DOCSLIB.ORG

Group I Introns Are Inherited Through Common Ancestry in the Nuclear-Encoded Rrna of Zygnematales

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Proc. Nati. Acad. Sci. USA Vol. 91, pp. 9916-9920, October 1994 Evolution Group I introns are inherited through common ancestry in the nuclear-encoded rRNA of Zygnematales (Charophyceae) (green algae/lateral traser/phylogeny/secondary structure) DEBASHISH BHATTACHARYA*t, BARBARA SUREK*, MATTHIAS RuSING*, SIMON DAMBERGERt, AND MICHAEL MELKONIAN* *UniversitAt zu Kdln, Botanisches Institut, Gyrhofstrasse 15, 50931 Cologne, Germany; and tDepartment of Molecular, Cellular, and Developmental Biology, University of Colorado, Porter Biosciences Building, Campus Box 347, Boulder, CO 80309-0347 Communicated by Thomas R. Cech, June 23, 1994 ABSTRACT Group I introns are found in organellar ge- suggests that they were introduced into the nucleus of nomes, in the genomes of eubacteria and phages, and in later-diverging species (i.e., Metakaryota) by gene transfer nuclear-encoded rRNAs. The origin and distribution of nucle- from the intron-containing cyanobacterium that gave rise to ar-encoded rRNA group I introns are not understood. To the plastid [i.e., tRNA'-eu group I intron (4, 9)] or the a purple elucidate their evolutionary relationships, we analyzed diverse eubacterium that gave rise to the mitochondrion. Group I nuclear-encoded small-subunit rRNA group I introns icluding introns have been found within protists that diverge after the nine sequences from the green-algal order Zygnematales Archezoa [e.g., Naegleria spp. (11, 12), Physarum polyceph- (Charophyceae). Phylogenetic analyses of group I introns and alum (13)] and before the radiation of the eukaryotic crown rRNA coding regions suggest that lateral transfers have oc- groups. curred in the evolutionary history of group I introns and that, To assess the origin and distribution of rRNA group I after transfer, some of these elements may form stable com- introns lacking ORFs, we analyzed a data set ofsmall-subunit ponents of the host-cell nuclear genomes. The Zygnematales (SSU) rRNA group I introns from green algae, Zygnematales introns, which share a common insertion site (position 1506 ("desmids"); red algae; and fungi. Zygnematales are mem- relative to the Escherchia cofi small-subunit rRNA), form one bers ofthe Charophyceae and occupy a basal position within subfamily o group I introns that has, after its origin, been the radiation of green algae and land plants (14).§ inherited through common ancestry. Since the first Zygne- matales appear in the middle Devonian within the fossil record, MATERIALS AND METHODS the "1506" group I intron presumably has been a stable component of the Zygnematales small-subunit rRNA coding Complete SSU rRNA sequences have been previously de- region for 350-400 million years. termined for four Zygnematales (14): Mesotaenium caldari- orum (Mesotaeniaceae), Genicularia spirotaenia and Stau- rastrum sp. M752; (Desmidiaceae, sensu ref. 15), and Mou- Group I introns are characterized by conserved RNA sec- geotia scalaris (Zygnemataceae, ref. 16). To enlarge on this ondary structures essential for splicing and are often capable data set we determined the complete rRNA coding regions of of self-splicing or require protein factors for excision (1-3). four members of the Desmidiaceae, Cosmarium botrytis The origin and distribution of group I introns are not under- [strain 274, Sammlung von Conjugaten-Kulturen University stood. Group I introns have been found most often in the of Hamburg (SCK), refs. 17 and 18], Cosmocladium saxoni- organellar and nuclear genomes ofgreen algae, higher plants, cum (strain 320, SCK), Sphaerozosma granulatum (strain and fungi and in the genomes of some eubacteria and phages 204, SCK), and Staurastrum sp. (strain M753, Culture Col- (3). Since the phage group I introns are readily mobile and the lection Melkonian, Cologne), and one member of the Zyg- phage genome represents a mosaic ofgene segments, it is not nemataceae, Zygnemopsis circumcarinata (strain 241, SCK). possible to address group I intron origin with these sequences DNA Amplification and Sequencing. Total DNA from Cos- (4). Of the organellar group I introns, some contain an open marium botrytis, Cosmocladium saxonicum, Sphaerozosma reading frame (ORF) which encodes a sequence-specific granulatum, Staurastrum sp. M753, and Zygnemopsis cir- endonuclease to mediate their lateral transfer into homolo- cumcarinata was prepared as described (14). SSU rRNA gous sequences [intron homing (5)]. Group I intron mobility genes were amplified by PCR (19) using oligonucleotide is also postulated to result from reverse splicing (6). primers complementary to conserved sequence elements Some group I introns which lack endonuclease coding proximal to the 5' and 3' termini ofrRNA coding regions (20). regions appear to be nonmobile