b r a z i l i a n j o u r n a l o f m i c r o b i o l o g y 4 8 (2 0 1 7) 476–482 ht tp://www.bjmicrobiol.com.br/ Medical Microbiology In vitro antifungal activity of organic compounds derived from amino alcohols against onychomycosis a b a César Augusto Caneschi , Angelina Maria de Almeida , Francislene Juliana Martins , b c d Mireille Le Hyaric , Manoel Marques Evangelista Oliveira , Gilson Costa Macedo , b a,∗ Mauro Vieira de Almeida , Nádia Rezende Barbosa Raposo a Universidade Federal de Juiz de Fora, Faculdade de Farmácia, Núcleo de Pesquisa e Inovac¸ão em Ciências da Saúde (NUPICS), Juiz de Fora, MG, Brazil b Universidade Federal de Juiz de Fora, Instituto de Ciências Exatas, Departamento de Química, Juiz de Fora, MG, Brazil c Fundac¸ão Oswaldo Cruz, Instituto Nacional de Infectologia Evandro Chagas, Laboratório de Micologia, Rio de Janeiro, RJ, Brazil d Universidade Federal de Juiz de Fora, Instituto de Ciências Biológicas, Departamento de Parasitologia, Microbiologia e Imunologia, Juiz de Fora, MG, Brazil a r t i c l e i n f o a b s t r a c t Article history: Onychomycosis is a fungal infection of the nail caused by high densities of filamentous Received 18 August 2016 fungi and yeasts. Treatment for this illness is long-term, and recurrences are frequently Accepted 7 December 2016 detected. This study evaluated in vitro antifungal activities of 12 organic compounds derived Available online 9 February 2017 from amino alcohols against standard fungal strains, such as Trichophyton rubrum CCT Associate Editor: Luis Henrique 5507 URM 1666, Trichophyton mentagrophytes ATCC 11481, and Candida albicans ATCC 10231. Souza Guimarães The antifungal compounds were synthesized from p-hydroxybenzaldehyde (4a–4f) and p- hydroxybenzoic acid (9a–9f). Minimum inhibitory concentrations and minimum fungicidal Keywords: concentrations were determined according to Clinical and Laboratory Standards Institute protocols M38-A2, M27-A3, and M27-S4. The amine series 4b–4e, mainly 4c and 4e com- Amino alcohols ␮ Amides pounds, were effective against filamentous fungi and yeast (MIC from 7.8 to 312 g/mL). On Lipophilicity the other hand, the amide series (9a–9f) did not present inhibitory effect against fungi, except amide 9c, which demonstrated activity only against C. albicans. This allowed us to infer that Antifungal activity Onychomycosis the presence of amine group and intermediate carbon number (8C–11C) in its aliphatic side chain seems to be important for antifungal activity. Although these compounds present cytotoxic activity on macrophages J774, our results suggest that these aromatic compounds might constitute potential as leader molecules in the development of more effective and less toxic analogs that could have considerable implications for future therapies of ony- chomycosis. © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/ licenses/by-nc-nd/4.0/). ∗ Corresponding author. E-mail: [email protected] (N.R. Raposo). http://dx.doi.org/10.1016/j.bjm.2016.12.008 1517-8382/© 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). b r a z i l i a n j o u r n a l o f m i c r o b i o l o g y 4 8 (2 0 1 7) 476–482 477 29–32 and immunological activities against Trypanosoma cruzi. Introduction Thus, the present study evaluated the antifungal activities of amphiphilic aromatic amino alcohols and amides against Onychomycosis is a fungal infection of the nails caused 1–5 different strains of fungi associated with onychomycosis. by dermatophytic fungi and yeasts. The main etiological 6,7 agents are Trichophyton, Epidermophyton, and Candida fungi. Onychomycosis is an emerging global health problem, as it Materials and methods 1,8,9 represents 50% of nail disorders and affects 2–9% of the 2,10 world population. This pathological condition affects qual- Chemistry ity of life, with loss of the patient self-esteem and may result 2,11,12 in physical, occupational, and social limitations. Amino alcohols 4a–4f were synthesized from p- Notable among the main factors related to onychomyco- hydroxybenzaldehyde 1, as described previously by Almeida sis are humidity, wearing closed shoes, repetitive nail trauma, et al. (2013) and amides 9a–9f were synthesized from 29 genetic predisposition, and chronic diseases, such as dia- p-hydroxybenzoic acid 5. Briefly, compound 1 was 2,10,13–16 betes, HIV, and immunosenescence. Moreover, the previously O-alkylated and then submitted to a direct main etiological agents of onychomycosis in infected areas reductive amination reaction in the presence of 