DOCSLIB.ORG

PBX1 Is a Favorable Prognostic Biomarker As It Modulates 13-Cis Retinoic Acid–Mediated Differentiation in Neuroblastoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
PBX1 Is a Favorable Prognostic Biomarker As It Modulates 13-Cis Retinoic Acid–Mediated Differentiation in Neuroblastoma Published OnlineFirst June 19, 2014; DOI: 10.1158/1078-0432.CCR-13-1486 Clinical Cancer Biology of Human Tumors Research PBX1 Is a Favorable Prognostic Biomarker as It Modulates 13-cis Retinoic Acid–Mediated Differentiation in Neuroblastoma Nilay Shah1, Jianjun Wang2, Julia Selich-Anderson1, Garrett Graham3, Hasan Siddiqui1, Xin Li4, Javed Khan2, and Jeffrey Toretsky3 Abstract Purpose: Neuroblastoma is an embryonic childhood cancer with high mortality. 13-cis retinoic acid (13- cisRA) improves survival for some patients, but many recur, suggesting clinical resistance. The mechanism of resistance and the normal differentiation pathway are poorly understood. Three–amino-acid loop extension (TALE) family genes are master regulators of differentiation. Because retinoids promote differentiation in neuroblastoma, we evaluated TALE family gene expression in neuroblastoma. Experimental Design: We evaluated expression of TALE family genes in RA-sensitive and -resistant neuroblastoma cell lines, with and without 13-cisRA treatment, identifying genes whose expression correlates with retinoid sensitivity. We evaluated the roles of one gene, PBX1, in neuroblastoma cell lines, including proliferation and differentiation. We evaluated PBX1 expression in primary human neuroblas- toma samples by qRT-PCR, and three independent clinical cohort microarray datasets. Results: We confirmed that induction of PBX1 expression, and no other TALE family genes, was associated with 13-cisRA responsiveness in neuroblastoma cell lines. Exogenous PBX1 expression in neuroblastoma cell lines, mimicking induced PBX1 expression, significantly impaired proliferation and anchorage-independent growth, and promoted RA-dependent and -independent differentiation. Reduced PBX1 protein levels produced an aggressive growth phenotype and RA resistance. PBX1 expression correlated with histologic neuroblastoma subtypes, with highest expression in benign ganglioneuromas and lowest in high-risk neuroblastomas. High PBX1 expression is prognostic of survival, including in multivariate analysis, in the three clinical cohorts. Conclusions: PBX1 is an essential regulator of differentiation in neuroblastoma and potentiates retinoid- induced differentiation. Neuroblastoma cells and tumors with low PBX1 expression have an immature phenotype with poorer prognosis, independent of other risk factors. Clin Cancer Res; 20(16); 1–13. Ó2014 AACR. Introduction sents numerous therapeutic challenges. Infant patients Neuroblastoma is the most common extracranial pedi- commonly present with low-grade disease, often with atric solid tumor, representing 8% of childhood cancer spontaneous regression, and some patients are managed diagnoses but 15% of childhood cancer-related deaths expectantly with observation never requiring surgery (2). (1). The diverse clinical spectrum of neuroblastoma pre- However, there are no validated biomarkers to predict which patients can be safely observed in contrast to those who would benefit from surgery and chemotherapy. Authors' Affiliations: 1Center for Childhood Cancer and Blood Diseases, In contrast, >40% of patients present at diagnosis with The Research Institute of Nationwide Children's Hospital and The Ohio aggressive disease and distant metastases (1). Patients with State University College of Medicine, Columbus, Ohio; 2Oncogenomics Section, Advanced Technology Center, Pediatric Oncology Branch, Center high-risk disease receive multiagent chemotherapy, surgery, for Cancer Research, National Cancer Institute, NIH, Gaithersburg, Mary- high-dose chemotherapy with autologous hematopoietic land; 3Department of Oncology, Lombardi Comprehensive Cancer Center; and 4Department of Biostatistics, Bioinformatics and Biomathematics, stem cell rescue (HDC-aHSCR), radiotherapy, immuno- Georgetown University, Washington, D.C. therapy with chimeric anti-GD2 antibody ch14.18, IL2, cis Note: Supplementary data for this article are available at Clinical Cancer and GM-CSF, and the differentiation agent 13- retinoic Research Online (http://clincancerres.aacrjournals.org/). acid (13-cisRA). Despite intensive treatment and improved Corresponding Author: