Molecular Characterization of Economically Important Poultry Viruses in Western Canada

University of Calgary PRISM: University of Calgary's Digital Repository

Graduate Studies The Vault: Electronic Theses and Dissertations

2020-12-04 Molecular characterization of economically important poultry viruses in western Canada

Palomino-Tapia, Victor A.

Palomino-Tapia, V. A. (2020). Molecular characterization of economically important poultry viruses in western Canada (Unpublished doctoral thesis). University of Calgary, Calgary, AB. http://hdl.handle.net/1880/112814 doctoral thesis

University of Calgary graduate students retain copyright ownership and moral rights for their thesis. You may use this material in any way that is permitted by the Copyright Act or through licensing that has been assigned to the document. For uses that are not allowable under copyright legislation or licensing, you are required to seek permission. Downloaded from PRISM: https://prism.ucalgary.ca UNIVERSITY OF CALGARY

Molecular characterization of economically important poultry viruses in western Canada

Victor A. Palomino-Tapia

A THESIS

SUBMITTED TO THE FACULTY OF GRADUATE STUDIES

IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE

DEGREE OF DOCTOR OF PHILOSOPHY

GRADUATE PROGRAM IN VETERINARY MEDICAL SCIENCES

CALGARY, ALBERTA

DECEMBER, 2020

Abstract

Avian Reovirus (ARV), Chicken Astrovirus (CAstV), and Hemorrhagic Enteritis Virus (HEV) are important enteric pathogens affecting poultry production around the world. These agents are the causative agents of Viral Arthritis (VA), White Chick Syndrome (WCS), and Hemorrhagic

Enteritis (HE), respectively. In meat-type chickens, pathogenic strains of ARV can replicate in the joints leading to edema, inflammatory cell infiltrate, and fibrosis, which results in rupture of tendons. Similarly, pathogenic strains of CAstV can cause transient increase in mid to late embryo mortality, reducing hatchability between 4-68%, with some hatched birds exhibiting pale plumage; these “white chicks” (WCS) usually die within the first week of life. In turkeys, HEV infection has two presentations: 1) A clinical disease consisting on gastrointestinal hemorrhages, depression and immunosuppression (Clinical HE); and 2) subclinical infection, consisting in immunosuppression and causing economical losses due to secondary infections and plant condemnations. In recent years, these diseases have gained importance in western Canada as a result of the economic losses sustained from these infections in: a) feed conversion, b) high number of culls/first week mortality, c) secondary bacterial infections, c) processing plant condemnations; and d) costly disruptions to the Canadian Supply Management system.

This thesis focuses on molecular characterization of ARV, CAstV, and HEV obtained either from clinical samples (ARV, CAstV), or from cases suspected to have subclinical infection (HEV) in poultry farms located in western Canada. The biological samples from chickens (ARV, CAStV) and turkeys (HEV) were collected from cases submitted for post-mortem examination and diagnosis to Poultry Health Services (PHS), a private poultry consulting firm, located in Airdrie,

Alberta, western Canada.

Further studies are required to assess the virulence of these isolates for understanding their impact in the western Canada Poultry Industry and for the implementation or enhancement of vaccination practices.

Keywords: Molecular characterization; Avian Reovirus; Viral Arthritis; Chicken Astrovirus;

White Chick Syndrome; Turkey Hemorrhagic Enteritis Virus; Hemorrhagic Enteritis; poultry enteric viruses, mutation, recombination.

iii

Preface

The studies described in this dissertation, were performed at The Beef Microbiology Laboratory

Alberta Agriculture and Forestry – Airdrie Centre (Airdrie AB, Canada); and at the Department of

Ecosystem and Public Health, Faculty of Veterinary Medicine, University of Calgary, Calgary,

Alberta, Canada. The research described in the manuscripts contained in this document was carried out by myself, Victor A. Palomino-Tapia, from September 2016 to September 2020 under the supervision of Dr. Faizal Abdul-Careem. This dissertation contains the following manuscripts already published with the participation of all our co-authors which are mentioned below.

Chapter 2. Palomino-Tapia, V.; Mitevski, D.; Inglis, T.; van der Meer, F.; Abdul-Careem, M. F.,

Molecular characterization of emerging avian reovirus variants isolated from viral arthritis cases in western Canada 2012-2017 based on partial sigma (sigma)C gene. Virology 2018, 522, 138-146

[1].

• The authors contributions were as follows: Conceptualization, F.v.d.M., M.F.A.-C., and V.P.-T.; methodology, M.F.A.-C., D.M., T.I., and V.P.-T.; software, F.v.d.M., and V.P.- T.; validation, F.v.d.M., M.F.A.-C., and V.P.-T.; formal analysis, F.v.d.M., and V.P.-T; investigation, D.M., T.I., and V.P.-T; resources, M.F.A.-C., D.M., T.I., and F.v.d.M.; data curation, F.v.d.M., and V.P.-T.; writing—original draft preparation, V.P.-T.; writing— review and editing, F.v.d.M, M.F.A.-C., and V.P.-T.; visualization, F.v.d.M., M.F.A.-C., and V.P.-T.; supervision, F.v.d.M., M.F.A.-C., T.I., and D.M.; project administration, M.F.A.-C., D.M., and T.I.; funding acquisition, M.F.A.-C., D.M., T.I., and V.P.-T. All authors have read and agreed to the published version of the manuscript

Chapter 3. Palomino-Tapia, V.; Mitevski, D.; Inglis, T.; van der Meer, F.; Martin, E.; Brash, M.;

Provost, Ch.; Gagnon C.; Abdul-Careem, M. F. Chicken Astrovirus (CAstV) molecular studies reveal evidence of multiple past-recombinations events in sequences originated from clinical samples of White Chick Syndrome (WCS) in western Canada –Viruses 2020, 12, (10), 1096 [2].

• The authors contributions were as follows: Conceptualization, F.v.d.M., M.F.A.-C., and V.P.-T.; methodology, M.F.A.-C., D.M., T.I., and V.P.-T.; histopathology, M.B. and E.M.; software, F.v.d.M., C.P., C.A.G., and V.P.-T.; validation, F.v.d.M., M.F.A.-C., C.P., C.A.G., and V.P.-T.; formal analysis, F.v.d.M., C.P., C.A.G., and V.P.-T; investigation, D.M., T.I., and V.P.-T; resources, M.F.A.-C., D.M., T.I., and F.v.d.M.; data curation, F.v.d.M., C.P., C.A.G., and V.P.-T.; writing—original draft preparation, V.P.-T.; writing— review and editing, F.v.d.M, M.F.A.-C., and V.P.-T.; visualization, F.v.d.M., M.F.A.-C., and V.P.-T.; supervision, F.v.d.M., M.F.A.-C., T.I., and D.M.; project administration, M.F.A.-C., D.M., and T.I.; funding acquisition, M.F.A.-C., D.M., T.I., and V.P.-T. All authors have read and agreed to the published version of the manuscript

Chapter 4. Palomino-Tapia, V.; Mitevski, D.; Inglis, T.; van der Meer, F.; Abdul-Careem, M. F.,

Molecular characterization of Hemorrhagic Enteritis Virus (HEV) obtained from clinical samples in western Canada 2017-2018. Viruses 2020, 12, (9) [3].

• The authors contributions were as follows: Conceptualization, F.v.d.M., M.F.A.-C., and V.P.-T.; methodology, M.F.A.-C., D.M., T.I., and V.P.-T.; software, F.v.d.M., and V.P.- T.; validation, F.v.d.M., M.F.A.-C., and V.P.-T.; formal analysis, F.v.d.M., and V.P.-T.; investigation, D.M., T.I., and V.P.-T.; resources, M.F.A.-C., D.M., T.I., and F.v.d.M.; data curation, F.v.d.M., and V.P.-T.; writing—original draft preparation, V.P.-T.; writing— review and editing, F.v.d.M., M.F.A.-C., and V.P.-T.; visualization, F.v.d.M., M.F.A.-C., and V.P.-T.; supervision, F.v.d.M., M.F.A.-C., T.I. and D.M.; project administration, M.F.A.-C., D.M., and T.I.; funding acquisition, M.F.A.-C., D.M., T.I., and V.P.-T. All authors have read and agreed to the published version of the manuscript.

Acknowledgements

Looking back, I must recognize that I have been extremely lucky and fortunate. Many friends and family members have told me or suggested, in private or in public, that I am talented and/or that I work a lot (perhaps too much, in detriment of my personal life and my poor wife). However, I feel neither of these perceived features can fully account for how an average Peruvian kid could have wound up studying abroad and having access to fully funded Master and Doctorate poultry programs in North America. Please, allow me to make my point by telling you a short story.

Around ten years ago, while consulting for layer poultry farm in Peru, I found that a humble foreman had designed a novel drinking nipple system for caged layers by combining expensive commercial poultry nipples with cheap PVC pipes, toilet tanks, and concrete. This noble foreman, who did not finish elementary school, had saved his employer several thousand dollars in equipment as well as in maintenance by sheer force of mind and resourcefulness. For me, it was and still is inevitable to think that, under similar conditions, he would have fared much, much better than me. Sometimes, at the end of a difficult long day, I think of him and decide to push myself just a little bit more.

I would also like to thank the following:

- My major professor, Dr. Faizal Abdul-Careem, for his guidance and teaching. Your

devotion to your students is an example to all of us.

- My committee, Drs. Frank van der Meer, Darko Mitevski, and Holly Sellers. Thank you

for your continuing mentoring and help.

- My external reviewers Drs. Rodrigo Gallardo and Monique França; and my co-authors Drs.

Emily Martin, Marina Brash, Martin Zuidhof, Carl A Gagnon and Chantale Provost for

sharing your time and expertise. Your comments and assistance have been greatly

appreciated.

- To Dr. Brenda Ralston for her help as liaison within Institute of Applied Poultry

Technologies (IAPT) and the Beef Microbiology Laboratory the laboratory located at

Alberta Agriculture and Forestry – Airdrie Centre (Airdrie, AB T4A 2K4, Canada);

- The University of Calgary Faculty of Veterinary Medicine (UCVM), and the funding

agencies of Alberta Agriculture and Forestry and MITACS for providing me with the

opportunity of conducting research, essentially making this research work possible.

- The routine animal management staff, and veterinarians at the Veterinary Sciences

Research Station (VSRS) at UCVM, especially Dr. Muench, and Greg Boorman; and at

University of Alberta (UofA), especially Dr. Martin Zuidhof. Thank you for your immense

support during my in-vivo studies, which unfortunately due to time constrains, are not part

of this dissertation.

- To Dr. Markus Czub and Jana Hundt for their continuous stimulating conversations.

- To Dr. Grace Kwong for her help with the statistical analysis on our animal studies.

- My brothers and sisters in arms at the Careem’s lab in these five past years: Upasama

Senapathi, Sarjoon-Mohammed Cader, Aruna Amarasinghe, Catalina Barboza-Solis, Ana

Pérez-Contreras, Shahnas Najimudeen, Sabrina Buharideen, and Mohamed Hassan; as well

as my comrades at the virology group at University of Calgary: Jared Rowell, Keith Lau,

Alessa Kuczewski, Maria Arifin, Chimoné Stefni Dalton, and Pearl Cherry. Thank you for

the chats, laughs, boardgames, weird existential conversations, and friendship. I will

cherish those memories for the years to come.

- To Dr. Tom Inglis, for trusting in me, for all your mentoring, the honest conversations, and for

listening to my “crazy” ideas. Without doubt you have made me a better professional. vii

- To the team at Poultry Health Services (PHS), especially to Drs. Juljana Mitevska, Darko

Mitevski, Ben Schlegel, and Luke Nickel, thank you all for sharing your time, knowledge, and

for your continuous support and friendship in this foreign land. I have learned a lot of the

Canadian Poultry Industry and Poultry Diagnostics thanks to you.

- Dr. Pedro Villegas, for making me believe that my dreams weren’t so impossible after all.

- Finally, to my family for their love and support, and to my loving wife Adriana Rincon, main

victim of my long work hours.

viii

Dedication

To Adri. Thank you for your unconditional love, patience, support, and guidance. I am very fortunate of having found you. “Together, we are much more than just two”.

To Mr. Christopher Hitchens, who bluntly and unapologetically taught me to follow the evidence and helped me becoming a better human being as a result.

To one of the greatest scientific minds of all time. Without his seminal work, Science would have been delayed by many years, decades, or even centuries… Although this dissertation is majorly founded on his work, it is just a very small consequence of his findings.

"The Darwin Experience - I Think" by Neal3K is licensed with CC BY-NC-ND 2.0. To view a copy of this license, visit https://creativecommons.org/licenses/by-nc-nd/2.0/

Table of Contents Abstract ...... ii

Preface...... iv

Acknowledgements ...... vi

Dedication ...... ix

Table of Contents ...... x

List of Tables ...... xv

List of Figures and Illustrations ...... xvi

List of Symbols, Abbreviations, and Nomenclature ...... xix

CHAPTER 1: INTRODUCTION ...... 1

1.1 General introduction ...... 1

1.2 Canadian poultry industry ...... 4

1.3 Avian reovirus ...... 6

1.3.1 ARV economic impact ...... 7 1.3.2 ARV Genome structure ...... 8 1.3.3 ARV entry and viral replication ...... 11 1.3.4 ARV pathogenicity ...... 11 1.3.5 Molecular epidemiology of ARV ...... 13 1.4 Chicken astrovirus ...... 14

1.4.1 CAstV economic impact ...... 14 1.4.2 Genome structure ...... 15 1.4.3 CAstV entry and viral replication ...... 16 1.4.4 CAstV pathogenicity ...... 18 1.4.5 Molecular epidemiology of CAstV...... 19

1.5 Turkey Hemorrhagic Enteritis Virus ...... 21

1.5.1 HEV economic impact ...... 21 1.5.2 Genome structure ...... 22 1.5.3 HEV entry and viral replication ...... 22 1.5.4 HEV Pathogenicity ...... 25 1.5.5 Classification of HEV ...... 28 1.6 Statement of Rationale ...... 29

1.7 Study hypotheses ...... 31

1.8 Study objectives ...... 32

CHAPTER 2: MOLECULAR CHARACTERIZATION OF EMERGING AVIAN

REOVIRUS VARIANTS ISOLATED FROM VIRAL ARTHRITIS CASES IN WESTERN

CANADA 2012-2017 BASED ON PARTIAL SIGMA (σ)C GENE [1] ...... 33

2.1 Abstract ...... 33

2.2 Introduction ...... 33

2.3 Materials and Methods ...... 36

2.3.1 ARV Propagation ...... 36 2.3.2 RNA Extraction, RT-PCR, PCR, and Gel Purification ...... 36 2.3.3 Phylogenetic analysis ...... 37 2.4 Results ...... 39