and provide a potentially SSU rRNA sequences were determined by the dideoxynu- valuable tool for tracing the evolutionary history of these cleotide chain-termination procedure (21) using single- sequences (2): the presence of a nonmobile group I intron stranded templates produced with the Dynabeads 280 positioned in thq homologous site of the tRNALeu of cyano- streptavidin system (Dynal; ref. 22). Coding and noncoding bacteria and in plastids of photosynthetic lineages that di- strands of Zygnematales rRNAs were determined with oli- verged as representatives of the eukaryotic crown group (7, gonucleotide primers complementary to conserved regions 8) radiation (e.g., green algae, land plants, heterokonts, within these coding regions. Two Zygnematales intron- glaucocystophytes) suggests that this intron was present in the progenitor(s) ofthese plastids and therefore is at least one Abbreviations: ORF, open reading frame; SSU, small subunit; LSU, billion years old (9). Within eukaryotes, the apparent absence large subunit. of group I introns within the earliest-diverging amitochon- tTo whom reprint requests should be addressed. drial and aplastidial Archezoa (see ref. 10 for definition) §The rRNA sequences of Cosmarium botrytis, Cosmocladium sax- onicum, Genicularia spirotaenia, Mesotaenium caldariorum, Sphaerozosma granulatum, Staurastrum sp. M752, Staurastrum The publication costs of this article were defrayed in part by page charge sp. M753, and Zygnemopsis circumcarinata have been deposited in payment. This article must therefore be hereby marked "advertisement" the GenBank database (accession nos. X79498, X79497, X74753, in accordance with 18 U.S.C. §1734 solely to indicate this fact. X75763, X79496, X74752, X77452, and X79495). 9916 Downloaded by guest on September 25, 2021 Evolution: Bhattacharya et al. Proc. Natl. Acad. Sci. USA 91 (1994) 9917 specific primers (6715F, 5'-ACCTTATCATTTAG-3'; tum (M84319), Chlorella ellipsoidea (X63520), Coleochaete 6716R, 5'-TTTAGTCTGTGAAC-3') were used to determine orbicularis (M95611), Cosmarium botrytis (X79498), Cosmo- double-stranded sequences over these regions. cladium saxonicum (X79497), Dunaliella parva (M62988), Host-Cell Phylogeny. To analyze the host-cell phylogeny of Dunaliella salina (M84320), Friedmannia israelensis intron-containing taxa, SSU rRNAs of 28 eukaryotes includ- (M62995), Gingko biloba (D16448), Genicularia spirotaenia ing members of the Zygnematales and other green algae and (X74753), Gloeotilopsis planctonica (27), Klebsormidium land plants were manually aligned, and only regions which flaccidum (M95613), Mesotaenium caldariorum (X75763), could be unambiguously aligned in all the sequences were Mougeotia scalaris (X70705), Nephroselmis olivacea used for the phylogenetic analysis (1718 nt). Distance anal- (X74754), Nitella sp. (M95615), Pneumocystis carinii ysis of group I introns was implemented with the PHYLIP (X12708), Porphyra umbilicalis (L26201), Sphaerozosma (version 3.5c; ref. 23) computer program. The neighbor- granulatum (X79496), Staurastrum sp. M752 (X74752), Stau- joining method (24) was used to infer an unrooted phyloge- rastrum sp. M753 (X77452), Ustilago maydis (X62396), netic tree from evolutionary distances estimated by the Zamia pumila (M20017), Zea mays (K02202), and Zygne- method ofKimura (25). Bootstrap resamplings (26) were used mopsis circumcarinata (X79495). to assess stability of monophyletic groups. Group I Intron Analysis. The alignment of Zygnematales The host-cell phylogenetic analysis included the following group I intron sequences was aided by the secondary struc- sequences (with GenBank accession numbers shown where ture-based alignments of Cech (1), Michel and Westhof (28), available): Acrosiphonia sp. (U03757), Ankistrodesmus stip- and S.D. and R. Gutell (unpublisheddata). The 5'-P-Q-R-S-3' itatus (X56100), Chara foetida (X70704), Characium sacca- regions were initially aligned, and then other conserved re- P P2> P2< P2.1> P2.1< P3> P4> PS> PSa> P5B> L5b P59< P5C> L5C C. botrytis * CAUGGAAGCCUAUGGGGG*ACAUGCUAGUGCU*UGCGAGCCG -tUCAGUCUGCGGGAA*UCCU-CCGUGGU*GGUA-CCAAGCGC*AGCGU*AGCGG-COGGaU-AGUGA------G C. saxonicum * CACGGAAGCCUAAGACCCAGUUGCUCCC¶CGCGAJGUt- CJAAGGGGGCCU-CUUPAlUGGUUA- CCAAGCAC-AAAGCA*AG - CCAG(CC*LVOGA*CCU-GG G. spirotatnia *UGarGAAGCCUUCCCC*GAAUGCUAGTGCC*UGCGACAUCG-CCAAAa)GCGGAGAA*UCCA* U*AUUA-CCAA *CAAG*CCCGUGG-CGCU-AAUG-CUULG M. caldariouxn *CCCCCC*AAACU GC UCA-GCCGACGGAAA-UCCC-UAAAGCUU*ACIA-CCAJGC*CGAAAS*CGCAUGG-CCPU-AA-CCUCGG M. scalaris *UACCGAAGCCUUAGCCGCCCoAAGUCUAGGUU-UGACAUCG-UCCC-U AAAGCUUACUA-CCAA£SCACoCGAAAG*GGUGU3G-AGGG A-CCUCGG S. granulatum *CAC CCUGPC-AUAUGCUX CCoGCAlGC3C-CCAAALCGAA-ACCA-CU-CUU~lGoaA-CCAAGCACGGAUAGC*UQG-C(AG3CC-ACGA*CCU-GG StaurastrunMl52 *CACGCWA3CACUAUoCCCUAlUGCCetGCGACGUCA-UC AAA*UCCU-A GGAUA-CCAAGCAC*CAIU-GUGt-CU
Recommended publications
  • Spirogyra and Mougeotia Zornitza G

