DOCSLIB.ORG

In Vitro Antifungal Activity of Organic Compounds Derived from Amino

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
In Vitro Antifungal Activity of Organic Compounds Derived from Amino b r a z i l i a n j o u r n a l o f m i c r o b i o l o g y 4 8 (2 0 1 7) 476–482 ht tp://www.bjmicrobiol.com.br/ Medical Microbiology In vitro antifungal activity of organic compounds derived from amino alcohols against onychomycosis a b a César Augusto Caneschi , Angelina Maria de Almeida , Francislene Juliana Martins , b c d Mireille Le Hyaric , Manoel Marques Evangelista Oliveira , Gilson Costa Macedo , b a,∗ Mauro Vieira de Almeida , Nádia Rezende Barbosa Raposo a Universidade Federal de Juiz de Fora, Faculdade de Farmácia, Núcleo de Pesquisa e Inovac¸ão em Ciências da Saúde (NUPICS), Juiz de Fora, MG, Brazil b Universidade Federal de Juiz de Fora, Instituto de Ciências Exatas, Departamento de Química, Juiz de Fora, MG, Brazil c Fundac¸ão Oswaldo Cruz, Instituto Nacional de Infectologia Evandro Chagas, Laboratório de Micologia, Rio de Janeiro, RJ, Brazil d Universidade Federal de Juiz de Fora, Instituto de Ciências Biológicas, Departamento de Parasitologia, Microbiologia e Imunologia, Juiz de Fora, MG, Brazil a r t i c l e i n f o a b s t r a c t Article history: Onychomycosis is a fungal infection of the nail caused by high densities of filamentous Received 18 August 2016 fungi and yeasts. Treatment for this illness is long-term, and recurrences are frequently Accepted 7 December 2016 detected. This study evaluated in vitro antifungal activities of 12 organic compounds derived Available online 9 February 2017 from amino alcohols against standard fungal strains, such as Trichophyton rubrum CCT Associate Editor: Luis Henrique 5507 URM 1666, Trichophyton mentagrophytes ATCC 11481, and Candida albicans ATCC 10231. Souza Guimarães The antifungal compounds were synthesized from p-hydroxybenzaldehyde (4a–4f) and p- hydroxybenzoic acid (9a–9f). Minimum inhibitory concentrations and minimum fungicidal Keywords: concentrations were determined according to Clinical and Laboratory Standards Institute protocols M38-A2, M27-A3, and M27-S4. The amine series 4b–4e, mainly 4c and 4e com- Amino alcohols ␮ Amides pounds, were effective against filamentous fungi and yeast (MIC from 7.8 to 312 g/mL). On Lipophilicity the other hand, the amide series (9a–9f) did not present inhibitory effect against fungi, except amide 9c, which demonstrated activity only against C. albicans. This allowed us to infer that Antifungal activity Onychomycosis the presence of amine group and intermediate carbon number (8C–11C) in its aliphatic side chain seems to be important for antifungal activity. Although these compounds present cytotoxic activity on macrophages J774, our results suggest that these aromatic compounds might constitute potential as leader molecules in the development of more effective and less toxic analogs that could have considerable implications for future therapies of ony- chomycosis. © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/ licenses/by-nc-nd/4.0/). ∗ Corresponding author. E-mail: [email protected] (N.R. Raposo). http://dx.doi.org/10.1016/j.bjm.2016.12.008 1517-8382/© 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). b r a z i l i a n j o u r n a l o f m i c r o b i o l o g y 4 8 (2 0 1 7) 476–482 477 29–32 and immunological activities against Trypanosoma cruzi. Introduction Thus, the present study evaluated the antifungal activities of amphiphilic aromatic amino alcohols and amides against Onychomycosis is a fungal infection of the nails caused 1–5 different strains of