly the function of ileZ-argN-argO in Sakai requires further investigation.

One approach we have taken to further investigate the roles of rare codon tRNAs

is transforming pRARE and its origin pACYC184 (Table 5.1) into Sakai. Strikingly, the

complementation of these tRNAs significantly altered the induction curve, Stx2

production and phage production (Fig. 5.8). Given the heavy usage of rare codons in

VT2-Sakai late genes, this result was opposite to our expectation. Currently we still do not know whether this phenotypic change results from one tRNA gene or a combination of multiple ones, or the detailed mechanism involved. One of our future plans is to knock out each of these plasmid-encoded tRNA genes and characterize their function

individually.

In conclusion, this is an ongoing project and more experiments are needed to

explain the biological significance of ileZ-argN-argO operon in EHEC. We investigated

the transcription and translational activity of VT2-Sakai-encoded ileZ2-argN2-argO2 but were unable to demonstrate their effects on the virulence of Sakai, at least on Stx2 and phage production. However, the supplementation of the rare codon tRNA significantly affected the biology of Sakai upon ciprofloxacin induction. Our observations suggested that the involvement of ileZ-argN-argO operon in the physiology of EHEC strains is truly complicated. The impact of these tRNA genes on host biology requires future studies.

195

5.6 Acknowledgement

This work was funded by USDA‐NIFA grant 2009‐03611, by start‐up funds through the Penn State University Department of Food Science and College of

Agricultural Sciences, and by the Casida Development Professorship to E.G.D. We would like to thank the help of the Penn State Genomics Core Facility (University Park, PA) for generating DNA Sequence information. We would also like to thank Dr. Wei Zhang

(Illinois Institute of Technology, Division of Biology) for providing bacterial strain.

196

5.7 References

1. Asadulghani, M., Y. Ogura, T. Ooka, T. Itoh, A. Sawaguchi, A. Iguchi, K. Nakayama, and T. Hayashi. 2009. The defective prophage pool of Escherichia coli O157: prophage-prophage interactions potentiate horizontal transfer of virulence determinants. PLoS Pathog. 5:e1000408. 2. Baca, A. M., and W. G. Hol. 2000. Overcoming codon bias: a method for high- level overexpression of Plasmodium and other AT-rich parasite genes in Escherichia coli. Int. J. Parasitol. 30:113-118. 3. Bachmann, B. J. 1996. Derivations and genotypes of some mutant derivatives of Escherichia coli K-12, p. 2460-2488. ASM Press,, Washington, D.C. 4. Bailly-Bechet, M., M. Vergassola, and E. Rocha. 2007. Causes for the intriguing presence of tRNAs in phages. Genome Res. 17:1486-1495. 5. Bertani, G. 1951. Studies on lysogenesis. I. The mode of phage liberation by lysogenic Escherichia coli. J. Bacteriol. 62:293-300. 6. Beutin, L., A. Miko, G. Krause, K. Pries, S. Haby, K. Steege, and N. Albrecht. 2007. Identification of human-pathogenic strains of Shiga toxin-producing Escherichia coli from food by a combination of serotyping and molecular typing of Shiga toxin genes. Appl. Environ. Microbiol. 73:4769-4775. 7. Blattner, F. R., G. Plunkett, 3rd, C. A. Bloch, N. T. Perna, V. Burland, M. Riley, J. Collado-Vides, J. D. Glasner, C. K. Rode, G. F. Mayhew, J. Gregor, N. W. Davis, H. A. Kirkpatrick, M. A. Goeden, D. J. Rose, B. Mau, and Y. Shao. 1997. The complete genome sequence of Escherichia coli K-12. Science 277:1453-1462. 8. Brandt, S. M., N. King, A. J. Cornelius, A. Premaratne, T. E. Besser, and S. L. W. On. 2011. Molecular risk assessment and epidemiological typing of Shiga toxin- producing Escherichia coli by using a novel PCR binary typing system. Appl. Env. Microbiol. 77:2458-2470. 9. Brooks, J. T., E. G. Sowers, J. G. Wells, K. D. Greene, P. M. Griffin, R. M. Hoekstra, and N. A. Strockbine. 2005. Non-O157 Shiga toxin–producing Escherichia coli infections in the United States, 1983–2002. J. Infect. Dis. 192:1422-1429. 10. Caprioli, A., S. Morabito, H. Brugere, and E. Oswald. 2005. Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Vet. Res. 36:289-311. 11. Chen, G. T., and M. Inouye. 1994. Role of the AGA/AGG codons, the rarest codons in global gene expression in Escherichia coli. Genes Dev. 8:2641-2652. 12. Clawson, M. L., J. E. Keen, T. P. L. Smith, L. M. Durso, T. G. McDaneld, R. E. Mandrell, M. A. Davis, and J. L. Bono. 2009. Phylogenetic classification of Escherichia coli O157:H7 strains of human and bovine origin using a novel set of nucleotide polymorphisms. Genome Biol. 10:R56. 13. Cruz-Vera, L. R., M. A. Magos-Castro, E. Zamora-Romo, and G. Guarneros. 2004. Ribosome stalling and peptidyl-tRNA drop-off during translational delay at AGA codons. Nucleic Acids Res. 32:4462-4468. 197

14. Del Tito Jr, B. J., J. M. Ward, J. Hodgson, C. Gershater, H. Edwards, L. A. Wysocki, F. A. Watson, G. Sathe, and J. F. Kane. 1995. Effects of a minor isoleucyl tRNA on heterologous protein translation in Escherichia coli. J. Bacteriol. 177:7086-7091. 15. Delahay, R. M., G. Frankel, and S. Knutton. 2001. Intimate interactions of enteropathogenic Escherichia coli at the host cell surface. Curr. Opin. Infect. Dis. 14:559-565. 16. Dobrindt, U., K. Piechaczek, A. Schierhorn, G. Fischer, M. Hecker, and J. Hacker. 2002. Influence of the leuX-encoded tRNA5 (Leu) on the regulation of gene expression in pathogenic Escherichia coli. J. Mol. Microbiol. Biotechnol. 4:205- 209. 17. Dong, H., L. Nilsson, and C. G. Kurland. 1996. Co-variation of tRNA abundance and codon usage in Escherichia coli at different growth rates. J. Mol. Biol. 260:649-663. 18. Donnenberg, M. S., and J. B. Kaper. 1991. Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector. Infect. Immun. 59:4310-4317. 19. Dudley, E. G., N. R. Thomson, J. Parkhill, N. P. Morin, and J. P. Nataro. 2006. Proteomic and microarray characterization of the AggR regulon identifies a pheU pathogenicity island in enteroaggregative Escherichia coli. Mol. Microbiol. 61:1267-1282. 20. Ehrenberg, M., and C. G. Kurland. 1984. Costs of accuracy determined by a maximal growth rate constraint. Q. Rev. Biophys. 17:45-82. 21. Elliott, S. J., L. A. Wainwright, T. K. McDaniel, K. G. Jarvis, Y. Deng, L.-C. Lai, B. P. McNamara, M. S. Donnenberg, and J. B. Kaper. 2002. The complete sequence of the locus of enterocyte effacement (LEE) from enteropathogenic Escherichia coli E2348/69. Mol. Microbiol. 28:1-4. 22. Eppinger, M., M. K. Mammel, J. E. Leclerc, J. Ravel, and T. A. Cebula. 2011. Genomic anatomy of Escherichia coli O157:H7 outbreaks. Proc. Natl. Acad. Sci. U. S. A. 108:20142-20147. 23. Fukushima, H., T. Hashizume, Y. Morita, J. Tanaka, K. Azuma, Y. Mizumoto, M. Kaneno, M. Matsuura, K. Konma, and T. Kitani. 1999. Clinical experiences in Sakai City Hospital during the massive outbreak of enterohemorrhagic Escherichia coli O157 infections in Sakai City, 1996. Pediatr. Int. 41:213-217. 24. Gamage, S. D., J. E. Strasser, C. L. Chalk, and A. A. Weiss. 2003. Nonpathogenic Escherichia coli can contribute to the production of Shiga toxin. Infect. Immun. 71:3107-3115. 25. Griffin, P. M., and R. V. Tauxe. 1991. The epidemiology of infections caused by Escherichia coli O157:H7, other enterohemorrhagic E. coli, and the associated hemolytic uremic syndrome. Epidemiol. Rev. 13:60-98. 26. Gyles, C. L. 2007. Shiga toxin-producing Escherichia coli: an overview. J. Anim. S. 85:E45-E62. 27. Hannan, T. J., I. U. Mysorekar, S. L. Chen, J. N. Walker, J. M. Jones, J. S. Pinkner, S. J. Hultgren, and P. C. Seed. 2008. LeuX tRNA-dependent and-independent 198

mechanisms of Escherichia coli pathogenesis in acute cystitis. Mol. Microbiol. 67:116-128. 28. Hayashi, T., K. Makino, M. Ohnishi, K. Kurokawa, K. Ishii, K. Yokoyama, C. G. Han, E. Ohtsubo, K. Nakayama, T. Murata, M. Tanaka, T. Tobe, T. Iida, H. Takami, T. Honda, C. Sasakawa, N. Ogasawara, T. Yasunaga, S. Kuhara, T. Shiba, M. Hattori, and H. Shinagawa. 2001. Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12. DNA research : an international journal for rapid publication of reports on genes and genomes 8:11-22. 29. Hughes, J. M., M. E. Wilson, K. E. Johnson, C. M. Thorpe, and C. L. Sears. 2006. The emerging clinical importance of Non-O157 Shiga toxin—producing Escherichia coli. Clin. Infect. Dis. 43:1587-1595. 30. Ibba, M., and D. Soll. 2000. Aminoacyl-tRNA synthesis. Annu. Rev. Biochem. 69:617-650. 31. Johnson, R. P., R. C. Clarke, J. B. Wilson, S. C. Read, K. Rahn, S. A. Renwick, K. A. Sandhu, D. Alves, M. A. Karmali, and H. Lior. 1996. Growing concerns and recent outbreaks involving non-O157:H7 serotypes of verotoxigenic Escherichia coli. J. Food Prot. 59:1112-1122. 32. Kane, J. F. 1995. Effects of rare codon clusters on high-level expression of heterologous proteins in Escherichia coli. Curr. Opin. Biotechnol. 6:494-500. 33. Kaper, J. B., J. P. Nataro, and H. L. Mobley. 2004. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2:123-140. 34. Kobayashi, A., H. Hirakawa, T. Hirata, K. Nishino, and A. Yamaguchi. 2006. Growth phase-dependent expression of drug exporters in Escherichia coli and its contribution to drug tolerance. J. Bacteriol. 188:5693-5703. 35. Kohrer, C., and U. L. Rajbhandary. 2008. The many applications of acid urea polyacrylamide gel electrophoresis to studies of tRNAs and aminoacyl-tRNA synthetases. Methods 44:129-138. 36. Kumar, S., M. Nei, J. Dudley, and K. Tamura. 2008. MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 9:299-306. 37. Kurland, C. G. 1993. Major codon preference: theme and variations. Biochem. Soc. Trans. 21:841-846. 38. Law, D. 2000. Virulence factors of Escherichia coli O157 and other Shiga toxin producing E. coli. J. Appl. Microbiol. 88:729-745. 39. Leopold, S. R., V. Magrini, N. J. Holt, N. Shaikh, E. R. Mardis, J. Cagno, Y. Ogura, A. Iguchi, T. Hayashi, A. Mellmann, H. Karch, T. E. Besser, S. A. Sawyer, T. S. Whittam, and P. I. Tarr. 2009. A precise reconstruction of the emergence and constrained radiations of Escherichia coli O157 portrayed by backbone concatenomic analysis. Proc. Natl. Acad. Sci. U. S. A. 106:8713-8718. 40. Makino, K., K. Yokoyama, Y. Kubota, C. H. Yutsudo, S. Kimura, K. Kurokawa, K. Ishii, M. Hattori, I. Tatsuno, H. Abe, T. Iida, K. Yamamoto, M. Onishi, T. Hayashi, T. Yasunaga, T. Honda, C. Sasakawa, and H. Shinagawa. 1999. Complete nucleotide sequence of the prophage VT2-Sakai carrying the verotoxin 2 genes of 199