    Spirogyra and Mougeotia Zornitza G

    Volatile Components of the Freshwater AlgaeSpirogyra and Mougeotia Zornitza G. Kamenarska3, Stefka D. Dimitrova-Konaklievab, Christina Nikolovac, Athanas II. Kujumgievd, Kamen L. Stefanov3, Simeon S. Popov3 * a Institute of Organic Chemistry with Centre of Phytochemistry. Bulgarian Academy of Sciences, Sofia 1113. Bulgaria. Fax: ++3592/700225. E-mail: [email protected] b Faculty of Pharmacy, Medical University, Sofia 1000, Bulgaria c Institute of Soil Sciences and Agroecology, “N. Pushkarov”, Sofia 1080, Bulgaria d Institute of Microbiology, Bulgarian Academy of Sciences, Sofia 1113, Bulgaria * Author for correspondence and reprint requests Z. Naturforsch. 55c, 495-499 (2000); received February 4/March 13, 2000 Antibacterial Activity, Mougeotia, Spirogyra, Volatile Compounds Several species of freshwater green algae belonging to the order ZygnematalesSpirogyra ( crassa (Ktz.) Czurda, S. longata (Vauch.) Ktz., and Mougeotia viridis (Ktz.) Wittr.) were found to have a specific composition of the volatile fraction, which confirms an earlier pro­ posal for the existence of two groups in the genusSpirogyra. Antibacterial activity was found in volatiles from S. longata. Introduction and Hentschel, 1966). Tannins (Nishizawa et al., 1985; Nakabayashi and Hada, 1954) and fatty acids While the chemical composition and biological (Pettko and Szotyori, 1967) were also found in activity of marine algae have been studied in Spyrogyra sp. Evidently, research on chemical depth, freshwater algae have been investigated composition of Spirogyra and Mougeotia species less intensively, especially those belonging to Zyg- is very limited, especially on their secondary me­ nemaceae (order Zygnematales). The most nu­ tabolites, which often possess biological activity. merous representatives of this family in the Bul­ The volatile constituents of Zygnemaceae algae garian flora are generaSpirogyra, Mougeotia and are of interest, because such compounds often Zygnema, which inhabit rivers and ponds.
  • CONTROL of CELL DIVISION in the FILAMENTOUS, GREEN ALGA ZYGNEMA by Robert Dale Staker a Thesis Submitted to the Faculty of the D