fungi associated with onychomycosis. by dermatophytic fungi and yeasts. The main etiological 6,7 agents are Trichophyton, Epidermophyton, and Candida fungi. Onychomycosis is an emerging global health problem, as it Materials and methods 1,8,9 represents 50% of nail disorders and affects 2–9% of the 2,10 world population. This pathological condition affects qual- Chemistry ity of life, with loss of the patient self-esteem and may result 2,11,12 in physical, occupational, and social limitations. Amino alcohols 4a–4f were synthesized from p- Notable among the main factors related to onychomyco- hydroxybenzaldehyde 1, as described previously by Almeida sis are humidity, wearing closed shoes, repetitive nail trauma, et al. (2013) and amides 9a–9f were synthesized from 29 genetic predisposition, and chronic diseases, such as dia- p-hydroxybenzoic acid 5. Briefly, compound 1 was 2,10,13–16 betes, HIV, and immunosenescence. Moreover, the previously O-alkylated and then submitted to a direct main etiological agents of onychomycosis in infected areas reductive amination reaction in the presence of 2-amino-2- are Trichophyton rubrum (60%), Trichophyton mentagrophytes hydroxymethyl-propane-1,3-diol (Tris), resulting in targeted (20%), Epidermophyton floccosum (10%), and Candida albicans amino alcohols 4a–4f with 32–87% yield (Fig. 1). Amphiphilic 1–3,9 (5–10%). The T. mentagrophytes complex is particularly dif- aromatic amides 9a–9f was obtained from O-alkylated esters ficult to identify because of the morphological features and 7a–7f prepared from carboxylic acid 5. After hydrolysis of the the inter-specific relationships within this group are unclear, ethyl ester, the carboxyl group was converted to acyl chloride 17 requiring molecular tools to identify species in this complex. and treated with Tris, resulting in the desired amides (Fig. 2). Despite recent advances in medicine, treating ony- chomycosis remains challenging due to the anatomical Fungal strains characteristics of nails and the poor efficacy of currently avail- 1,18–20 able treatments. Existing therapies for onychomycosis Experiments were conducted using T. rubrum CCT-5507 URM are only partially effective, and recurrence and consequent 1666 obtained from the Collection of Tropical Crops (CCT) pro- fungal resistance are common when combined with poor vided by the André Tosello Foundation (Campinas, São Paulo, 21–25 medication compliance. Furthermore, oral antifungal SP, Brazil), T. mentagrophytes ATCC 11481 and C. albicans ATCC drugs are associated with undesirable side effects, such 10231 from the American Type Culture Collection (ATCC) were 8,10,19 as hepatotoxicity. Therefore, new alternatives to pre- provided by the National Institute of Quality Control in Health- vent, diagnose, and treat onychomycosis are of utmost Oswaldo Cruz Foundation (Rio de Janeiro, RJ, Brazil). 26 importance. Thus, the discovery of novel antifungal com- pounds is urgently necessary to develop more effective, Molecular identification economical therapies with fewer side effects. Amine and amide groups are significant functional groups in medications Genomic DNA was extracted from T. mentagrophytes ATCC 27 due to their reactive and chemical properties, and these 11481 to identify the fungal strain complex. Partial sequenc- 28 groups comprise peptides found in various proteins. Our ing of the internal transcribed spacer (ITS) region was previous data show that amino alcohols have antimicrobial evaluated using ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 O O 1) K2CO 3 DMF, 70ºC H H 2) 0.5 eq KI H C(H C) 3 2 n O HO CH3(CH2)nX 1 2 a-f n=3,5,7,8,9,11,13 X=Cl, Br 1) 1 eq 2) 2 eq NaBH4 OH 3) HCI 4M OH refluxo 5h MeOHanid H2N OH 3 OH 4a: n=3 4b: n=7 OH 4c: n=8 N .HCI n=9 H OH 4d: H3C(H2C)n 4e: n=11 O 4f: n=13 4 a-f 29 Fig. 1 – Synthesis of the amine series adapted from Almeida et al. (2013). 