the enterohemorrhagic Escherichia coli O157:H7 derived from the Sakai outbreak. Genes Genet. Syst. 74:227-239. 41. Melton-Celsa, A. R., and A. D. O'Brien. 1998. Structure, biology, and relative toxicity of Shiga toxin family members for cells and animals, p.121-128. Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. ASM Press, Washington, D.C. 42. Morl, M., and A. Marchfelder. 2001. The final cut. The importance of tRNA 3'- processing. EMBO Rep. 2:17-20. 43. Najafabadi, H. S., H. Goodarzi, and R. Salavati. 2009. Universal function- specificity of codon usage. Nucleic Acids Res. 37:7014-7023. 44. Ogura, Y., T. Ooka, A. Iguchi, H. Toh, M. Asadulghani, K. Oshima, T. Kodama, H. Abe, K. Nakayama, K. Kurokawa, T. Tobe, M. Hattori, and T. Hayashi. 2009. Comparative genomics reveal the mechanism of the parallel evolution of O157 and non-O157 enterohemorrhagic Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 106:17939-17944. 45. Perna, N. T., G. Plunkett, 3rd, V. Burland, B. Mau, J. D. Glasner, D. J. Rose, G. F. Mayhew, P. S. Evans, J. Gregor, H. A. Kirkpatrick, G. Posfai, J. Hackett, S. Klink, A. Boutin, Y. Shao, L. Miller, E. J. Grotbeck, N. W. Davis, A. Lim, E. T. Dimalanta, K. D. Potamousis, J. Apodaca, T. S. Anantharaman, J. Lin, G. Yen, D. C. Schwartz, R. A. Welch, and F. R. Blattner. 2001. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature 409:529-533. 46. Philippe, N., J.-P. Alcaraz, E. Coursange, J. Geiselmann, and D. Schneider. 2004. Improvement of pCVD442, a suicide plasmid for gene allele exchange in bacteria. Plasmid 51:246-255. 47. Pollock, K. G. J., T. J. Beattie, B. Reynolds, A. Stewart, and J. M. Cowden. 2007. Clinical management of children with suspected or confirmed E. coil O157 infection. Scott. Med. J. 52:5-7. 48. Ritter, A., D. L. Gally, P. B. Olsen, U. Dobrindt, A. Friedrich, P. Klemm, and J. Hacker. 1997. The Pai associated leuX specific tRNALeu5 affects type 1 fimbriation in pathogenic Escherichia coli by control of FimB recombinase expression. Mol. Microbiol. 25:871-882. 49. Rose, R. E. 1988. The nucleotide sequence of pACYC184. Nucleic Acids Res. 16:355. 50. Ruggenenti, P., M. Noris, and G. Remuzzi. 2001. Thrombotic microangiopathy, hemolytic uremic syndrome, and thrombotic thrombocytopenic purpura. Kidney Int. 60:831-846. 51. Serna Iv, A., and E. C. Boedeker. 2008. Pathogenesis and treatment of Shiga toxin-producing Escherichia coli infections. Curr. Opin. Gastroenterol. 24:38-47. 52. Serra-Moreno, R., J. Jofre, and M. Muniesa. 2007. Insertion site occupancy by stx2 bacteriophages depends on the locus availability of the host strain chromosome. J. Bacteriol. 189:6645-6654. 53. Simons, R. W., F. Houman, and N. Kleckner. 1987. Improved single and multicopy lac-based cloning vectors for protein and operon fusions. Gene 53:85- 96. 200

54. Suzuki, T., and K. Miyauchi. 2010. Discovery and characterization of tRNAIle lysidine synthetase (TilS). FEBS Lett. 584:272-277. 55. Tinker, J. K., and S. Clegg. 2001. Control of FimY translation and type 1 fimbrial production by the arginine tRNA encoded by fimU in Salmonella enterica serovar Typhimurium. Mol. Microbiol. 40:757-768. 56. Tozzoli, R., A. Caprioli, and S. Morabito. 2005. Detection of toxB, a plasmid virulence gene of Escherichia coli, in enterohemorrhagic and enteropathogenic E. coli. J. Clin. Microbiol. 43:4052-4056. 57. USDA-FSIS. 2011. Shiga Toxin-producing Escherichia coli in certain raw beef products, vol. 58157, http://www.fsis.usda.gov/OPPDE/rdad/FRPubs/2010- 0023.pdf Accessed August 2, 2012. 58. Waldor, M. K., and D. I. Friedman. 2005. Phage regulatory circuits and virulence gene expression. Curr. Opin. Microbiol. 8:459-465. 59. Watanabe, H., A. Wada, Y. Inagaki, K. Itoh, and K. Tamura. 1996. Outbreaks of enterohaemorrhagic Escherichia coli O157: H7 infection by two different genotype strains in Japan, 1996. Lancet 348:831-832. 60. Withers, M., L. Wernisch, and M. Dos Reis. 2006. Archaeology and evolution of transfer RNA genes in the Escherichia coli genome. RNA 12:933-942. 61. Yang, Z., J. Kim, C. Zhang, M. Zhang, J. Nietfeldt, C. M. Southward, M. G. Surette, S. D. Kachman, and A. K. Benson. 2009. Genomic instability in regions adjacent to a highly conserved pch prophage in Escherichia coli O157:H7 generates diversity in expression patterns of the LEE pathogenicity island. J. Bacteriol. 191:3553-3568. 62. Zhang, X., A. D. McDaniel, L. E. Wolf, G. T. Keusch, M. K. Waldor, and D. W. Acheson. 2000. Quinolone antibiotics induce Shiga toxin-encoding bacteriophages, toxin production, and death in mice. J. Infect. Dis. 181:664-670. 63. Ziebell, K., M. Steele, Y. Zhang, A. Benson, E. N. Taboada, C. Laing, S. McEwen, B. Ciebin, R. Johnson, and V. Gannon. 2008. Genotypic characterization and prevalence of virulence factors among Canadian Escherichia coli O157:H7 strains. Appl. Environ. Microbiol. 74:4314-4323.

201

Figure legend

FIG. 5.1. Relative abundance of ileZ (A), argOa (B) and argOb (C) in E. coli O157:H7 that vary in sources and O types. The relative copy numbers of ileZ and argO comparing to

rrsA were assayed by qPCR and calculated as ΔCt (ΔCt = CttRNA - CtrRNA). The mean ΔCt of

each source/O-type group was presented in the figure. Open diamonds represent low

risk O type and open cycles represent high risk O type. The uncrossed nature of the

dashed lines for each tRNA indicated that the source and O type were associated with

tRNA gene distribution independent.

FIG. 5.2. Transcription of the ileZ-argN-argO operons. (A) Predicted promoters for each

of the ileZ-argN-argO cassettes are active by the β-galactosidase assay. SakaiΔlacZ was

transformed with pRS551 derivatives carrying the promoters from each of the 7 copies

of ileZ-argN-argO promoter (pRS-PtDNA1 through pRS-PtDNA7). SakaiΔlacZ carrying

empty pRS551 were kept control. Error bars indicate the standard deviation from 3

independent repeats. Asterisks indicate significant difference between pRS-PtDNA and

pRS551; *: p < 0.05, **: p < 0.01 (Student’s t-Test). Promoters were put in the order of

their positions in the genome. (B) The transcription of ileZ and argOa was detected

using RT-qPCR. The mean Ct from 4 replicates was presented, and the standard deviation is included in the parenthesis. ND: Not detected.

FIG. 5.3. ileZ2 complemented the expression of 2ATA-Hfq. Whole cell protein extracts

from IPTG-induced BL21(DE3) derivatives carrying the following plasmids were profiled

by SDS-PAGE and Coomassie Brilliant Blue staining. Lane 1: pET28::hfq; lane 2: pET-2ATA; 202

lane 3: pET-2ATA/pACYC-tDNA2; lane 4: pET-2ATA/pRARE; lane 5: pET-2ATT. M: size

standard.

FIG. 5. 4. 4 tandem CGA codons did not inhibit the translation of co-responding Hfq

derivative. Whole cell protein extracts from IPTG-induced BL21(DE3) derivatives

carrying the following plasmids were profiled by SDS-PAGE and Coomassie Brilliant Blue

staining. Lane 1: pET::hfq; lane2: pET-4CGA; lane3: pET-4CGC. M: size standard. See Fig.

S5.5 for original gel picture.

FIG. 5.5. argO2 failed in restoring the expression of 3AGA-Hfq. Whole cell protein

extracts from IPTG-induced BL21(DE3) derivatives carrying the following plasmids were

profiled by SDS-PAGE and Coomassie Brilliant Blue staining. (A) Lane 1: pET::hfq; lane

2:pET-2AGA; lane 3: pET-3AGA; lane 4: pET-3AGA/pACYC-tDNA2; lane 5: pET-

3AGA/pRARE. (B) Lane 1: pET::hfq; lane 2:pET-3AGA; lane 3: pET-3AGA/pRARE; lane 4:

pET-3AGA/pRARE-argO2. M: size standard.

FIG. 5.6. Quantification of Stx2 and phage from Sakai and SakaiΔtDNA. (A)

Representative slot blot result for Stx2 production after ciprofloxacin induction. (B) The intensity of each Stx2 band was analyzed using the Odyssey Application Software and is presented in arbitrary units. The Stx2 recovery from SakaiΔtDNA was lower than that from the parental strain, but the difference was not statistically significant (p = 0.266,

Student’s t-Test). (C) VT2-Sakai was quantified from each strain by qPCR. No significant

difference in phage levels was seen between the strains (p = 0.171, Student’s t-Test). All

results were the averages from three biological repeats and error bars represent 1 SD. 203

FIG. 7. Quantification of Stx2 and phage from C600::VT2-Sakai and C600::VT2-

SakaiΔtDNA. (A) Representative slot blot result for Stx2 production after ciprofloxacin

induction. (B) The intensity of each Stx2 band was analyzed using the Odyssey

Application Software and is presented in arbitrary units. Stx2 production between

C600::VT2-Sakai and C600::VT2-SakaiΔtDNA was not significantly different (p = 0.428,

Student’s t-Test). (C) The quantity of VT2-Sakai was quantified from each strain by qPCR.

No significant difference in induced phage levels were observed between the two

strains (p = 0.762, Student’s t-Test). ). All results were the averages from three biological repeats and error bars represent 1 SD.