    CONTROL of CELL DIVISION in the FILAMENTOUS, GREEN ALGA ZYGNEMA by Robert Dale Staker a Thesis Submitted to the Faculty of the D

    Control of cell division in the filamentous green alga Zygnema Item Type text; Thesis-Reproduction (electronic) Authors Staker, Robert Dale, 1945- Publisher The University of Arizona. Rights Copyright © is held by the author. Digital access to this material is made possible by the University Libraries, University of Arizona. Further transmission, reproduction or presentation (such as public display or performance) of protected items is prohibited except with permission of the author. Download date 25/09/2021 05:42:58 Link to Item http://hdl.handle.net/10150/318132 CONTROL OF CELL DIVISION IN THE FILAMENTOUS, GREEN ALGA ZYGNEMA by Robert Dale Staker A Thesis Submitted to the Faculty of the DEPARTMENT OF BIOLOGICAL SCIENCES In Partial Fulfillment of the Requirements For the Degree of MASTER OF SCIENCE WITH A MAJOR IN BOTANY In the Graduate College THE UNIVERSITY OF ARIZONA 1 9 7 S STATEMENT BY AUTHOR This thesis has been submitted in partial fulfill­ ment of requirements for an advanced degree at The University of Arizona and is deposited in the University Library to be made available to borrowers under rules of the Library, Brief quotations from this thesis are allowable without special permission, provided that accurate acknowledgment of source is made. Requests for permission for extended quotation from or reproduction of this manuscript in whole or in part may be granted by the head of the major department or the Dean of the Graduate College when in his judgment the proposed use of the material is in the interests of scholarship. In all other instances, however, permission must be obtained from the author.
  • Permian–Triassic Non-Marine Algae of Gondwana—Distributions

    Permian–Triassic Non-Marine Algae of Gondwana—Distributions

    Earth-Science Reviews 212 (2021) 103382 Contents lists available at ScienceDirect Earth-Science Reviews journal homepage: www.elsevier.com/locate/earscirev Review Article Permian–Triassic non-marine algae of Gondwana—Distributions, natural T affinities and ecological implications ⁎ Chris Maysa,b, , Vivi Vajdaa, Stephen McLoughlina a Swedish Museum of Natural History, Box 50007, SE-104 05 Stockholm, Sweden b Monash University, School of Earth, Atmosphere and Environment, 9 Rainforest Walk, Clayton, VIC 3800, Australia ARTICLE INFO ABSTRACT Keywords: The abundance, diversity and extinction of non-marine algae are controlled by changes in the physical and Permian–Triassic chemical environment and community structure of continental ecosystems. We review a range of non-marine algae algae commonly found within the Permian and Triassic strata of Gondwana and highlight and discuss the non- mass extinctions marine algal abundance anomalies recorded in the immediate aftermath of the end-Permian extinction interval Gondwana (EPE; 252 Ma). We further review and contrast the marine and continental algal records of the global biotic freshwater ecology crises within the Permian–Triassic interval. Specifically, we provide a case study of 17 species (in 13 genera) palaeobiogeography from the succession spanning the EPE in the Sydney Basin, eastern Australia. The affinities and ecological im- plications of these fossil-genera are summarised, and their global Permian–Triassic palaeogeographic and stra- tigraphic distributions are collated. Most of these fossil taxa have close extant algal relatives that are most common in freshwater, brackish or terrestrial conditions, and all have recognizable affinities to groups known to produce chemically stable biopolymers that favour their preservation over long geological intervals.
  • Lateral Gene Transfer of Anion-Conducting Channelrhodopsins Between Green Algae and Giant Viruses

    Lateral Gene Transfer of Anion-Conducting Channelrhodopsins Between Green Algae and Giant Viruses