478 b r a z i l i a n j o u r n a l o f m i c r o b i o l o g y 4 8 (2 0 1 7) 476–482 O O O H SO 2 4 1. K2CO3 OH OC2H5 OC2H5 EtOH, reflux 2. CH3(CH2)nCI,KI CH3(CH2)n HO HO DMF, 70ºC O 5 6 n=3,5,7,8,9,11 7 a-f 9a: n=3 9b: n=5 1. KOH,EtOH,reflux 9c: n=7 2. HCI 4M 9d: n=8 9e: n=9 9f: n=11 OH O O OH 1– Oxalyl chloride, toluene, 0ºC-r.t. N OH H CH (CH )n OH 2– Tris, K CO , DMA, 60ºC CH (CH )n 3 2 O 2 3 3 2 O 9 a-f 8 a-f 29 Fig. 2 – Synthesis of the amide series adapted from Almeida et al. (2013). 33 (TCCTCCGCTTATTGATATGC). Briefly, the conditions were buffered with MOPS, and tested for filamentous fungi at final ␮ ␮ 100 ng DNA, 10 pmol of each primer, and an annealing concentrations of 7.8–1000 g/mL and 39.06–5000 g/mL for ◦ ␮ temperature of 58 C. Automated sequencing was evaluated yeasts. Fungal growth was assessed by adding 100 L RPMI- using the Sequencing Platform at Fundac¸ão Oswaldo Cruz- 1640 culture medium buffered with MOPS containing the PDTIS/FIOCRUZ, Brazil. The sequences were edited using fungal inoculum. The fungi were homogenized for 2 min and ◦ ± Sequencher 4.9 software and compared with BLAST. The ITS incubated in a sterile 96-well plate at 28 2 C for seven days ◦ ± sequence isolated from T. mentagrophytes ATCC 11481 was (dermatophytes) or 37 2 C for 48 h (yeasts). The fungi were deposited in Genbank under accession number NCBI/GenBank analyzed visually using a SMZ800 microscope (Nikon, Melville, KX132909. This procedure was not necessary for other strains NY). Terbinafine, ketoconazole, and amphotericin B were used used herein because these standard strains have been inves- as reference drugs and assessed in accordance with the M38- 34,35 36 37 tigated recently by different authors, confirming the A2 and M27-A3 protocols.
Load more

Recommended publications
  • Chemical Chemical Hazard and Compatibility Information
    Chemical Chemical Hazard and Compatibility Information Acetic Acid HAZARDS & STORAGE: Corrosive and combustible liquid. Serious health hazard. Reacts with oxidizing and alkali materials. Keep above freezing point (62 degrees F) to avoid rupture of carboys and glass containers.. INCOMPATIBILITIES: 2-amino-ethanol, Acetaldehyde, Acetic anhydride, Acids, Alcohol, Amines, 2-Amino-ethanol, Ammonia, Ammonium nitrate, 5-Azidotetrazole, Bases, Bromine pentafluoride, Caustics (strong), Chlorosulfonic acid, Chromic Acid, Chromium trioxide, Chlorine trifluoride, Ethylene imine, Ethylene glycol, Ethylene diamine, Hydrogen cyanide, Hydrogen peroxide, Hydrogen sulfide, Hydroxyl compounds, Ketones, Nitric Acid, Oleum, Oxidizers (strong), P(OCN)3, Perchloric acid, Permanganates, Peroxides, Phenols, Phosphorus isocyanate, Phosphorus trichloride, Potassium hydroxide, Potassium permanganate, Potassium-tert-butoxide, Sodium hydroxide, Sodium peroxide, Sulfuric acid, n-Xylene. Acetone HAZARDS & STORAGE: Store in a cool, dry, well ventilated place. INCOMPATIBILITIES: Acids, Bromine trifluoride, Bromine, Bromoform, Carbon, Chloroform, Chromium oxide, Chromium trioxide, Chromyl chloride, Dioxygen difluoride, Fluorine oxide, Hydrogen peroxide, 2-Methyl-1,2-butadiene, NaOBr, Nitric acid, Nitrosyl chloride, Nitrosyl perchlorate, Nitryl perchlorate, NOCl, Oxidizing materials, Permonosulfuric acid, Peroxomonosulfuric acid, Potassium-tert-butoxide, Sulfur dichloride, Sulfuric acid, thio-Diglycol, Thiotrithiazyl perchlorate, Trichloromelamine, 2,4,6-Trichloro-1,3,5-triazine