FIG. 5.8. Effects of pRARE on the biology of Sakai when induced with ciprofloxacin. (A)

The OD600 development of Sakai(pACYC184) (rectangle) and Sakai(pRARE) (triangle) were

profiled for 6 hours. (B) VT2-Sakai was quantified from each strain by qPCR. Significantly

more phage was detected from Sakai(pACYC184) than Sakai(pRARE) (p = 0.004,

Student’s t-Test). (C) Stx2 production was detected using slot blot .The intensity of the

bands were analyzed using the Odyssey Application Software and is presented in

arbitrary units. The Stx2 recovery from Sakai(pRARE) was significantly lower than that

from Sakai(pACYC184) (p < 0.001, Student’s t-Test). Representative results from slot blot

are shown in the bottom. All results were the averages from three biological repeats

and error bars represent 1 SD.

204

Table 5.1 Strains and plasmids used in this study

Strain or plasmid Relevant Characteristics Reference * E. coli Strains

SM10λpir Host for maintenance and conjugation of pDS132 derivatives Lab collection Sakai O157:H7, Strr mutant; stx1, stx2 W. Zhang SakaiΔlac Sakai derivative with lac operon inactivated This study Sakai derivative with deletions at the second nucleotide of anti-codons in SakaiΔtDNA This study ileZ2, argN2 and argO2 BL21(DE3) Host for IPTG-induced expression Novagen MG1655 K-12 (7) C600 K-12 derivative, lambdoid prophage-cured CGSC C600::VT2-Sakai C600 lysogenized with stx2-encoding phage VT2-Sakai This study C600::VT2-Sakai with deletions at second nucleotide of anti-codons in ileZ2, C600::VT2-SakaiΔtDNA This study argN2 and argO2

Plasmids pDS132 Suicide vector; Camr; levansucrase-encoding (46) pDS132 carrying ileZ2-argN2-argO2, the second nucleotide of each anti- pDS132::ΔtDNA This study codon is removed pDS132::ΔtDNA-alt pDS132 carrying concatenated fragments flanking ileZ2-argN2-argO2 This study pCVD442 Suicide vector; Camr; levansucrase-encoding (18) pCVD442::Δlac pCVD442 carrying concatenated fragments flanking Sakai lac operon This study pRS551 lac-based promoter fusion vector (53) pRS-PtDNA1 pRS551 containing the ileZ1-argN1-argO1 promoter This study pRS-PtDNA2 pRS551 containing the ileZ2-argN2-argO2 promoter This study pRS-PtDNA3 pRS551 containing the ileZ3-argO3 promoter This study pRS-PtDNA4 pRS551 containing the ileZ4-argO4 promoter This study pRS-PtDNA5 pRS551 containing the ileZ5-argO5 promoter This study pRS-PtDNA6 pRS551 containing the ileZ6-argN6-argO6 promoter This study pRS-PtDNA7 pRS551 containing the ileZ7-argN7-argO7 promoter This study Derivative of pET-28a(+) with a 310-bp Hfq protein-encoding fragment pET28::hfq K. Keiler from E. coli K-12 between its NdeI and EcoRI sites. pET-2ATA pET28::hfq with 2 tandem ATA codon integrated after the initiating ATG This study pET-2ATT pET28::hfq with 2 tandem ATT codon integrated after the initiating ATG This study pET-4CGA pET28::hfq with 4 tandem CGA codon integrated after the initiating ATG This study pET-4CGC pET28::hfq with 4 tandem CGC codon integrated after the initiating ATG This study pET-2AGA pET28::hfq with 2 tandem AGA codon integrated after the initiating ATG This study pET-3AGA pET28::hfq with 3 tandem AGA codon integrated after the initiating ATG This study pACYC184 Cloning vector (49) pACYC184 with a 474 bp HindIII/BamHI fragment encoding the ileZ2- pACYC-tDNA2 This study argN2-argO2 from E. coli Sakai

205

Table 5.1 Strains and plasmids used in this study (Cont’d)

plasmid Relevant Characteristics Reference Plasmid harboring p15a ori and genes for rare tRNAs proL (reads CCC and CCU), leuW (reads UUG), metT (reads AUG), argW (reads AGG), thrT pRARE (reads ACC and ACU), glyT (reads GGA and GGG), tyrU (reads UAC and Novagen UAU), thrU (reads ACA, ACU, and ACG), argU (reads AGA), and ileX (reads AUA) pRARE-argO2 pRARE with argO2 replacing argU This study

*CGSC: E. coli Genetic Resources at Yale, the Coli Genetic Stock Center; W. Zhang: Dr. Wei Zhang, Division of Biology; Illinois Institute of Technology; K. Keiler: Kenneth Keiler, Department of Biochemistry and Molecular Biology, Pennsylvania State University.

206

A 12 B 12 C 12 argOa argOb 10 ileZ 10 10

8 8 8 Ct Ct Ct Δ Δ Δ 6 6 6 Mean Mean Mean Mean Mean Mean 4 4 4

2 2 2

0 0 0 Human Environment Human Environment Human Environment Source Source Source

Figure 5.1 207

A B

1000 ** * * * ** * ileZ argOa rrsA 100 Sakai 28.70(3.09) 30.72(1.09) 25.27(1.44)

Miller Units Miller 10 K-12 ND ND 24.13(3.30)

1

Figure 5.2 208

1 2 3 4 5 M

25 kDa 20 kDa Hfq or its derivatives 15 kDa 10 kDa

Figure 5.3 209

M 1 2 3

25 kDa

20 kDa Hfq or 15 kDa its derivatives

10 kDa

Figure 5.4 210

A M 1 2 3 4 5 25 kDa

20 kDa Hfq or its derivatives 15 kDa

10 kDa

B M 1 2 3 4

20 kDa 15 kDa Hfq or 10 kDa its derivatives

Figure. 5.5 211 A C

18.00

B Sakai SakaiΔtDNA 16.00 25.00 14.00

20.00 12.00 10.00

15.00 Ct 8.00

10.00 6.00

4.00 5.00 Fluorescence Intensity Fluorescence 2.00

0.00 0.00 Sakai SakaiΔtDNA Sakai SakaiΔtDNA

Figure 5.6 212 Figure 5.7 A C 25.00

C600::VT2- C600::VT2- 20.00 Sakai SakaiΔtDNA B 1.00 15.00 0.90

0.80 Ct 0.70 10.00 0.60 0.50 0.40 0.30 5.00 0.20 Fluorescence Intensity Fluorescence 0.10 0.00 0.00 213 A 1.2 C 1 4.00 0.8 3.50 600 0.6

OD 3.00 0.4 0.2 2.50

0 2.00 Hour B 0 2 4 6 25.00 1.50

20.00 Intensity Fluorescence 1.00

15.00 0.50 Ct 10.00 0.00

05.00 Sakai(pACYC184) Sakai(pRARE)

00.00 Sakai(pACYC184) Sakai(pRARE)

Figure 5.8 214

40.00 y = 3.558x + 16.44 R² = 0.983 35.00 y = 3.111x + 15.63 R² = 0.972

30.00 ileZ y = 2.930x + 14.25 argOa Ct R² = 0.997 25.00 argO2

20.00

15.00 log10 (dilution fold) 0 1 2 3 4 5 6 7

FIG. S5.1. Quantifying abundance of ileZ, argOa and argOb in 10‐fold serial diluted Sakai cultures using qPCR. Error bars indicating 1 SD from triplicate experiments are included but some are too small to be visualized. 215

FIG. S5.2. A scheme of the cloning/expression region of pET-28a(+). The translation initiating ATG is highlighted with blue box. The tandem rare codons are inserted in its 3’ end (shown in red arrow). The hfq is cloned in between NdeI and EcoR I sites (indicated by green arrows). 216

argO2 argU

Anticodon D loop T loop loop

FIG. S5.3. Alignment of argO2 and argU. The stem-forming nucleotides were colored differently. The nucleotides differ between two genes were indicated with open boxes. The anticodons of the two genes were underscored. 1,266,101 217

1,267,400 FIG. S5.4. The sequence of the synthesized DNA fragment for ileZ2-argN2-argO2 anticodon knockout. The coordinates of the corresponding nucleotides in Sakai genome (GenBank accession number: BA000007) are indicated in arrows. The XbaI sites are labeled in red. ileZ2, argN2 and argO2 are indicated in dark red, green and blue boxes, respectively. The anticodon of each tRNA gene was underscored. Notice that the second nucleotide of each anticodon is missing in this synthesized fragment. 218

M 1 2 3 4 5 6 7 8 9 10 11

25 kDa 20 kDa

15 kDa 10 kDa

hfq 2CGC 4CGC -hfq -hfq 2AGA-hfq 2CGA-hfq 4CGA-hfq

FIG. S5.5. Effects of tandem arginine codons on the expression of corresponding Hfq derivative. Whole cell protein extracts from IPTG-induced BL21(DE3) derivatives carrying the following plasmids were profiled by SDS- PAGE and Coomassie Brilliant Blue staining. Lane 1: pET::hfq; lane2 to 4:pET- 2AGA (independent constructs); lane 5 to 6: pET-2CGA (independent constructs); lane 7 to 9: pET-4CGA (independent constructs); lane 10: pET- 2CGC; lane 11: pET-4CGC. M: size standard. Lane 1, lane 7 and lane 11 were extracted and shown in Fig. ileZ 219

argN

argO

FIG. S5.6. The 7 alleles of ileZ-argN-argO of Sakai are aligned using MEGA 4. The intergenic sequences between ileZ and argN, and between argN and argO are presented. Asterisks indicate the nucleotide that conserve in all 7 alleles 220 Table S5.1 Copy number of ileZ-argN-argO tRNA genes in different E. coli pathogens and commensals

Labora- EHEC EAEC EPEC ExPEC Commensal tory Strain O157 O26 O111 O103 55989 E2348 CFT073 536 APEC MG 1655 HS SE11 ileZ 7 6 8 (1) 5 3 2 1 0 2 0 0 0 argN 7 (3) 6 (2) 7 (2) 5 (1) 2 (1) 2 (2) 1 0 2 (1) 0 0 0 argO 7 6 7 5 3 2 1 0 1 0 0 0

EAEC: Enteroaggregative E. coli, EPEC: Enteropathogenic E. coli, ExPEC: Extracellular pathogenic E. coli, APEC: Avian pathogenic E. coli. Numbers in parenthesis are predicted pseudogenes. The table was reproduced from Comparative genomics reveal the mechanism of the parallel evolution of O157 and non-O157 enterohemorrhagic Escherichia coli, Ogura et al., PNAS, 2009. 221

