DOCSLIB.ORG

Genetic Variant Rs2301721 in the HOXA7 Gene Is Associated with Leukemia Risk in Jammu Region of India

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetic Variant Rs2301721 in the HOXA7 Gene Is Associated with Leukemia Risk in Jammu Region of India RESEARCH Genetic variant rs2301721 in the HOXA7 gene is associated with leukemia risk in Jammu region of India a b a a a a Amrita Bhat , Deepak Abrol , Gh. Rasool Bhat , Ruchi Shah , Sonali Verma , Divya Bakshi , Bhanu Sharma a c d a , Supinder Singh , Rakesh Raina , Rakesh Kumar * a Shri Mata Vaishno Devi University, Katra b Department of Radiotherapy, GMC, Kathua, J&K c Department of Medicine, ASCOMS, Sidhra. d Siddhi Vinayak Dental and Health Care Centre, Rupnagar, Jammu, India *Corresponding author e-mail: [email protected] ABSTRACT Background: Leukemia is a heterogeneous disorder, characterized by high proliferation of white blood cells. Various genetic studies have tried to assess the role of SNPs contributing to the development of leukemia. The HOX is implicated in normal as well as abnormal hematopoiesis. The role of the present variant rs2301721 has been previously studied in various population groups; however, the role of this variant in Leukemia in the Jammu region/population is unclear. Aim: In the present study, we investigated the genetic variant rs2301721 in the HOXA7 gene in leukemia patients from the Jammu region of India. Methods: The variant was genotyped by using Sanger sequencing in 180 individuals (90 leukemic cases and 90 healthy controls). The association of SNP with the disease was evaluated by using logistic regression. Results: It was observed that the variant rs2301721 showed significant association with Leukemia risk in Jammu population The allelic OR of variant rs2301721 was 1.54 (1.01 – 2.34) with p-value = 0.004 and under H.W.E it was 0.838 when corrected for age, gender, BMI, smoking and alcohol. Conclusion: The present study concludes that the variant rs2301721 in the HOXA7 gene acts as a risk factor in the development of leukemia in the study population. KEYWORDS: Homeobox proteins (HOXA7); Linkage Disequilibrium (LD); Jammu region; SNP Citation: Bhat et al. Genetic variant rs2301721 in the HOXA7 gene is associated with Leukemia risk in Jammu region of India. Polymorphism 2020; 5: 68-76. POLYMORPHISM 68 RESEARCH INTRODUCTION may regulate gene expression, morphogenesis, and Leukemia consists of a group of heterogeneous differentiation in hematopoietic stem cells (Inoue et malignancies in which immature and dysfunctional al., 2013). The present study aimed at exploring the hematopoietic progenitors proliferate and association of variant rs2301721 of HOXA7 with the accumulate in the bone marrow (Alharbi, risk of Leukemia in Jammu population. Pettengell, Pandha, & Morgan, 2013). In the hematopoietic stem cells, a disruption of the cellular MATERIAL AND METHODS processes, including proliferation, differentiation, Ethics statement and cell growth ultimately causes Leukemia The study was approved by the Institutional Ethics ("Leukemia," 2017). In the United States, leukemia is Review Board (IERB) of Shri Mata Vaishno Devi ranked 8th for being the most commonly diagnosed University (SMVDU) under notification number cancer with approximately 61,789 new cases and (SMVDU/IERB/16/41). All the details have been 23,100 deaths in 2019. According to the Population- recorded in a predesigned proforma and written Based Cancer Registry of India, males are more informed consent was obtained from each affected than females by the ratio 2:1 (Asthana, participant before conducting the study. All 2018). The incidence of leukemia in Jammu has shot experimental protocols were conducted according up rapidly from the previous decade to the guidelines and regulations set by IERB, (Chokkalingam & Buffler, 2008). One of India’s SMVDU. highly diverse and predominately inbred population groups, the population of Jammu and Kashmir (J&K) region, remained unexplored for Sample collection and DNA isolation blood disorders. Leukemia is multifactorial in origin, A total of 180 subjects were recruited for the study, which can be caused by both genetic as well as out of which 90 were cases (leukemic patients) and non-genetic factors (Sinnett, 2000). Various genetic 90 were healthy controls. All the cases were alterations, including genetic polymorphisms histopathologically confirmed. The genomic DNA resulting in gain-of-function mutation in proto- was isolated from the blood samples using a oncogenes as well as inactivating tumor suppressor Qiagen DNA Isolation kit (Catalogue No. 51206). genes can lead to the progression of leukemia Agarose gel electrophoresis was used to analyze (Münger, 2002). Genome-wide association studies the quality of the genomic DNA and quantification (GWAS) have advanced our understanding of was performed using UV spectrophotometer susceptibility to leukemia; however, much of the (Nanodrop). heritable risk remains unidentified. This factor has been increasingly documented as an inherited Exome sequencing genetic factor that can contribute to the progression of leukemia. GWAS data indicate that The exome sequencing for 05 cases was done on much of the heritable risk of leukemia is ascribable Illumina NGS Platform. The alignment against the to common genetic variations which need to be hg GrCh37 genome was carried out using BWA and discovered. Recently, GWAS has found the the variant calling was done using GATK pipeline. association of variant rs2301721 of HOXA7 with The alignment against the hg19 GrCh37 genome depression disease in Russian population (Shadrina, was carried out using BWA, and the variant calling Bondarenko, & Slominsky, 2018) and colon cancer was done using GATK pipeline. The variants were in Korean population (Kan et al., 2007). The genetic identified using GATK tool and annotated using variant rs2301721 of HOXA7 has cytogenetic ANNOVAR. The databases used for study include localization to 7p15.2 with the 1st exonic position and 1000 genome, DBNSFP, dbSNP, GWAS and ClinVar. encodes a DNA-binding transcription factor which POLYMORPHISM 69 RESEARCH After filtration of variants against various filters by the use of Exome Capture Kits targeted region. RESULT The total data was generated 45.63 GB with more Sanger Sequencing than 100X sequencing coverage. HOXA7 variant Polymerase chain reaction (PCR) was done to rs2301721 was frequently observed in all samples. amplify PAX5 using Mastercycler® pro, Eppendorf Detail of gene is given in Table 2 and Figure 1 AG, Hamburg, Germany. Overall the target region HOXA7 was not been reported in leukemia from was amplified using the PCR program with 95ºC for Jammu Kashmir population of North India. As the 1 minute, 95ºC for 1 min, 60ºC for 45 seconds with variant of HOXA7 was shortlisted from WES, it was 36 cycles, 72ºC for 1 min, 72ºC for 2min, 4ºC infinity imperative to further validate in a larger number of (∞) shown in Table 1 and sequencing was samples and the same was done by sanger performed by Aggrigenome Pvt. Limited using sequencing. The main aim was to explore the Sequence Scanner Software (ABI 3730 XL DNA association of variant rs2301721 of HOXA7 with the Analyser) and Chromas v2.6.6 (Technelysium Pty Leukemia risk. Ltd, South Brisbane, Australia). This case-control association study included 180 samples (90 leukemic cases and 90 healthy Statistical Analysis controls). The clinical characteristic distributions of Statistical Analysis of the data was done by using the cases and the controls are given in Table 2. In SPSS software (v.20; Chicago, IL). Chi-square (χ2) Table 1, 60% of Leukemia patients were males, and was performed, and genotype frequencies were 40% were females, while in controls, 70% were tested for total Hardy–Weinberg equilibrium. Binary males, and 30% were females. The mean ages were Logistic Regression was also used to estimate OR at 