    [Show full text]
  • Why Nature Chose Selenium Hans J
    Reviews pubs.acs.org/acschemicalbiology Why Nature Chose Selenium Hans J. Reich*, ‡ and Robert J. Hondal*,† † University of Vermont, Department of Biochemistry, 89 Beaumont Ave, Given Laboratory, Room B413, Burlington, Vermont 05405, United States ‡ University of WisconsinMadison, Department of Chemistry, 1101 University Avenue, Madison, Wisconsin 53706, United States ABSTRACT: The authors were asked by the Editors of ACS Chemical Biology to write an article titled “Why Nature Chose Selenium” for the occasion of the upcoming bicentennial of the discovery of selenium by the Swedish chemist Jöns Jacob Berzelius in 1817 and styled after the famous work of Frank Westheimer on the biological chemistry of phosphate [Westheimer, F. H. (1987) Why Nature Chose Phosphates, Science 235, 1173−1178]. This work gives a history of the important discoveries of the biological processes that selenium participates in, and a point-by-point comparison of the chemistry of selenium with the atom it replaces in biology, sulfur. This analysis shows that redox chemistry is the largest chemical difference between the two chalcogens. This difference is very large for both one-electron and two-electron redox reactions. Much of this difference is due to the inability of selenium to form π bonds of all types. The outer valence electrons of selenium are also more loosely held than those of sulfur. As a result, selenium is a better nucleophile and will react with reactive oxygen species faster than sulfur, but the resulting lack of π-bond character in the Se−O bond means that the Se-oxide can be much more readily reduced in comparison to S-oxides.
    [Show full text]
  • Explorative Application of Selenium Catalysts in the Oxidation of Benzyl Alcohol
    Explorative application of selenium catalysts in the oxidation of benzyl alcohol. Hanane Achibat,b Luca Sancineto,a Martina Palomba,a Laura Abenante,a Maria Teresa Sarro,a Mostafa Khouilib and Claudio Santi*a a Group of Catalysis and Organic Green Chemistry, Department of Pharmaceutical Sciences, University of Perugia, Via del Liceo 1, Perugia 06100, Italy – [email protected] b Laboratoire de Chimie Organique & Analytique, Université Sultan Moulay Slimane, Faculté des Sciences et Techniques, BP 523, 23000 Béni-Mellal (Morocco) Abstract: Oxidation mediated by hydrogen peroxide needs to be accelerate by approrpiate catalyst in order to be completed in a reasonable reaction time. As a part of our investigation in the use of organoselenium cataysts in bio-mimetic oxidative protocol we reported here some preliminary results on the oxidation of benzyl alcohol into the corresponding benzoic acid. Keywords: alcohol; oxidation; selenium; catalysis; carboxylic acids; hydrogen peroxide; green chemistry During the last years, some of us introduced the term “Bio-Logic-catalysis” to indicate the bioinspired use of organoselenium catalysts in some oxidation reactions (Fig. 1). These were effected using hydrogen peroxide as reactive species of oxygen, water as medium and seleninic acid as the catalyst involved in a mechanism that has been demonstrated to be very similar to that of the naturally occurring enzyme glutathione peroxidase.1 Following this protocol, the direct 1,2 dihydroxylation of olefins was carried out in appreciable yield and with a significant chemo and stereocontrol.2 Similarly, the oxidation of aldehydes to the corresponding carboxylic acids or esters can be easily achieved under mild conditions, which is normally associated to a high level of atom economy.3 1 C.