2.4.1 Clinical sample collection for virus isolation and histopathology ...... 39 2.4.2 Histopathology evaluation and ARV propagation in Leghorn Male Hepatoma (LMH) cells 40 2.4.3 Western Canada ARV genotyping clusters and phylogenetic and amino acid analysis comparison of partial σC gene amongst other North American isolates ...... 43 2.5 Discussion ...... 52

2.6 Conclusions ...... 55

2.7 Supplementary Materials...... 56

CHAPTER 3: CHICKEN ASTROVIRUS (CAstV) MOLECULAR STUDIES REVEAL

EVIDENCE OF MULTIPLE PAST RECOMBINATION EVENTS IN SEQUENCES

ORIGINATED FROM CLINICAL SAMPLES OF WHITE CHICK SYNDROME (WCS) IN

WESTERN CANADA...... 68

3.1 Abstract ...... 68

3.2 Introduction ...... 69

3.3 Materials and Methods ...... 71

3.3.1 Sample collection, histopathology, and processing ...... 71 3.3.2 Virus Propagation ...... 72 3.3.3 RNA extraction, Reverse Transcription, qPCR and sequencing ...... 73 3.3.4 Data analysis & Phylogenetic analysis ...... 75 3.3.5 Recombination Analysis ...... 76 3.4 Results ...... 78

3.4.1 Clinical background, gross lesions, and histopathology ...... 78 3.4.2 Whole genome sequencing ...... 82 3.4.3 ORF1a ...... 87 3.4.4 ORF1b ...... 87 3.4.5 Genotyping and comparison of ORF2 ...... 88 3.4.6 Recombination Analysis ...... 90 3.5 Discussion ...... 94

3.6 Conclusions ...... 98

3.7 Supplementary Materials...... 99

3.8 Funding...... 107

xii

CHAPTER 4: MOLECULAR CHARACTERIZATION OF HEMORRHAGIC ENTERITIS

VIRUS (HEV) OBTAINED FROM CLINICAL SAMPLES IN WESTERN CANADA 2017–

2018 [3] ...... 108

4.1 Abstract ...... 108

4.2 Introduction ...... 109

4.3 Material and Methods...... 113

4.3.1 Sample collection, Processing, and Ultracentrifugation ...... 113 4.3.2 DNA Extraction, PCR, and Sequencing ...... 116 4.3.3 Data Analysis ...... 118 4.4 Results ...... 121

4.4.1 Whole Genome Sequencing ...... 121 4.4.2 Hexon Gene ...... 124 4.4.3 ORF1 Region ...... 125 4.4.4 E3 Gene ...... 126 4.4.5 Fib knob Domain ...... 126 4.4.6 pTP ...... 127 4.4.7 Prediction of O-Linked Glycosylation Sites in fib Knob by NetOGlyc Service ...... 131 4.4.8 Prediction of N-Linked Glycosylation Sites in fib Knob by NetOGlyc Service ...... 132 4.5 Discussion ...... 137

4.6 Conclusions ...... 143

4.7 Supplementary Materials...... 143

4.8 Funding...... 146

CHAPTER 5: DISCUSSION AND CONCLUSIONS ...... 147

xiii

5.1 Chapter 2. Molecular characterization of emerging avian reovirus variants isolated from viral arthritis cases in western Canada 2012-2017 based on partial σC gene [1]. Published in

“Virology” in July 2018...... 151

5.2 Chapter 3. Chicken Astrovirus (CAstV) Molecular studies reveal evidence of multiple past recombination events in sequences originated from clinical samples of White Chicken

Syndrome (WCS) in western Canada (Submitted for publication to journal “Viruses”) ...... 155

5.3 Chapter 4. Molecular Characterization of Hemorrhagic Enteritis Virus (HEV) Obtained from Clinical Samples in western Canada 2017-2018 [310]. Published on “Viruses” in August

2020. 158

5.4 Future directions ...... 160

5.5 References ...... 161

5.6 Appendices ...... 204

5.6.1 Appendix A: Copyright permissions ...... 204

xiv

List of Tables

Table 1.1 ARV genome segments and viral proteins………………………………………. 10

Table 2.1 List of the 39 ARV isolates deposited in GenBank…………………………….. 43

Table 2.2 List of ARV isolates strains deposited in GenBank and genotyping classification according to year…………………………………………………………… 44

Supplement Table 2.1 List of all ARV isolates included in the phylogenetic trees in the study with GenBank Accession Numbers………………………………………………… 63

Table 3.1 List and Classification of 14 CAstV isolates deposited in GenBank…………... 77

Table 3.2 List of all CAstV sequences in the study with GenBank Accession Numbers… 84

Table 3.3 Details on Recombination Events detected on 24-CAstV sequences………….. 91

Table 3.4 CAstV recombinant sequences and parents/parent-like sequences……………. 92

Supplement Table 3.1 Genome sizes of complete CAstV sequences…………………….. 99

Table 4.1 Details of the samples used in this study in chronological order………………. 108

Table 4.2 Primer sequences used to amplify the HEV genome and ORF1 gene…………. 120

Table 4.3 List of all HEV sequences in the study with GenBank accession numbers……. 122

Table 4.4 List of 22 fib knob sequences and their corresponding NetOGlyc 4.0 Server prediction results (threshold score ≥ 0.5)…………………………………………………. 132

Table 4.5 List of 22 fib knob sequences and their corresponding NetNGlyc 1.0 Server prediction results (threshold score ≥ 0.5)…………………………………………………. 134

Supplement Table 4.1 Sequence differences in Hexon, ORF1, E3, and fib knob domain... 144

Table 5.1 Advantages and disadvantages of main types of vaccines based on licensing requirements. VBG – Veterinary Biologics Guidelines………………………………… 149

List of Figures and Illustrations

Figure 1.1 World meat production by livestock between 1961-2018……………………… 5

Figure 1.2 Illustration of an ARV virion…………………………………………………… 9

Figure 1.3 Illustration of two CAstV virions (Immature Virion, Fig 1.3a; Mature

Trypsin-digested Virion, Fig 1.3b)………………………………………………………... 17

Figure 1.4 Illustration of HEV virion……………………………………………………... 24

Figure 2.1 Viral Arthritis in broilers chickens…………………………………………….. 41

Figure 2.2 ARV Microphotographs of histopathological lesions from clinical cases

(Hematoxylin and eosin staining)…………………………………………………………. 42

Figure 2.3 RAxML Phylogenetic Tree #2 of a total of 79 partial σC sequences (amino acid positions 16-300)…………………………………………………………………… 46

Figure 2.4 Cluster 4 and Cluster 1 sub-clades marked on percentage heat map of aa identity obtained from RAxML Phylogenetic Tree #3……………………………………. 49

Figure 2.5 Multiple amino acid sequence alignment of Tree #2………………………….. 51

Supplemental Fig 2.1 RAxML Phylogenetic Tree #1 of a total of 182 partial σC sequences (first 300 aa)…………………………………………………………………… 57

Supplemental Fig 2.2 Percentage heat map of aa identity obtained from RAxML

Phylogenetic Tree #1……………………………………………………………………… 59

Supplement Figure 2.3. RAxML Phylogenetic Tree #3 of a total of 42 partial σC sequences (first 300 aa)…………………………………………………………………… 60

Supplement Figure 2.4. Percentage heat map of aa identity obtained from RAxML

Phylogenetic Tree #2……………………………………………………………………… 61

xvi

Supplement Figure 2.5 Multiple amino acid sequence alignment of Tree #3 used on

Supplement Fig 2.3………………………………………………………………………... 62

Figure 3.1 Hatching of normal (yellow) and affected (white) chicks. Progenitor broiler breeders had a drop in production, and low hatchability (case 14-1235)…………………. 80

Figure 3.2 Post-mortem examination on dead-in-shell embryos and culls of case 15-

1262a, and histopathology of cases 14-1235a; and 15-1262a respectively……………… 81

Figure 3.3 Nucleotide ML phylogenetic tree of complete CAstV sequences. Different colors indicate different genotypes according to ORF2 analysis described in Smyth et al

2017 (i.e. Aiii, Bi, Bii, Biii, and Biv in red)………………………………………………. 86

Figure 3.4 Amino acid ML phylogenetic tree of 52 ORF2 CAstV sequences……………. 89

Figure 3.5 Bootscan analysis of recombinant CAstV sequences for confirming recombination was performed using Simplot program v3.5.1……………………………. 93

Supplement Figure 3.1 Amino acid ML phylogenetic tree of ORF1a CAstV sequences… 100

Supplement Figure 3.2 Amino acid ML phylogenetic tree of ORF1b CAstV sequences… 101

Supplement Figure 3.3 Nucleotide ML phylogenetic analyses of CAstV on each of the

Recombination Events described on Table 3.2…………………………………………… 103

Supplement Figure 3.4 CAstV microphotographs of histopathological liver lesions on

WCS clinical cases………………………………………………………………………... 106

Figure 4.1 Systemic bacterial infection in 52-day-old turkeys (case 18-0374). This case was submitted due to elevated mortality in a flock without hemorrhagic enteritis virus

(HEV) vaccination………………………………………………………………………… 117

Figure 4.2 Nucleotide RAxML-based phylogenetic tree of complete HEV sequences (a); and amino acid RaxML-based phylogenetic trees of hexon gene (b), respectively………. 125

xvii

Figure 4.3 ORF1 maximum likelihood (ML) tree. Sequences shows all ORF1 HEV sequences previously published in GenBank, and those obtained in the present project…. 128

Figure 4.4 E3 (a) and fib knob domain (b) ML trees. Sequences in bold green were obtained from vaccines in the present study, bold red from non-vaccinated flocks, and bold blue from vaccinated flocks…………………………………………………………. 129

Figure 4.5 Structure of the HEV fib knob domain………………………………………... 130

xviii

List of Symbols, Abbreviations, and Nomenclature

Symbol Definition

°C Degrees Celcius aa Amino acid

AB Alberta

ARV Avian Reovirus

ATCC American type culture collection

B cell Bursa derived lymphocytes

BC British Columbia bp Base pair

CAD Canadian dollars

CAstV Chicken Astrovirus cDNA Complementary DNA

CFIA Canadian Food Inspection Agency

CO2 Carbon Dioxide

Ct Cycle threshold

DNA Deoxyribonucleic acid

DPI Days post-infection

E. coli Escherichia coli

ELISA Enzyme linked immunosorbent assay

H&E Hematoxylin and eosin

H2O Water

HEV Hemorrhagic Enteritis Virus

xix

HSACC Health Sciences Animal Care Committee

Kb Kilo bases

M Molar mL Milliliters mM Millimolar mm Millimetres mRNA Messenger RNA

NCBI National Centre for Biotechnology Information

NGS Next-generation sequencing nsp Nonstructural protein nt nucleotide

ON Ontario

ORF Open reading frame

PBS phosphate buffered saline

PCR Polymerase chain reaction qPCR Quantitative PCR

RAxML Randomized accelerated maximum likelihood

RNA Ribonucleic Acid

RP19 In reference of the B-lymphoblastoid cell line MDTC-RP19, obtained

from Marek’s disease virus-induced tumors in turkeys.

RT Reverse Transcriptase

RT-PCR Reverse transcriptase PCR

SK Saskatchewan

xx ssRNA Single stranded RNA

TCID50 Fifty percent Tissue Culture infectious dose

μL Microliters

μM Micromolar

USA United States of America

VSACC Veterinary Sciences Animal Care Committee

VSRS Veterinary Sciences Research Station

WGS Whole genome sequence

xxi

CHAPTER 1: INTRODUCTION

1.1 General introduction

In recent years, the Canadian Poultry industry, including poultry operations in western Canada,

has been impacted by the emergence and/or the increased incidence of diseases associated with

certain enteric virus infections, namely Avian Reovirus (ARV) [4-7], Chicken Astrovirus

(CAstV)[8, 9], and Hemorrhagic Enteritis virus (HEV) [3, 10]. Two of these viruses, namely

ARV and CAstV, primarily affect chickens, while HEV affects mainly turkeys.

These diseases have gained importance worldwide, including in Canada, as a result of the

economic losses arising from these viral infections in: a) feed conversion, b) high number of

culls/first week mortality, c) secondary bacterial infections, and c) processing plant

condemnations [1, 4, 8, 9, 11] as well as the costly disruptions they cause to the Canadian

Supply Management system as it is perceived by farmers [11]. All representatives of these

three viruses, regardless of their ability to cause disease or level of virulence, will replicate in

the intestine [12-14]. Even though these three poultry enteric viruses were described decades

ago, as was the fact that enteric diseases generate large economic losses to the poultry industry,

information is scarce on basic and applied aspects of these viruses [15-18].

Pathogenic strains of ARV cause tenosynovitis in broilers and turkeys. Birds from all ages are

susceptible to the infection, though severity of the clinical signs depends on the age of infection

[19, 20]. Young birds are infected mainly by vertical transmission (hens-to-progeny) or

horizontally (through the fecal-oral route and abrasions in the skin) [12]. An increased

incidence related to variant arthrotropic reoviruses obtained from clinical cases with

tenosynovitis has been reported in classical-ARV-vaccinated commercial poultry flocks in the

United States of America (USA) and other parts of the world since 2011 [1, 6].

CAstV infects poultry, including chickens and turkeys [21]. In chickens, it causes mainly three clinical manifestations; one of them, White Chicken Syndrome (WCS), has been described since the early 1980s, and has emerged worldwide in the last 6 years [8]. There is still much to understand about WCS; so far, the disease affects susceptible broiler breeders in the laying period, causing decreased hatchability due to embryo mortality. Upon hatching, it is common to observe an increased number of dead-in-shell embryos in the trays at the hatchers, and some depressed, weak, pale-plumage hatched birds (“white chicks”), which usually die within a week and require culling [22].

The third virus, HEV, has been taxonomically classified within the Siadenovirus genus. This adenovirus is usually associated with an acute haemorrhagic gastrointestinal disease, which usually affects turkeys between 6 - 12 weeks of age. The virus gets into a host through the fecal-oral, or the vent route. It mainly affects the bursa of Fabricius, intestine, and spleen of the birds [23]. All HEV strains, including vaccines, are known to cause different degrees of immunosuppression [24, 25]. In recent years, there have been reports of field strains of HEV associated with increased bacterial infections/long vaccine reactions, suggestive of an immunosuppressive nature on those viruses bearing virulence factors different from the vaccine strains [26-28].

Control for these diseases is done by a) the implementation of biosecurity programs, limiting the likelihood of pathogen entry to the farm, and cleaning and disinfecting the farm in between rearing cycles; and b) the implementation of an effective vaccination program. To implement such programs and to epidemiologically understand the disease, we first need to understand the antigenic variation of the challenge in the field and how divergent it is from classical

2 vaccines if available. In extreme cases, flocks are depopulated when most of the birds are affected at a very young age, far from market age [1].