40.51(±14.67) for leukemia patients and 50.76 95% CI, and the respective level of significance was (±13.30) years for controls. BMI in cases was 21.2 estimated as p-value. Moreover, various (±6.10) and 24.9 (±5.3) in Controls. interactions of genes were analyzed by the string software tool. Table: 1 Showing the details of forwarding and reversed primers of variant rs2301721 of HOXA7. Gene Zygosity SNP ID cDNA Protei Exon Function Type of Alteration Change n No. chang e HOXA7 Heterozygosit rs2301721 g.2862429 p.A18T 01 Mis-sense Non synonymous y 4 G>A variant SNV POLYMORPHISM 70 RESEARCH Table 2: Clinical Characteristics of Cases and Controls. Characteristics Cases Controls p-value Age * 40.7 (±14.5) 49.1(±15.30) <0.01 Gender (in %) F=40 F=30 - M=60 M=70 BMI** 21.2 (±6.10) 24.9 (±5.3) <0.01 Histopathology (Leukemia Types) Acute Lymphoblastic Leukemia (ALL) 0.17 Acute Myeloid Leukemia (AML) 0.23 Chronic Myeloid Leukemia (CML) 0.50 Chronic Lymphoid Leukemia (CLL) 0.10 Smoker 0.63 0.22 - Non-Smoker 0.37 0.78 - Alcoholic 0.53 0.17 - Non-Alcoholic 0.47 0.83 - *age in years and **BMI in kg/m2 GENES TERT HOXA7 8% ATM 17% 8% TP63 9% PAX5 14% XRCC1 11% ASXL1 11% IKZF1 11% ARID5B 11% Figure 1: Showing the percentage frequency of genes targeted in exome sequencing, where HOXA7 had a higher percentage (17%) frequency among all genes. The C>T genetic variant (rs10899750) in the HOXA7 HOXA7 shows homozygous wild (CC), gene results in an amino acid change from Alanine heterozygous (CT) and Homozygous mutant (TT) to tryptophan. An allelic frequency distribution is (Figure 3). shown in Figure 2 and the chromatogram of POLYMORPHISM 71 RESEARCH CASES CONTROLS 40 35 30 25 20 15 Frequency 10 5 0 CC CT TT Allele Figure 2: Showing Allelic frequency distribution of variant rs2301721 of HOXA7 Figure 3: Chromatogram of HOXA7 with variant rs2301721 having missense mutation C >T. Showing A) homozygous wild (CC) B) heterozygous (CT) and C) Homozygous mutant (TT). The allelic OR of variant rs2301721 was 1.54 (1.01 – HOXA7 shows a significant association with the risk 2.34) with p-value = 0.004 and under H.W.E it was of leukemia in the population of Jammu region of 0.838.
Load more

Recommended publications
  • Supplementary Materials for the Oncogenic Runx3–Myc
    Supplementary Materials for The oncogenic Runx3–Myc axis defines p53-deficient osteosarcomagenesis Shohei Otani†, Yuki Date†, Tomoya Ueno, Tomoko Ito, Shuhei Kajikawa, Keisuke Omori, Ichiro Taniuchi, Masahiro Umeda, Toshihisa Komori, Junya Toguchida, Kosei Ito* †These authors contributed equally. *Correspondence to: [email protected] Department of Molecular Bone Biology, Graduate School of Biomedical Sciences, Nagasaki University, 1-7-1 Sakamoto, Nagasaki, 852-8588, Japan. This file includes: Figs. S1 to S13 Tables S1 and S2 1 Fig. S1 Up- and down-regulated transcription factors in p53-deficient osteosarcomagenesis in human and mouse. (A) OS development in the tibia of a representative osteoprogenitor-specific p53 knockout mouse (Osterix/Sp7-Cre; p53fl/fl). Arrows indicate the tumor. Osterix-Cre is expressed in BM-MSCs of adult mice as well (56). Right panel: radiograph. A scale bar = 1 cm. (B) Principal component analysis (PCA) of RNA-seq data comparing OS tissues (OS) and normal osteoblasts (OB) in human and mouse. (C) MA plot presentation of RNA-seq data comparing OS and OB. The seven TFs (Fig. 1, A and B) are indicated by red dots. (D) Prognostic efficacy of the seven transcription factors (Fig. 1, A and B) as determined by Kaplan–Meier analysis of survival in the OS patients in the TARGET cohort. **p < 0.01; *p < 0.05. 2 Fig. S2 Runx3 is required for tumorigenicity of p53-deficient OS. (A) Levels of the indicated proteins in OS (mOS) in 14 individual OS mice and newborn calvaria, as determined by western blotting. (B) Tumorigenicity of clonal mOS cells isolated from mOS (arrow) in individual OS mice (left) was evaluated by allograft in nude mice (BALB/c nu/nu mice; right).