    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.15.042127; this version posted April 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 5 Lateral gene transfer of anion-conducting channelrhodopsins between green algae and giant viruses Andrey Rozenberg 1,5, Johannes Oppermann 2,5, Jonas Wietek 2,3, Rodrigo Gaston Fernandez Lahore 2, Ruth-Anne Sandaa 4, Gunnar Bratbak 4, Peter Hegemann 2,6, and Oded 10 Béjà 1,6 1Faculty of Biology, Technion - Israel Institute of Technology, Haifa 32000, Israel. 2Institute for Biology, Experimental Biophysics, Humboldt-Universität zu Berlin, Invalidenstraße 42, Berlin 10115, Germany. 3Present address: Department of Neurobiology, Weizmann 15 Institute of Science, Rehovot 7610001, Israel. 4Department of Biological Sciences, University of Bergen, N-5020 Bergen, Norway. 5These authors contributed equally: Andrey Rozenberg, Johannes Oppermann. 6These authors jointly supervised this work: Peter Hegemann, Oded Béjà. e-mail: [email protected] ; [email protected] 20 ABSTRACT Channelrhodopsins (ChRs) are algal light-gated ion channels widely used as optogenetic tools for manipulating neuronal activity 1,2. Four ChR families are currently known. Green algal 3–5 and cryptophyte 6 cation-conducting ChRs (CCRs), cryptophyte anion-conducting ChRs (ACRs) 7, and the MerMAID ChRs 8. Here we 25 report the discovery of a new family of phylogenetically distinct ChRs encoded by marine giant viruses and acquired from their unicellular green algal prasinophyte hosts.
  • Genus Micrasterias

    Genus Micrasterias

    Triquetrous forms in the genus Micrasterias by J. Heimans (Amsterdam). In the winter and early spring of 1916 Mrs. Anna Weber-van Bosse at her hospitable residence near Eerbeek initiated me in the study of Freshwater Algae. For several years after that date in numerous trips all over this country I collected and studied some thousands of samples from all kinds The Desmids drew of freshwater ponds and lakes, canals and streams. soon when rich and varied Desmid flora my special attention, an unexpectedly was found in certain fens and ponds in the diluvial and moor districts of our country. considerable of Still more surprising was the presence of a number those Desmid species which in the publications of W. and G. S. West, whose Monograph at that time was the only handbook for the study of Desmids, are held to be confined to the Western rocky districts of the British Isles in the drainage area of precarboniferous rocks. One of the most beautiful and most characteristic species of this "Caledonian type" of Desmid vegetation, Staurastrum Ophiura Lund, had been found by Mrs Weber herself some years before in a sample from the province of North Brabant. did the Not until several years afterwards we learn from publications of R. Gronblad, A. Donat, H. Homfeld and others that this "Atlantic Element of the Desmid flora" is the N.W. of spread over parts Europe from Finland to Portugal. Besides Staurastrum Ophiura a considerable number of species be- longing to this Western element was found in the Netherlands, although of them of Staurastrum brasiliense most are rare occurrence, e.g.
  • Simultaneous Parsimony Jackknife Analysis of 2538 &lt;Emphasis Type