2-amino-2- are Trichophyton rubrum (60%), Trichophyton mentagrophytes hydroxymethyl-propane-1,3-diol (Tris), resulting in targeted (20%), Epidermophyton floccosum (10%), and Candida albicans amino alcohols 4a–4f with 32–87% yield (Fig. 1). Amphiphilic 1–3,9 (5–10%). The T. mentagrophytes complex is particularly dif- aromatic amides 9a–9f was obtained from O-alkylated esters ficult to identify because of the morphological features and 7a–7f prepared from carboxylic acid 5. After hydrolysis of the the inter-specific relationships within this group are unclear, ethyl ester, the carboxyl group was converted to acyl chloride 17 requiring molecular tools to identify species in this complex. and treated with Tris, resulting in the desired amides (Fig. 2). Despite recent advances in medicine, treating ony- chomycosis remains challenging due to the anatomical Fungal strains characteristics of nails and the poor efficacy of currently avail- 1,18–20 able treatments. Existing therapies for onychomycosis Experiments were conducted using T. rubrum CCT-5507 URM are only partially effective, and recurrence and consequent 1666 obtained from the Collection of Tropical Crops (CCT) pro- fungal resistance are common when combined with poor vided by the André Tosello Foundation (Campinas, São Paulo, 21–25 medication compliance. Furthermore, oral antifungal SP, Brazil), T. mentagrophytes ATCC 11481 and C. albicans ATCC drugs are associated with undesirable side effects, such 10231 from the American Type Culture Collection (ATCC) were 8,10,19 as hepatotoxicity. Therefore, new alternatives to pre- provided by the National Institute of Quality Control in Health- vent, diagnose, and treat onychomycosis are of utmost Oswaldo Cruz Foundation (Rio de Janeiro, RJ, Brazil). 26 importance. Thus, the discovery of novel antifungal com- pounds is urgently necessary to develop more effective, Molecular identification economical therapies with fewer side effects. Amine and amide groups are significant functional groups in medications Genomic DNA was extracted from T. mentagrophytes ATCC 27 due to their reactive and chemical properties, and these 11481 to identify the fungal strain complex. Partial sequenc- 28 groups comprise peptides found in various proteins. Our ing of the internal transcribed spacer (ITS) region was previous data show that amino alcohols have antimicrobial evaluated using ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 O O 1) K2CO 3 DMF, 70ºC H H 2) 0.5 eq KI H C(H C) 3 2 n O HO CH3(CH2)nX 1 2 a-f n=3,5,7,8,9,11,13 X=Cl, Br 1) 1 eq 2) 2 eq NaBH4 OH 3) HCI 4M OH refluxo 5h MeOHanid H2N OH 3 OH 4a: n=3 4b: n=7 OH 4c: n=8 N .HCI n=9 H OH 4d: H3C(H2C)n 4e: n=11 O 4f: n=13 4 a-f 29 Fig. 1 – Synthesis of the amine series adapted from Almeida et al. (2013). 478 b r a z i l i a n j o u r n a l o f m i c r o b i o l o g y 4 8 (2 0 1 7) 476–482 O O O H SO 2 4 1. K2CO3 OH OC2H5 OC2H5 EtOH, reflux 2. CH3(CH2)nCI,KI CH3(CH2)n HO HO DMF, 70ºC O 5 6 n=3,5,7,8,9,11 7 a-f 9a: n=3 9b: n=5 1. KOH,EtOH,reflux 9c: n=7 2. HCI 4M 9d: n=8 9e: n=9 9f: n=11 OH O O OH 1– Oxalyl chloride, toluene, 0ºC-r.t. N OH H CH (CH )n OH 2– Tris, K CO , DMA, 60ºC CH (CH )n 3 2 O 2 3 3 2 O 9 a-f 8 a-f 29 Fig. 2 – Synthesis of the amide series adapted from Almeida et al. (2013). 33 (TCCTCCGCTTATTGATATGC). Briefly, the conditions were buffered with MOPS, and tested for filamentous fungi at final ␮ ␮ 100 ng DNA, 10 pmol of each primer, and an annealing concentrations of 7.8–1000 g/mL and 39.06–5000 g/mL for ◦ ␮ temperature of 58 C. Automated sequencing was evaluated yeasts. Fungal growth was assessed by adding 100 L RPMI- using the Sequencing Platform at Fundac¸ão Oswaldo Cruz- 1640 culture medium buffered with MOPS containing the PDTIS/FIOCRUZ, Brazil. The sequences were edited using fungal inoculum. The fungi were homogenized for 2 min and ◦ ± Sequencher 4.9 software and compared with BLAST. The ITS incubated in a sterile 96-well plate at 28 2 C for seven days ◦ ± sequence isolated from T. mentagrophytes ATCC 11481 was (dermatophytes) or 37 2 C for 48 h (yeasts). The fungi were deposited in Genbank under accession number NCBI/GenBank analyzed visually using a SMZ800 microscope (Nikon, Melville, KX132909. This procedure was not necessary for other strains NY). Terbinafine, ketoconazole, and amphotericin B were used used herein because these standard strains have been inves- as reference drugs and assessed in accordance with the M38- 34,35 36 37 tigated recently by different authors, confirming the A2 and M27-A3 protocols.