    [Show full text]
  • Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Expression Pattern of the Class I Homeobox Genes in Ovarian Carcinoma
    J Gynecol Oncol Vol. 21, No. 1:29-37, March 2010 DOI:10.3802/jgo.2010.21.1.29 Original Article Expression pattern of the class I homeobox genes in ovarian carcinoma Jin Hwa Hong1, Jae Kwan Lee1, Joong Jean Park2, Nak Woo Lee1, Kyu Wan Lee1, Jung Yeol Na1 Departments of 1Obstetrics and Gynecology, 2Physiology, Korea University College of Medicine, Seoul, Korea Objective: Although some sporadic reports reveal the link between the homeobox (HOX) genes and ovarian carcinoma, there is no comprehensive analysis of the expression pattern of the class I homeobox genes in ovarian carcinoma that determines the candidate genes involved in ovarian carcinogenesis. Methods: The different patterns of expression of 36 HOX genes were analyzed, including 4 ovarian cancer cell lines and 4 normal ovarian tissues. Using a reverse transcription-polymerase chain reaction (RT-PCR) and quantification analysis, the specific gene that showed a significantly higher expression in ovarian cancer cell lines than in normal ovaries was selected, and western blot analysis was performed adding 7 ovarian cancer tissue specimens. Finally, immunohistochemical and immunocytochemical analyses were performed to compare the pattern of expression of the specific HOX gene between ovarian cancer tissue and normal ovaries. Results: Among 36 genes, 11 genes had a different level of mRNA expression between the cancer cell lines and the normal ovarian tissues. Of the 11 genes, only HOXB4 had a significantly higher level of expression in ovarian cancer cell lines than in normal ovaries (p=0.029). Based on western blot, immunohistochemical, and immunocytochemical analyses, HOXB4 was expressed exclusively in the ovarian cancer cell lines or cancer tissue specimens, but not in the normal ovaries.
    [Show full text]
  • A Crucial Role for the Ubiquitously Expressed Transcription Factor Sp1 at Early Stages of Hematopoietic Specification
    This is a repository copy of A crucial role for the ubiquitously expressed transcription factor Sp1 at early stages of hematopoietic specification.. White Rose Research Online URL for this paper: http://eprints.whiterose.ac.uk/83683/ Version: Published Version Article: Gilmour, J, Assi, SA, Jaegle, U et al. (6 more authors) (2014) A crucial role for the ubiquitously expressed transcription factor Sp1 at early stages of hematopoietic specification. Development, 141 (12). 2391 - 2401. ISSN 0950-1991 https://doi.org/10.1242/dev.106054 Reuse Unless indicated otherwise, fulltext items are protected by copyright with all rights reserved. The copyright exception in section 29 of the Copyright, Designs and Patents Act 1988 allows the making of a single copy solely for the purpose of non-commercial research or private study within the limits of fair dealing. The publisher or other rights-holder may allow further reproduction and re-use of this version - refer to the White Rose Research Online record for this item. Where records identify the publisher as the copyright holder, users can verify any specific terms of use on the publisher’s website. Takedown If you consider content in White Rose Research Online to be in breach of UK law, please notify us by emailing [email protected] including the URL of the record and the reason for the withdrawal request. [email protected] https://eprints.whiterose.ac.uk/ © 2014. Published by The Company of Biologists Ltd | Development (2014) 141, 2391-2401 doi:10.1242/dev.106054 RESEARCH ARTICLE STEM CELLS AND REGENERATION A crucial role for the ubiquitously expressed transcription factor Sp1 at early stages of hematopoietic specification Jane Gilmour1, Salam A.
    [Show full text]
  • Discovery of Biased Orientation of Human DNA Motif Sequences
    bioRxiv preprint doi: https://doi.org/10.1101/290825; this version posted January 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Discovery of biased orientation of human DNA motif sequences 2 affecting enhancer-promoter interactions and transcription of genes 3 4 Naoki Osato1* 5 6 1Department of Bioinformatic Engineering, Graduate School of Information Science 7 and Technology, Osaka University, Osaka 565-0871, Japan 8 *Corresponding author 9 E-mail address: [email protected], [email protected] 10 1 bioRxiv preprint doi: https://doi.org/10.1101/290825; this version posted January 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 11 Abstract 12 Chromatin interactions have important roles for enhancer-promoter interactions 13 (EPI) and regulating the transcription of genes. CTCF and cohesin proteins are located 14 at the anchors of chromatin interactions, forming their loop structures. CTCF has 15 insulator function limiting the activity of enhancers into the loops. DNA binding 16 sequences of CTCF indicate their orientation bias at chromatin interaction anchors – 17 forward-reverse (FR) orientation is frequently observed. DNA binding sequences of 18 CTCF were found in open chromatin regions at about 40% - 80% of chromatin 19 interaction anchors in Hi-C and in situ Hi-C experimental data.