In viruses, this antigenic diversity usually depends on only a few viral proteins, most of them responsible for cell attachment/cell receptor interaction and eliciting neutralizing antibodies; and/or virulence factors responsible of overcoming the immunity conferred by a properly executed vaccination program. In the case of ARV, these diversity studies are currently being performed on the Sigma C (σC) protein in the U.S. [6, 29], Canada [1, 4], Europe [30, 31],

China [32, 33], and Middle East [34, 35]; for CAstV using the Capsid protein (open reading frame or ORF2) in U.S. [36, 37], Canada [8, 9], UK [22, 38], Europe [39], Brazil [18, 40-42],

India [43-46], China [47], and Nigeria [48]; and for HEV using the hexon, and fiber knob domain (fib knob), and virulence factor proteins (ORF1, E3) in U.S. [28, 49], Europe (i.e.

Germany, Italy, Poland) [26, 27, 50], and now in Canada. In this dissertation, results on divergence from classical vaccines (i.e. ARV, HEV), and the diversity of virus and presence of recombinants (i.e. CAstV) are consequential for the Canadian poultry industry, as this knowledge is paramount for the effort of vaccine candidate selection (e.g. different classification systems amongst researchers), vaccine development, and vaccine program implementation. Indeed, vaccination is one of the most effective control strategies for limiting poultry diseases [51-54].

The overall aim of this dissertation was to molecularly characterize the circulating ARV,

CAstV, and HEV in western Canada poultry farms. Each of these chapters corresponds to first author manuscripts that have been published. Thus, this thesis has three main chapters and each one is dedicated to molecular characterization of these three viruses: Chapter 2 for ARV;

Chapter 3 for CAstV, and Chapter 4 for HEV. To conclude, Chapter 5 discusses the findings

of these three manuscripts on the general knowledge of these diseases and its effects on the

Poultry Industry in western Canada, the limitations of the study, and future directions. This

introductory chapter provides general information about each of the viruses and underscores

the key take-home messages of this research. It also discusses future knowledge gaps for

developing vaccines leading to the control of these diseases in the field and the reduction of

the economic impact of these diseases on the Canadian poultry industry with an emphasis on

western Canada.

1.2 Canadian poultry industry

Poultry is currently the most produced meat worldwide, followed by pork and beef (Figure

1.1) [55, 56]. It is also the fastest growing meat type, with a projected 16% production increase

in the next 10 years [57]. Currently, chicken is the most consumed meat in Canada at 35.13 kg

per capita [58] contributing to poultry and egg products worth a combined total of 4.8 billion

Canadian Dollars (CAD) to the Canadian economy [59, 60]. Nearly 10% of the Canadian

chicken and turkey production (i.e. 9.5%) takes place in Alberta; and together with other

neighboring provinces, namely British Columbia (BC), Saskatchewan (SK), and Manitoba

(MB) which are commonly referred to as western Canada, produce 31.9% of the chicken, and

31% of the turkey meat in Canada [61].

In the last 2 decades, the Canadian poultry industry has been growing steadily (it has risen by

~9 kg per capita since 1998) [61, 62]. Reasons for this growth are the presumed superior health

attributes of chicken meat, its feed-efficient production, and its broad cultural acceptability; in

contrast, other meats have sustained major challenges due to fluctuating international market

prices and significant increases of feed costs [62]. Unlike other countries, the poultry supply

4 of commercial products in Canada is “controlled” through a marketing system [63], and producers are required to hold a right or “quota” in order to produce and sell their goods [11].

Figure 1.1 World meat production by livestock between 1961-2018 [56]. Copyright

permission by CC BY OurWorldInData.org.

Because production levels of poultry goods (“quotas”) are determined each year in advance, diseases that cause disruptions in the production system, such as increased level of culls (i.e.

ARV, and CAstV), condemnations of chicken and turkeys at the processing plant (ARV in chickens, and immunosuppression due to HEV infection in turkeys), and/or a drop in hatchability in several broiler breeder flocks (CAstV). All of this would generate the need for urgent import of hatching eggs, which may or may not be of poor quality, with a different broiler breeder vaccination program and the chance of bringing new vertically transmitted

viruses into Canada [1, 11]. Thus, it is crucial to understand the antigenic variation challenges

of emergent viruses in western Canada (i.e. ARV, CAstV, and THEV) in order to implement

efficient disease control strategies.

1.3 Avian reovirus

The ARV is a ubiquitous poultry virus that has been taxonomically classified as a member of

the family Reoviridae, subfamily Spinareovirinae and the genus Orthoreovirus [64]. The virus

was first isolated in 1954 from the respiratory tract of a chicken [65], and later in 1957 from a

case of synovitis in chickens [66]. In 1972, the virus was identified as a reovirus, which stands

for Respiratory Enteric Orphan (REO) virus [65-67]. It has been associated with several

syndromes and enteric diseases, such as immunosuppression, runting-stunting syndrome

(RSS), myocarditis hepatitis and viral arthritis (VA), as well as respiratory diseases, from

which the most important manifestation and clear association is VA [12]. The ARV

vaccination program in broiler breeders in North America usually consists of two live

vaccinations, one at day of age (with a highly passaged vaccine) by subcutaneous injection

route, and the other one at five weeks of age by drinking water route (low passaged vaccine),

and two inactivated vaccines applied at 10-12 weeks of age and between 16-18 weeks of age

by intramuscular injection route [6, 68]. This vaccination control program is in contrast of

other vertically-transmitted diseases requiring lighter vaccination programs, such as Chicken

Infectious Anemia [69], or Avian Encephalomyelitis [70] both of which require only one live

vaccine application. Although parent stocks are heavily vaccinated with classical live and

inactivated vaccines developed in the 1980s, outbreaks of VA have been occurring since 2011

in North America and Europe, mostly caused by variant ARVs antigenically different from

classical vaccines [1, 4, 71]. Understanding the diversity of the challenge virus circulating in

the field is crucial to an autogenous vaccination program to control the disease in western

Canada.

1.3.1 ARV economic impact

Avian Reoviruses can be found in intestines of chickens worldwide with only a minority

of the isolates being pathogenic [12]. Because of this, isolation of an ARV from the

intestine is not suggestive of pathogenicity, and viral isolation from affected hock joint

tissues/synovial fluid can be interpreted as the cause of the lesions [6]. Economic losses

due to culling, morbidity, and condemnations with clinical signs compatible to VA are

important and can account for 100% of the flock and trigger depopulation [1]. Severity and

flock distribution of the clinical signs (i.e. lameness, RSS), especially near to the processing

age, are closely related with the degree of economic losses of a poultry operation infected

with a pathogenic ARV [12]. Economic impact can be categorized in a)

mortality/culling/depopulation, which can be severe due to increased mortality [29], the

level of lame birds in the flock which causes a high number of cullings, and even

depopulation of the flock, if most of the birds are affected [1]; b) Condemnations, which

can be of the complete carcass caused by secondary bacterial infections, due to cellulitis

by scratches in prostrate birds; or partial carcass condemnation, as tenosynovitis can trigger

condemnation of the affected limb(s) [31]; and c) performance losses, due to poor feed

conversions, lack of uniformity and low performance of the flock [72]. Sometimes, further

losses can be avoided with an early marketing of the flock, specially near the onset of

clinical signs [12].

1.3.2 ARV Genome structure

The ARV genome consists of double-stranded RNA, divided into 10 genome segments: 3

large (L1-L3), 3 medium (M1-M3), and 4 small (S1-S4). These segments encode 12

primary translation products as S1 produces 3 translation products (Table 1.1), 8 of which

are structural components while the remaining 4 are non-structural proteins (Fig 1.2).

Within these, the S1 segment codes for the σC, which is the immunologically dominant

structural protein (Fig 1.1). The σC protein is involved in cell attachment, and thus is

vulnerable to neutralizing antibodies [6, 30, 73, 74]. Other ARV proteins have been

investigated and found that are also involved in neutralization of homologous virus such

as λB and σB, which confer broadly specific neutralizing activity, analogous to the λ2 and

σ3 proteins found in mammalian reovirus [29, 73, 75-78]. However, the σC protein,

analogous to σ1 protein in mammalian reovirus, is recognized as the only viral protein

inducing a virus type-specific neutralizing immunity and, therefore, more important than

the immunity conferred by λB and σB [4, 29, 73, 75, 76, 79]. Hitherto, research on

replication of avian reovirus and other mammalian reoviruses has not been able to identify

the cell receptor used by the virus for cell entry [76, 80], or the target cells at the joints

responsible for the tendon damage.

Figure 1.2 Illustration of an ARV virion, with σC protein as homotrimer, prepared by the author of this thesis inspired by the works of Benavente, J and Martinez-Costas J 2007 [80], and research results of Goldenberg et al 2010 [81]. The genome contains 10 viral genes. The virion consists of an inner core (viral proteins λA, σA); an outer shell (viral proteins μB, σB); turrets that extend from the inner core into the outer core (viral protein λC), and the cell-attachment protein σC, which projects from the turrets [80, 81].

Table 1.1 ARV genome segments and viral proteins modified from Benavente and Martinez-

Costas 2007 and updated according with current publications [71, 80, 82, 83].

Viral Segment Encoded Location Function Size (aa) (kb) Protein L1 (~3.9kb) λA Inner Core Core shell scaffold ~1,293 aa

L2 (~3.8kb) λB Inner Core Transcriptase ~1,259 aa

L3 (~3.9kb) λC Turrets Capping enzyme ~1,285 aa

M1 (~2.2kb) μA Inner Core Transcriptase co-factor ~732 aa

μB ~676 aa Penetration (μBN and μBC originate M2 (~2.1kb) μBN Outer capsid ~42 aa from post-translational cleavage of μB) μBC ~634 aa

μNS Formation of viral factories (μNSC and ~635 aa

M3 (~1.9kb) μNSC Non-Structural μNSN originate from post-translational NDa

μNSN cleavage of μNS) NDa

σC Outer Capsid Cell Attachment 326 aa

S1 (~1.6kb) p10 Permeabilizing/fusogenic 98 aa Non-structural p17 Induction of autophagosomes. 146 aa

dsRNA binding, anti-interferon S2 (~1.2kb) σA Inner Core 416 aa activity, autophagosomes.

Dysregulation of molecular patterns

(downregulation and upregulation) of S3 (~1.1kb) σB Outer Capsid 367 aa genes favouring the development of

tenosynovytis

S4 (~1.1kb) σNS Non-structural ssRNA binding 367 aa

1.3.3 ARV entry and viral replication

The virion attaches to its cellular receptor via the σC protein, which triggers the endocytosis of the attached virus. Once in the lysosomes, the virions are degraded to core particles under low pH conditions before entering the cytoplasm [84], which triggers the virion-associated RNA- dependent RNA polymerase, and capping enzymes to transcribe 10 mRNAs (each corresponding to a virus segment) that are then released into the cytoplasm of the infected cell [85]. The S1 transcript contains three out-of-phase and partially overlapping cistrons expressing p10, p17, and

σC (Table 1.1) [80]. These mRNA are translated and interact with recently-translated viral proteins to form sub-viral particles, which continue to produce mRNA for translation by the cell machinery, and promote the assembly of additional subviral particles, putting together the core for the outer capsid proteins to be added to form the mature virus [80, 85, 86]. Once mature, viral particles are released from the cell by lysis [80]; however, the mechanisms causing cell lysis are not known

[87],

1.3.4 ARV pathogenicity

ARVs are ubiquitous in chicken and turkey farms worldwide and are commonly found in the intestine and respiratory tract of healthy chickens and turkeys. It is estimated that pathogenic strains of ARV represent a small portion (~20%) of the total ARVs isolated from chickens [88,

89]. The viral infections produced by pathogenic ARVs are commonly associated with arthritis in chickens and turkeys, as well as other disease syndromes and conditions such as: RSS (growth retardation), pericarditis, enteritis, atrophy of thymus and bursa of Fabricius, and respiratory syndromes [64]. It is widely recognized that the ARV is mainly an enteric virus which replicates chiefly in the intestine [90] and liver [20]; transmission occurs mainly through the fecal-oral route

11 but also vertically [91] and through damaged skin [92]. In the environment, as a non-enveloped virus, ARV can survive for extended periods of time due to its resistance to heat (e.g. 15-16 weeks for 37°C; 48-51 weeks for 22°C); disinfectants (2% Lysol, 3% formalin); and fomites (e.g. 10 days in feathers, in feed and up to 10 weeks in drinking water) [93].

Pathogenic arthrotropic ARV strains that cause VA have a tropism for the joints, mainly the tibio-femoral joint, and the tibiotarsal-tarsometatarsal joint (hock). Of these two joints, the latter is the main weight-bearing joint in the bird, thus this joint and its tendons are the most affected by the disease [94]. Thus, VA-affected birds are commonly impacted with inflammation of the gastrocnemius, digital flexor, and/or metatarsal extensor tendons. Under these conditions, the affected tendon loses elasticity and, depending on the level of inflammation and stress (e.g. weight of the bird), the tendon ruptures together with the blood vessels surrounding it, resulting in the inability of the bird to move the metatarsus [64]. This condition can occur in one or in both legs and is called unilateral or bilateral lameness, respectively. VA has been described in both, meat-type and table egg layers, although the disease is most important in the former than in the latter [6, 64]. It is probable that this breed susceptibility plays a role in the outcome of the disease since the joints of heavy meat-type chickens are required to sustain more weight per square inch, and, therefore, are subjected to more stress than the joints of light table egg layer breeds.

The protective immunity against VA is mainly humoral, although cellular immunity is required for clearing the infection [95]. It is likely that the presence of systemic antibodies prevents or decreases the ability of the pathogenic ARVs present in the gut from reaching the joints and/or reproductive organs, therefore preventing disease and limiting horizontal and vertical transmission of ARV strains homologous to the vaccine virus eliciting the immunity. Traditionally, the disease has been controlled by vaccination of the parent stock using live-modified and inactivated vaccines

12 developed in the late 70s and early 80s [74, 96]. Since 2011, new emerging ARV infections have occurred around the world, including USA and Canada [1, 4, 29, 31]. These emerging infections seem to be refractory to the immunity generated by commercial ARV vaccines but preventable through inactivated vaccines prepared with homologous challenge strains (autogenous vaccination) [1, 4, 6].

Currently, commercial ARV vaccines appear to provide insufficient protection against emergent ARV antigenic variants. It is noteworthy that VA outbreaks in well vaccinated flocks occurred across North America and in several other countries in recent times [1, 4, 78], prompting intensified molecular characterization of ARVs by sequencing the σC gene. Although variant

ARVs have been reported since 2003 [76, 97], presumably as a natural consequence of the high mutation rate of the virus (the mutation rate of dsRNA virus is 10-6-10-4 substitution per nucleotide per round of copying[98-100], and for ARV in particular, 2.3 x 10-3 substitution/site/year [101]), which only non-synonymous mutations translate into amino acid changes. This increased identification of variant ARVs worldwide that are less susceptible to commercial-vaccine induced immunity has occurred in extensive geographical areas around the world in a relatively short span of time [30, 31].