    [Show full text]
  • Parte Inicial Só Frente Tese
    UNIVERSIDADE FEDERAL DE SANTA MARIA CENTRO DE CIÊNCIAS NATURAIS E EXATAS PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS BIOLÓGICAS: BIOQUÍMICA TOXICOLÓGICA EFEITOS DE COMPOSTOS ORGÂNICOS DE SELÊNIO NA TOXICIDADE INDUZIDA POR METILMERCÚRIO: ESTUDOS IN VITRO. TESE DE DOUTORADO Daiane Francine Meinerz Santa Maria, RS, Brasil 2014 EFEITOS DE COMPOSTOS ORGÂNICOS DE SELÊNIO NA TOXICIDADE INDUZIDA POR METILMERCÚRIO: ESTUDOS IN VITRO . Daiane Francine Meinerz Tese apresentada ao programa de Pós-graduação em Ciências Biológicas: Bioquímica Toxicológica da Universidade Federal de Santa Maria (UFSM, RS), como requisito parcial para obtenção do grau de Doutora em Bioquímica Toxicológica Orientador: Prof. Dr. João Batista Teixeira da Rocha Co-orientador: Prof. Dr. Jeferson Luis Franco Santa Maria, RS, Brasil 2014 AGRADECIMENTOS Agradeço inicialmente aos meus pais, José e Marlene, pelo exemplo, amor e dedicação. A vocês que sempre me apoiaram em todas as minhas decisões e jamais mediram esforços para me ajudar. Também a minha irmãzinha querida, Daniele, que é minha conselheira e companheira para todas as horas. Está sempre disposta a me ajudar no que for preciso. Simplesmente melhor irmã do mundo. Ao meu noivo Maurício por todo carinho, apoio e amor e por estar sempre ao meu lado mesmo nas horas mais difíceis. Também à sua família, pelo apoio e presença em minha vida. Ao meu orientador João Batista Teixeira da Rocha por me ensinar que dedicação e esforço valem a pena. Obrigada por toda compreensão que tens tido comigo. Admiro-te pela sabedoria, dedicação e competência. Ao meu co-orientador Jeferson L. Franco pela amizade e paciência. Obrigada por estar sempre disposto a me ajudar e pela dedicação ao meu trabalho.
    [Show full text]
  • Proceedings of the Indiana Academy of Science
    : Organic Compounds op Selenium 165 I. ORGANIC COMPOUNDS OF SELENIUM W. E. Bradt and M. Van Valkenhurgh, University of Cincinnati Introduction. Because selenium and some of its compounds are now- available in considerable amounts at reasonable prices, the investigation of the preparation and properties of organic selenium compounds is quite feasible. In order to further this work, the senior author plans a series of papers which, when completed, will present: (a) a classification of the known organic selenium compounds based on the analogous oxygen and sulphur types, (b) a complete list of all known organic selenium compounds, (c) a resume of the chemistry and methods of preparation developed for each class of compounds, and (d) a com- plete bibliography for each known organic selenium compound. The physiological action of some of the more common inorganic selenium compounds is well known. Many organic selenium compounds are reported to exhibit valuable therapeutic and tinctorial properties. However, the investigation of these properties has been so incomplete that organic compounds of selenium are still only of scientific interest. It is hoped that a systematic presentation of the chemistry of organic selenium compounds, with a statement of the extent of the synthetic work accomplished to date, will create interest in developing the possibilities of service to mankind (dyes, medicinals etc.), which probably exist in this field. Investigation in this direction lends itself particularly to the worker who has available only limited equipment. The reactions can usually be conducted in apparatus which is always available or which may be easily prepared. Aliphatic Selenols In this group will be discussed compounds, represented by the following formulas, in which "R" is a methyl group, the hydrogen atoms of which may or may not be replaced by other groups.
    [Show full text]
  • Studies Related to Tue Synthesis of Tetracycline
    STUDIES RELATED TO TUE SYNTHESIS OF TETRACYCLINE a thesis presented by • MOSHE NATHAN ROSENFELD in partial fulfilment of the requirements for the award of the degree of DOCTOR OF PHILOSOPHY OF THE UNIVERSITY OF LONDON WHIFFEN LABORATORY, CHEMISTRY DEPARTMENT, IMPERIAL COLLEGE, LONDON SW7 2AY. AUGUST, 1976, nwp,To N1M nwyaw nnl , evnlw xln 'Into nn .ynyn nnn win 12a TInl nIn1710 ell 'n7 win vin nT MR1 'IDIOT nal r21 .1313m'7n 'In 172N (1—n I n Onp) That which hath been, is that which shall be , And that which hath been done,is that which shall be done, And there is nothing new under the sun . Is There a thing, whereof it is said:'see this is new' , It hath been already in the ages, which were before us . (Liber Ecclesiastae 1,9-11) 3. ACKNOWLEDGEMENTS I thank Professor Sir Derek Barton, F.R.S., for the opportunity of working with him and for his encouragement, guidance and tolerance throughout the course of this work. My colleagues in the Whiffen Laboratory, especially Dr. S.V.Ley„ are warmly thanked for their assistance and friendship at all times. Mr. K.I.Jones and his staff are thanked for their excellent analytical service, Mrs. Lee for the mass spectra, and Dr. L.Phillips and his team for the 13C n.m.r. spectra. Technical assistance from Mr. R.Carter, Mr. A.Ellis, and Mr. T. Adey was greatly appreciated, as was the kindness and co-operation of Mrs. Day in the 'Organic Stores'. I wish to express my thanks to the Wellcome Trust for the award of a Fellowship for the period of this research.