    [Show full text]
  • Three-Dimensional Regulation of HOXA Cluster Genes by a Cis-Element in Hematopoietic Stem Cell and Leukemia
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.16.017533; this version posted April 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Three-dimensional regulation of HOXA cluster genes by a cis-element in hematopoietic stem cell and leukemia. Xue Qing David Wang1, Haley Gore1, Pamela Himadewi1, Fan Feng2, Lu Yang3, Wanding Zhou1,5, Yushuai Liu1, Xinyu Wang4, Chun-wei Chen3, Jianzhong Su4, Jie Liu2, Gerd Pfeifer1,*, Xiaotian Zhang1,* 1. Center for Epigenetics, Van Andel Research Institute, Grand Rapids, Michigan 2. Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan. 3. Department of System Biology, City of Hope Cancer Center, California 4. Institute of Biomedical Big Data, Wenzhou Medical University, Wenzhou, China 5. Current address: Children Hospital of Philadelphia, University of Pennsylvania *. These authors jointly supervise this project Correspondence should be addressed to Xiaotian Zhang: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.04.16.017533; this version posted April 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract: Proper gene regulation is crucial for cellular differentiation, and dysregulation of key genes can lead to diseased states such as cancer. The HOX transcription factors play such a role during hematopoiesis, and aberrant expression of certain HOXA genes is found in certain acute myeloid leukemias (AMLs).
    [Show full text]
  • The Notch Target Hes1 Directly Modulates Gli1 Expression and Hedgehog Signaling: a Potential Mechanism of Therapeutic Resistance
    Clinical Cancer Cancer Therapy: Preclinical Research The Notch Target Hes1 Directly Modulates Gli1 Expression and Hedgehog Signaling: A Potential Mechanism of Therapeutic Resistance Karisa C. Schreck1,2,5, Pete Taylor6, Luigi Marchionni4, Vidya Gopalakrishnan6, Eli E. Bar2, Nicholas Gaiano1,3,5, and Charles G. Eberhart2,4 Abstract Purpose: Multiple developmental pathways including Notch, Hedgehog, and Wnt are active in malignant brain tumors such as medulloblastoma and glioblastoma (GBM). This raises the possibility that tumors might compensate for therapy directed against one pathway by upregulating a different one. We investigated whether brain tumors show resistance to therapies against Notch, and whether targeting multiple pathways simultaneously would kill brain tumor cells more effectively than monotherapy. Experimental Design: We used GBM neurosphere lines to investigate the effects of a gamma-secretase inhibitor (MRK-003) on tumor growth, and chromatin immunoprecipitation to study the regulation of other genes by Notch targets. We also evaluated the effect of combined therapy with a Hedgehog inhibitor (cyclopamine) in GBM and medulloblastoma lines, and in primary human GBM cultures. Results: GBM cells are at least partially resistant to long-term MRK-003 treatment, despite ongoing Notch pathway suppression, and show concomitant upregulation of Wnt and Hedgehog activity. The Notch target Hes1, a repressive transcription factor, bound the Gli1 first intron, and may inhibit its expression. Similar results were observed in a melanoma-derived cell line. Targeting Notch and Hedgehog simultaneously induced apoptosis, decreased cell growth, and inhibited colony-forming ability more dramatically than monotherapy. Low-passage neurospheres isolated from freshly resected human GBMs were also highly susceptible to coinhibition of the two pathways, indicating that targeting multiple developmental pathways can be more effective than monotherapy at eliminating GBM-derived cells.