    Simultaneous Parsimony Jackknife Analysis of 2538 <Emphasis Type

    Simultaneous parsimony jackknife analysis of 2538 rbcL DNA sequences reveals support for major clades of green plants, land plants, seed plants and flowering plants Källersjö, Mari; Farris, James S.; Chase, Mark W.; Bremer, Birgitta; Fay, Michael F.; Humphries, Christopher J.; Petersen, Gitte; Seberg, Ole; Bremer, Kåre Published in: Plant Systematics and Evolution Publication date: 1998 Document version Publisher's PDF, also known as Version of record Citation for published version (APA): Källersjö, M., Farris, J. S., Chase, M. W., Bremer, B., Fay, M. F., Humphries, C. J., Petersen, G., Seberg, O., & Bremer, K. (1998). Simultaneous parsimony jackknife analysis of 2538 rbcL DNA sequences reveals support for major clades of green plants, land plants, seed plants and flowering plants. Plant Systematics and Evolution, 213(3-4), 259-287. Download date: 28. sep.. 2021 Plant Pl. Syst. Evol. 213:259-287 (1998) Systematics and Evolution © Springer-Verlag 1998 Printed in Austria Simultaneous parsimony jackknife analysis of 2538 rbcL DNA sequences reveals support for major clades of green plants, land plants, seed plants and flowering plants MARI KÄLLERSJÖ, JAMES S. FARNS, MARK W. CHASE, BIRGITTABREMER, MICHAEL F. FAY, CHRISTOPHERJ. HUMPHRIES, GITTE PETERSEN, OLE SEBERG, and KÄRE BREMER Received October 16, t997; in revised version March 16, 1998 Key words: Parsimony jackknifing, phylogenetic analysis, large data sets, rbcL, DNA sequences, green plants, land plants, seed plants, flowering plants. Abstract" The ever-larger data matrices resulting from continuing improvements in DNA sequencing techniques require faster and more efficient methods of phylogenetic analysis. Here we explore a promising new method, parsimony jackknifing, by analyzing a matrix comprising 2538 sequences of the chloroplast gene rbcL.
  • Vegetative Cell Division and Nuclear Translocation in Three Algae Species of Netrium (Zygnematales, Chlorophyta)

    Vegetative Cell Division and Nuclear Translocation in Three Algae Species of Netrium (Zygnematales, Chlorophyta)

    Hayati, Maret 2006, hlm. 39-42 Vol. 13, No. 1 ISSN 0854-8587 CATATAN PENELITIAN Vegetative Cell Division and Nuclear Translocation in Three Algae Species of Netrium (Zygnematales, Chlorophyta) DIAN HENDRAYANTI Department of Biology, Faculty Mathematics and Science, University of Indonesia, Depok 16424 Tel. +62-21-7270163, Fax. +62-21-78849010, E-mail: [email protected] Diterima 20 Juni 2005/Disetujui 9 Februari 2006 Three species of Netrium oblongum, N. digitus v. latum, and N. interruptum were studied for their mode in the vegetative cell division and nuclear translocation during mitosis using light and fluorescence microscopy. The process of cell division in the three species began with the prominent constriction at the chloroplast in both semicells about half way from the apex. The constriction of chloroplast was mostly visible in N. digitus v. latum. Soon after nucleus divided, septum was formed across the cell and cytokinesis occurred. Observation with fluorescence microscope showed that the movement of nucleus moved back into the center of daughter cells was not always synchronous. Division of chloroplast in N. oblongum and N. digitus v. latum were different with that of N. interruptum. Chloroplast division in two former species occured following the movement of the nucleus down semicell. However, in N. interruptum, chloroplast divided later after nucleus occupied the position at the center of the daughter cells. Cell restoration started after the completion of mitosis and cytokinesis. Key words: Cell division, conjugating alga, mitosis, Netrium ___________________________________________________________________________ The genus Netrium is one of the taxonomically chloroplast and pyrenoid. Mitosis is followed by the formation problematic members of the conjugating green algae (Class of an ingrowing septum, which cuts the symmetrical cell in Zygnematophyceae).
  • Kociolek University of Colorado Rev Standard Operating Procedures and Protocols for Algal Taxonomic Identification

    Kociolek University of Colorado Rev Standard Operating Procedures and Protocols for Algal Taxonomic Identification

    Kociolek Rev University of Colorado Standard Operating Procedures and Protocols for 8 June, 2020 Algal Taxonomic Identification Table of Contents Section 1.0: Traceability of Analysis……………………………..…………………………………...2 A. Taxonomic Keys and References Used in the Identification of Soft-Bodied Algae and Diatoms.....2 B. Experts……………………………………………………………………………………………….6 C. Training Policy………………………………………………………………………………………7 Section 2.0: Procedures…………….……………………………………………………………………8 A. Sample Receiving……………………………………………………………………………………8 B. Storage……………………………………………………………………………………………….8 C. Processing……………………………………………………………………………………………8 i. Phytoplankton ii. Macroalgae iii. Periphyton iv. Preparation of Permanent Diatom Slides D. Analysis………………………………………………………………….…………………………14 i. Phytoplankton ii. Macroalgae iii. Periphyton iv.Identification and Enumeration Analysis of Diatoms E. Digital Image Reference Collection……………………………………………………………….....17 F. Development of List of Names……………………………………………………………………... 17 G. QA/QC Review……………………………………………………………………………………...17 H. Data Reporting……………………………………………………………………………………... 18 I. Archiving and Storage………………………………………………………………………………. 18 J. Shipment and Transport to Repository/BioArchive……………………………………………….... 18 K. Other Considerations……………………………………………………….………………………. 18 Section 3.0: QA/QC Protocols…………………………………………..………………………………19 Section 4.0: Relevant Literature………………………………………………………………………..20 1 Section 1.0 Traceability of Analysis A.Taxonomic Keys And References Used In The Identification Of Soft-Bodied Algae And Diatoms
  • New Desmid Records from High Mountain Lakes in Artabel Lakes Nature Park, Gümüşhane, Turkey