    [Show full text]
  • Selenium Redox Biochemistry of Zinc–Sulfur Coordination Sites in Proteins and Enzymes
    Proc. Natl. Acad. Sci. USA Vol. 96, pp. 1910–1914, March 1999 Biochemistry Selenium redox biochemistry of zinc–sulfur coordination sites in proteins and enzymes CLAUS JACOB,WOLFGANG MARET, AND BERT L. VALLEE* Center for Biochemical and Biophysical Sciences and Medicine, Harvard Medical School, Seeley G. Mudd Building, 250 Longwood Avenue, Boston, MA 02115 Contributed by Bert L. Vallee, December 31, 1998 ABSTRACT Selenium has been increasingly recognized pounds can oxidize thiols under reducing conditions such as as an essential element in biology and medicine. Its biochem- those found in the cytosol. Selenium compounds are redox istry resembles that of sulfur, yet differs from it by virtue of fined-tuned owing to the many different oxidation states of both redox potentials and stabilities of its oxidation states. selenium as well as the protein environment in which the Selenium can substitute for the more ubiquitous sulfur of element resides and in which it is found catalytically active in cysteine and as such plays an important role in more than a peroxidative reactions (6), thiolydisulfide interchange (7), and dozen selenoproteins. We have chosen to examine zinc–sulfur reduction of cytochrome c (8) or molecular oxygen to super- centers as possible targets of selenium redox biochemistry. oxide (9) by thiols. These multiple catalytic potentials may be Selenium compounds release zinc from zincythiolate- among the reasons that selenium compounds are so effective coordination environments, thereby affecting the cellular thiol while acting at concentrations much lower than the corre- redox state and the distribution of zinc and likely of other sponding sulfur analogues. metal ions.
    [Show full text]
  • Enzymatic Reactions Involving the Heteroatoms from Organic Substrates
    Anais da Academia Brasileira de Ciências (2018) 90(1 Suppl. 1): 943-992 (Annals of the Brazilian Academy of Sciences) Printed version ISSN 0001-3765 / Online version ISSN 1678-2690 http://dx.doi.org/10.1590/0001-3765201820170741 www.scielo.br/aabc | www.fb.com/aabcjournal Enzymatic reactions involving the heteroatoms from organic substrates CATERINA G.C. MARQUES NETTO1,2, DAYVSON J. PALMEIRA1, PATRÍCIA B. BRONDANI3 and LEANDRO H. ANDRADE1 1Departamento de Química Fundamental, Universidade de São Paulo, Avenida Prof. Lineu Prestes, 748, 05508-000 São Paulo, SP, Brazil 2Departamento de Química, Universidade Federal de São Carlos, Rodovia Washington Luis, s/n, Km 235, 13565-905 São Carlos, SP, Brazil 3Departamento de Ciências Exatas e Educação, Universidade Federal de Santa Catarina, Rua João Pessoa, 2750, 89036-256 Blumenau, SC, Brazil Manuscript received on September 20, 2017; accepted for publication on January 1, 2018 ABSTRACT Several enzymatic reactions of heteroatom-containing compounds have been explored as unnatural substrates. Considerable advances related to the search for efficient enzymatic systems able to support a broader substrate scope with high catalytic performance are described in the literature. These reports include mainly native and mutated enzymes and whole cells biocatalysis. Herein, we describe the historical background along with the progress of biocatalyzed reactions involving the heteroatom(S, Se, B, P and Si) from hetero-organic substrates. Key words: heteroatom, biocatalysis, enzymes, biotransformation. INTRODUCTION see: Gao et al. 2015, Applegate and Berkowitz 2015, Guan et al. 2015, Wallace and Balskus 2014, Enzymes act as Nature’s machinery to obtain Anobom et al. 2014, Fesko and Gruber-Khadjawi new molecules through energetically favorable 2013, Matsuda 2013) or organometallic protocols reactions.