1.3.5 Molecular epidemiology of ARV

ARV strains can be classified according to a) pathotype, requiring inoculation in birds [75,

102, 103], b) serogroup, requiring balanced levels of specific antibodies and quantities of determined reference ARV strains [81, 104, 105], and c) genotype, analyzing the protein responsible of cell attachment, the σC protein, and its encoding gene [76].

So far, phylogenetical analyses performed on the σC protein sequences obtained from isolated ARVs corresponding to different pathotypes and geographical locations have identified six genotypic clusters with no particular relation to pathotype [1, 4, 29]; some of them have such a level of diversity that it is speculated that cross-protection between members of a given cluster is limited [1].

1.4 Chicken astrovirus

The CAstV [106], an enteric, non-enveloped, positive-sense RNA virus has recently emerged as an important poultry pathogen in hatching broilers across North America, Brazil,

China, and several European countries including Poland from non-existent or rarely observed, to several outbreaks per year [8, 13, 22, 47, 107-109]. In 2019, the International Committee of

Taxonomy of viruses (ICTV), classified CAstV, together with Avian Nephritis Virus (ANV), as members of the Avastrovirus II species within the genus Avastrovirus, in the Astroviridae family

[110, 111]. It is worth noting that classification of astroviruses has changed several times since first descriptions were published in the late 1970s-early 1980s [112-114]. These continuous changes had led to confusion amongst researchers, for instance, in some recent publications,

CAstV was classified as “Avastrovirus I” [47], whereas in others as “Avastrovirus II” following

2019 ICTV taxonomy [13, 22]. Molecular biology studies will shed light on epidemiological features of the virus and contribute to design a future autogenous vaccination program strategy.

1.4.1 CAstV economic impact

All CAstVs replicate mainly in the intestine [22, 38]. Economic losses are closely related with the type of clinical manifestation of pathogenic CAstV infection in the flock, which can be:

14 a) RSS, b) Kidney disease and visceral gout; and c) WCS. For instance, mortality and culling would be of great importance with kidney disease and visceral gout, which has reported mortalities of up to 40% in young broilers between 6-9 days of age [44, 46], as well as in WCS, with some depressed white chicks at hatch succumbing to the infection during the first week of life [8, 9, 13], and RSS-affected flocks in which some birds would have to be culled due to severe growth depression [22]. Performance losses are variable . For instance, in case of WCS, losses in Canada were estimated to be an average of 5,912 CAD (4,417 USD) per 10 000 hens, with peaks of 16,788

CAD (12,544 USD) per 10 000 in the most severe cases with egg production drops of 0-15% and hatchability drops of 1.8-49.1% in 2017 [9]. In the case of RSS, performance losses are much more difficult to quantify as the syndrome is depending on a myriad of factors, including co-infection with other pathogens. All of this can create a “multi-factorial scenario” leading to the establishment of the syndrome [22, 48, 115, 116].

1.4.2 Genome structure

The genetic organization of CAstV is similar to other astroviruses as it is composed of a small, linear, positive sense RNA of ~7.5 kilo base pairs (kb) in length, coding for 3 ORFs: a non- structural protein (ORF1a), a viral RNA-dependent RNA polymerase (ORF1b, also named RdRp), and a capsid protein (ORF2) [13, 22, 36, 117]. The capsid protein is highly variable, especially on its 3’ half of the ORF, which forms the external surface of the capsid, forming the characteristically five- or six-pointed star-like projections of astroviruses [118-120].

1.4.3 CAstV entry and viral replication

The capsid protein (ORF2) interacts with the host cell receptor, which is unknown as a result, and is exposed to the host immune system [13, 22, 118]; and has been divided into 2 major antigen groups with sub-divisions: Group A divided into 3 subgroups (i.e. Ai, Aii, and Aiii); and

Group B divided into four subgroups (i.e. Bi, Bii, Biii, and Biv) [22]. These differences are believed to change the tropism of the virus towards a particular tissue (e.g. liver, kidney, intestine), suggesting that more than one receptor molecule for cell entry may be used [121]. Although the replication of CAstV has been poorly studied, there are some reasonable assumptions corresponding to all linear, single stranded, positive-sense RNA viruses. For instance, it can be hypothesized that after translation of the positive sense viral RNA and proteolytic action of ORF1a non-structural protein, an assembly of viral and cellular proteins (viral replicase complex) is formed with the objective of producing viral genomic RNA (gRNA) and messenger RNA (mRNA) in the infected cell [122]. Mature virions are most likely released by cell lysis [123].

Capsid Capsid Projections b) Projections a) (90) (30)

Immature Virion (Not Trypsinized) Mature Virion

Figure 1.2 Illustration of two CAstV virions (Immature(Trypsinized) Virion, Fig 1.3a; Mature Trypsin-

digested Virion, Fig 1.3b). Figures are based on a cryo-electron reconstruction of a Human

astrovirus published by Arias et al 2017 [118]. Image modified and reproduced under the

terms and conditions of the Creative Commons Attribution (CC BY) license

(http://creativecommons.org/licenses/by/4.0). The Capsid protein coded by ORF2 sequence,

constitutes the capsid forming an inner, continuous core layer, and an outer layer containing

90 globular spikes. Upon trypsinization in the gut, the outer layer shows only 30 spikes. It

is not clear if the other 60 are released from the virus or if they remain loosely attached to

the virion [118, 119].

1.4.4 CAstV pathogenicity

Features of the capsid protein of CAstV are believed to drive the pathogenesis into 3 syndromes/diseases that are not mutually exclusive. In WCS, some of hatched chicks are considered “white chicks”, a condition characterized by pale plumage, weakness, slow weight gain, poor condition and eventually death during the first days of life [13, 107, 124]. Lesions can be observed in kidney, liver, feathers, and intestine [13, 22, 107, 124]. Although WCS has been known in England [112] and Canada since 1980s [8, 9], the author of this thesis has found none to few reports of the disease in different areas of the world dating from late 1980s to 2010s. It has only recently been associated with CAstV in 2012 upon increasing reports of WCS in North

America, and the emergence of the disease in Brazil [8, 18]. Improvements on surveillance and diagnostic assays have revealed an increased incidence of the problem, and important economic losses have rendered WCS an emerging problem in poultry production in Canada [8, 9, 125].

Transmission of CAstV can be horizontal, through the fecal-oral route; and probably vertical, although this has not been experimentally proven [8, 13, 22]. In the case of WCS, the virus can be detected in dead-in-shell embryos, meconium, and young chickens within the first week of life [8, 36, 112]. Progenitor broiler breeders of affected broiler flocks usually have a history of no hatchability decrease or a decrease up to 68% [8, 13, 22]. Many studies speculate that progenitor flocks, naïve to CAstV, are challenged during production, experience a variable decrease in hatchability (with birds hatching as “white chicks”), and return to normality after ~4 week period, where they become seropositive by commercial CAstV Group B ELISA testing [13,

22, 126].

In contrast to our knowledge of the molecular and epidemiologic characteristics of CAstV, our comprehension of CAstV pathogenesis is still scarce. Studies performed in a similar virus of

18 turkeys that affects mainly the gut, Turkey Astrovirus-1 (TAstV-1), showed that the virus infection changed the expression of sodium transporters and enzymes in the brush border of the gut, decreasing absorption of D-xylose, and resulting in malabsorption and diarrhea by osmosis [127,

128]. This dysregulation of enzyme expressions and transporters may result from changes of the cellular cytoskeleton according to Moser et al, and Nighot et al [127-130].

Currently, the control of this disease is impaired by its large area of distribution, its ability to transmit vertically and horizontally, the virus stability, the resilience to disinfection, and the lack of a commercially-available vaccines, as CAstV is difficult to grow at titers that allow cost- effective commercial autogenous vaccine production [8, 13, 21]. So far, the Canadian poultry industry is relying on strict biosecurity, increased down time between flocks and effective disinfection of the premises by selecting chemicals proven to inactivate CAstV at appropriate concentrations. In some operations the controversial practice of controlled-exposure by moving litter from CAstV ELISA-positive flocks into naïve pullet flocks is also used despite the dangers of exposing naïve birds to other important pathogens such as Mycoplasma or Salmonella species.

Recently, several outbreaks of WCS were identified across western Canada and Ontario.

These outbreaks have caused considerable losses in Canadian poultry operations not only due to the detrimental effects of the disease, but also due to the sudden changes in allocation of day-old broiler chickens, which are of importance in the Canadian Supply Management System.

1.4.5 Molecular epidemiology of CAstV

CAstV strains can be classified according to their: a) pathotype (RSS, Kidney/Gout disease, WCS), which requires in vivo studies for classification [36, 42, 46, 107, 131], and b) their genotype, analyzing the capsid protein (coded by the ORF2) responsible for attachment and

19 susceptible to neutralizing antibodies [22, 47]. Serogrouping research has been limited and conducted more for Turkey Astroviruses [132, 133], than for CAstV in part due to the inherent laborious features of virus-neutralization tests required to accomplish this classification (i.e. generating virus stocks, specific virus-neutralizing antisera) [134], and the impressive variability of the Capsid protein between different sequences potentially resulting in an increasing number of serotype misclassifications amongst researchers [13, 135]. CAstV genotyping of the complete capsid protein (ORF2 gene) have shown the great variation between isolates and has revealed the presence of two major antigenic groups, namely A, and B [22]. These antigenic groups had important subclusters, that have been associated with specific CAstV manifestations. For instance, subcluster Biii CAstV isolates were obtained from clinical cases with kidney disease and visceral gout, and were able to reproduce the disease [44, 46]; and subcluster Biv CAstVs were isolated from WCS cases, although no sequences were published in GenBank [22]. The high level of diversity between CAstVs suggests a low to no cross-protection between viruses from different subclusters.

1.5 Turkey Hemorrhagic Enteritis Virus

The HEV is an enteric, non-enveloped, double-stranded DNA virus, present in all turkey- meat producing countries [23]. First observed in 1936 [136], the virus has been classified as Turkey siadenovirus A, a member of the family Adenoviridae, genus Siadenovirus. Using molecular biology tools, it has been shown that HEV infection was associated with three different pathologies in different species of birds: 1) Marble Spleen Disease (MSD) causing respiratory disease in pheasants; 2) Avian Adenovirus Splenomegaly (AAS) in chickens, causing an MSD-like milder disease which is of rare occurrence; and 3) Hemorrhagic enteritis (HE) in turkeys, causing an acute bloody enteritis, death and immunosuppression [14]. Being a most economical clinical entity, HE has been successfully controlled in turkeys using commercial tissue culture and splenic vaccines developed in the 1980s, as well as autogenous splenic vaccines produced by turkey-meat producing companies for their own use [14]. All vaccines are immunosuppressive on their own account and may predispose young animals to secondary bacterial infections [24]. Furthermore, in recent years, evidence has been mounting regarding the circulation of wild type HEV different from HEV vaccine strains used in the turkey farms in USA, Germany, and Italy suggesting that the HEV vaccination programs used may not protect against new circulating variants [26-28].

1.5.1 HEV economic impact

Out of the three HEV manifestations explored in the previous segment, the most important is HE, which affects turkeys. Prior to the extensive use of the vaccine by the turkey industry, the direct losses due to HE surpassed the 3 million USD/year y [137]; while the losses associated with immunosuppression were indirectly quantified by the economic losses associated with colibacillosis in turkey flocks which were calculated to be around the 40 million USD/year [138].

Currently, the clinical HE disease is not observed in the field unless incorrect vaccination or no vaccination leading to a failure in HEV immunization has occurred in the flock [14]. However, in recent years, an increase in secondary infections suggestive of immunosuppression events has been observed in meat turkeys, which has caused a wave in HEV research in USA [28, 49], and Europe

(i.e. Germany, Italy and Poland) [26, 27, 50]. No assessment has been done in the economic impact of the other two HEV-infection manifestations in pheasants (MSD) and chickens (AAS) [14].

1.5.2 Genome structure

HEV has a linear, double-stranded DNA genome of 26.6 kb [137], and codes for 8 ORFs distributed in two clusters [139]. Within these, the hexon and fiber proteins are important for their involvement in cell attachment and entry plus the induction of neutralizing antibodies and protection against the disease [140-142]. When virulent (HEVs able to cause HE in SPF turkeys) and avirulent (HEVs that did not cause HE in SPF turkeys) were compared, their genomes shared

99.9% nucleotide (nt) identity [28]. Differences between these virulent and avirulent strains were found in ORF1, E3, fiber (fib knob domain) [28], and hexon [27] genes and may be involved in

HEV virulence.

1.5.3 HEV entry and viral replication

The fiber protein, through the fib domain, interacts with sialic acids (perhaps α2,3-and α2,6 linked) [141, 143] expressed on susceptible host cells mainly in the intestine and spleen, but also in other target organs/cells (i.e. bursa of Fabricius, cecal tonsils, thymus, liver, kidney, circulating leukocytes, macrophages, B lymphocytes, and lungs). Interestingly, recent crystallography research has shown that this trimeric protein resembles more the structure of reoviruses than

22 adenoviruses [141]. After binding of the fib knob with host receptor, the virus is internalized following interaction with the penton base (see III protein-penton base at Fig 1.4) and cellular integrins [144]. The outer capsid layer is destabilized by the endosome low pH, releasing the pVI protein which disrupts the endosome membrane and allows the entry of the core containing the viral DNA into the cytoplasm [85, 144]. The capsid is then transported to the nucleus using microtubules; once in the nucleus, the core binds to the nuclear core complex and releases the viral

DNA inside the nucleus of the infected cell. There, the genome is transcribed for mRNA production, and replicated for generation of new viral DNA copies. New virions are also assembled in the nucleus and are released upon destruction of the cell [145].

Turkey Hemorrhagic Enteritis Virus

II protein (hexon) III protein (penton base) IIIa protein IV protein (fiber) V protein VI protein VII protein pVIII protein IX protein (hydrophobic?) X protein TP (Terminal (Protein)

Viral DNA IV protein (fib knob) Figure 1.4. Illustration of HEV virion based on a modified representation of a viral particle from the family Adenoviridae. "File:Adeno structure Vector illustration.png" by Eladk is licensed with

CC BY-SA 3.0 https://creativecommons.org/licenses/by-sa/3.0. The Adenoviridae virion consists of an outer core composed by the following proteins (hexon-II, penton base-III, IIIa, fiber-IV, VI, pVIII, IX), and an inner core with proteins (V, VII, X, and TP proteins).

1.5.4 HEV Pathogenicity

In turkeys, HEV has two presentations: 1) clinical disease consisting of depression, gastrointestinal hemorrhages, and transient immunosuppression followed by increased mortality

(up to 80% for highly virulent strains due to blood loss and secondary infection with opportunists like Escherichia coli) [14, 23, 146]; and 2) subclinical infection, consisting in immunosuppression and causing economical losses because of secondary bacterial infection, especially from E. coli, and processing plant condemnations [146-148]. The immunosuppression caused by the subclinical infection increases the bird susceptibility to secondary bacterial infections, which poses a problem for the judicious antibiotic use in farm animals, both being important problems for the turkey industry [24].