    [Show full text]
  • Aberrant Expression of Homeobox Gene HOXA7 Is Associated with Mu
    Aberrant expression of homeobox gene HOXA7 is associated with mu¨llerian-like differentiation of epithelial ovarian tumors and the generation of a specific autologous antibody response Honami Naora*†, Fredrick J. Montz‡, Chee-Yin Chai*, and Richard B. S. Roden*‡ Departments of *Pathology and ‡Gynecology and Obstetrics, Johns Hopkins University School of Medicine, Baltimore, MD 21205 Edited by Lloyd J. Old, Ludwig Institute for Cancer Research, New York, NY, and approved October 15, 2001 (received for review September 19, 2001) Autologous serum antibodies to molecules that are aberrantly (OSE) (9, 10). The OSE is a single layer of mesodermally derived expressed in tumors represent potential biomarkers for early cells surrounding the ovary and is morphologically similar to the diagnosis of cancer. In this study, we identified the homeobox simple mesothelial lining of peritoneal surfaces. In contrast, gene HOXA7 as encoding an antigen in epithelial tumors of the epithelial ovarian tumors often resemble the specialized, more ovary. These tumors are thought to arise from the simple epithe- architecturally complex epithelia of the female reproductive lium lining the ovarian surface, but they often resemble the tract that derive from the mu¨llerian ducts (10). A major imped- specialized epithelia derived from the mu¨llerian ducts. Expression iment to early diagnosis of ovarian carcinoma has been the lack of HOXA7 was detected in ovarian tumors exhibiting mu¨llerian-like of defined precursor or premalignant lesions. No description of features and correlated with the generation of anti-HOXA7 anti- a stepwise sequence of molecular events exists for ovarian bodies by patients. In contrast, it was observed that healthy carcinogenesis analogous to that described for colorectal neo- women lack anti-HOXA7 antibodies (P < 0.0001) and that HOXA7 plasia (11).
    [Show full text]
  • Parathyroid Tumor Development Involves Deregulation of Homeobox Genes
    Endocrine-Related Cancer (2008) 15 267–275 Parathyroid tumor development involves deregulation of homeobox genes H-C Jennifer Shen, Jennifer E Rosen, Lauren M Yang, Sharon A Savage3, A Lee Burns1, Carmen M Mateo1, Sunita K Agarwal1, Settara C Chandrasekharappa2, Allen M Spiegel1, Francis S Collins2, Stephen J Marx1 and Steven K Libutti Tumor Angiogenesis Section, Surgery Branch, National Cancer Institute, Building 10, Room 4W-5940, 10 Center Drive, Bethesda, Maryland 20892, USA 1Metabolic Diseases Branch, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, Maryland, USA 2Genome Technology Branch, National Human Genome Research Institute, Bethesda, Maryland, USA 3Division of Cancer Epidemiology and Genetics, National Cancer Institute, National Institute of Health, Bethesda, Maryland, USA (Correspondence should be addressed to S K Libutti; Email: [email protected]) A M Spiegel is now at Albert Einstein College of Medicine, Bronx, New York, USA Abstract Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant syndrome caused by mutations in the MEN1 tumor suppressor gene. Loss of the functional second copy of the MEN1 gene causes individuals to develop multiple endocrine tumors, primarily affecting the parathyroid, pituitary, and pancreas. While it is clear that the protein encoded by MEN1, menin, suppresses endocrine tumors, its biochemical functions and direct downstream targets remain unclear. Recent studies have suggested that menin may act as a scaffold protein to coordinate gene transcription, and that menin is an oncogenic cofactor for homeobox (HOX) gene expression in hematopoietic cancer. The role of HOX genes in adult cell differentiation is still obscure, but growing evidence suggests that they may play important roles in the development of cancer.