Table S5.2 Strains used in ileZ, argO copy number assay

Strain name O type Risk Source stx1 by PCR stx2 by PCR Stx by ELISA 0.1623 103 High Environment + 2.1509 157 High Environment ++ 3.2605 103 High Environment + 5.2217 26 High Environment + 6.1068 157 High Environment + 6.1192 157 High Environment + 6.1592 26 High Environment + + 7.1639 111 High Environment + + 8.0176 26 High Environment + 8.0288 111 High Environment + 9.0108 103 High Environment + 9.0538 145 High Environment + 10.0563 26 High Environment + 10.0815 111 High Environment + + 10.0941 103 High Environment + 81.0193 26 High Environment + 81.0211 26 High Environment + 82.0219 26 High Environment + 85.1150 26 High Environment + 85.1983 103 High Environment + 86.0765 103 High Environment + 87.1368 103 High Environment + 87.1377 111 High Environment + + 87.1917 111 High Environment + 90.0040 157 High Environment + 90.0107 103 High Environment ++ 90.1764 103 High Environment + 92.0048 157 High Environment + 93.0134 157 High Environment + 95.0187 145 High Environment + 98.1208 111 High Environment + 99.0238 157 High Environment + 99.1244 157 High Environment + 88.1041 157 High Human + 93.0494 26 High Human + 93.0521 111 High Human + 93.1685 103 High Human + + 99.1761 26 High Human + 0.0533 128 Low Environment + 0.0846 5 Low Environment + 0.1077 5 Low Environment + 0.2536 91 Low Environment + 0.2694 128 Low Environment + 0.3146 174 Low Environment + 1.2265 76 Low Environment + 1.2805 2 Low Environment + + 1.2914 4 Low Environment + 2.0179 98 Low Environment + 2.0665 5 Low Environment ++ 222

Table S5.2 Strains used in ileZ, argO copy number assay (Cont'd)

Strain name O type Risk Source stx1 by PCR stx2 by PCR Stx by ELISA 3.1185 117 Low Environment + 3.3439 174 Low Environment + 3.3544 7 Low Environment + + 3.3885 136 Low Environment + 3.4383 116 Low Environment ++ 4.0965 153 Low Environment + 6.1112 4 Low Environment + 6.1594 38 Low Environment + 6.1595 128 Low Environment + + 6.1596 154 Low Environment + 6.2569 141 Low Environment ++ 7.2660 88 Low Environment + 8.0131 33 Low Environment + 8.2969 136 Low Environment + 9.0014 8 Low Environment + 9.0015 73 Low Environment + + 9.0106 55 Low Environment + 9.0107 76 Low Environment + + 9.0109 113 Low Environment + + 9.0110 117 Low Environment + 10.0553 118 Low Environment + 10.0727 174 Low Environment + 10.0735 41 Low Environment + 10.0938 76 Low Environment + 10.0939 8 Low Environment + 10.0940 8 Low Environment + + 10.1083 4 Low Environment + 10.1367 76 Low Environment + 10.1610 88 Low Environment + 10.1614 79 Low Environment ++ 10.1617 88 Low Environment + 10.1618 8 Low Environment + + 10.2206 85 Low Environment + + 10.2208 158 Low Environment + 90.0001 68 Low Environment + 90.0011 64 Low Environment + 92.0911 138 Low Environment ++ 95.0022 50 Low Environment + 95.0071 51 Low Environment + 95.0114 17 Low Environment + 95.0604 86 Low Environment + 96.0502 88 Low Environment ++ 96.0850 146 Low Environment + 96.0856 85 Low Environment + 96.0865 76 Low Environment + 96.0876 75 Low Environment + 96.0885 76 Low Environment + 96.0903 113 Low Environment + 96.1142 84 Low Environment + + 223

Table S5.2 Strains used in ileZ, argO copy number assay (Cont'd)

Strain name O type Risk Source stx1 by PCR stx2 by PCR Stx by ELISA 96.1191 10 Low Environment + 96.1892 1 Low Environment + 96.1898 50 Low Environment + 97.0166 69 Low Environment + 97.1174 65 Low Environment + 97.1571 146 Low Environment + 98.0106 149 Low Environment + 98.0556 118 Low Environment + 90.0008 32 Low Human + 90.0009 5 Low Human + 91.1576 134 Low Human + 93.0602 85 Low Human + 95.3644 88 Low Human + 95.4080 6 Low Human + 96.0611 84 Low Human + 96.0616 139 Low Human + 96.1488 21 Low Human + 96.1523 120 Low Human + 96.1534 5 Low Human + 224

Table S5.3 Primers used in this study

Primer names Sequences * SK‐lac‐LL AAAAAATCTAGACACCCTGGTTAGTTCAACAT SK‐lac‐LR GACCAGGATGTCCAGGCGTCACCATTGGGGATAATTCTGT SK‐lac‐RL GACGCCTGGACATCCTGGTCATCCAGCGGATAGTTAATGA SK‐lac‐RR ATATATTCTAGAGGCTATGCAGGTTTACTGAA lac‐seq‐L GATGCCTTCGGTGATTAAA lac‐seq‐R TAATTCCTTACTGGGGAACC PtDNA1‐L AAAAAAGAATTCGTTACGCCTGCATATGAGTGA PtDNA1‐R AAAAAAGGATCCGCTAAAGGGCTGGGTCAAA PtDNA2‐L AAAAAAGAATTCGTAACAGCATTTTGCTCTAC PtDNA2t ‐R AAAAAAGGATCCGCTAAAGGGCCGGGCGCAGGAGG CCGC GGGCCGGGCGC GG PtDNA3‐L AAAAAAGAATTCCAGCAGATAATCAGCGCAAG PtDNA3‐R AAAAAAGGATCCCTAAAGGGCCGATTGCTGAA PtDNA4‐L AAAAAAGAATTCATTGGCTAAAGGTGGCAGAA PtDNA4‐R AAAAAAGGATCCCTAAAGGGCCGGGAGCAGAA PtDNA5‐L AAAAAAGAATTCCCGGTATGGATATGGACAGG PtDNA5‐R AAAAAAGGATCCCTAAAGGGCCGAGCCAAAAA PtDNA6‐L AAAAAAGAATTCTTTGCCGATTTTGTACGTGA PtDNA6‐R AAAAAAGGATCCCTAAAGGGCCGGGCGCAG pRS‐seq‐L ATTTGAACGTTGCGAAGCA pRS‐seq‐R GTTTTCCCAGTCACGACGTT pET‐hfq‐2ATA /5Phos/TATTATCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGA pET‐hfq‐2ATT /5Phos/AATAATCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGA pET‐hfq‐4CGA /5Phos/TCGTCGTCGTCGCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATT ppETET‐ hfqhfq‐ 4CGC //5Phos/GCGGCGGCGGCGCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATT5Phos/GCGGCGGCGGCGCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATT pET‐hfq‐2AGA /5Phos/TCTTCTCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGA pET‐hfq‐3AGA /5Phos/TCTTCTTCTCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCT pET‐hfq‐R /5Phos/GGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGG pET28‐seq‐L TAATACGACTCACTATAGGG pET28‐seq‐R GGCTTTGTTAGCAGCCGGAT tDNA2‐seq‐L GTAGCGTCAAAGCAGCAATG ttDNA2DNA2‐ seq‐ RRAAAACTTTGTTGGGTCGAAAAGTCCTTTGTTGGGTCGAAAAGTC tDNA2‐clon‐L AAAAAAAAGCTTGGCGCTAGGGCGTCGTGCAAT tDNA2‐clon‐R AAAAAAGGATCCGGTGTTCCTTTTGGCTGAAG pACYC‐seq‐L CTTCAAATGTAGCACCTGAAGTC pACYC‐seq‐R ATGCCGGCCACGATGCGT argO‐rare‐L /5Phos/CAATCGGTCACTGGTTCGAATCCAGTACAACGCGCCATTACAATTCAATCAGTTACGCC argO‐rare‐R /5Phos/CTCAGAAGGCAATTGCTCTGTCCGGCTGAGCTAACAACGCGTTGATACCGCAATGCGGTG pRARE‐seq‐L CAAAAGCCATTGACTCAGCA pRARE‐seq‐R GCGTAGAGGATCCGTCACAT tDNA2‐LL AAAAAATCTAGAACGGTCAGAAAATACACTGG tDNA2‐LR CCGTTCCAAGCGGCCGCAAGAGCGGGTACGTAACTAATCCTGCAA tDNA2‐RL CGCTCTTGCGGCCGCTTGGAACGGATTTACCAGGCTCGCTTT 225

Table S5.3 Primers used in this study (Cont'd)

Primer names Sequences tDNA2-RR TTTTTTTCTAGACGCTGCAGCTGTATTACTTT tDNA2-out-L ATCAGACCGAGGTAGCCAGA tDNA2-out-R TGCAAATAAAACCGCCATAA uidA-F GAGAGGTTAAAGCCGACAGC uidA-R CATCGCAGCGTAATGCTCTA wrbA2-lp CGAATCGCTACGGAATAGAGA wrbA2-LJ CCGACCTTTGTACGGATGTAA wrbA1-up AGGAAGGTACGCATTTGACC wrbA1-RJ ATCGTTCGCAAGAATCACAA ileZ-L RGCCCTTTAGCTCAGTGGTG ileZ-R TGGTGGCCCTTGCTGGATTT argOa-L GCGTTGTTAGCTCAGCCGGA argOa-R TGGCYGCGTTGTACSTGGATKTC argOb-L TGGYGCGTTGTASTGGRKTC argOb-R GCGTTkTTAGCTCAGCMGGA rrsA-L CGGTGGAGCATGTGGTTTAA rrsA-R GAAAACTTCCGTGGATGTCAAGA stx1com-F (C/T)AGTTGAGGGGGGTAAAATG stx1com-R CG(A/G)AAAATAAC(C/T)TCGCTGAATC LP43 ATCCTATTCCCGGGAGTTTACG LP44 GCGTCATCGTATACACAGGAGC

* /5Phos/ stands for phosphate decoration at the 5' end 226

Chapter Six

RESTRICTIVE STREPTOMYCIN-RESISTANT MUTATIONS DECREASE THE SECRETION OF

ESPA AND ESPB IN ESCHERICHIA COLI O157:H7 STRAINS

Chun Chen and Edward G. Dudley*

Department of Food Science, the Pennsylvania State University, University Park, Pennsylvania 16802

* Corresponding author. Mailing address: 326 Food Science Building, The Pennsylvania State University, University Park, PA 16802, US. Phone: (814)867‐0439; Email: [email protected]

227

6.1 Abstract

Streptomycin wa s the f irst di scovered a ntibiotic dr ug o f t he a minoglycosides

class. It binds to the r ibosome o f bacteria a nd can i nhibit tr anslation by promoting

misreading of mR NA. C ertain mu tations o n the ribosomal p rotein S1 2 in crease the accuracy o f t he d ecoding p rocess and therefore c onfer onto the ba cteria the streptomycin resistance phenotype. However, these mutations concomitantly decrease the r ate o f tr anslation in many cases. Streptomycin i s commonly us ed dur ing investigations o f the c olonization and pa thogenesis o f enterohemorrhagic Escherichia

coli O157:H7 in an imal mo dels t o repress t he c olonization re sistance f rom intestinal

microflora. The c attle g astrointestinal t ract is the majo r b iological re servoir of E. coli

O157:H7, and genes within a region called the locus of enterocyte effacement (LEE) are necessary f or an imal c olonization. LEE-encoded g enes a re also r esponsible fo r the

characteristic attaching and effacement (A/E) lesion observed upon attachment to the

human i ntestinal e pithelia. E spA a nd E spB a re two LEE-encoded e ffectors that play

important ro les in t he formation o f A/ E le sion. In the c urrent s tudy, we o bserved a

striking d ecrease in t he s ecretion le vels o f EspA a nd E spB with E. coli O157:H7 Strr

restrictive mutants, which carry K42T or K42I mutations in the S12 protein. However,

strains c arrying m utation pr eviously de fined as mildly r estrictive ( K87R) an d n on-

restrictive (K42R) showed slight and indistinguishable change in EspA and EspB secretion,

respectively. T herefore, w e propose tha t r estrictive S trr mutations alter t he EspA a nd

EspB secretion of the bacteria and results in a compromised colonizing and pathogenic 228

abilities. W e s uggest c haracterizing t he g enetic c ause of thi s S trr phenotype be fore

applying the mutant to further assays.