    [Show full text]
  • Selenoxide Elimination Triggers Enamine Hydrolysis to Primary and Secondary Amines: a Combined Experimental and Theoretical Investigation
    molecules Article Selenoxide Elimination Triggers Enamine Hydrolysis to Primary and Secondary Amines: A Combined Experimental and Theoretical Investigation Giovanni Ribaudo 1 , Marco Bortoli 2,3 , Erika Oselladore 1, Alberto Ongaro 1 , Alessandra Gianoncelli 1 , Giuseppe Zagotto 4 and Laura Orian 2,* 1 Dipartimento di Medicina Molecolare e Traslazionale, Università degli Studi di Brescia, Viale Europa 11, 25123 Brescia, Italy; [email protected] (G.R.); [email protected] (E.O.); [email protected] (A.O.); [email protected] (A.G.) 2 Dipartimento di Scienze Chimiche, Università degli Studi di Padova, Via Marzolo 1, 35131 Padova, Italy; [email protected] 3 Departament de Química, Institut de Química Computacional i Catàlisi, Universitat de Girona, C/M.A. Capmany 69, 17003 Girona, Spain 4 Dipartimento di Scienze del Farmaco, Università degli Studi di Padova, Via Marzolo 5, 35131 Padova, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-049-8275140 Abstract: We discuss a novel selenium-based reaction mechanism consisting in a selenoxide elimination- triggered enamine hydrolysis. This one-pot model reaction was studied for a set of substrates. Under oxidative conditions, we observed and characterized the formation of primary and secondary amines Citation: Ribaudo, G.; Bortoli, M.; as elimination products of such compounds, paving the way for a novel strategy to selectively release Oselladore, E.; Ongaro, A.; bioactive molecules. The underlying mechanism was investigated using NMR, mass spectrometry Gianoncelli, A.; Zagotto, G.; Orian, L. and density functional theory (DFT). Selenoxide Elimination Triggers Enamine Hydrolysis to Primary and Keywords: selenoxide elimination; one-pot; imine-enamine; reaction mechanism; DFT calcula- Secondary Amines: A Combined Experimental and Theoretical tions; selenium Investigation.
    [Show full text]
  • Communtcattonsn .*
    J. Org. Chem. 1988,53, 2389-2390 2389 CommuntcattonsN .* Organoselenium Chemistry. Preparation and The selenenic acid la was prepared by hydrolysis of the Reactions of 2,4,6-Tri-tert-butylbenzeneselenenic ester lb in aqueous acetonitrile, acetone, or THF (Figure Acid The reaction was monitored by both 'H and I7Se NMR which initially showed formation of methanol and Summary: The preparation and chemistry of 2,4,6-tri- la followed by buildup of the disproportionation products tert-butylbenzeneselenenic acid and several of its esters diselenide 5 and seleninic acid 2a. Under optimum con- and amides are described. ditions as much as 80% of selenenic acid la was present. Both the selenenate ester hydrolysis and selenenic acid Sir: Selenenic acids play a central role in the oxidation disproportionation reactions were strongly solvent-de- and reduction chemistry of Nevertheless, only pendent and were catalyzed by acid and base. In non- areneselenenic acids and esters stabilized by coordination hydroxylic solvents the rate of disproportionation of sel- to ortho nitro or carbonyl substituents have been ob- enenic acid la was much faster than its rate of formation served;1a4$2p3aother selenenic acids disproportionate to by either selenoxide elimination or hydrolysis.6 Com- diselenides and seleninic acids too rapidly to permit pound la was independently prepared by selenoxide spectroscopic observation.'ay2a We not report the first elimination of phenethyl2,4,6-tri-tert-butylphenylselen- observation of a selenenic acid lacking coordinating sub- oxide in aqueous acetone1p8 and was characterized by its stituents that disproportionates sufficiently slowly to NMR spectrum and its chemical derivatization. permit spectroscopic ob~ervation.~ We have used la and lb to test several of the reactions Selenenate ester lb was prepared according to Scheme commonly ascribed to selenenic acids and esters (Table I (Ar = 2,4,6-tri-tert-butylphenyl)by reaction of the sel- I).