Nilay Shah, Nationwide Children's Hospital, 700 responses with the introduction of immunotherapy (3), up Children's Drive, RBII WA4023, Columbus, OH 43205. Phone: 614-722- to 40% of high-risk patient tumors progress during induc- 2876; Fax: 614-355-5895; E-mail: [email protected] tion chemotherapy (4) and 5-year disease-free survival doi: 10.1158/1078-0432.CCR-13-1486 remains <50% (5). Identification of MYCN amplification Ó2014 American Association for Cancer Research. as a prognostic biomarker of aggressive disease radically www.aacrjournals.org OF1 Downloaded from clincancerres.aacrjournals.org on September 29, 2021. © 2014 American Association for Cancer Research. Published OnlineFirst June 19, 2014; DOI: 10.1158/1078-0432.CCR-13-1486 Shah et al. tissue. These varying but important roles make it critical to Translational Relevance evaluate these genes specifically in neuroblastoma to define Neuroblastoma arises from neural crest progenitor their roles in oncogenesis. cells, but the errors in differentiation that drive tumor- Here, we perform the first comprehensive analysis of igenesis remain cryptic. We identify PBX1 as a putative TALE family gene expression in neuroblastoma. We dem- critical regulator of differentiation in neuroblastoma. onstrate that, among TALE family genes, only PBX1 expres- Clinically, neuroblastoma presents diversely in children. sion is associated with responsiveness to 13-cisRA in neu- The majority of tumors in infants undergo spontaneous roblastoma. We confirm that PBX1 induces neuronal dif- involution or differentiation, but some patients require ferentiation and increases sensitivity to 13-cisRA. Further- chemotherapy to be cured. Most patients greater than 18 more, we show that PBX1 expression is directly associated months old, in contrast, present with high-risk meta- with decreased proliferation independently of 13-cisRA. static disease. Some patients benefit from multimodal Finally, we demonstrate that PBX1 expression in primary treatment including 13-cisRA, but there are no clinically human tumors is associated with low tumor grade and validated biomarkers that predict benefit for high-risk patient survival. PBX1 expression may thus serve as a bio- patients. Patient tumors with low PBX1 expression may marker in low-risk disease by identifying patients who may indicate more aggressive disease in both low-risk and be observed without intervention. In high-risk disease, high-risk neuroblastoma. Our work supports validation PBX1 may stratify those patients for whom current therapies of PBX1 expression as a risk factor for treatment strati- are ineffective, directing them to novel therapies. fication in patients with low-risk and high-risk neuro- blastoma, and also supports further studies into the Materials and Methods PBX1 regulation of and targeted therapeutics for treat- Cell lines ment-resistant disease. Cell lines SK-N-SH, LAN-5, IMR-32, SK-N-BE (2), and SK- N-RA were obtained from Javed Khan; SMS-KAN and SMS- KANR from Joanna Kitlinska [via Children’s Oncology Group (COG) MTA with Georgetown University, Washing- improved risk stratification and treatment of neuroblasto- ton, D.C.]; NBL-WS and LAI-5S from Susan Cohn (Univer- ma (6). Since the seminal discovery of MYCN, additional sity of Chicago, Chicago, IL); SHSY5Y from ATCC; CHLA- clinical and genetic biomarkers have been identified, but 15, CHLA-42, CHLA-90, CHLA-136, and LAN-6 from COG connection of these factors to neuroblastoma biology or Cell Culture Repository; and HEK293 T from OpenBioSys- tumor aggression remains cryptic, particularly in tumors tems. All were previously characterized (22–28). A table of without MYCN amplification (7, 8). the MYCN status of each cell line is in the Supplementary Neuroblastoma is a prototypic embryonic cancer with Methods. CHLA-15, CHLA-42, CHLA-136, and CHLA-90 demonstrated aberrations in normal developmental path- were grown in Iscove’s modified Dulbecco’s medium with ways (9, 10). The HOX genes are master regulators of 20% FBS (Hyclone) and 0.1% insulin, transferrin, and development in animals; select HOX gene expression, selenium (Corning). All other cell lines were grown in RPMI including HOXC6 and HOXC9, has been associated with with 10% FBS. All parental and modulated cell lines were neuroblastoma differentiation, response to 13-cisRA, and tested and authenticated by PowerPlex16 short tandem outcome (11, 12). HOX proteins critically interact with repeat (STR) analysis (Promega) by the Nucleic Acids Core cofactors, including members of the three–amino-acid loop laboratory at Nationwide Children’s Hospital (NCH), last extension (TALE) gene family. The TALE family genes in December 2013, and January 2014. Note that the SK-N- (PBX1-4, MEIS1-3, and PKOX1-2), like HOX genes, are RA cell line was initially labeled as SK-N-AS when received, critical to tissue differentiation (13), including retinoid- but has been characterized by STR analysis to be the SK-N- induced differentiation (14). Expression of PBX1-3 is reg- RA cell line, including aliquots of the original cell line ulated by retinoids in other cell types (15) and has been received from the Khan lab, all generated modulated cell shown to direct endogenous retinoid synthesis within the lines, and the aliquots of the cell lines at the end of the nervous system (16). A comprehensive study of the expres- studies. Dr. Khan’s lab has confirmed that the cell line
Load more

Recommended publications
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • UNIVERSITY of CALIFORNIA, IRVINE Combinatorial Regulation By
    UNIVERSITY OF CALIFORNIA, IRVINE Combinatorial regulation by maternal transcription factors during activation of the endoderm gene regulatory network DISSERTATION submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biological Sciences by Kitt D. Paraiso Dissertation Committee: Professor Ken W.Y. Cho, Chair Associate Professor Olivier Cinquin Professor Thomas Schilling 2018 Chapter 4 © 2017 Elsevier Ltd. © 2018 Kitt D. Paraiso DEDICATION To the incredibly intelligent and talented people, who in one way or another, helped complete this thesis. ii TABLE OF CONTENTS Page LIST OF FIGURES vii LIST OF TABLES ix LIST OF ABBREVIATIONS X ACKNOWLEDGEMENTS xi CURRICULUM VITAE xii ABSTRACT OF THE DISSERTATION xiv CHAPTER 1: Maternal transcription factors during early endoderm formation in 1 Xenopus Transcription factors co-regulate in a cell type-specific manner 2 Otx1 is expressed in a variety of cell lineages 4 Maternal otx1 in the endodermal conteXt 5 Establishment of enhancers by maternal transcription factors 9 Uncovering the endodermal gene regulatory network 12 Zygotic genome activation and temporal control of gene eXpression 14 The role of maternal transcription factors in early development 18 References 19 CHAPTER 2: Assembly of maternal transcription factors initiates the emergence 26 of tissue-specific zygotic cis-regulatory regions Introduction 28 Identification of maternal vegetally-localized transcription factors 31 Vegt and OtX1 combinatorially regulate the endodermal 33 transcriptome iii
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Large Scale Transgenic and Cluster Deletion Analysis of the Hoxd Complex Separate an Ancestral Regulatory Module from Evolutionary Innovations
    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION where groups of genes acquired shared enhancer se- Large scale transgenic and quences acting independently of colinearity. For in- cluster deletion analysis of the stance, the early phase of Hoxd gene expression in limb buds is regulated in a colinear fashion, whereas expres- HoxD complexseparate an sion of the same genes in digits is concurrent, rather than ancestral regulatory module colinear (Nelson et al. 1996). In the HoxD complex, gene recruitment involved in from evolutionary innovations many instances the design of potent enhancer sequences, which regulate several genes at once. We proposed ear- François Spitz,1 Federico Gonzalez,1 lier that expression of four genes in developing digits was Catherine Peichel,2,3 Thomas F. Vogt,2,4 controlled by a unique enhancer that displays poor pro- Denis Duboule,1,5 and József Zákány1 moter specificity as it influenced foreign promoters when targeted to the locus (van der Hoeven et al. 1996; 1Department of Zoology and Animal Biology, University Hérault et al. 1999). Targeted deletions in the posterior of Geneva, Sciences III, 1211 Geneva 4, Switzerland; HoxD complex placed this enhancer somewhere up- 2Department of Molecular Biology, Princeton University, stream of Evx2, outside the cluster (Kondo and Duboule Princeton, New Jersey 08544, USA 1999). Likewise, several genes respond to a gut enhancer sequence that is required to form the ileo-coecal sphinc- The ancestral role of the Hox gene family is specifying ter (Zakany and Duboule 1999) and is localized either in morphogenetic differences along the main body axis.