The rate of clinical disease (bloody feces, and acute mortality) has become low due to vaccination and circulation of avirulent HE in the field [27], yet, many reports have suggested that avirulent strains are able to trigger subclinical infection in turkeys, causing strong immunosuppression and losses due to exacerbation of viral and bacterial diseases [50, 146].

Despite this, some Canadian poultry producers do not regularly vaccinate their turkey flocks against HE due to the absence of clinical disease amidst seroconversion in the flocks, disregarding the potential immunosuppressive nature of these avirulent strains. Currently, HEV is immunosuppressive and responsible for morbidity and mortality [23, 25, 149].

Transmission of HEV can be horizontally through fecal-oral/cloacal routes [150-153] and, unlike other adenoviruses, there is no evidence of vertical transmission [23, 137], insect vectors are not known. Recent data suggests that recovered birds can become persistently infected and in some cases become long term virus shedders [154], in this way contributing to the persistence of the pathogen in the population. Being an adenovirus, it increases its resistance to the elements

25 when it is protected from drying [155, 156], and it will remain viable for up to 7 weeks in contaminated carcasses or feces [137]. It has been found to remain stable for one hour at a temperature of about 65 °C, at 37 °C for up to 4 weeks or at 4 °C (40 °F) for 6 months and at least for 4 years at −20 °C [137]. This resistance to environmental influences contributes to the HEV survival despite cleaning, and disinfection between production cycles.

Upon ingestion or cloacal entry, the virus replicates in the gastrointestinal tract leading to a primary viremia from which the virus spreads to other internal organs, such as bursa of Fabricius and spleen. As HEV is considered an enterotropic, lymphotropic and lymphocytopathic virus [157,

158], it primarily targets IgM bearing B-lymphocytes in the bursa of Fabricius and spleen [159], notably, HEV targets macrophages [160]. Transient immunosuppression, characterized by reduced antibody production by B cells, and diminished phagocytic activity by macrophages, becomes evident during acute phase of the infection [161, 162]. At the same time, high levels of virus can be observed in the lamina propria of the small intestine together with intestinal congestion and hemorrhage, probably caused by the release of prostaglandins and histamine by mast cells [23,

158]. This transient immunosuppressive effect will be more profound in HE caused by virulent strains with HE; compared to avirulent strains [163, 164]. However, avirulent strains are not devoid of the ability to cause disease (apathogenic) and could cause immunosuppression [50, 137, 146].

In addition, there are limited options to study the virus as isolation mainly occur in: 1) naïve ⩾6- week-old SPF turkeys, which are scarce and difficult to obtain [165], and 2) the immortalized cell- line RP19 [166], which grows in suspension, requires extensive paperwork for its use (requested by the Patent Depositor at ATCC), and may not work for all isolates. Thus, a method to study the virus, without passaging it in expensive/difficult systems is necessary.

HEV seems to have only one serotype, and research in the 1970s showed that avirulent strains prevented clinical disease caused by virulent strains [167]. This led to the development of the

Domermuth strain, which is still used as vaccine (Splenic) in Europe. Cell-mediated immune response in the protection against clinical signs is not well understood. Upon infection, there is an increase in splenic CD4+ T cells after 4-6 days post infection (DPI) [14, 147], followed by a CD8+

T cell increase at 16 DPI, with a decrease in some other types of T cells (CD3+, and CD8a+) in spleen and blood [14, 147, 161, 162]. Maternal antibodies are important, as it is expected to provide passive immunity in the progeny of vaccinated turkey breeders and to protect the poults for the first 2-3 weeks of life [14, 168].

Currently, three types of vaccine are used in poultry operations worldwide: a) live, commercial or autogenous “splenic” vaccines, produced from spleens of HEV-infected SPF turkeys; b) live, tissue culture derived vaccines, available in most countries and currently the only vaccine type available in Canada; and c) inactivated vaccines, used more commonly in countries where no live vaccines are permitted [14, 27]. In North America, live vaccines are delivered by the drinking water route at ~4 weeks of age or older according to manufacturer’s instructions. The use of either live vaccine variants (a and b) will induce seroconversion and lead to protection against virus challenge [169]. However, the splenic vaccines induce a strong and immediate immunity and can be given as emergency vaccine during an outbreak [14]. Because of this, splenic vaccines are regarded as a more potent vaccine compared to the tissue culture vaccine, and requires fewer revaccinations in the field to achieve a protective antibody titre [14, 168].

The access to some vaccines, drugs, and ELISA kits is limited due to market constrains

(Canada produces 20 times less turkey meat than USA). In Canada, the tissue culture vaccine is the only vaccine approved for HE control and is applied once using a full dose containing ≥ 102.6

27 median tissue culture infectious dose (TCID50) between 3.5-6 weeks of age, or twice using a lower

2.4 dose (e.g. 2/3 of a dose or ≥ 10 TCID50) at days 25 and 35. This strategy is designed to reduce field HEV circulation in susceptible birds by immunizing birds with low maternal antibodies with the first vaccine delivery (day 25), and to infect those who were not immunized at the first vaccination due to high levels of neutralizing maternal antibodies or low vaccine intake (day 35).

In addition, some producers rely on circulation and protection generated by avirulent field strains and will therefore not vaccinate as there is no manifestation of clinical disease, ignoring the immunosuppressive potential of these field HEV viruses.

Recently, several virulence factors of HEV were identified (i.e. Hexon ORF1, E3, and fib knob domain) [27, 28]. Many reports have found that HEV variants containing these factors are circulating in vaccinated flocks [26, 27]. No clinical disease has been observed in these described flocks, but subclinical infections associated with immunosuppression [26, 27].

1.5.5 Classification of HEV

HEV strains have been classified according to their a) pathotype, as virulent and avirulent strains according to their ability to cause clinical HE when inoculated into naïve poults, characterized by bloody diarrhea and severe enteritis [28]; and b) genotype, which is much recent and requires targeting of multiple virulence factors, such as Hexon, fib knob (part of Fiber protein),

E3, ORF1 [26-28, 50]. All HEV strains isolated have been shown to be of one serotype [167, 170,

171].

1.6 Statement of Rationale

In order to provide sources of protein in a cost-effective manner, the poultry industry (e.g.

meat-type chickens, table-egg layers, and meat turkeys), has opted for a continuous and

methodical increase of the number of birds and throughput of their production cycles through

enhancements on genetics, nutrition, pharmaceuticals, and management [172]. The natural

consequence of this approach has led to the rearing of an increasing number of animals in

smaller conditioned areas, thus intensifying the risk of disease and the load of biological agents

in the flock environment, and rendering more likely the surge of variants either antigenically

different from classical/avirulent vaccine strains [12, 172, 173], or more efficient in infecting

susceptible birds prior to vaccination [172, 174]. Thus, control strategies of ARV, CAstV, and

HEV-induced diseases are crucial for reducing the consequence of the challenge by either: a)

bio exclusion (limiting the exposure to the agent/pathogen); b) depopulation (when most of the

birds are affected); and c) Immunization (limiting the effects of the challenge when birds are

exposed to the agent/pathogen).

The recent increase in the disease occurrence or perceived consequences of the infection

caused by ARV, CAstV, and HEV in western Canada, have triggered investigations focused

on understanding the diversity of the challenge present in poultry farms, and how this diversity

compares with classical vaccine strains used in the field. As mentioned in section 1.1, these

viruses have been studied across the globe. Recently, a Canadian study by Ayalew et al 2017

[4], performed a study characterizing 37 emergent variant ARV strains exclusively obtained

from the province of SK, Canada which corresponded to Clusters 2, 4, 5, and 6 according to

the classification proposed by Kant et al 2003 [76]. In contrast, our research analyzed 38 ARV

29 isolates obtained from three provinces: AB, BC, and SK, and showed that all worldwide published clusters (Clusters 1, 2, 3, 4, 5, and 6), were circulating in western Canada, providing a clear assessment of the ARV challenge in the region [1]. In case of CAstV, there is one study by Long, et al 2018 in which 31 strains detected from 2011-2016 in Ontario (ON), Quebec

(QC), Nova Scotia (NS), SK, and AB were molecular characterized and classified as CAstV

Group B, Subgroup Bii according to Smyth 2017 [8, 22]. However, this characterization was performed based on a partial segment ORF2 gene and not the whole ORF2 gene as is originally described by Smyth 2017 [22]. This partial analysis consisted of performing a phylogenetic analysis on 644 nt segment from a total of 2,217 nt constituting the ORF2 CAstV gene for a coverage of ~29%. Given that this protein is most variable within CAstV genome, to our judgement, this partial analysis is insufficient to reliably assign a genotype. This hypothesis was confirmed upon analysis of their data against our data [2]. Thus, it was noted that there was a gap of knowledge and a need for CAstV isolates obtained from clinical cases in AB and

SK to be subjected to a more in-depth analysis. In the case of HEV, it was the first study analysing the variability of HEV detected in field samples in Canada [3].

Therefore, in those diseases for which a commercial vaccine is available (i.e. ARV, HEV) it is necessary to evaluate if vaccines are expected to provide protection against a challenge with the prevalent field strain, whereas in other diseases in which a vaccine is not available (i.e.

AstV) these studies are necessary to understand the challenge and make decisions on what disease control strategy is to follow. For instance, the presence of the same or similar challenge strain continuously being isolated from a farm, would suggest that cleaning and disinfection procedures need to be reviewed. Also, record tracking at the hatchery could be implemented

to certain “problem farms” with repetitive CAstV issues, so special conditions for hatching are

applied and the spread of this enteric virus to susceptible birds is limited.

These molecular characterization studies, designed to understand the current ARV, CAstV,

and HEV challenge circulating in the field, are crucial for designing a comprehensive disease

control plan entailing immunization. In case the challenge viruses circulating is similar or close

to standard licensed vaccines that are currently being used by the industry, then control through

the use of classical vaccines should be possible and vaccine failure in flocks affected should

be investigated and confirmed using in-vivo studies. On the other hand, if the challenge viruses

are shown to be different from standard license vaccines (variants), then control through the

manufacturing of custom-made, “complex-specific” or “farm-specific” autogenous vaccines

made with isolates obtained from affected flocks would be advisable in order to overcome the

shortcomings of the classical standard licensed commercial vaccines, one of the most important

not providing immunity against antigenically different viruses.

1.7 Study hypotheses

My hypotheses were:

1. Clinical VA cases detected since 2011 in western Canada are associated with the presence

of ARVs antigenically different from classical vaccines (variant ARVs).

2. WCS cases detected between 2014-2019 in western Canada are associated with the

presence of Group B CAstV in affected organs obtained from WCS cases.

3. Wild-type HEV is associated with flocks with recurrent secondary bacterial infections and

suspected of immunosuppression according to the attending veterinarian and detected in

western Canada in 2017-2018

1.8 Study objectives

The objectives were to:

1. To carry out a molecular characterization of ARV isolates obtained from cases detected

since 2011 in western Canada based on partial σC gene sequences

2. To carry out a molecular characterization of CAstV obtained from WCS cases in

western Canada during 2014-2019 based on whole genome sequences

3. To carry out a molecular characterization of HEV obtained from farms with recurrent

secondary bacterial infection and suspected of immunosuppression detected in western

Canada in 2017-2018.

CHAPTER 2: MOLECULAR CHARACTERIZATION OF EMERGING AVIAN

REOVIRUS VARIANTS ISOLATED FROM VIRAL ARTHRITIS CASES IN WESTERN

CANADA 2012-2017 BASED ON PARTIAL SIGMA (σ)C GENE [1]

2.1 Abstract

Viral Arthritis (VA), a disease caused by Avian Reovirus (ARV), has emerged as a significant cause of economic losses in broiler chicken flocks in western Canada. These outbreaks were characterized by 4-13% morbidity, followed by a spike in mortality/culling that in extreme cases required total flock depopulation. From 2012 to 2017, 38 ARV isolates were recovered. Molecular characterization of a partial segment of the sigma (σ)C gene shows all six previously known ARV clusters in western Canadian broiler chickens. The most numerous clusters were Cluster#4 and

Cluster #5 while the most variable clusters were Cluster#1 (76.7-100% identity), Cluster#2 (66-

99.3%), and Cluster#4 (62-100%). This variation suggests that an autogenous vaccine may not protect against a same-cluster challenge virus. This is the first publication showing the wide genetic diversity of ARV Cluster#4, the circulation of all six worldwide reported ARV clusters in

Canada, and important differences in ARV Cluster classification among researchers.

2.2 Introduction

Avian reovirus (ARV) is a ubiquitous poultry pathogen that has been taxonomically classified as a member of the family Reoviridae, subfamily Spinareovirinae, genus Orthoreovirus. The ARV genome consists of double-stranded RNA, divided into 10 genome segments (3 large, 3 medium, and 4 small). Within these, the S1 segment codes for the Sigma C protein (σC) which is the immunologically dominant structural protein. The σC protein is involved in cell attachment, and

33 as such, vulnerable to neutralizing antibodies [76, 104, 175]. In meat-type chickens, ARV infections have a wide range of clinical outcomes and this virus is associated with a variety of syndromes such as viral arthritis (VA) and runting-stunting syndrome (RSS) [64, 79, 176-178]. In the case of VA, pathogenic ARVs replicate in the joints of broiler chickens leading to marked edema and rupture of tendons leading to poor growth, low uniformity, secondary infections, mortality, and downgrading of the carcasses at the processing plant [64].

Traditionally, VA has been controlled by vaccination of the parent stock using live-modified and inactivated vaccines developed in the late 70’s and early 80’s [74, 96]. A typical vaccination program consisted in a day-old vaccination of the broiler breeder with a live-modified highly attenuated ARV strain grown in cell culture, followed by two applications during rearing (before egg production) of an oil-based inactivated ARV vaccine with a live boost with a low attenuated

ARV strain grown in embryonated eggs.

Current research on the diversity of ARV isolates related to VA outbreaks, has focused on the molecular characterization of partial segment of the S1 gene, which codes the σC protein responsible for cell-attachment [4, 6, 29]. To date, six genotypes have been described based on the classification established by Kant et al in 2003 [76]. As these novel pathogenic reoviruses are being studied and surveilled by several groups worldwide, classification systems other than Kant’s have been used, which has (and still generates) confusion amongst researchers and field veterinarians because it is difficult to make comparisons between different sets of data as not all sequences have been published or have been submitted to GenBank. These different classifications systems are based on serotyping [179], and partial S1 genotyping using roman numbers [4]; and letters [5]. So far, published data on circulating ARVs in Canada is scarce and limits to one publication analyzing 37 isolates obtained in the province of Saskatchewan from 2013 to 2015 in

34 which representatives of Clusters II, IV, V, and VI where found but it is unclear if this classification follows Kant et al 2003 [4, 76].