    [Show full text]
  • University Microfilms, Inc., Ann Arbor, Michigan OXIDIZING PROPERTIES of SELENIUM COMPOUNDS
    OXIDIZING PROPERTIES OF SELENIUM COMPOUNDS Item Type text; Dissertation-Reproduction (electronic) Authors White, Joe Wade, 1940- Publisher The University of Arizona. Rights Copyright © is held by the author. Digital access to this material is made possible by the University Libraries, University of Arizona. Further transmission, reproduction or presentation (such as public display or performance) of protected items is prohibited except with permission of the author. Download date 25/09/2021 07:39:00 Link to Item http://hdl.handle.net/10150/284855 This dissertation has been ~ microfilmed exactly as received 67-11,365 WHITE, Joe Wade, 1940- OXIDIZING PROPERTIES OF SELENIUM COMPOUNDS. University of Arizona, Ph.D., 1967 Chemistry, organic University Microfilms, Inc., Ann Arbor, Michigan OXIDIZING PROPERTIES OF SELENIUM COMPOUNDS by Joe Wade White A Dissertation Submitted to the Faculty of the DEPARTMENT OF CHEMISTRY In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY In the Graduate College THE UNIVERSITY OF ARIZONA 19 6 7 THE UNIVERSITY OF ARIZONA GRADUATE COLLEGE I hereby recommend that this dissertation prepared under my direction by Joe Wade White entitled Oxidizing Properties of Selenium Compounds be accepted as fulfilling the dissertation requirement of the degree of Doctor of Philosophy Dissertation DirectorDire Date After inspection of the dissertation, the following members of the Final Examination Committee concur in its approval and recommend its acceptance:* *//s/ 7 —r—/ is- is? ll S a-/3 -(-7 » -/S-4 7 *This approval and acceptance is contingent on the candidate's adequate performance and defense of this dissertation at the final oral examination. The inclusion of this sheet bound into the library copy of the dissertation is evidence of satisfactory performance at the final examination.
    [Show full text]
  • Functional Groups, a Short List 1 Oxygen-Containing Acetal/Ketal
    Functional Groups, A Short List Oxygen-containing Diketene Acetal/ketal Acid anhydride Ester Acyl halide Ether X = Cl, Br, I Ethylenedioxy- (crown ether) Acylal Hemiacetal/Hemiketal Alcohol Homoallylic Carbonate Hydroperoxide Carboxylic acid/carboxylate anion Ketene Chloroformate ester Ketone/aldehyde Dicarbonate Lactone 1 Methylenedioxy- Amide Orthocarbonate ester Amidine Orthoester Amidrazone Peroxide Amine Ynol* *Highly unstable, tautomer of ketene Azide Ynone Azine Nitrogen-containing Azo group Acylurea Azoxy Aldimine (primary/secondary) Carbamate 2 Carbazide Hydroxamic acid Carbodiimide Imide Carboximidate Imidic acid Cyanate Isocyanate Cyanimide Isonitrile Diazo group Ketenimine Enamide Ketimine (primary/secondary) Enamine Lactam Hydrazone Nitrile (cyanide) Nitrite 3 Nitrosamine Dithiocarboxylic acid ester Nitroso Isothiocyanate Oxime S-nitrosothiol Sulfate Semicarbazide Sulfenamide Semicarbazone Sulfenyl chloride Triazene Sulfinic acid Sulfur-containing Sulfite Disulfide Sulfonate ester Dithiocarbamate Sulfone Dithiocarboxylic acid 4 Sulfonic acid Thioketene Sulfonyl Thiol X = Cl, Br, I Thiolester Sulfoxide Thionoester Sulfuryl Thiosemicarbazide X = Cl, Br, I Thial Thiourea Thiocarboxylic acid (O) Phosphorus-containing Thiocarboxylic acid (S) Phosphate Thiocyanate Phosphine Thioether (sulfide) Phosphodiester Thioketone 5 Phosphonate Siloxy group Silyl chloride Phosphonic acid Silyl ether Phosphonite Silyl hydride Phosphoramide Phosphoramidite Alkyl groups Adamantyl group Silicon-containing Silanol Allyl group Benzyl group (–Bn)
    [Show full text]