6.2 Introduction

Streptomycin (Str), derived from the actinobacterium Streptomyces griseus, was the first discovered antibiotic drug of the aminoglycosides class (44). Since its first isolation in 1942, Str has been widely used in the treatment of tuberculosis (8). A few

different mechanisms have been proposed to explain the bactericidal effect of Str, and

most of them involve the binding between the antibiotic and the ribosome, which leads

to the inhibition of protein synthesis.

Misreading of mRNA is a well-documented mechanism of Str-mediated inhibition

of translation. Davies et al. (10) reported a high rate of miscoding using cell-free extract

from Str-sensitive (Strs) Escherichia coli strains, while miscoding was less frequent or

negligible with extracts prepared from Str-resistant (Strr) strains. Using synthetic

polynucleotide templates containing two nucleotides in alternating sequence, Davies et

al. (11) further concluded that Str promotes the misreading of the first two nucleotides from the 5’ end of the codon, of only one base at a time, and of pyrimidines more frequently than purines. Moreover, they suggested that reading frame shifts is not always invoked in the Str-induced misreading phenomena. Kinetic explanations for these observations have been later proposed. It has been shown that streptomycin lowers the forward rates of GTPase activation, which therefore increases the 229

accommodation for the near-cognate tRNA at the A site, leading to an increased error rate (23, 41).

Strr bacteria were discovered as soon as this antibiotic was used clinically (35, 39).

It was subsequently established that in E. coli, these mutations are mostly associated

with different structural alterations of the 30S ribosomal subunit protein S12 (5, 26).

The rpsL-encoded S12 is involved in the inspection of codon-anticodon parings in the A

site of the ribosome, as well as in the subsequent domain rearrangements of the 30S

subunit, which is essential for the accommodation of the new aminoacyl-tRNA (3). Some

mutations within rpsL increase the accuracy of the decoding process and confer

bacterial resistance against Str. However other mutants have been described as having

the same or slightly higher translational error rates than wild-type cells (5, 47). Based on

these phenotypes, Bohman et al. divided E. coli Strr mutants into two classes: restrictive

and non-restrictive (5).

Error rates of translation in vivo have been estimated to be on the order of 10−3 –

10−4 (30), while this rate is 20% to 70% lower in restrictive mutants (5). This is because the restrictive mutations disrupt the contacts between S12 and 16S rRNA, both comprised by 30S subunit of ribosome, and therefore destabilize the tRNA-A site binding

and also increase the energy barrier to the formation of such binding. This results in the

increase in accuracy (40). Nevertheless, in most cases such mutations with restrictive

decoding accuracy concomitantly decrease the rate of translation (3, 5, 40, 47). Indeed,

Bohman et al. (5) regarded the decreased translational speed as the price paid for

increased accuracy. They reported that elongation rates of β-galactosidase range from 230

7.8 to 12 amino acids per second in restrictive mutants at the absence of Str, compared

to 14 in the wild-type strain (5). Using a cell-free protein synthesis system,

Chumpolkulwong et al. (7) reported that restrictive mutations on S12 (K42N or K42I)

decreased translational efficiency of an mRNA template, while such decrease was not

observed with another Strr mutant carrying K87R on S12, which is defined as “mildly restrictive” (21). Surprisingly, they also saw increased translational efficiency with another restrictive S12 mutation K42T, though this observation was contradicted by another publication from the same group (27). It is noteworthy that no significant

restrictive mutation-associated alteration in the growth profile compared to wild-type

strains was observed in these two studies (7, 27), although difference in growth rate

was reported in some other papers (16, 43).

The Strr mutations that do not exhibit a hyper-accurate translation phenotype

are referred to as non-restrictive (5). K42R on S12 is one of such mutations in E. coli (50).

Bohman et al. (5) reported that Strr mutants of this group are phenotypically indistinguishable from the wild-type in their pattern of suppression and the rate of peptide elongation, yet their translation error rates were slightly higher than the wild-

type strain.

A very important application of Str is in the animal study of enterohemorrhagic E.

coli (EHEC), of which O157:H7 is the most important serotype. Since its first report in

1983, E. coli O157:H7 has emerged as one of the most important foodborne pathogens for its low infectious dose (45) and the potential to cause severe diseases including

hemorrhagic colitis (HC) and hemolytic uremic syndrome (HUS) (22, 42). The genetic 231

elements that are necessary for the development of HC and HUS include the locus of

enterocyte effacement (LEE) and Shiga toxins (6). Interestingly, these virulence factors

are commonly located on mobile genetic elements including prophage, integrative

elements and plasmids that were acquired by E. coli O157:H7 through horizontal gene

transfer (2, 6, 17, 54).

LEE is found in E. coli O157:H7, enteropathogenic E. coli (EPEC) (32, 33, 38) and a

mouse pathogen Citrobacter rodentium (13). In E. coli O157:H7 LEE is integrated at the

tRNA gene selC (25). LEE facilitates the intimate adherence between bacteria and

epithelial cells and the effacement of microvilli, which is referred to as the attaching and

effacing (A/E) lesion (14). The protein products of LEE include an outer membrane

protein (intimin), a type three secretion system (T3SS) and secreted effector proteins

(18). In the process of LEE-mediated A/E, T3SS forms a molecular syringe that translocates secreted proteins through the bacterial cytoplasm across the epithelial cell membrane. Translocated intimin receptor (TIR) is one of these secreted proteins. It incorporates into the epithelial cell membrane and its domain exposed on the cell surface acts as the receptor of intimin, leading to the intimate attachment of bacteria (9,

12).

LEE-dependent mucosal adherence is essential for E. coli O157:H7 colonization of cattle, sheep and other species, and intimin plays an important role in this process as well (15, 34). In addition, proteins called Esp (E. coli-secreted protein) are encoded by

LEE and also play major roles in the development of the A/E lesion. For example, espA 232

encodes a filament that assembles into the T3SS syringe, forming the physical conduit between the bacterium and the eukaryotic cell surface (29). At the distal end of this conduit, EspB and EspD make 3 to 5 nm pores in the host epithelial cell membrane, which makes the protein translocation into cells and the formation of the A/E lesion possible (20, 55). Recent studies have identified T3SS effector proteins that are outside

of the LEE (non-LEE-encoded effector, Nle’s) (48). It was noticeable that the majority of

Nle’s are encoded within mobile genetic regions such as prophage (48).

Wadolkowski et al. (52) developed the first Str-treated mouse model for E. coli

O157:H7 colonization studies. Because E. coli O157:H7, similar to other human E. coli

isolates, does not effectively compete with the native microflora within the animal

intestine. To promote colonization of the pathogen, streptomycin-supplemented diets

are used to reduce the levels of competing microorganisms, and spontaneously derived

Strr mutants are generated (37). The combination of spontaneously derived Strr EHEC mutant and Str-treated animal have been employed in many different studies (19, 31,

36, 46, 51). A lack of characterization of the spontaneously derived Strr mutants in these

studies implies that the authors assumed the mutation(s) to be neutral, yet this is rarely

if ever been experimentally confirmed.

In the current study, we isolated 7 unique spontaneous Strr E. coli O157:H7 mutants and divided them into three groups based on the sequences of their S12-

encoding rpsL: restrictive, mildly restrictive and non-restrictive. We observed a striking

decrease in EspA and EspB secretion levels with the restrictive mutants. However, the

secretion levels in EspA and EspB of the mildly restrictive and non-restrictive mutants 233

were slightly decreased and indistinguishable, respectively, from parental strains.

Therefore, we propose that the restrictive Strr mutation decrease the secretion of EspA and EspB of the bacteria and results in a compromised colonizing and pathogenic abilities. We suggest characterizing the rpsL mutations that led to Strr before applying the mutant to further assays.

6.3 Materials and methods

Bacterial strains and culture media. The bacterial strains and plasmids used in this study are described in Table 6.1. Strains were routinely grown in liquid or solid

Lysogeny Broth medium (LB) (4). All stocks were maintained at -80 °C in 10% glycerol.

Strr mutants of E. coli O157:H7 strains were screen by plating overnight culture of the wild-type strains on LB agar supplemented with Str (100 µg/ml). Putative Strr colonies

were streaked on the same media for purification.

Analysis of secreted proteins. Quantification of secreted EspA and EspB was

performed using a method adapted from those previously described (28, 49). Bacteria

were grown statically overnight at 37 °C in DMEM (with 4.5 g/L glucose and L-glutamine,

without sodium pyruvate, Cellgro, Manassas, VA) from frozen stocks. A total of 2 ml of

the cultures were diluted into 28 ml of fresh DMEM and incubated statically at 37 °C

until an OD600 of 0.8. The bacteria were removed by centrifugation (4,000 × g, 30

minutes) and filtration through 0.2 µm acetate cellulose filters (VWR, Philadelphia, PA).

BSA (NEB, Ipswich, MA) was added into the culture supernatant to a final concentration 234

of 2 µg/ml as a co-precipitant, and trichloroacetic acid was added to 10% (v/v) for the

protein precipitation. This mix was incubated overnight at 4 °C, followed by 30 minutes

centrifugation at 4,000 × g. Protein pellets were carefully dried with a Kimwipe

(Kimberly-Clark, Neenah, WI), and then dissolved in 120 µl of 1 M Tris-Cl (pH 8.0).

EspA and EspB quantification was performed by Western blot analysis. A mixture of 8 μl of the resuspended sample and 2 μl 5 × Laemmli buffer (60 mM Tris-Cl pH 6.8, 2%

SDS, 10% glycerol, 5% β-mercaptoethanol and 0.01% bromophenol blue) was loaded

onto a 4 – 20% precast linear gradient polyacrylamide gel (Bio-Rad, Hercules, CA).

Electrophoresis was conducted in a Mini-PROTEAN® system (Bio-Rad, Hercules, CA) at

180 V for 45 minutes. The same system (40 V, 16 hours, 4 °C) was also used to transfer

protein from the polyacrylamide gel to a 0.45 μm PVDF membrane (Millipore, Billerica,

MA). Rabbit anti-EspB and anti-EspA (kindly provided by Dr. James Kaper) primary, and

IRDye 680RD goat anti-rabbit IgG (LI-COR, Lincoln, NE) secondary were used. The

Odyssey Infrared Imaging System (LI-COR, Lincoln, NE) was used for fluorescence

detection. A Coomassie Brilliant Blue staining protocol was additionally followed to

visualize the BSA loading control. Briefly, after an SDS-PAGE was performed as described

above, the gel was incubated for 1 hour in the staining solution (0.025%

Coomassie Brilliant Blue R250, 40% methanol, 7% glacial acetic acid), 1 hour in the destaining solution I (40% methanol, 7% glacial acetic acid) and 1 hour in the destaining

solution II (5% methanol, 7% glacial acetic acid). The gel was then visualized and photographed using a transilluminator (UVP, Upland, CA). All experiments were conducted in two biological repeats. 235

Sequencing for rpsL. In order screen for mutations within rpsL, rpsL of each E.

coli O157:H7 isolate and its mutant was amplified and sequenced using primer pair rpsL-

L (5’-ACGTGGCATGGAAATACTCC -3’) and rpsL-R (5’- AATTCGGCGTCCTCATATTG- 3’). The

annealing temperature and elongation time were set to 55 °C and 1 minute, respectively.