In the fall of 2011, VA emerged in western Canadian broiler flocks (data unpublished), since then, the poultry industry in western Canada has sustained significant economic losses. From

January 2012 to May 2017, a total of 94 clinical cases have been diagnosed as VA by Poultry

Health Services (PHS) in Airdrie, Alberta, western Canada. These clinical events occurred in the progeny of ARV-vaccinated broiler breeders, suggesting a vaccine-failure. Currently, commercial

ARV vaccines appear to provide insufficient protection, possibly due to the emergence of antigenic variants in the circulating ARVs. Noteworthy, VA outbreaks in well vaccinated flocks occurred across North America and in several other countries within a short period of time [29, 30, 97, 180] prompting intensified molecular characterization of ARVs by sequencing the σC gene. Although variant ARVs have been reported since 2003 [76, 81, 181], presumably as a natural consequence of the high mutation rate of the virus (dsRNA virus 10-6-10-4 substitution per nucleotide per cell infection) [98-100]. This increased effort identified variant ARVs that are less susceptible to commercial-vaccine induced immunity [6, 29-31, 73, 75, 103, 182-185].

We hypothesized that the clinical VA cases that were detected since 2011 in western Canada were associated with the presence of variant ARVs. Our objective was to characterize these ARV isolates based on partial σC gene sequences.

2.3 Materials and Methods

2.3.1 ARV Propagation

In this study, 38 ARV isolates originated from 34 VA cases that were received from Animal

Health Centre; (Abbotsford BC, Canada) were molecularly characterized. First, these isolates were propagated in LMH cells at The Beef Microbiology Laboratory Alberta Agriculture and Forestry

– Airdrie Centre (Airdrie AB, Canada). The Leghorn Male Hepatoma (LMH; ATCC CRL-2113) cell line is an avian cell line with an epithelial phenotype [186] which can be infected by a variety of poultry viruses [64, 187-189], including ARV [190]. The cells were propagated in Waymouth’s

Medium with 10% fetal bovine serum (FBS), 100 U/mL penicillin and 100 μg/mL streptomycin

(Gibco, Carlsbad, California, USA). After viral infection, similar media was used except that 2% calf serum (CS) was used instead of 10% FBS. Cells were incubated at 37 °C with 5% CO2.Tissue culture plates were pre-treated with a layer of 0.1% gelatin (ESGRO Complete™ Gelatin Solution,

Millipore, Darmstadt, Germany) and used for the culture of LMH cells which were infected at

>90% confluence. A sample was obtained from a vial of an S1133 commercial vaccine

(Enterovax® - Serial # 00681373; Intervet Inc. Omaha, NE, USA), was also passaged in LMH cells following the previously described procedure.

2.3.2 RNA Extraction, RT-PCR, PCR, and Gel Purification

Total RNA was extracted from infected LMH cell culture supernatants using a High Pure miRNA isolation kit following manufacturer’s instructions (Roche Diagnostics GmbH, Germany).

High-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA) was used for cDNA synthesis using P1/P4 primers design to partly amplify the σC protein (1088bp out of

1643bp) [76]. The RT-PCR reaction mix consisted of 0.5 μM forward primer P1, 0.5 μM reverse primer P4, 2 μL 10x RT Buffer, 4 mM dNTP Mix, 1 μL MultiScribe™ RT, 4.2 μL Nuclease free

H20 and 10 μL RNA template for a total of 20 μL reaction mix. RT-PCR thermocycler conditions consisted of three steps: Step 1-Incubation, 25°C for 10 min; Step 2-Reverse Transcriptase, 37°C for 120 min; and Step 3, Reverse transcriptase inactivation, 85°C for 5 min. PCR amplification was performed using TaqDNA polymerase (Invitrogen, Carlsbad, CA, USA). The PCR reaction mix consisted of 0.5 μM of each primer, P1/P4, 2.5 μL 10x PCR Buffer, 1.5 mM MgCl2, 0.2 mM dNTP Mix, 5U Taq DNA Polymerase, and 2 μL cDNA template for a total of 25 μL reaction mix.

PCR thermocycler conditions consisted of 35 cycles of 94°C for 45 sec, 58°C for 30 sec, 72°C for

90 sec; and a final extension of 72°C for 10 min resulting in a 1088 bp fragment of the S1 gene.

The PCR fragments were purified using an E.Z.N.A. Gel Extraction Kit (Omega Bio-tek Inc.,

Norcross, GA, USA) and Sanger sequenced (The Centre for Applied Genomics –TCAG at

Hospital for Sick Children, Toronto ON, Canada; University of Calgary Core DNA services,

Calgary AB, Canada).

2.3.3 Phylogenetic analysis

ARV sequences obtained by Sanger sequencing were assembled to obtain a partial σC sequence (nucleotides positions 525 to 1424 in S1 gene with a total of ~1.6 kb- this represents the first 300 amino acids of a total of 326 aa). Assembled sequences were aligned, translated into amino acids and realigned before protein phylogenetic analyses. The Geneious Assembler on

Geneious version 10.1.3 (Biomatters Ltd., Auckland, New Zealand) was used for Sanger sequencing contig De Novo assemble, Open Reading Frame (ORF) prediction, and nucleotide

37 sequence translation. Nucleotide and amino acid alignments were performed using the Clustal

Omega plugin version 1.2.2. The sequences were deposited in GenBank (Table 2.1).

RAxML was used for protein phylogenetic analysis in this study. RAxML trees were generated using RAxML plugin version 8.2.7 (Geneious v10.1.3) applying the protein model

GAMMA BLOSUM62 with Rapid bootstrapping and search for best-scoring ML tree with 1000 bootstrap replicates, with parsimony random seed 439,956 [191]. For phylogenetic tree analyses, partial σC protein sequences from 180 ARV reference strains and field sequences from different publications around the world were retrieved from GenBank and included in the study

(Supplement Table 2.1) [4, 6, 29, 31]. The ARV classification of 38 western Canadian isolates into clusters and sub-clusters was based on two criteria: 1) Bootstrap values of three RAxML phylogenetic trees both with 1000 replicates (above 75), and 2) Percentage of identity matrix resulting from such analyses.

Three different RAxML phylogenetic trees were generated: Tree #1, included 38 western

Canada ARV isolates obtained in this project, four vaccine sequences (three previously published

[29] and one obtained in this project); and 140 ARV sequences obtained from previously published papers [6, 29, 31]. Tree #2, included 38 western Canada ARV isolates obtained in this project, four vaccine sequences (three previously published [29] and one obtained in this project); and 37

Canadian isolates from Saskatchewan, Canada (SK sequences) obtained from a previously published paper [4]. Finally, Tree #3 included only 38 western Canada ARV isolates obtained in this project, and four vaccine sequences (three previously published [29] and one obtained in this project). All sequences analyzed can be found in Supplement Table #2.1.

For RAxML phylogenetic trees #1 and #3, the analyses were conducted on a partial sequence of the S1 gene (525-1424 nucleotides – 900 bases/300aa). For RAxML phylogenetic Tree #2, a

38 smaller partial sequence of the S1 gene (570-1424 nucleotides – 855 bases/285aa) was analyzed due to the short length of the SK published sequences [4].

2.4 Results

2.4.1 Clinical sample collection for virus isolation and histopathology

VA-affected broiler flocks were characterized by great weight variability, moderate to severe lameness, and splay legs due to inflammation and/or rupture of the hock (Fig 2.1). High mortality and culling rates, because of severe clinical signs and/or secondary infections, were observed in severe VA cases, which could range from 4% to 13% of the total flock population. In extremely severe cases, the entire flock was euthanized (Case #16-0542).

The age of submission of the cases included in this study was as early as 6 days and as late as

40 days with an average of 24 days. It is important to mention that submission occurred after the onset of clinical signs. Clinical necropsies and sample collections from submitted cases were performed by trained PHS personnel at the post-mortem facility at the Alberta Agriculture and

Forestry Building – Airdrie Centre (Airdrie AB, Canada), following guidelines approved by

Canadian Food Inspection Agency (CFIA) and the Public Health Agency of Canada (PHAC).

To confirm VA diagnosis, entire legs from clinical VA cases were collected aseptically for virology and were submitted to the laboratory of the Animal Health Centre; (Abbotsford BC,

Canada) for viral isolation. Affected tendons and hearts from clinical VA were also sent to the

Animal Health Laboratory (University of Guelph, Guelph ON, Canada) for histopathology examination. Tissues surrounding tendons and joints were used for ARV isolation by the Animal

Health Centre; Abbotsford BC, Canada.

2.4.2 Histopathology evaluation and ARV propagation in Leghorn Male Hepatoma (LMH) cells

Under microscopic examination of tissues obtained from clinical cases (Fig 2.1), affected hearts usually showed multiple subepicardial lymphoid nodules with mixed mononuclear cell infiltrates including lymphocytes, plasma cells, macrophages, and less frequently heterophils. Fig.

2.2a shows a nodular development over the epicardium of the heart of case 16-0542. In the case of affected tendons, these usually showed a mild to moderate numbers of mixed mononuclear cells including plasma cells in thickened tendon sheaths; strands of fibrin and heterophils were usually found between the peritendon spaces. Bacterial component was not always found in the submitted cases. Fig. 2.2b shows lymphoid nodules in the synovial membranes from case 16-0699. No ARV has been hitherto isolated from broiler breeder cases suspicious of VA in this study.

An important feature of ARV is its ability to cause cell fusion in cell culture and it is considered a prominent feature of viral replication (Fig. 2.2c) [192, 193]. Cytopathic effect (CPE) compatible with ARV infection was observed in LMH cells within 1 passage in all passaged ARVs.

To assure high titers, samples were passaged and aliquoted prior for storage at -80°C.

(a) (b)

Figure 2.1 Viral Arthritis in broilers chickens: (a) and (b) show clinical signs from Case # 15-

0643 in 22 day old broilers affected with unilateral lameness (commonly known as “hockey stick” legs, or “green hock”) with subcutaneous hemorrhage (see red arrows); c) Case 13-0880 VA in 40 day old Broilers, the photo shows rupture of tendon (see red arrow), and; d) Case 14-0631 VA in

36 day old– ARV with secondary bacterial infection (see caseous exudate signaled by red arrow).

(a) (b)

Figure 2.2 ARV Microphotographs of histopathological lesions from clinical cases

(Hematoxylin and eosin- HE staining) (a) Case 16-0542 showing nodular development over the epicardium of the heart; b) Case 16-0699 showing lymphoid nodules in the synovial membranes; c) LMH cells at 72 h post-infection with 14-1130 ARV isolate.; d)

Mock-control LMH cells at 72 h post inoculation. As histopathological slides were obtained from clinical cases and not a controlled trial, no negative control microphotographs are included.

2.4.3 Western Canada ARV genotyping clusters and phylogenetic and amino acid analysis

comparison of partial σC gene amongst other North American isolates

The 38 western Canadian isolates were divided into six previously published clusters (Cluster

1 through 6), with subclusters in Cluster 1 (subcluster 1.1, and 1.2), Cluster 2 (subcluster 2.1, 2.2, and 2.3), and Cluster 4 (subcluster 4.1, 4.2, and 4.3) (Table 2.1, Fig 2.3; Supplement Fig 2.1).

Table 2.1 List of the 39 ARV isolates deposited in GenBank.

σC gene GenBank σC gene GenBank # ARV ID Origin # ARV ID Origin Genotyping Accession Genotyping Accession 1 12-0840 A 5 Tendon MG822675 21 15-0097 5 Tendon MG822681 2 12-0840 B 5 Tendon MG822674 22 15-0643 4.3 Tendon MG822698 3 12-0840 C 5 Tendon MG822673 23 15-1221 4.3 Tendon MG822697 4 12-1089 5 Tendon MG822685 24 16-0282 4.3 Tendon MG822696 5 12-1099 4.1 Tendon MG822706 25 16-0485 1.2 Tendon MG822695 6 13-0931 5 Tendon MG822705 26 16-0541 4.3 Tendon MG822694 7 14-0587 4.3 Tendon MG822702 27 16-0542 1.2 Tendon MG822693 8 14-0509 5 Joint MG822704 28 16-0687 4.3 Tendon MG822692 9 14-0580 5 Tendon MG822703 29 16-0699 2.3 Joint MG822691 10 14-0730 4.2 Tendon MG822700 30 16-0712 4.2 Tendon MG822678 11 14-0631 5 Tendon MG822701 31 16-0711 3 Tendon MG822679 12 14-0838 4.2 Tendon MG822699 32 16-0753 A 3 Intestine MG822677 13 PP14-0041 2.2 Joint MG822669 33 16-0753 B 3 Tendon MG822676 14 14-1125 1.2 Tendon MG822684 34 17-0025 6 Tendon MG822690 15 14-1130 1.2 Tendon MG822683 35 17-0079 4.1 Joint MG822689 16 14-1171 2.1 Tendon MG822682 36 17-0106 5 Tendon MG822670 17 PP14-0046 1.2 Joint MG822686 37 17-0147 5 Joint MG822688 18 14-0804 A 2.2 Tendon MG822672 38 17-0160 1.2 Tendon MG822687 Vaccine 19 14-0804 B 5 Tendon MG822671 Enterova 39 S1133- 1.1 MG822668 x® Vial 20 15-0157 5 Tendon MG822680 2017

Table 2.2 List of ARV isolates strains deposited in GenBank and genotyping

classification according to year.

ARV Genotyping clusters based on partial oC gene sequences Total ARV Year 1 2 3 4 5 6 isolates 2012 1 (20%) 4 (80%) 5 (100%) 2013 1 (100%) 1 (100%) 2014 3 (23.1%) 3 (23.1%) 3 (23.1%) 4 (30.8%) 13 (100%) 2015 2 (50%) 2 (50%) 4 (100%) 2016 2 (20%) 1 (10%) 3 (30%) 4 (40%) 10 (100%) 2017 1 (20%) 1 (20%) 2 (40%) 1 (20%) 5 (100%) Genotype % 6 (15.8%) 4 (10.5%) 3 (7.9%) 11 (28.9%) 13 (34.2%) 1 (2.6%) 38 (100%)

According to Tree #1 (Supplement Fig 2.1), the Canadian isolates characterized in this project were distributed into six clusters previously described [29]: 5 isolates were classified in Cluster 1

(13.5%); 4 isolates in Cluster 2 (10.8%); 3 in Cluster 3 (8.1%); 11 in Cluster 4 (29.7%); 13 in

Cluster 5 (35.1%) and 1 in Cluster 6 (2.7%) (Supplement Fig 2.1). Interestingly, the US isolate

C2-22690 previously reported as Cluster 2, in the present work it was designated as Cluster 5 in

Tree #1 [29] (Supplement Fig 2.1). Also, Clusters VI, V, and IV from Ayalew, et al 2017 corresponded to Cluster 4, 6, and 5 in this study, respectively. Classification by year of isolation according to Tree #1 is shown in Table 2.2 and shows the appearance of the novel Cluster 6 in recent samples isolated in 2017.