    [Show full text]
  • Comprehensive Analysis Reveals Novel Gene Signature in Head and Neck Squamous Cell Carcinoma: Predicting Is Associated with Poor Prognosis in Patients
    5892 Original Article Comprehensive analysis reveals novel gene signature in head and neck squamous cell carcinoma: predicting is associated with poor prognosis in patients Yixin Sun1,2#, Quan Zhang1,2#, Lanlin Yao2#, Shuai Wang3, Zhiming Zhang1,2 1Department of Breast Surgery, The First Affiliated Hospital of Xiamen University, School of Medicine, Xiamen University, Xiamen, China; 2School of Medicine, Xiamen University, Xiamen, China; 3State Key Laboratory of Cellular Stress Biology, School of Life Sciences, Xiamen University, Xiamen, China Contributions: (I) Conception and design: Y Sun, Q Zhang; (II) Administrative support: Z Zhang; (III) Provision of study materials or patients: Y Sun, Q Zhang; (IV) Collection and assembly of data: Y Sun, L Yao; (V) Data analysis and interpretation: Y Sun, S Wang; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors contributed equally to this work. Correspondence to: Zhiming Zhang. Department of Surgery, The First Affiliated Hospital of Xiamen University, Xiamen, China. Email: [email protected]. Background: Head and neck squamous cell carcinoma (HNSC) remains an important public health problem, with classic risk factors being smoking and excessive alcohol consumption and usually has a poor prognosis. Therefore, it is important to explore the underlying mechanisms of tumorigenesis and screen the genes and pathways identified from such studies and their role in pathogenesis. The purpose of this study was to identify genes or signal pathways associated with the development of HNSC. Methods: In this study, we downloaded gene expression profiles of GSE53819 from the Gene Expression Omnibus (GEO) database, including 18 HNSC tissues and 18 normal tissues.
    [Show full text]
  • Supplementary File Table S1
    Supplementary file Table S1 Grouping of Homeobox genes according to their main known function. Anatomical Structure Morphogenesis EN1, HOXC10, HOXC13, HOXD3, LBX1, SIX2, SIX4 Organ Morphogenesis CDX1, CDX2, HOXA11, HOXA13, ISL1, LHX1, PAX3, PDHX, PITX2, PITX3, PROX1, SIX6 Body Pattern Formation ALX3, EMX2, HHEX, HOXA11, HOXA2, HOXA4, HOXA5, HOXA6, HOXB1, HOXB5, HOXB6, HOXC5, HOXD10, HOXD8, LMX1B, PITX2 Ectoderm Development PROX1, VAX2 Endoderm Development HOXC11 Brain & Nervous System Development Brain Development ALX1, DLX2, EMX2 Nervous System Development: ARX, DLX5, DLX6, HOXD10, LBX1, LHX1, OTP, PAX3, PHOX2A, PHOX2B Skeletal Development: ALX3, ALX4, DLX3, DLX5, DLX6, EN1, HOXA11, HOXA13, HOXA2, HOXB6, HOXD10, HOXD13, MSX2 Muscle Development: BARX2, MKX, SIRT1, SIRT2, SIX1 Other Homeobox Genes Involved In BARX1, CDX4, CUX1, DLX1, EMX1, EN2, Multicellular Organismal HOXA1, HOXA7, HOXA9, HOXB13, HOXB2, Development: HOXB3, HOXB4, HOXB7, HOXB8, HOXB9, HOXC12, HOXC8, HOXC9, HOXD1, HOXD11, HOXD12, HOXD9, ISL2, LBX2, LMX1A, MEIS1, NKX3-1, OTX1, TLX1, VAX1, VSX1, VSX2 Homeobox Genes Involved In Cell ARX, EMX2, HHEX, HLX, HOPX, LBX1, LHX1, Differentiation: LMX1B, MIXL1, OTP, PHOX2A, SIRT1, VSX2 Other Genes: PHTF1, SIRT3, SIRT6, SIRT7, ZHX1, ZHX2 Homeobox genes include two subsets of genes coding for transcription factors involved in multiple functions. The clustered HOX genes are indicated in bold. Supplementary file Figure S2 5’ Spatial collinearity 3’ HOXA Chr. 7p15.3 HOXB Chr. 17q21.3 HOXC Chr. 12q13.3 HOXD Chr. 2q31 13 12 11 10 9 8 7 6 5 4 3 2 1 Paralogous HOX groups Distribution of the 39 human HOX genes in four clusters located in different chromosomal regions*. Blue indicates anterior HOX genes. Yellow, paralogy group 3 Hox genes, green and purple indicatete central HOX genes and Red the posterior HOX genes.
    [Show full text]