Overnight bacterial culture (1/40, v/v) was used as template for each reaction.

6.4 Results

EDL933 Strr mutants vary in rpsL sequence and EspA/EspB secretion. After antibiotic selection, we collected 3 spontaneous Strr mutants from E. coli O157:H7 strain

EDL933 (Table 6.1). By sequencing the rpsL gene, we identified one different nucleotide alteration in each of these mutants, which all caused change of amino acid at site 42

(Table 6.2). Eight hour incubation was allowed before the total secreted protein was collected from DMEM media, by when all cultures reached an OD600 of 0.8 ± 0.04 (data not shown). Using Western blot assay, we identified a variation in EspA/EspB secretion

from EDL933 and its mutants: remarkable reduction in Esp secretion was seen with

EDL933-strR2 (K42T on S12) and EDL933-strR3 (K42N), which carry restrictive mutations; while the Esp secretion level of non-restrictive mutant EDL933-strR1 (K42R) was

indistinguishable from the wild-type EDL933 (Fig. 6.1).

Strr mutants from other E. coli O157:H7 strains. One spontaneous Strr mutant

from each of Sakai, PA4, PA5 and PA11 (Table 6.1) were collected after antibiotic

selection. rpsL sequencing revealed that all but PA11 carry the same mutation on S12 236

(K42T) as EDL-StrR2. As therefore expected, remarkable reduction in secreted Esps was observed when comparing the Sakai-strR, PA4-strR and PA5-strR to their corresponding

parental strains (Fig. 6.1). Interestingly, the difference in Esp secretion levels were

smaller between PA11 and PA11-strR (Fig. 6.1), which contains a K87R mildly restrictive

mutation (Table 6.2). It was also noticed that great diversity in the protein secretion levels present among the tested wild-type strains. Particularly, the EspA secretion from

wild-type PA4 and PA5 were below the detection limit (Fig. 6.1).

6.5 Discussion

The first murine colonization protocol described for E. coli O157:H7 was the Str-

treated mouse model developed by Wadolkowski et al. (52). The E. coli O157:H7 mouse

model uses Str-treated drinking water as a means of reducing the animals’ normal

intestinal facultative flora, which promotes the colonization of the infecting E. coli

O157:H7 strain. This methodology was based on the work of Myhal et al. as described in

1982 (37). Myhal et al. compared the colonization abilities of E. coli strains, which were individually resistant to streptomycin, rifampicin, nalidixic acid, tetracycline, ampillicin, chloramphenicol and novobiocin, in the mice treated with the corresponding antibiotic.

They found that Str treatment not only leaves the obligate anaerobe population undisturbed, and also does not alter the distribution pattern of E. coli in the intestine of the treated mouse. More importantly, they concluded that Str resistance stems from a change in ribosomes and that it is “unlikely that such alteration would affect the surface 237

properties of the strains and, therefore, presumably would not alter their colonizing

abilities”, while defects were observed with other antibiotic resistant E. coli derivatives

(37).

Wadolkowski et al. followed a very similar methodology for their E. coli O157:H7

infection studies in Str-treated mice (52). Since then, the combination of spontaneously

derived Strr EHEC mutant and Str-treated animal have been employed in many different

studies (19, 31, 36, 46, 51), yet none of these reported the rpsL mutations that led to

Strr in their strains. In this study, we investigated the effects of the Str resistance

mutations on the secretion levels of EspA and EspB, two proteins that are essential to

the colonization and pathogenesis of EHEC and EPEC (1, 20, 29, 55). Upon collecting 7

spontaneous Strr mutants from 5 E. coli O157:H7 strains, we obtained 4 different types

of mutations in rspL. All mutations were located at amino acid residue 42 or 87 of S12, which were reported as hot spots for Strr mutation (7). Based on the amino acid

alterations and their reported effects on decoding accuracy, these 4 mutations could be divided into three groups: restrictive (K42T, K42N), mildly restrictive (K87R) and non-

restrictive (K42R) (Table 6.2) (3, 21, 50).

Previous studies identified that the restrictive decoding accuracy concomitantly

decrease the rate of translation (3, 5, 40, 47), while the translational efficiency of non-

restrictive mutants was indistinguishable from the wild-type strain (5). We observed

striking correspondence between the predicted translational efficiency and the secretion levels of EspA and EspB (Fig. 6.1): a remarkable reduction in secretion levels

was observed in restrictive mutants (Sakai-strR, PA4-strR, PA5-strR, EDL933-strR2 and 238

EDL933-strR3), a slight reduction in mildly restrictive mutant (PA11-strR) and no different in non-restrictive mutant (EDL-strR1). Meanwhile, we did not observe a growth rate reduction for restrictive mutations, which was seen in some earlier studies

(16, 43), but not in more recent ones (3, 7, 27).

Without further experiments, we cannot conclude whether the restrictive Strr

mutation influences the translation of LEE regulator, the translation of T3SS structural

genes (therefore affect secretion), and/or the translation of EspA and EspB directly. Yet

our observation clearly indicated that the Strr mutation is not always neutral with regard

to phenotype associated with O157:H7 virulence. The restrictive mutations can result in

decreased secretion levels of EspA and EspB, and potentially affect the progress of the

colonization and pathogenesis of E. coli O157:H7. Therefore we suggest further characterization of the Strr mutation upon collecting the spontaneous mutants before

applying them to the animal studies.

6.6 Acknowledgements

This work was funded by USDA‐NIFA grant 2009‐03611, by start‐up funds

through the Penn State University Department of Food Science and College of

Agricultural Sciences, and by the Casida Development Professorship to E.G.D. We would

like to thank the help of the Penn State Genomics Core Facility (University Park, PA) for

generating DNA Sequence information. We would also like to thank Dr. James Kaper

(University of Maryland, School of Medicine) for providing the antibodies and Dr. Wei 239

Zhang (Illinois Institute of Technology, Department of Biological and Chemical Sciences) for providing the bacterial strain.

240

6.7 Reference

1. Abe, A., U. Heczko, R. G. Hegele, and B. Brett Finlay. 1998. Two enteropathogenic Escherichia coli type III secreted proteins, EspA and EspB, are virulence factors. J. Exp. Med. 188:1907-1916. 2. Abe, H., A. Miyahara, T. Oshima, K. Tashiro, Y. Ogura, S. Kuhara, N. Ogasawara, T. Hayashi, and T. Tobe. 2008. Global regulation by horizontally transferred regulators establishes the pathogenicity of Escherichia coli. DNA Res. 15:25-38. 3. Agarwal, D., S. T. Gregory, and M. O'Connor. 2011. Error-prone and error-restrictive mutations affecting ribosomal protein S12. J. Mol. Biol. 410:1-9. 4. Bertani, G. 1951. Studies on lysogenesis. I. The mode of phage liberation by lysogenic Escherichia coli. J. Bacteriol. 62:293-300. 5. Bohman, K., T. Ruusala, P. C. Jelenc, and C. G. Kurland. 1984. Kinetic impairment of restrictive streptomycin-resistant ribosomes. Mol. Gen. Genet. 198:90-99. 6. Caprioli, A., S. Morabito, H. Brugere, and E. Oswald. 2005. Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Vet. Res. 36:289-311. 7. Chumpolkulwong, N., C. Hori-Takemoto, T. Hosaka, T. Inaoka, T. Kigawa, M. Shirouzu, K. Ochi, and S. Yokoyama. 2004. Effects of Escherichia coli ribosomal protein S12 mutations on cell-free protein synthesis. Eur. J. Biochem. 271:1127-1134. 8. Comroe, J. H., Jr. 1978. Pay dirt: the story of streptomycin. Part I. From Waksman to Waksman. Am. Rev. Respir. Dis. 117:773-781. 9. Creuzburg, K., B. Middendorf, A. Mellmann, T. Martaler, C. Holz, A. Fruth, H. Karch, and H. Schmidt. 2011. Evolutionary analysis and distribution of type III effector genes in pathogenic Escherichia coli from human, animal and food sources. Environ. Microbiol. 13:439-452. 10. Davies, J., W. Gilbert, and L. Gorini. 1964. Streptomycin, suppression, and the code. Proc. Natl. Acad. Sci. U. S. A. 51:883-890. 11. Davies, J., D. Jones, and H. Khorana. 1966. A further study of misreading of codons induced by streptomycin and neomycin using ribopolynucleotides containing two nucleotides in alternating sequence as templates. J. Mol. Biol. 18:48-57. 12. Delahay, R. M., G. Frankel, and S. Knutton. 2001. Intimate interactions of enteropathogenic Escherichia coli at the host cell surface. Curr. Opin. Infect. Dis. 14:559- 565. 13. Deng, W., Y. Li, B. A. Vallance, and B. B. Finlay. 2001. Locus of enterocyte effacement from Citrobacter rodentium: sequence analysis and evidence for horizontal transfer among attaching and effacing pathogens. Infect. Immun. 69:6323-6335. 14. Donnenberg, M. S., J. B. Kaper, and B. B. Finlay. 1997. Interactions between enteropathogenic Escherichia coli and host epithelial cells. Trends Microbiol. 5:109-114. 15. Donnenberg, M. S., S. Tzipori, M. L. McKee, A. D. O'Brien, J. Alroy, and J. B. Kaper. 1993. The role of the eae gene of enterohemorrhagic Escherichia coli in intimate attachment in vitro and in a porcine model. J. Clin. Invest. 92:1418-1424. 16. Ehrenberg, M., and C. G. Kurland. 1984. Costs of accuracy determined by a maximal growth rate constraint. Quart. Rev. Biophys. 17:45-82. 17. Eppinger, M., M. K. Mammel, J. E. Leclerc, J. Ravel, and T. A. Cebula. 2011. Genomic anatomy of Escherichia coli O157:H7 outbreaks. Proc. Natl. Acad. Sci. U. S. A. 108:20142- 20147. 241