In Tree #1, the amino acid (aa) sequence identity between western Canada sequences and US sequences varied from 43% to 100%. Interestingly, sequences with ≥ 99% identity were detected between western Canadian and US sequences (Supplement Fig 2.2). The commercial S1133 vaccine sequenced as “Vaccine S1133-2017” was found to share 96.7% identity to other S1133 vaccine sequence (GenBank).

In Tree #2, all Canadian sequences and four vaccine strains sequences were included (western

Canada sequences, SK sequences, and vaccine strain sequences) (Fig 2.3). The aa sequence identity between the two groups of sequences varied from 43% to 100%. Cluster 5 sequences with

100% identity were also detected between western Canadian sequences and SK sequences

(Supplement Fig 2.3.). Several other sequences between both sets of data grouped in Cluster 2 and

5 shared an identity of ≥ 99% identity (Supplement Fig 2.3).

CLUSTER 3 CLUSTER 2 Subcluster Subcluster 2.1 2.3 Subcluster 4.1 Subcluster 2.2 Cluster 4 = Cluster VI (Ayalew 2017)

Subcluster 1.1 CLUSTER 1

Subcluster 1.2

Subcluster 4.2

Subcluster 4.3 CLUSTER 4 Cluster 5 = Cluster IV (Ayalew 2017) Cluster 6 = Cluster V (Ayalew 2017) CLUSTER 5 CLUSTER 6

Figure 2.3 RAxML Phylogenetic Tree #2 of a total of 79 partial σC sequences (amino acid

positions 16-300). The analysis included 75 Canadian ARV field isolates and 4 ARV

commercial vaccine strains. The 75 field isolates were comprised of 38 isolated in western

Canada 2012-2017 in bold; and 37 isolates obtained in Saskatchewan, Canada from 2013-

2015 which start with roman number cluster classification used in the paper [4]. The 4 ARV

commercial vaccine strains included 3 previously published sequences [29] and one sequence

(Vaccine S1133-Seq) obtained from processing an S1133 vaccine vial. Vaccine strains are

shown in a bold and cursive font.

In Tree #3, only western Canada sequences, and four vaccine strain sequences were analyzed.

The aa sequence identity between the sequences varied from 46.3% to 100%. Sequences with

100% identity were detected in Clusters 1, 3, 4, and 5 and several other sequences shared an identity of ≥ 99% identity (Supplement Fig 2.4). It is worth noting that the identical sequences 16-

0753A-Broiler-BC-2016, and 16-0753B-Broiler-BC-2016 were obtained from intestine and tendon samples from the same group of birds with clinical signs consistent with VA and RSS.

In Cluster 1, isolates shared 76.7-100% sequence identity, and 2 sub-clusters were observed.

Sub-cluster 1.1 was formed by commercial vaccine strains which shared a high aa sequence identity (96-99.7%) and were considered as a different sub-cluster from that formed of 6 Canadian

ARV isolates, which shared a high aa sequence identity (91–100%). The members of these two sub-clusters only shared 76.7–81.3% aa identity. No SK strains representatives were found.

Clusters 2, and 3 each composed by 4 Canadian ARV, had aa sequences identities within the cluster of 66-99.33%, and 99.3-100% respectively (Fig. 2.3; and Supplement Fig 2.1, and 2.3).

Interestingly, when added 11 SK sequences classified as Cluster 2, isolates grouped into three sub- clusters with 83.9-94.7% identity within sub-clusters and 63.2-80% identity between sub-clusters.

No sub-clusters were observed in cluster 3 due to the high similarity of the grouped sequences; no

Cluster 3 were found in the SK sequences.

Cluster 4 was composed by 11 Canadian ARV isolates which shared 62-100 % aa identity and were distributed into 3 sub-clusters: sub-cluster 1 formed by 2 Canadian ARV isolates sharing

93.7% aa identity; sub-cluster 2 formed by 3 isolates sharing 86.3-100% aa identity; and sub-

47 cluster 3 formed by 6 isolates sharing 96.7-100% aa identity. The members of these three sub- clusters only shared 58-70% aa identity (Fig 2.3; and Supplement Figs 2.1, and 2.3). Upon inclusion of 13 SK sequences identified as Cluster 4, there is no change in the number of sub- clusters found. All SK sequences grouped together in sub-cluster 4.1 (Fig 2.3).

In case of Cluster 5, 13 Canadian ARV isolates grouped together sharing 93.7-100% aa identity. Upon inclusion of 4 SK sequences, no extra sub-clusters were found, and the shared identity was similar (93.3-100%). For the only representative of Cluster 6, the isolate grouped together with other Cluster 6 sequences in Tree #1, however in Tree #2 and #3 it was grouped together with Cluster 4 isolates. Interestingly, when 4 SK sequences classified in cluster 6 were analyzed, all 5 sequences shared an identity of 78.2-98.6% and were classified as if they were

Cluster 4 isolates by both phylogenetic Trees #2 and #3. Similarities between Cluster 4 and Cluster

6 sequences in Tree #2 and Tree #3 may have played a role in grouping these Cluster 6 representatives as Cluster 4 when a limited number of sequences was available. The similarities in

Tree #2 alignment between Cluster 6 and Cluster 4 when compared against the consensus are at the following positions: #7, #11, #18, #38, #39, #53, #70, #93, #99, #108, #118, #129, #144, #155,

#186, #238, #239, #262, #272, #282, and #283 (Fig 2.5; and Supplemental Fig 2.5).

We will not merge the Cluster 6 isolate in Cluster 4 as this Cluster 6 isolate shared only 47.3-

65.7% identity with any of the other Canadian isolates tested (Fig 2.4; and Supplement Figs 2.4, and 2.5). Low aa sequence identities were observed on Cluster 2 (66%), and Cluster 4 (62%), we will not suggest a novel classification of ARV clusters and will follow previous publications classification as to limit the level of disagreements between researchers in benefit of the wider use of a particular ARV classification system [12, 29, 76].

Subcluster 4.1 Subcluster 4.2 Cluster 6 Subcluster 4.3

Subcluster 1.1 Subcluster 1.2

Figure 2.4. Cluster 4 and Cluster 1 sub-clades marked on percentage heat map of aa identity obtained from RAxML

Phylogenetic Tree #3. The only representative of Cluster 6 was included as member of Cluster 4 (red arrow).

Figure 2.5 Multiple amino acid sequence alignment of Tree #2. This alignment includes four commonly used vaccine strains and the 75 Canadian ARV isolates. The translation alignment was made using Clustal Omega 1.2.2. The code C1-C6 refers to Cluster classification of the isolates according to Tree #1.

2.5 Discussion

Two factors that determine the potential efficacy of ARV vaccines are the antigenic relationship between vaccine and field ARV strains and the neutralization titer generated by the

ARV vaccine. Since 2011 there has been an increase in VA, an important poultry disease caused by pathogenic ARVs, in Canadian broiler chicken production [1, 4, 101, 194]. These first affected broiler flocks originated from broiler-breeder operations which were routinely vaccinated with commercially available ARV vaccines. Based on field data and several other research [4, 6, 29], it is clear that current commercial ARV vaccines do not confer adequate protection to these new pathogenic variant ARVs that have become the most prevalent challenge field strains in North

America. As a result, many Canadian broiler chicken producers are using autogenous vaccines manufactured with ARV isolates obtained from local clinical cases. Thus, sequencing of the variable σC protein, the most immunologically important protein of ARV, is crucial. Proper phylogenetic analysis is important not only for selecting the isolate used in autogenous vaccine design, but also to monitor ARV antigenic drift, or the emergence of a different genotype from those included in the vaccine once an autogenous vaccination program is implemented [1, 32, 71,

195, 196], as it occurs for other viruses, such as influenza [197]. This can give the poultry industry insight into the clusters and sub-clusters that circulate and assist in the autogenous vaccine design to provide optimal protection. As autogenous vaccines should be used in emergency situations, they can only be custom-made in specialized facilities under specific regulations [6].

Consequently, it can take between 6-18 months from the moment a new isolate is obtained until a batch of autogenous vaccine is ready for use. Vaccination with ARV isolates, homologous to the challenge ARVs, is the only efficacious measure available against the effects of the disease, as no antiviral treatment exists [12].

Although neutralization titers are heavily used as an indicator of vaccine-mediated protection, virus neutralization assays that determine the neutralization titers are based on in vitro cell culture models. It has been shown that neutralization titers are not always correlating with vaccine- mediated protection of animals against rabies [198]. However, a good correlation has been found between in vitro neutralizing assays titers and in vivo protection relevant to mouse-poliomyelitis virus infection [199] and chicken-ARV induced tenosynovitis [200]. The later study showed that the vaccinated chickens that acquired geometric mean neutralizing antibody titers of 1:238 or higher correlated well with the protection against foot pad challenge with avian reovirus strain 58-

132 indicating that serum neutralization titer is a good indicator of protection against ARV induced

VA.

The σC protein is involved in cell attachment, and as such, vulnerable to neutralizing antibodies

[76, 88, 104, 175]. Other ARV proteins have been investigated and found that are also involved in neutralization of homologous virus, such as λB and σB which confer broadly specific neutralizing activity, which are analogous to the λ2 and σ3 proteins found in mammalian reovirus [77, 104,

180, 201]. However, the σC protein, analogous to σ1 protein in mammalian reovirus, is recognized as the only viral protein conferring a virus type-specific neutralizing immunity and therefore more important than the immunity conferred by λB and σB [4, 6, 64, 77, 104, 201, 202]. Consequently, we focused our molecular characterization on σC gene partial sequences.

In the present study, σC phylogenetic analysis show the separation of 38 ARV isolates into 6 different clusters [6, 29, 76]. We hypothesized that the clinical VA cases that were detected since

2011 in western Canada were associated with the presence of variant ARVs and all the sequences obtained in this study were considered variants. In concordance with earlier studies, most ARV

Canadian field isolates (32/38 – 84.2%) could be classified in clusters other than Cluster 1, the cluster that includes the commercial vaccine viruses. The remaining field isolates (6/38 – 15.8%) were classified within the same Cluster 1 but with a low identity (76.7–81.3%) with commercial vaccine viruses. It is doubtful that commercial, or autogenous vaccines prepared from ARV sharing a low level of identity with a prevalent field strain grouped in the same cluster, will be able to confer sufficient cross-protection. In other words, variant ARV from a particular cluster (e.g.

Cluster 1, 2, or 4) may not necessarily protect against members of its own cluster if sharing a low level of identity. Another interesting finding is the apparent merge of Cluster 4 and Cluster 6 isolates on Trees #2 and #3, but not in Tree #1. We speculate that this merging in Trees #2 and #3, supported by the heatmaps of amino acid identity (Fig 2.4; and Supplemental Fig 2.4) and multiple amino acid sequence alignments (Fig 2.5; and Supplemental Fig 2.5).occurred due to a certain level of similarity between both Cluster 6 and Cluster 4 and that may be the issue trying to classify both Clusters accurately and consistently by other research groups. Moreover, it is possible that this same “merging” problem may occur between other Clusters, complicating interpretations if sequence or amino acid identity data are not available.

It is difficult to accurately predict cross-protection between two isolates using only molecular information as a small amino acid change can be responsible of the generation of a new serotype

[203], and fixation procedures during autogenous vaccine production can also alter the spatial configuration of an antigen, thus altering the resulting immunity [204]. Research on Infectious

Bronchitis virus, other RNA poultry virus, indicates that a low cross protection exists when challenge and vaccine strains aa differences equal 5% [205]. Therefore, a safe recommendation for a competent autogenous vaccine program would be to include ARV isolates with at least 95%

σC protein aa identity to the circulating field strains.

All these field variants were isolated from cases with a parent stock vaccination program against VA, which included several inactivated and live commercial vaccines. This indicates that the field variants characterized in this study, including those in Cluster 1 sub-cluster 1.2 (76-7-

80% aa identity), evade the immunity generated by commercial vaccines. The aa modifications in the σC protein that are responsible of this vaccine-escape are part of an ongoing study.

2.6 Conclusions

In summary, this study demonstrated that all ARVs isolated from clinical VA cases in western

Canada analyzed in the scope of this work were variant strains with a low percentage of identity when compared with current commercially-available vaccine strains according to a partial molecular characterization of the σC protein. No other of the 10 structural proteins on the avian reovirion (8 primary translation products, and 2 obtained by post-translational cleavage) is able to generate immunity capable to substantially contribute to host protection [64, 80, 181, 200]. Our findings also indicate that there are disagreements in the literature on the identity of each ARV cluster: Clusters 4, 5, and 6 in Kant, et al, 2003; Lu, et al, 2015; Sellers, et al, 2016 and the present work, equate with Clusters VI, IV, and V, in Ayalew, et al, 2017, respectively. Additionally, ARV representatives of Cluster 6 did not always group as a separate cluster; and not all clusters shared a high level of identity. These facts may cause unwanted consequences when selecting isolates to be included in autogenous vaccine programs. Thus, it is crucial that ARV cluster classification is supported with identity data when selecting vaccine candidates. We suggest that a competent autogenous vaccine program should include isolates with ~95% aa identity with current circulating field strains. To the best of our knowledge, this is the first publication showing the wide genetic

55 diversity of ARV Cluster#4 in field ARV isolates and the circulation of all six worldwide reported

ARV clusters in Canada.

2.7 Supplementary Materials

The following are available online: Supplement Figure 2.1. RAxML Phylogenetic Tree #1;

Supplement Figure 2.2. Percentage heat map of aa identity obtained from RAxML Phylogenetic

Tree #1; Supplemental Fig 2.3. RAxML Phylogenetic Tree #3; Supplemental Fig 2.4. Percentage heat map of aa identity obtained from RAxML Phylogenetic Tree #2; Fig 2.5. Multiple aa sequence alignment of Tree #3 used on Supplement Fig 2.3; and Supplement Table 2.1. List of all ARV isolates included in the phylogenetic trees in the study with GenBank Accession

Numbers.

CLUSTER 3 6666666665

Supplement Fig 2.1. RAxML Phylogenetic Tree #1 of a total of 182 partial σC sequences (first

300 aa). The analysis included 178 ARV field isolates and 4 ARV commercial vaccine strains.

The 178 field isolates were comprised of 38 ARV strains isolated in western Canada between

2012-2017 in bold and with an asterisk on one side; 114 isolated in Pennsylvania USA 2011-

2014 which start with “C” [29]; and 26 isolates from across US isolated by The University of

Georgia (Athens, GA, USA) during 2011-2014 which start with “G”. The 4 ARV commercial

57 vaccine strains including 3 previously published sequences [29] and one sequence (Vaccine

S1133-Seq) obtained from processing an S1133 vaccine vial.

1 2

Cl 3

Cl 6

Cl 5

Cl 4

Cl 1

Cl 2

3 4 Supplement Figure 2.2. Percentage heat map of aa identity obtained from RAxML Phylogenetic Tree #1. From upper left to lower right – Cluster 3, 5, 4, 1, and 2 (Supplement Figure 2.1).

