Proc. Nati. Acad. Sci. USA Vol. 91, pp. 9916-9920, October 1994 Evolution Group I introns are inherited through common ancestry in the nuclear-encoded rRNA of Zygnematales (Charophyceae) (green algae/lateral traser/phylogeny/secondary structure) DEBASHISH BHATTACHARYA*t, BARBARA SUREK*, MATTHIAS RuSING*, SIMON DAMBERGERt, AND MICHAEL MELKONIAN* *UniversitAt zu Kdln, Botanisches Institut, Gyrhofstrasse 15, 50931 Cologne, Germany; and tDepartment of Molecular, Cellular, and Developmental Biology, University of Colorado, Porter Biosciences Building, Campus Box 347, Boulder, CO 80309-0347 Communicated by Thomas R. Cech, June 23, 1994 ABSTRACT Group I introns are found in organellar ge- suggests that they were introduced into the nucleus of nomes, in the genomes of eubacteria and phages, and in later-diverging species (i.e., Metakaryota) by gene transfer nuclear-encoded rRNAs. The origin and distribution of nucle- from the intron-containing cyanobacterium that gave rise to ar-encoded rRNA group I introns are not understood. To the plastid [i.e., tRNA'-eu group I intron (4, 9)] or the a purple elucidate their evolutionary relationships, we analyzed diverse eubacterium that gave rise to the mitochondrion. Group I nuclear-encoded small-subunit rRNA group I introns icluding introns have been found within protists that diverge after the nine sequences from the green-algal order Zygnematales Archezoa [e.g., Naegleria spp. (11, 12), Physarum polyceph- (Charophyceae). Phylogenetic analyses of group I introns and alum (13)] and before the radiation of the eukaryotic crown rRNA coding regions suggest that lateral transfers have oc- groups. curred in the evolutionary history of group I introns and that, To assess the origin and distribution of rRNA group I after transfer, some of these elements may form stable com- introns lacking ORFs, we analyzed a data set ofsmall-subunit ponents of the host-cell nuclear genomes. The Zygnematales (SSU) rRNA group I introns from green algae, Zygnematales introns, which share a common insertion site (position 1506 ("desmids"); red algae; and fungi. Zygnematales are mem- relative to the Escherchia cofi small-subunit rRNA), form one bers ofthe Charophyceae and occupy a basal position within subfamily o group I introns that has, after its origin, been the radiation of green algae and land plants (14).§ inherited through common ancestry. Since the first Zygne- matales appear in the middle Devonian within the fossil record, MATERIALS AND METHODS the "1506" group I intron presumably has been a stable component of the Zygnematales small-subunit rRNA coding Complete SSU rRNA sequences have been previously de- region for 350-400 million years. termined for four Zygnematales (14): Mesotaenium caldari- orum (Mesotaeniaceae), Genicularia spirotaenia and Stau- rastrum sp. M752; (Desmidiaceae, sensu ref. 15), and Mou- Group I introns are characterized by conserved RNA sec- geotia scalaris (Zygnemataceae, ref. 16). To enlarge on this ondary structures essential for splicing and are often capable data set we determined the complete rRNA coding regions of of self-splicing or require protein factors for excision (1-3). four members of the Desmidiaceae, Cosmarium botrytis The origin and distribution of group I introns are not under- [strain 274, Sammlung von Conjugaten-Kulturen University stood. Group I introns have been found most often in the of Hamburg (SCK), refs. 17 and 18], Cosmocladium saxoni- organellar and nuclear genomes ofgreen algae, higher plants, cum (strain 320, SCK), Sphaerozosma granulatum (strain and fungi and in the genomes of some eubacteria and phages 204, SCK), and Staurastrum sp. (strain M753, Culture Col- (3). Since the phage group I introns are readily mobile and the lection Melkonian, Cologne), and one member of the Zyg- phage genome represents a mosaic ofgene segments, it is not nemataceae, Zygnemopsis circumcarinata (strain 241, SCK). possible to address group I intron origin with these sequences DNA Amplification and Sequencing. Total DNA from Cos- (4). Of the organellar group I introns, some contain an open marium botrytis, Cosmocladium saxonicum, Sphaerozosma reading frame (ORF) which encodes a sequence-specific granulatum, Staurastrum sp. M753, and Zygnemopsis cir- endonuclease to mediate their lateral transfer into homolo- cumcarinata was prepared as described (14). SSU rRNA gous sequences [intron homing (5)]. Group I intron mobility genes were amplified by PCR (19) using oligonucleotide is also postulated to result from reverse splicing (6). primers complementary to conserved sequence elements Some group I introns which lack endonuclease coding proximal to the 5' and 3' termini ofrRNA coding regions (20). regions appear to be nonmobile and provide a potentially SSU rRNA sequences