18. Frankel, G., A. D. Phillips, I. Rosenshine, G. Dougan, J. B. Kaper, and S. Knutton. 1998. Enteropathogenic and enterohaemorrhagic Escherichia coli: more subversive elements. Mol. Microbiol. 30:911-921. 19. Fujii, J., T. Kita, S. Yoshida, T. Takeda, H. Kobayashi, N. Tanaka, K. Ohsato, and Y. Mizuguchi. 1994. Direct evidence of neuron impairment by oral infection with verotoxin-producing Escherichia coli O157:H- in mitomycin-treated mice. Infect. Immun. 62:3447-3453. 20. Gauthier, A., J. L. Puente, and B. B. Finlay. 2003. Secretin of the enteropathogenic Escherichia coli type III secretion system requires components of the type III apparatus for assembly and localization. Infect. Immun. 71:3310-3319. 21. Gregory, S. T., J. H. D. Cate, and A. E. Dahlberg. 2001. Streptomycin-resistant and streptomycin-dependent mutants of the extreme thermophile Thermus thermophilus1. J. Mol. Biol. 309:333-338. 22. Griffin, P. M., and R. V. Tauxe. 1991. The epidemiology of infections caused by Escherichia coli O157:H7, other enterohemorrhagic E. coli, and the associated hemolytic uremic syndrome. Epidemiol. Rev. 13:60-98. 23. Gromadski, K. B., and M. V. Rodnina. 2004. Kinetic determinants of high-fidelity tRNA discrimination on the ribosome. Mol. Cell 13:191-200. 24. Hartzell, A., C. Chen, C. Lewis, K. Liu, S. Reynolds, and E. G. Dudley. 2011. Escherichia coli O157:H7 of genotype lineage-specific polymorphism assay 211111 and clade 8 are common clinical isolates within Pennsylvania. Foodborne Pathog. Dis. 8:763-768. 25. Hayashi, T., K. Makino, M. Ohnishi, K. Kurokawa, K. Ishii, K. Yokoyama, C. G. Han, E. Ohtsubo, K. Nakayama, T. Murata, M. Tanaka, T. Tobe, T. Iida, H. Takami, T. Honda, C. Sasakawa, N. Ogasawara, T. Yasunaga, S. Kuhara, T. Shiba, M. Hattori, and H. Shinagawa. 2001. Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12. DNA Res. 8:11-22. 26. Holberger, L. E., and C. S. Hayes. 2009. Ribosomal protein S12 and aminoglycoside antibiotics modulate A-site mRNA cleavage and transfer-messenger RNA activity in Escherichia coli. J. Biol. Chem. 284:32188-32200. 27. Hosaka, T., N. Tamehiro, N. Chumpolkulwong, C. Hori-Takemoto, M. Shirouzu, S. Yokoyama, and K. Ochi. 2004. The novel mutation K87E in ribosomal protein S12 enhances protein synthesis activity during the late growth phase in Escherichia coli. Mol. Genet. Genomics. 271:317-324. 28. Iyoda, S., and H. Watanabe. 2004. Positive effects of multiple pch genes on expression of the locus of enterocyte effacement genes and adherence of enterohaemorrhagic Escherichia coli O157:H7 to HEp-2 cells. Microbiology 150:2357-2371. 29. Knutton, S., I. Rosenshine, M. J. Pallen, I. Nisan, B. C. Neves, C. Bain, C. Wolff, G. Dougan, and G. Frankel. 1998. A novel EspA-associated surface organelle of enteropathogenic Escherichia coli involved in protein translocation into epithelial cells. EMBO J. 17:2166-2176. 30. Kramer, E. B., and P. J. Farabaugh. 2007. The frequency of translational misreading errors in E. coli is largely determined by tRNA competition. Rna 13:87-96. 31. Lindgren, S. W., A. R. Melton, and A. D. O'Brien. 1993. Virulence of enterohemorrhagic Escherichia coli O91:H21 clinical isolates in an orally infected mouse model. Infect. Immun. 61:3832-3842. 32. McDaniel, T. K., K. G. Jarvis, M. S. Donnenberg, and J. B. Kaper. 1995. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc. Natl. Acad. Sci. U. S. A. 92:1664-1668. 242

33. McDaniel, T. K., and J. B. Kaper. 1997. A cloned pathogenicity island from enteropathogenic Escherichia coli confers the attaching and effacing phenotype on E. coli K-12. Mol. Microbiol. 23:399-407. 34. McKee, M. L., A. R. Melton-Celsa, R. A. Moxley, D. H. Francis, and A. D. O'Brien. 1995. Enterohemorrhagic Escherichia coli O157:H7 requires intimin to colonize the gnotobiotic pig intestine and to adhere to HEp-2 cells. Infect. Immun. 63:3739-3744. 35. Miller, C. P., and M. Bohnhoff. 1947. Two streptomycin-resistant variants of meningococcus. J. Bacteriol. 54:467-481. 36. Miranda, R. L., T. Conway, M. P. Leatham, D. E. Chang, W. E. Norris, J. H. Allen, S. J. Stevenson, D. C. Laux, and P. S. Cohen. 2004. Glycolytic and gluconeogenic growth of Escherichia coli O157:H7 (EDL933) and E. coli K-12 (MG1655) in the mouse intestine. Infect. Immun. 72:1666-1676. 37. Myhal, M. L., D. C. Laux, and P. S. Cohen. 1982. Relative colonizing abilities of human fecal and K-12 strains of Escherichia coli in the large intestines of streptomycin-treated mice. Eur. J. Clin. Microbiol. 1:186-192. 38. Nataro, J. P., and J. B. Kaper. 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11:142-201. 39. Newcombe, H. B., and R. Hawirko. 1949. Spontaneous mutation to streptomycin resistance and dependence in Escherichia coli. J. Bacteriol. 57:565-572. 40. Ogle, J. M., and V. Ramakrishnan. 2005. Structural insights into translational fidelity. Annu. Rev. Biochem. 74:129-177. 41. Rodnina, M. V., T. Daviter, K. Gromadski, and W. Wintermeyer. 2002. Structural dynamics of ribosomal RNA during decoding on the ribosome. Biochimie 84:745-754. 42. Ruggenenti, P., M. Noris, and G. Remuzzi. 2001. Thrombotic microangiopathy, hemolytic uremic syndrome, and thrombotic thrombocytopenic purpura. Kidney Int. 60:831-846. 43. Ruusala, T., D. Andersson, M. Ehrenberg, and C. G. Kurland. 1984. Hyper-accurate ribosomes inhibit growth. EMBO J. 3:2575-2580. 44. Schatz, A., E. Bugle, and S. A. Waksman. 1944. Streptomycin, a substance exhibiting antibiotic activity against Gram-positive and Gram-negative bacteria. Proc. Soc. Exp. Biol. Med. 55:66-69. 45. Serna Iv, A., and E. C. Boedeker. 2008. Pathogenesis and treatment of Shiga toxin- producing Escherichia coli infections. Curr. Opin. Gastroenterol. 24:38-47. 46. Snider, T. A., A. J. Fabich, K. E. Washburn, W. P. Sims, J. L. Blair, P. S. Cohen, T. Conway, and K. D. Clinkenbeard. 2006. Evaluation of a model for Escherichia coli O157:H7 colonization in streptomycin-treated adult cattle. Am. J. Vet. Res. 67:1914-1920. 47. Stelzl, U., S. Connell, K. H. Nierhaus, and B. Wittmann‐Liebold. 2009. Ribosomal Proteins: Role in Ribosomal Functions p. 1-12. Encyclopedia of Life Sciences. John Wiley & Sons, Ltd. 48. Tobe, T., S. A. Beatson, H. Taniguchi, H. Abe, C. M. Bailey, A. Fivian, R. Younis, S. Matthews, O. Marches, and G. Frankel. 2006. An extensive repertoire of type III secretion effectors in Escherichia coli O157 and the role of lambdoid phages in their dissemination. Proc. Natl. Acad. Sci. U.S.A. 103:14941-14946 49. Tree, J. J., A. J. Roe, A. Flockhart, S. P. McAteer, X. Xu, D. Shaw, A. Mahajan, S. A. Beatson, A. Best, S. Lotz, M. J. Woodward, R. La Ragione, K. C. Murphy, J. M. Leong, and D. L. Gally. 2011. Transcriptional regulators of the GAD acid stress island are carried by effector protein-encoding prophages and indirectly control type III secretion in enterohemorrhagic Escherichia coli O157:H7. Mol. Microbiol. 80:1349-1365. 243

50. Tubulekas, I., R. H. Buckingham, and D. Hughes. 1991. Mutant ribosomes can generate dominant kirromycin resistance. J. Bacteriol. 173:3635-3643. 51. Uhlich, G. A., J. E. Keen, and R. O. Elder. 2002. Variations in the csgD promoter of Escherichia coli O157:H7 associated with increased virulence in mice and increased invasion of HEp-2 cells. Infect. Immun. 70:395-399. 52. Wadolkowski, E. A., J. A. Burris, and A. D. O'Brien. 1990. Mouse model for colonization and disease caused by enterohemorrhagic Escherichia coli O157:H7. Infect. Immun. 58:2438-2445. 53. Wells, J. G., B. R. Davis, I. K. Wachsmuth, L. W. Riley, R. S. Remis, R. Sokolow, and G. K. Morris. 1983. Laboratory investigation of hemorrhagic colitis outbreaks associated with a rare Escherichia coli serotype. J. Clin. Microbiol. 18:512-520. 54. Wick, L. M., W. Qi, D. W. Lacher, and T. S. Whittam. 2005. Evolution of genomic content in the stepwise emergence of Escherichia coli O157:H7. J. Bacteriol. 187:1783- 1791. 55. Wolff, C., I. Nisan, E. Hanski, G. Frankel, and I. Rosenshine. 2002. Protein translocation into host epithelial cells by infecting enteropathogenic Escherichia coli. Mol. Microbiol. 28:143-155.

244

Figure Legend

FIG. 6.1. Secretion of EspA and EspB from E. coli O157:H7 strains and their respective

Strr mutants. Total secreted protein was collected after 8 hours incubation in DMEM and separated by SDS-PAGE using 4 – 20% linear gradient polyacrylamide gel. BSA was detected by Coomassie Blue staining. EspB and EspA were detected by Western blot.

245

Table 6.1. Strains used in this study

Strain Relevant Characteristics Reference

Sakai E. coli O157:H7; stx1, stx2 W. Zhang*

Sakai-strR Spontaneous Strr mutant of Sakai This study

EDL933 E. coli O157:H7; stx1, stx2; clade 3; lineage I (53)

EDL933-strR1 Spontaneous Strr mutants of EDL933 This study

EDL933-strR2 Spontaneous Strr mutants of EDL933 This study

EDL933-strR3 Spontaneous Strr mutants of EDL933 This study

PA4 E. coli O157:H7; stx1,stx2; lineage I (24)

PA4-strR Spontaneous Strr mutant of PA4 This study

PA5 E. coli O157:H7; stx1,stx2; lineage I (24)

PA5-strR Spontaneous Strr mutant of PA5 This study

PA11 E. coli O157:H7; stx2; lineage I (24)

PA11-strR Streptomycin resistant mutant of PA11 This study

*Dr. Wei Zhang. Department of Biological and Chemical Sciences, Illinois Institute of Technology.

246

Table 6.2. Point mutations identified in E. coli O157:H7 Strr strains

a S12 alteration Restrictive or non-

Strain Site 42 Site 87 restrictive phenotype Reference

Wild-type b AAA(Lys) AAA(Lys)

EDL933-strR1 AGA(Arg) - Non-restrictive (50 )

EDL933-strR2 ACA(Thr) - Restrictive (3)

EDL933-strR3 AAC(Asn) - Restrictive (50)

Sakai-strR ACA(Thr) - Restrictive (3)

PA4-strR ACA(Thr) - Restrictive (3)

PA5-strR ACA(Thr) - Restrictive (3)

PA11-strR - AGA(Arg) Mildly restrictive (21, 50)

a The mutated base is underlined in each case. b The sequences of the wild-type allele of rpsL are the same in all E. coli O157:H7 strains included in this study.

247

EDL EDL EDL Sakai- PA4- PA5- EDL PA11- Sakai PA4 PA5 933- 933- 933- PA11 strR strR strR 933 strR strR1 strR2 strR3

BSA EspB

EspA

Figure 6.1 248

Chapter Seven

CONCLUSIONS AND FUTURE DIRECTIONS

7.1 Conclusions

Escherichia coli O157:H7 is one of the most devastating foodborne pathogens

and bacteriophage are profoundly involved in its evolution and virulence. Chapter Three

through Chapter Five investigated the influence of prophage and prophage-encoded

genes on the biology and pathogenesis of E. coli O157:H7 from three different angles.