    [Show full text]
  • 1 Single-Cell Mrna Profiling Reveals Heterogeneous
    bioRxiv preprint doi: https://doi.org/10.1101/327619; this version posted May 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Single-cell mRNA profiling reveals heterogeneous combinatorial expression of Hoxd genes during limb development Short title: Single-cell Hox combinations in developing limbs Authors : P. J. Fabre1,4,*, M. Leleu1, B. Mascrez2, Q. Lo Giudice4, J. Cobb3 and D. Duboule1,2,* Affiliations: 1School of Life Sciences, Ecole Polytechnique Fédérale, Lausanne, 1015 Lausanne, Switzerland. 2Department of Genetics and Evolution, University of Geneva, 1211 Geneva 4, Switzerland. 3Department of Biological Sciences, University of Calgary, Calgary, Canada. 4Department of Basic Neurosciences, University of Geneva, 1205 Geneva, Switzerland. KEYWORDS: Hox genes, digits, limb, development, enhancers, single-cell, transcriptome, differentiation, gene expression. *Corresponding authors: Pierre Fabre ([email protected]) and Denis Duboule ([email protected]) HIGHLIGHTS • Collinear expression of Hox genes is only weaved at the tissue scale • Enhancer-sharing to specific target genes is reduced at the single-cell level • Hoxd gene combinatorial expression is linked to distinct transcriptional signatures • In presumptive digits, Hoxd combinations follow a pseudotime trajectory 1 bioRxiv preprint doi: https://doi.org/10.1101/327619; this version posted May 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
    [Show full text]
  • Role of HOX Genes in Stem Cell Differentiation and Cancer
    Thomas Jefferson University Jefferson Digital Commons Kimmel Cancer Center Papers, Presentations, and Grand Rounds Kimmel Cancer Center 7-22-2018 Role of HOX Genes in Stem Cell Differentiation and Cancer. Seema Bhatlekar Helen F. Graham Cancer Center and Research Institute; University of Delaware Jeremy Z Fields CATX Inc. Bruce M. Boman Thomas Jefferson University; Helen F. Graham Cancer Center and Research Institute; University of Delaware; CATX Inc. Follow this and additional works at: https://jdc.jefferson.edu/kimmelgrandrounds Part of the Oncology Commons Let us know how access to this document benefits ouy Recommended Citation Bhatlekar, Seema; Fields, Jeremy Z; and Boman, Bruce M., "Role of HOX Genes in Stem Cell Differentiation and Cancer." (2018). Kimmel Cancer Center Papers, Presentations, and Grand Rounds. Paper 62. https://jdc.jefferson.edu/kimmelgrandrounds/62 This Article is brought to you for free and open access by the Jefferson Digital Commons. The Jefferson Digital Commons is a service of Thomas Jefferson University's Center for Teaching and Learning (CTL). The Commons is a showcase for Jefferson books and journals, peer-reviewed scholarly publications, unique historical collections from the University archives, and teaching tools. The Jefferson Digital Commons allows researchers and interested readers anywhere in the world to learn about and keep up to date with Jefferson scholarship. This article has been accepted for inclusion in Kimmel Cancer Center Papers, Presentations, and Grand Rounds by an authorized administrator of the Jefferson Digital Commons. For more information, please contact: [email protected]. Hindawi Stem Cells International Volume 2018, Article ID 3569493, 15 pages https://doi.org/10.1155/2018/3569493 Review Article Role of HOX Genes in Stem Cell Differentiation and Cancer 1,2 3 1,2,3,4 Seema Bhatlekar , Jeremy Z.