were determined by the dideoxynu- valuable tool for tracing the evolutionary history of these cleotide chain-termination procedure (21) using single- sequences (2): the presence of a nonmobile group I intron stranded templates produced with the Dynabeads 280 positioned in thq homologous site of the tRNALeu of cyano- streptavidin system (Dynal; ref. 22). Coding and noncoding bacteria and in plastids of photosynthetic lineages that di- strands of Zygnematales rRNAs were determined with oli- verged as representatives of the eukaryotic crown group (7, gonucleotide primers complementary to conserved regions 8) radiation (e.g., green algae, land plants, heterokonts, within these coding regions. Two Zygnematales intron- glaucocystophytes) suggests that this intron was present in the progenitor(s) ofthese plastids and therefore is at least one Abbreviations: ORF, open reading frame; SSU, small subunit; LSU, billion years old (9). Within eukaryotes, the apparent absence large subunit. of group I introns within the earliest-diverging amitochon- tTo whom reprint requests should be addressed. drial and aplastidial Archezoa (see ref. 10 for definition) §The rRNA sequences of Cosmarium botrytis, Cosmocladium sax- onicum, Genicularia spirotaenia, Mesotaenium caldariorum, Sphaerozosma granulatum, Staurastrum sp. M752, Staurastrum The publication costs of this article were defrayed in part by page charge sp. M753, and Zygnemopsis circumcarinata have been deposited in payment. This article must therefore be hereby marked "advertisement" the GenBank database (accession nos. X79498, X79497, X74753, in accordance with 18 U.S.C. §1734 solely to indicate this fact. X75763, X79496, X74752, X77452, and X79495). 9916 Downloaded by guest on September 25, 2021 Evolution: Bhattacharya et al. Proc. Natl. Acad. Sci. USA 91 (1994) 9917 specific primers (6715F, 5'-ACCTTATCATTTAG-3'; tum (M84319), Chlorella ellipsoidea (X63520), Coleochaete 6716R, 5'-TTTAGTCTGTGAAC-3') were used to determine orbicularis (M95611), Cosmarium botrytis (X79498), Cosmo- double-stranded sequences over these regions. cladium saxonicum (X79497), Dunaliella parva (M62988), Host-Cell Phylogeny. To analyze the host-cell phylogeny of Dunaliella salina (M84320), Friedmannia israelensis intron-containing taxa, SSU rRNAs of 28 eukaryotes includ- (M62995), Gingko biloba (D16448), Genicularia spirotaenia ing members of the Zygnematales and other green algae and (X74753), Gloeotilopsis planctonica (27), Klebsormidium land plants were manually aligned, and only regions which flaccidum (M95613), Mesotaenium caldariorum (X75763), could be unambiguously aligned in all the sequences were Mougeotia scalaris (X70705), Nephroselmis olivacea used for the phylogenetic analysis (1718 nt). Distance anal- (X74754), Nitella sp. (M95615), Pneumocystis carinii ysis of group I introns was implemented with the PHYLIP (X12708), Porphyra umbilicalis (L26201), Sphaerozosma (version 3.5c; ref. 23) computer program. The neighbor- granulatum (X79496), Staurastrum sp. M752 (X74752), Stau- joining method (24) was used to infer an unrooted phyloge- rastrum sp. M753 (X77452), Ustilago maydis (X62396), netic tree from evolutionary distances estimated by the Zamia pumila (M20017), Zea mays (K02202), and Zygne- method ofKimura (25). Bootstrap resamplings (26) were used mopsis circumcarinata (X79495). to assess stability of monophyletic groups. Group I Intron Analysis. The alignment of Zygnematales The host-cell phylogenetic analysis included the following group I intron sequences was aided by the secondary struc- sequences (with GenBank accession numbers shown where ture-based alignments of Cech (1), Michel and Westhof (28), available): Acrosiphonia sp. (U03757), Ankistrodesmus stip- and S.D. and R. Gutell (unpublisheddata). The 5'-P-Q-R-S-3' itatus (X56100), Chara foetida (X70704), Characium sacca- regions were initially aligned, and then other conserved re- P P2> P2< P2.1> P2.1< P3> P4> PS> PSa> P5B> L5b P59< P5C> L5C C. botrytis * CAUGGAAGCCUAUGGGGG*ACAUGCUAGUGCU*UGCGAGCCG -tUCAGUCUGCGGGAA*UCCU-CCGUGGU*GGUA-CCAAGCGC*AGCGU*AGCGG-COGGaU-AGUGA------G C. saxonicum * CACGGAAGCCUAAGACCCAGUUGCUCCC¶CGCGAJGUt- CJAAGGGGGCCU-CUUPAlUGGUUA- CCAAGCAC-AAAGCA*AG - CCAG(CC*LVOGA*CCU-GG G. spirotatnia *UGarGAAGCCUUCCCC*GAAUGCUAGTGCC*UGCGACAUCG-CCAAAa)GCGGAGAA*UCCA* U*AUUA-CCAA *CAAG*CCCGUGG-CGCU-AAUG-CUULG M. caldariouxn *CCCCCC*AAACU GC UCA-GCCGACGGAAA-UCCC-UAAAGCUU*ACIA-CCAJGC*CGAAAS*CGCAUGG-CCPU-AA-CCUCGG M. scalaris *UACCGAAGCCUUAGCCGCCCoAAGUCUAGGUU-UGACAUCG-UCCC-U AAAGCUUACUA-CCAA£SCACoCGAAAG*GGUGU3G-AGGG A-CCUCGG S. granulatum *CAC CCUGPC-AUAUGCUX CCoGCAlGC3C-CCAAALCGAA-ACCA-CU-CUU~lGoaA-CCAAGCACGGAUAGC*UQG-C(AG3CC-ACGA*CCU-GG StaurastrunMl52 *CACGCWA3CACUAUoCCCUAlUGCCetGCGACGUCA-UC AAA*UCCU-A GGAUA-CCAAGCAC*CAIU-GUGt-CU