    New Desmid Records from High Mountain Lakes in Artabel Lakes Nature Park, Gümüşhane, Turkey

    Turkish Journal of Botany Turk J Bot (2019) 43: 570-583 http://journals.tubitak.gov.tr/botany/ © TÜBİTAK Research Article doi:10.3906/bot-1810-71 New desmid records from high mountain lakes in Artabel Lakes Nature Park, Gümüşhane, Turkey 1, 2 Bülent ŞAHİN *, Bülent AKAR 1 Department of Biology Education, Fatih Education Faculty, Trabzon University, Trabzon, Turkey 2 Department of Food Engineering, Faculty of Engineering and Natural Sciences, Gümüşhane University, Gümüşhane, Turkey Received: 30.10.2018 Accepted/Published Online: 15.04.2019 Final Version: 08.07.2019 Abstract: The algal flora of 17 lakes and 1 pond in the Artabel Lakes Nature Park were investigated during two summer seasons (2013 and 2016). In total, 26 desmid taxa were found and identified as new records for the desmid flora of Turkey based on their morphotaxonomic characteristics and ecological preferences. The taxa identified belong to the genera Actinotaenium (1), Closterium (1), Cosmarium (15), Micrasterias (1), Spondylosium (1), Staurastrum (5), Teilingia (1), and Tetmemorus (1). Morphotaxonomy, ecology, and distribution of each species were discussed in detail. Key words: Desmids, new records, high mountain lakes, Artabel Lakes Nature Park, Turkey 1. Introduction Desmids are an integral part of benthic habitats of Desmid habitats are exclusively freshwater (Coesel and high mountain lakes; in particular, those of the Northern Meesters, 2007; Kouwets, 2008). Desmids usually prefer Hemisphere (Medvedeva, 2001; Sterlyagova, 2008). In acidic or pH-circumneutral, nutrient-poor, and clear the period from 1998 to 2014, 43 new records of desmid waters (Lenzenweger, 1996; Coesel and Meesters, 2007). species from high mountain lakes in the eastern Black It is well known that members of order Desmidiales Sea Region were identified and published (Şahin, 1998, exhibit great diversity in their external morphology and 2000, 2002, 2007, 2008, 2009; Şahin and Akar, 2007; Akar also have remarkably complex cell symmetry (Lee, 2015).
  • Compartmentalization of Mrnas in the Giant, Unicellular Green Algae

    Compartmentalization of Mrnas in the Giant, Unicellular Green Algae

    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.303206; this version posted September 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Compartmentalization of mRNAs in the giant, 2 unicellular green algae Acetabularia acetabulum 3 4 Authors 5 Ina J. Andresen1, Russell J. S. Orr2, Kamran Shalchian-Tabrizi3, Jon Bråte1* 6 7 Address 8 1: Section for Genetics and Evolutionary Biology, Department of Biosciences, University of 9 Oslo, Kristine Bonnevies Hus, Blindernveien 31, 0316 Oslo, Norway. 10 2: Natural History Museum, University of Oslo, Oslo, Norway 11 3: Centre for Epigenetics, Development and Evolution, Department of Biosciences, University 12 of Oslo, Kristine Bonnevies Hus, Blindernveien 31, 0316 Oslo, Norway. 13 14 *Corresponding author 15 Jon Bråte, [email protected] 16 17 Keywords 18 Acetabularia acetabulum, Dasycladales, UMI, STL, compartmentalization, single-cell, mRNA. 19 20 Abstract 21 Acetabularia acetabulum is a single-celled green alga previously used as a model species for 22 studying the role of the nucleus in cell development and morphogenesis. The highly elongated 23 cell, which stretches several centimeters, harbors a single nucleus located in the basal end. 24 Although A. acetabulum historically has been an important model in cell biology, almost 25 nothing is known about its gene content, or how gene products are distributed in the cell. To 26 study the composition and distribution of mRNAs in A.
  • Identification of 13 Spirogyra Species (Zygnemataceae) by Traits of Sexual Reproduction Induced Under Laboratory Culture Conditions