    [Show full text]
  • Gene Networks Activated by Specific Patterns of Action Potentials in Dorsal Root Ganglia Neurons Received: 10 August 2016 Philip R
    www.nature.com/scientificreports OPEN Gene networks activated by specific patterns of action potentials in dorsal root ganglia neurons Received: 10 August 2016 Philip R. Lee1,*, Jonathan E. Cohen1,*, Dumitru A. Iacobas2,3, Sanda Iacobas2 & Accepted: 23 January 2017 R. Douglas Fields1 Published: 03 March 2017 Gene regulatory networks underlie the long-term changes in cell specification, growth of synaptic connections, and adaptation that occur throughout neonatal and postnatal life. Here we show that the transcriptional response in neurons is exquisitely sensitive to the temporal nature of action potential firing patterns. Neurons were electrically stimulated with the same number of action potentials, but with different inter-burst intervals. We found that these subtle alterations in the timing of action potential firing differentially regulates hundreds of genes, across many functional categories, through the activation or repression of distinct transcriptional networks. Our results demonstrate that the transcriptional response in neurons to environmental stimuli, coded in the pattern of action potential firing, can be very sensitive to the temporal nature of action potential delivery rather than the intensity of stimulation or the total number of action potentials delivered. These data identify temporal kinetics of action potential firing as critical components regulating intracellular signalling pathways and gene expression in neurons to extracellular cues during early development and throughout life. Adaptation in the nervous system in response to external stimuli requires synthesis of new gene products in order to elicit long lasting changes in processes such as development, response to injury, learning, and memory1. Information in the environment is coded in the pattern of action-potential firing, therefore gene transcription must be regulated by the pattern of neuronal firing.
    [Show full text]
  • Comprehensive Epigenome Characterization Reveals Diverse Transcriptional Regulation Across Human Vascular Endothelial Cells
    Nakato et al. Epigenetics & Chromatin (2019) 12:77 https://doi.org/10.1186/s13072-019-0319-0 Epigenetics & Chromatin RESEARCH Open Access Comprehensive epigenome characterization reveals diverse transcriptional regulation across human vascular endothelial cells Ryuichiro Nakato1,2† , Youichiro Wada2,3*†, Ryo Nakaki4, Genta Nagae2,4, Yuki Katou5, Shuichi Tsutsumi4, Natsu Nakajima1, Hiroshi Fukuhara6, Atsushi Iguchi7, Takahide Kohro8, Yasuharu Kanki2,3, Yutaka Saito2,9,10, Mika Kobayashi3, Akashi Izumi‑Taguchi3, Naoki Osato2,4, Kenji Tatsuno4, Asuka Kamio4, Yoko Hayashi‑Takanaka2,11, Hiromi Wada3,12, Shinzo Ohta12, Masanori Aikawa13, Hiroyuki Nakajima7, Masaki Nakamura6, Rebecca C. McGee14, Kyle W. Heppner14, Tatsuo Kawakatsu15, Michiru Genno15, Hiroshi Yanase15, Haruki Kume6, Takaaki Senbonmatsu16, Yukio Homma6, Shigeyuki Nishimura16, Toutai Mitsuyama2,9, Hiroyuki Aburatani2,4, Hiroshi Kimura2,11,17* and Katsuhiko Shirahige2,5* Abstract Background: Endothelial cells (ECs) make up the innermost layer throughout the entire vasculature. Their phe‑ notypes and physiological functions are initially regulated by developmental signals and extracellular stimuli. The underlying molecular mechanisms responsible for the diverse phenotypes of ECs from diferent organs are not well understood. Results: To characterize the transcriptomic and epigenomic landscape in the vascular system, we cataloged gene expression and active histone marks in nine types of human ECs (generating 148 genome‑wide datasets) and carried out a comprehensive analysis with chromatin interaction data. We developed a robust procedure for comparative epigenome analysis that circumvents variations at the level of the individual and technical noise derived from sample preparation under various conditions. Through this approach, we identifed 3765 EC‑specifc enhancers, some of which were associated with disease‑associated genetic variations.