In Chapter Three, I demonstrated that a minimal number of infectious Shiga

toxin 2 (stx2)-encoding phage can lead to significant production of Stx2. In the absence of inducing antibiotic, the majority of Stx2 accumulation for some strains may occur as the result of lytic infection of susceptible commensal E. coli. My results suggested that

upon infection, both the genomic background of the O157:H7 strain and its stx2-

encoding phage can affect toxin accumulation. This observation may explain in part the

low infectious dose of this pathogen. Also, it challenges the accepted measure for

evaluating the virulence potential of E. coli O157:H7 strains, which quantifies the

expression of virulence genes in pure culture.

I identified that the two E. coli O157:H7 strains belonging to clade 8, the clade

most frequently associated with hemolytic uremic syndrome (HUS), carry the most

infectious stx2-encoding phage among those screened, even though these strains

produce limited Stx2 as pure cultures. Also, I found the phage encoding stx2c, which is a

less virulent form of stx2, possessed limited infectivity. My result provides a potential link between the genetic background of E. coli O157:H7 strains and the disease outcome. 249

In Chapter Four, I identified 3 classes of spontaneous deletions within the Sp11-

Sp12 tandem prophage region of E. coli O157:H7 Sakai. One deletion involved a precise

excision of Sp11 and the other two spanned the junction of Sp11 and Sp12. All deletions

resulted in shifts in the pulsed-field gel electrophoresis patterns. These observations are

in line with the previously described genetic instability of this genomic region, though deletions of this size (approximately 50 kb) have never been reported. My results also suggested that these deletion events are caused by homologous recombination rather than by integrase-mediated excision. This adds to a number of previous reports describing the mechanisms of genomic rearrangement in E. coli O157:H7 that may limit the reliability of PFGE in epidemiology studies.

In Chapter Five, I reported that inactivation of the ileZ2-argN2-argO2 operon does not affect the production of Stx2 and the stx2-encoding phage in E. coli O157:H7

Sakai and in the phage-converted E. coli C600, though these observations do not support the widespread but untested belief that phage-encoded tRNA gene operons are required for efficient synthesis of Stx2 and phage particles. Meanwhile, it was identified that the E. coli O157:H7 human isolates and isolates belonging to O serogroups that are frequently associated with foodborne outbreaks carry more copies of the ileZ and argO than others; and for the first time, I demonstrated promoter activity upstream of all seven ileZ-argN-argO operons in Sakai. These results implied positive selection of these operons, though their effects on the biology of the prophage and host bacteria require further research. 250

In Chapter Six I reported a striking decrease in the secretion levels of EspA and

EspB with E. coli O157:H7 restrictive streptomycin-resistant (Strr) mutants. Because

EspA and EspB are important for animal colonization and pathogenesis, my observation

suggests the need to revisit the many previous published conclusions from E. coli

O157:H7 animal studies, where spontaneous Strr mutants were used and this mutation

was assumed to be neutral.

7.2 Future directions

7.2.1 The genetic diversity of stx2-encoding phage

My result from Chapter Three identified that some stx2-encoding phage are

more infectious than others; however, I do not have any genetic explanation for this

difference so far. During lytic infection, the host range, the ability to inject DNA, the rate

of replication and the efficiency of Stx2 synthesis of a phage can all contribute to the

overall accumulation of Stx2. All of these functions are encoded by genes in the phage

genome. Therefore, sequencing of the stx2-encoding phage from different E. coli

O157:H7 strains is needed. The resulting data, connecting each genetic module in the

phage genome to its impact on the process of lytic infection, will facilitate the prediction

of the overall Stx2 production potential of an stx2-encoding phage allele.

251

7.2.2 Evaluating the virulence potential of E. coli O157:H7 strains “in vivo”

Using laboratory media and an aerobic environment, I determined that Stx2 accumulation may be different when E. coli O157:H7 strains are coincubated in the presence of laboratory E. coli compared to that seen from a pure culture. However, the human intestine is a very different environment in terms of oxygen and nutrient availability. How these differences affect the biology of E. coli O157:H7 and impact phage infection remains unknown. Therefore, it is necessary to repeat the coincubation experiments in a micro-aerobic environment in the presence of intestinal mucus as a media. This system would provide a better measure of the in vivo virulence potential of

E. coli O157:H7 strains.

7.2.3 Effects of deletions within Sp11-Sp12 on the biology of the host

The deletions containing pchB and/or psrC, which are Sp11-encoded regulators

of the type III secretion, did not affect the secretion level of EspA or EspB effectors.

These results were somewhat contrary to the previous report by Iyoda and Watanabe,

in which an approximately 50% decrease in the expression of EspB was seen with the

pchB- mutant. Yet this observation does not mean the deletions within Sp11-Sp12 are

neutral. A microarray-based experiment would be useful in examining the effects of

these deletions on the biology of the host, and the change in the expression level of any

gene can be interesting. Also, if alteration in gene expression were observed, it would demonstrate the influence of prophage-mediated genomic rearrangement on the biology of E. coli O157:H7. 252

7.2.4 The function of argO

My data suggested that argO is expressed in Sakai but I was not able to

demonstrated the activity of argO2 in a translation assay. One of the future directions is

to determine whether this tRNA can be charged, and an acid urea polyacrylamide gel

electrophoresis protocol, as discussed in section 5.5, can be used for this purpose.

Furthermore, a very interesting observation I made by comparing the sequences of all argO genes in Sakai is that, argO2 is the only tRNA with a guanine at position 37

(next to the anticodon); all the other allelic variants have an adenine at this position as well as argU, though other sequence differences are present between these two Arg- cognate tRNAs as well. BLAST result using argO2 as a query indicated a polymorphism

(A/G) at this nucleotide position among stx2-encoding prophage from Shiga-toxin producing E. coli (STEC) of different serotypes. My hypothesis is that this single nucleotide polymorphism inhibits the recognition of argO2 by the arginyl-tRNA

synthetase and this can be tested using the BL21(DE3) system described in section 5.3.

Altered induction profile, Stx2 production, and phage production observed with

the rare codon-encoding plasmid pRARE-transformed Sakai. It is possible that these

changes are resulted from the increased expression of an AGA-cognate tRNA. This can

be tested by inactivating the plasmid copy of argU and repeating same assay. If this

were the case, it would suggest for the first time that the virulence evolution in STEC

selected for the inactivation of a phage-encoded tRNA gene.

253

7.2.5 Effects of restrictive Strr mutation on the virulence of E. coli O157:H7

EspA and EspB are essential for the attaching and effacing lesion. Therefore, after showing the remarkable decreased in secretion of these two effectors in restrictive

Strr E. coli O157:H7 mutants, I should assay whether the mutation impacts adherence to

HEp-2 cells and/or actin-assembly at the adherence foci.

7.2.6 Mechanism of decreased EspA and EspB secretion

The decrease in EspA and EspB secretion can occur at three levels: transcription,

translation and secretion. A reverse transcription qPCR for EspA and EspB could be used

to separate these possibilities. If a decrease in espA and espB mRNA abundance is seen,

it might indicate that the synthesis of specific regulator(s) of the locus of enterocyte

effacement is affected by the mutation. The regulator(s) involved can be determined by

Western blot using antibodies specific to each of them. If there is no change in espA and

espB mRNA levels, then I can evaluate the translation of these two proteins by extracting whole cell protein and perform Western blot using EspA, EspB antibodies. If this Western blot shows no difference between the mutant and the wild-type, it will suggest restrictive Strr mutation affect EspA and EspB at translation level. Chun Chen Email: [email protected] EDUCATION: Ph.D Food Microbiology, Dept of Food Science, Pennsylvania State Univ. Aug, 2007 - Dec, 2012 B.S. Biotechnology, School of Life science, Fudan Univ., Shanghai, China Sep, 2003 - Jul, 2007

ACADEMIC EXPERIENCE: Thesis title: Investigating the impact of prophage (bacterial viruses) in the virulence and physiology of a major foodborne pathogen, Escherichia coli O157:H7  Characterized the contribution of Shiga toxin2 (the toxin causes hemolytic uremic syndrome)-encoding phage, in the pathogenesis of E. coli O157:H7 infection. My work demonstrated that the Shiga toxin2-encoding phage produced by E. coli O157:H7 has the potential to infect the commensal E. coli in human intestine, and convert them into Shiga toxin2-producing. It suggested that majority of the Shiga toxin accumulated during this infection process, but not by E. coli O157:H7 directly.

 Determined the activities of prophage-encoded tRNA genes in E. coli O157:H7, which were previously hypothesized to facilitate the expression of virulence genes. My work for the first time confirmed the expression of these tRNA genes and their activities, but found they were not essential to the biology of the prophage or the virulence gene expression.

 Identified that the streptomycin-resistant mutation of E. coli O157:H7 is associated with significant reduction in virulence gene expression.

 Identified a nd characterized a gr oup of l ow-frequency m utation events within prophage r egion of E. coli O157:H7 genome, which shifts the results from the pulse field gel electrophoresis (PFGE)-based subtyping. Independent Innovation and Methods Development: • Designed pi pelines f or S OLiD s equencing dat a analysis and single nuc leotide pol ymorphism comparison, t he preliminary data obtained from which led to a successful $400,000 USDA grant. • Developed a new p hage q uantification m ethod which s hortened t he pr ocedure f rom 2 da ys t o 5 h ours, while t he accuracy was also improved. • Proposed a n ovel pr ocedure for E. coli O157:H7 virulence ev aluation, wh ich for t he first t ime takes t he interaction between the pathogen and intestinal microflora into consideration. • Developed a new method for E. coli O157:H7 clade 8 (the most virulent subgroup) isolates identification, which lowered the requirement for equipment. • Developed a n ovel m echanism t o t ransfer bacteriophage f rom E. coli O157:H7 t o non -pathogenic s trains, s olving a technological issue many researchers experience. • Developed model expression systems to determine the translational activity of each tRNA gene. Interdepartmental collaboration:  Performed in silico comparison on genetic components of a type VI secretion system among Bordetella spp., in a project that investigates the role of this secretion system in the pathogenesis of B. bronchiseptica. (collaboration with Eric Harvill’s group at Dept. of Veterinary and Biomedical Science, a manuscript on this project has been submitted)

 Tested the microbial inhibitory activities of triclosan (an antibiotic) derivatives, in a project studying the effects of different structural modifications on the release kinetics of triclosan from its β-galactoside derivatives (collaboration with Scott Phillips’ group at Dept. of Chemistry).

LEADSHIP, TEACHING EXPERIENCE AND MEMBERSHIPS: Mentor, Undergraduate Research Program 2009 - present Teaching Assistant, Ice Cream Short Course 2010 Graduate Representative, Department of Food Science 2008 - 2010 Teaching Assistant, Dept. of Food Science, Penn State Univ. 2008, 2009 Volunteering Personal Tutor, Xinxuan Charitable Group, Fudan Univ. 2004 - 2007 Member of International Association for Food Protection 2012 - present Member of the American Society for Microbiology 2009 - present Member of Product Development Team, Dept. of Food Science 2008 - 2009 Member of Food Science Club, Dept. of Food Science 2007 - present