    Identification of 13 Spirogyra Species (Zygnemataceae) by Traits of Sexual Reproduction Induced Under Laboratory Culture Conditions

    www.nature.com/scientificreports OPEN Identifcation of 13 Spirogyra species (Zygnemataceae) by traits of sexual reproduction induced Received: 16 November 2018 Accepted: 23 April 2019 under laboratory culture conditions Published: xx xx xxxx Tomoyuki Takano1,6, Sumio Higuchi2, Hisato Ikegaya3, Ryo Matsuzaki4, Masanobu Kawachi4, Fumio Takahashi5 & Hisayoshi Nozaki 1 The genus Spirogyra is abundant in freshwater habitats worldwide, and comprises approximately 380 species. Species assignment is often difcult because identifcation is based on the characteristics of sexual reproduction in wild-collected samples and spores produced in the feld or laboratory culture. We developed an identifcation procedure based on an improved methodology for inducing sexual conjugation in laboratory-cultivated flaments. We tested the modifed procedure on 52 newly established and genetically diferent strains collected from diverse localities in Japan. We induced conjugation or aplanospore formation under controlled laboratory conditions in 15 of the 52 strains, which allowed us to identify 13 species. Two of the thirteen species were assignable to a related but taxonomically uncertain genus, Temnogyra, based on the unique characteristics of sexual reproduction. Our phylogenetic analysis demonstrated that the two Temnogyra species are included in a large clade comprising many species of Spirogyra. Thus, separation of Temnogyra from Spirogyra may be untenable, much as the separation of Sirogonium from Spirogyra is not supported by molecular analyses. Spirogyra Link (Zygnemataceae, Zygnematales) is a genus in the Class Zygnematophyceae (Conjugatophyceae), which is a component member of the Infrakingdom Streptophyta1,2. Spirogyra has long been included in high school biology curricula. Te genus is widely distributed in freshwater habitats including fowing water, perma- nent ponds and temporary pools3.
  • Freshwater Algae in Britain and Ireland - Bibliography

    Freshwater Algae in Britain and Ireland - Bibliography

    Freshwater algae in Britain and Ireland - Bibliography Floras, monographs, articles with records and environmental information, together with papers dealing with taxonomic/nomenclatural changes since 2003 (previous update of ‘Coded List’) as well as those helpful for identification purposes. Theses are listed only where available online and include unpublished information. Useful websites are listed at the end of the bibliography. Further links to relevant information (catalogues, websites, photocatalogues) can be found on the site managed by the British Phycological Society (http://www.brphycsoc.org/links.lasso). Abbas A, Godward MBE (1964) Cytology in relation to taxonomy in Chaetophorales. Journal of the Linnean Society, Botany 58: 499–597. Abbott J, Emsley F, Hick T, Stubbins J, Turner WB, West W (1886) Contributions to a fauna and flora of West Yorkshire: algae (exclusive of Diatomaceae). Transactions of the Leeds Naturalists' Club and Scientific Association 1: 69–78, pl.1. Acton E (1909) Coccomyxa subellipsoidea, a new member of the Palmellaceae. Annals of Botany 23: 537–573. Acton E (1916a) On the structure and origin of Cladophora-balls. New Phytologist 15: 1–10. Acton E (1916b) On a new penetrating alga. New Phytologist 15: 97–102. Acton E (1916c) Studies on the nuclear division in desmids. 1. Hyalotheca dissiliens (Smith) Bréb. Annals of Botany 30: 379–382. Adams J (1908) A synopsis of Irish algae, freshwater and marine. Proceedings of the Royal Irish Academy 27B: 11–60. Ahmadjian V (1967) A guide to the algae occurring as lichen symbionts: isolation, culture, cultural physiology and identification. Phycologia 6: 127–166 Allanson BR (1973) The fine structure of the periphyton of Chara sp.