    [Show full text]
  • Targeting HOX/PBX Dimers in Cancer
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 19), pp: 32322-32331 Review Targeting HOX/PBX dimers in cancer Richard Morgan1, Mohamed El-Tanani1, Keith D. Hunter2, Kevin J. Harrington3 and Hardev S. Pandha4 1 Institute of Cancer Therapeutics, Faculty of Life Sciences, University of Bradford, Bradford, UK 2 Unit of Oral and Maxillofacial Pathology, School of Clinical Dentistry, University of Sheffield, Sheffield, UK 3 Targeted Therapy Team, Chester Beatty Laboratories, The Institute of Cancer Research, London, UK 4 Faculty of Health and Medical Sciences, University of Surrey, Guildford, UK Correspondence to: Richard Morgan, email: [email protected] Keywords: HOX, PBX, HXR9, targeted therapy, biomarker Received: December 08, 2016 Accepted: February 23, 2017 Published: March 07, 2017 Copyright: Morgan et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT The HOX and PBX gene families encode transcription factors that have key roles in establishing the identity of cells and tissues in early development. Over the last 20 years it has become apparent that they are also dysregulated in a wide range of solid and haematological malignancies and have a predominantly pro-oncogenic function. A key mode of transcriptional regulation by HOX and PBX proteins is through their interaction as a heterodimer or larger complex that enhances their binding affinity and specificity for DNA, and there is growing evidence that this interaction is a potential therapeutic target in malignancies that include prostate, breast, renal, ovarian and lung cancer, melanoma, myeloma, and acute myeloid leukaemia.
    [Show full text]
  • BMC Biology Biomed Central
    BMC Biology BioMed Central Research article Open Access Classification and nomenclature of all human homeobox genes PeterWHHolland*†1, H Anne F Booth†1 and Elspeth A Bruford2 Address: 1Department of Zoology, University of Oxford, South Parks Road, Oxford, OX1 3PS, UK and 2HUGO Gene Nomenclature Committee, European Bioinformatics Institute (EMBL-EBI), Wellcome Trust Genome Campus, Hinxton, Cambridgeshire, CB10 1SA, UK Email: Peter WH Holland* - [email protected]; H Anne F Booth - [email protected]; Elspeth A Bruford - [email protected] * Corresponding author †Equal contributors Published: 26 October 2007 Received: 30 March 2007 Accepted: 26 October 2007 BMC Biology 2007, 5:47 doi:10.1186/1741-7007-5-47 This article is available from: http://www.biomedcentral.com/1741-7007/5/47 © 2007 Holland et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: The homeobox genes are a large and diverse group of genes, many of which play important roles in the embryonic development of animals. Increasingly, homeobox genes are being compared between genomes in an attempt to understand the evolution of animal development. Despite their importance, the full diversity of human homeobox genes has not previously been described. Results: We have identified all homeobox genes and pseudogenes in the euchromatic regions of the human genome, finding many unannotated, incorrectly annotated, unnamed, misnamed or misclassified genes and pseudogenes.
    [Show full text]
  • Control of Growth and Gut Maturation by Hoxd Genes and the Associated
    Control of growth and gut maturation by HoxD genes PNAS PLUS and the associated lncRNA Haglr Jozsef Zakanya, Fabrice Darbellayb, Bénédicte Mascreza, Anamaria Necsuleab,1, and Denis Duboulea,b,2 aDepartment of Genetics and Evolution, University of Geneva, 1211 Geneva 4, Switzerland; and bSchool of Life Sciences, Federal Institute of Technology, Lausanne (EPFL), 1015 Lausanne, Switzerland Contributed by Denis Duboule, September 21, 2017 (sent for review July 13, 2017; reviewed by Nicoletta Bobola and Natasza Kurpios) During embryonic development, Hox genes participate in the build- side (9), emphasizing a potential link between growth retardation ing of a functional digestive system in metazoans, and genetic con- and alterations in gut development. ditions involving these genes lead to important, sometimes lethal, In this study, we tried to find a common explanatory frame- growth retardation. Recently, this phenotype was obtained after work for the various cases described above. We decided to deletion of Haglr,theHoxd antisense growth-associated long non- complete the allelic series with a few more mutant chromosomes coding RNA (lncRNA) located between Hoxd1 and Hoxd3. In this necessary to unambiguously interpret the previous observations study, we have analyzed the function of Hoxd genes in delayed relating phenotypes to particular genes. By using CRISPR/Cas9 growth trajectories by looking at several nested targeted defi- mutagenesis in embryo, we demonstrate that the growth-retardation – ciencies of the mouse HoxD cluster. Mutant pups were severely phenotype observed in HoxDDel(1 9) mice is caused by the dominant- stunted during the suckling period, but many recovered after wean- negative effect of the HOXD10 protein.
    [Show full text]