6 7 8 9 10 11

13 14 Supplement Figure 2.3. RAxML Phylogenetic Tree #3 of a total of 42 partial σC

15 sequences (first 300 aa). The analysis included 38 isolated in western Canada 2012-2017

16 and 4 ARV commercial vaccine strains including 3 previously published sequences [29]

17 and one sequence (Vaccine S1133-20176) obtained from processing an S1133 vaccine

18 vial. Vaccine strains are shown in a bold and cursive font.

20 21 22 Cluster 3

Cluster 5

Cluster 4

Cluster 6

Cluster 1

Cluster 2

23 24 Supplement Figure 2.4. Percentage heat map of aa identity obtained from RAxML Phylogenetic Tree #2. From upper left to lower right – Cluster 3, 5, 4, 1, and 2. In Tree #2, representatives of Cluster 6 were considered as member of Cluster 4 (Fig 2.3).

31 Supplement Figure 2.5. Multiple amino acid sequence alignment of Tree #3 used on Supplement Fig 2.3. This alignment includes four commonly used vaccine strains and the 38 ARV isolates. The translation alignment was made using Clustal Omega 1.2.2. The code C1-C6 refers to Cluster classification

32 of the isolates according to Tree #2.

33 Supplement Table 2.1. List of all ARV isolates included in the phylogenetic trees in the study

34 with GenBank Accession Numbers

Phylogenetic GenBank Genotyping Name of the Isolate Tree Accession Paper Published Cluster 1 2 3 Number 12-0840A-Broiler-AB-2012 X X X 5 MG822675 12-0840B-Broiler-AB-2012 X X X 5 MG822674 12-0840C-Broiler-AB-2012 X X X 5 MG822673 12-1089-Broiler-BC-2012 X X X 5 MG822685 12-1099-Broiler-AB-2012 X X X 4 MG822706 13-0931-Broiler-AB-2013 X X X 5 MG822705 14-0587-Broiler-AB-2014 X X X 4 MG822702 14-0509-Broiler-AB-2014 X X X 5 MG822704 14-0580-Broiler-AB-2014 X X X 5 MG822703 14-0730-Broiler-AB-2014 X X X 4 MG822700 14-0631-Broiler-AB-2014 X X X 5 MG822701 14-0838-Broiler-AB-2014 X X X 4 MG822699 PP14-0041-Broiler-SK-2014 X X X 2 MG822669 14-1125-Broiler-BC-2014 X X X 1 MG822684 14-1130-Broiler-BC-2014 X X X 1 MG822683 14-1171-Broiler-BC-2014 X X X 2 MG822682 PP14-0046-Broiler-AB-2014 X X X 1 MG822686 14-0804A-Broiler-SK-2014 X X X 2 MG822672 14-0804B-Broiler-SK-2014 X X X 5 MG822671 15-0157-Broiler-BC-2015 X X X 5 MG822680 Palomino et al, 2018 15-0097-Broiler-BC-2015 X X X 5 MG822681 15-0643-Broiler-AB-2015 X X X 4 MG822698 15-1221-Broiler-AB-2015 X X X 4 MG822697 16-0282-Broiler-AB-2016 X X X 4 MG822696 16-0485-Broiler-AB-2016 X X X 1 MG822695 16-0541-Broiler-AB-2016 X X X 4 MG822694 16-0542-Broiler-AB-2016 X X X 1 MG822693 16-0687-Broiler-AB-2016 X X X 4 MG822692 16-0699-Broiler-AB-2016 X X X 2 MG822691 16-0712-Broiler-BC-2016 X X X 4 MG822678 16-0711-Broiler-BC-2016 X X X 3 MG822679 16-0753 A-Broiler-BC-2016 X X X 3 MG822677 16-0753 B-Broiler-BC-2016 X X X 3 MG822676 17-0025-Broiler-AB-2017 X X X 6 MG822690 17-0079-Broiler-AB-2017 X X X 4 MG822689 17-0106-Broiler-SK-2017 X X X 5 MG822670 17-0147-Broiler-AB-2017 X X X 5 MG822688 17-0160-Broiler-AB-2017 X X X 1 MG822687 Vaccine S1133-2017 X X X 1 MG822668 Vaccine - 1733 X X X 1 AF004857 Vakharia et al.,1997 A Vaccine - 2408 X X X 1 AF204945 Liu et al., 2000 A Vaccine - S1133 X X X 1 L39002 Shapouri et al., 1995A C1-01384-Broiler-PA-2014 X 1 KR856956 C1-01805-Layer-PA-2014 X 1 KR856964.1 Lu, et al, 2015 C1-04660-Broiler-PA-2014 X 1 KR856959

C1-04666-Broiler-PA-2014 X 1 KP727768 C1-04667-Broiler-PA-2014 X 1 KP727767 C1-04769B-Broiler-PA-2014 X 1 KR856957 C1-04769-Broiler-PA-2014 X 1 KP727766 C1-06500-Broiler-PA-2013 X 1 KR856953 C1-06608-Broiler-PA-2014 X 1 KP727770 C1-07833-Broiler-PA-2013 X 1 KR856952.1 C1-12166-Broiler-PA-2014 X 1 KR856961.1 C1-16424-Broiler-PA-2013 X 1 KP727764 C1-16429-Broiler-PA-2013 X 1 KR856954.1 C1-16979-Broiler-PA-2014 X 1 KR856962 C1-19422-Broiler-PA-2013 X 1 KP727760 C1-19464-Broiler-PA-2013 X 1 KP727759 C1-19698-Broiler-PA-2013 X 1 KR856955 C1-19699B-Broiler-PA-2013 X 1 KR856960 C1-19699-Broiler-PA-2013 X 1 KP727762 C1-19752-Broiler-PA-2013 X 1 KP727761 C1-19980-Broiler-PA-2013 X 1 KP727763 C1-22784-Broiler-PA-2013 X 1 KP727765 C1-25070-Broiler-PA-2014 X 1 KR856963.1 C1-27614B-Layer-PA-2013 X 1 KR856958.1 C1-27614-Layer-PA-2013 X 1 KP727769 C2-00659-Turkey-PA-2014 X 2 KM116024 C2-01382-Broiler-PA-2014 X 2 KR856980 C2-01769-Turkey-PA-2014 X 2 KM116025 C2-04455-Broiler-PA-2013 X 2 KP727778 C2-05273A-Broiler-PA-2014 X 2 KR856981 C2-05273B-Broiler-PA-2014 X 2 KR856982 C2-05287-Broiler-PA-2014 X 2 KR856986 C2-06605-Broiler-PA-2014 X 2 KR856987 C2-07160-Broiler-PA-2013 X 2 KR856977 C2-07362-Turkey-PA-2014 X 2 KR856983 C2-07483-Turkey-PA-2011 X 2 KR856972 C2-08241-Broiler-PA-2014 X 2 KP727782 C2-09271-Broiler-PA-2014 X 2 KR856984 C2-09282-Turkey-PA-2014 X 2 KR856985 C2-09552-Broiler-PA-2013 X 2 KP727775 C2-09617-Guineafowl-PA-2011 X 2 KR856978 C2-10249A-Broiler-PA-2013 X 2 KR856973 C2-10249B-Broiler-PA-2013 X 2 KR856966 C2-11069-Broiler-PA-2013 X 2 KR856974 C2-11583-Broiler-PA-2013 X 2 KR856965 C2-12883-Turkey-PA-2011 X 2 KM116023 C2-13417-Turkey-PA-2011 X 2 KM116022 C2-17010-Turkey-PA-2013 X 2 KM116021 C2-18550-Turkey-PA-2012 X 2 KP727777 C2-21597-Turkey-PA-2011 X 2 KR856979 C2-22690-Turkey-PA-2012 X 2 KP727801 C2-23536b-Broiler-PA-2011 X 2 KR856971 C2-23536-Broiler-PA-2011 X 2 KP727773 C2-23647B-Turkey-PA-2011 X 2 KR856967 C2-23647-Turkey-PA-2011 X 2 KP727774 C2-25427kp-Chukar-PA-2011 X 2 KP727772

C2-25427kr-Chukar-PA-2011 X 2 KR856970 C2-27399-Turkey-PA-2012 X 2 KR856975 C2-27541kp-Broiler-PA-2012 X 2 KP727776 C2-27541kr-Broiler-PA-2012 X 2 KR856976 C2-28725-Turkey-PA-2011 X 2 KP727771 C2-29730-Layer-PA-2011 X 2 KR856968 C2-30024-Guineafowl-PA-2011 X 2 KR856969 C3-01224-Layer-PA-2014 X 3 KP727789 C3-03422-Layer-PA-2014 X 3 KP727788 C3-07634-Broiler-PA-2014 X 3 KR856992 C3-22790-Broiler-PA-2011 X 3 KP727787 C3-28439-Broiler-PA-2011 X 3 KR856989 C3-28505B-Broiler-PA-2011 X 3 KR856990 C3-28505-Broiler-PA-2011 X 3 KP727786 C4-03349-Broiler-PA-2014 X 4 KR856994.1 C4-04314-Broiler-PA-2014 X 4 KR856995.1 C4-05682-Broiler-PA-2012 X 4 KP727791.1 C4-08170-Broiler-PA-2014 X 4 KP727796.1 C4-12323-Broiler-PA-2013 X 4 KP727793.1 C4-23932-Broiler-PA-2012 X 4 KP727792.1 C4-30857-Broiler-PA-2011 X 4 KP727790.1 C5-02807-Broiler-PA-2014 X 5 KP727807 C5-03795-Broiler-PA-2014 X 5 KP727805 C5-04870-Broiler-PA-2014 X 5 KP727806 C5-05247-Turkey-PA-2014 X 5 KP727808 C5-05573-Broiler-PA-2012 X 5 KP727800 C5-05907-Broiler-PA-2014 X 5 KR857002 C5-06305-Broiler-PA-2014 X 5 KP727809 C5-07209A-Broiler-PA-2013 X 5 KR856996 C5-07209B-Broiler-PA-2013 X 5 KR856997 C5-07361-Broiler-PA-2012 X 5 KP727797 C5-07412-Broiler-PA-2013 X 5 KP727799 C5-07618-Broiler-PA-2014 X 5 KP727810 C5-07830-Layer-PA-2014 X 5 KP727811 C5-07916-Layer-PA-2014 X 5 KP727812 C5-08391-Broiler-PA-2014 X 5 KR857007 C5-09113-Broiler-PA-2012 X 5 KP727804 C5-09614-Broiler-PA-2014 X 5 KR857003 C5-10615-Broiler-PA-2014 X 5 KR857004 C5-11733-Broiler-PA-2012 X 5 KP727803 C5-11781-Broiler-PA-2012 X 5 KP727802 C5-13649-Pheasant-PA-2014 X 5 KR857006 C5-14702-Broiler-PA-2014 X 5 KR857005 C5-15511-Broiler-PA-2013 X 5 KR857000 C5-20953-Broiler-PA-2012 X 5 KR856999 C5-22280-Broiler-PA-2013 X 5 KR857001 C5-26850-Broiler-PA-2012 X 5 KR856998 C5-27964-Broiler-PA-2011 X 5 KP727798 C6-03200-Broiler-PA-2012 X 6 KP727785 C6-03476-Broiler-PA-2012 X 6 KP727784 C6-03974-Broiler-PA-2012 X 6 KP727783 C6-05911-Broiler-PA-2014 X 6 KR857009 C6-08244-Broiler-PA-2014 X 6 KR857008

C6-09409-Broiler-PA-2014 X 6 KR856988 C6-16431-Broiler-PA-2013 X 6 KP727794 C6-19981-Broiler-PA-2013 X 6 KR856993 C6-25766-Broiler-PA-2012 X 6 KR856991 C6-28928-Broiler-PA-2013 X 6 KP727795 G1-11-12523 X 1 HE985296.1 G1-11-12524 X 1 HE985297.1 G1-11-12525 X 1 HE985298.1 Troxler, et al 2013 G1-11-12526 X 1 HE985299.1 G1-11-17268 X 1 HE985300.1 G1-12-1167 X 1 HE985301.1 G1-95524-AL-2012 X 1 KJ803976.1 G1-95873-AL-2012 X 1 KJ803980.1 G1-96139-GA-2012 X 1 KJ803990.1 G1-96837-KY-2012 X 1 KJ804004.1 G1-96986-GA-2013 X 1 KJ879627.1 G1-99952-GA-2012 X 1 KJ879692.1 G2-96949-GA-2013 X 2 KJ879625.1 G2-99159-AL-2013 X 2 KJ879682.1 G2-01769-GA-2014 X 2 KM116025.1 G3-97837-GA-2013 X 3 KJ879660.1 Sellers, 2016 G3-97992-MS-2013 X 3 KJ879667.1 G4-96815-NC-2012 X 4 KJ803996.1 G4-97350-GA-2013 X 4 KJ879644.1 G5-91955-GA-2011 X 5 KJ803958.1 G5-92715-GA-2012 X 5 KJ803959.1 G5-93116-GA-2012 X 5 KJ803962.1 G5-93117-GA-2012 X 5 KJ803963.1 G5-94592-GA-2012 X 5 KJ803964.1 G5-94593-GA-2012 X 5 KJ803965.1 G5-94826-GA-2012 X 5 KJ803967.1 VI-SK-R1-Broiler-SK X 4 KX855899.1 VI-SK-R2-Broiler-SK X 4 KX855900.1 VI -SK-R3-Broiler-SK X 4 KX855901.1

VI -SK-R4-Broiler-SK X 4 KX855902.1

VI -SK-R5-Broiler-SK X 4 KX855903.1

VI -SK-R6-Broiler-SK X 4 KX855904.1

VI -SK-R7-Broiler-SK X 4 KX855905.1

VI -SK-R8-Broiler-SK X 4 KX855906.1

VI -SK-R9-Broiler-SK X 4 KX855907.1

V-SK-R10-Broiler-SK X 6 KX855908.1

V -SK-R11-Broiler-SK X 6 KX855909.1

V -SK-R12-Broiler-SK X 6 KX855910.1

IV-SK-R13-Broiler-SK X 5 KX855911.1

IV-SK-R14-Broiler-SK X 5 KX855912.1

IV-SK-R15-Broiler-SK X 5 KX855913.1

IV-SK-R16-Broiler-SK X 5 KX855914.1

IV-SK-R17-Broiler-SK X 5 KX855915.1

IV-SK-R18-Broiler-SK X 5 KX855916.1

IV-SK-R19-Broiler-SK X 5 KX855917.1 Ayalew, et al 2017 IV-SK-R20-Broiler-SK X 5 KX855918.1 IV-SK-R21-Broiler-SK X 5 KX855919.1 II-SK-R22-Broiler-SK X 2 KX855920.1

II -SK-R23-Broiler-SK X 2 KX855921.1 II -SK-R24-Broiler-SK X 2 KX855922.1 II -SK-R25-Broiler-SK X 2 KX855923.1 II -SK-R26-Broiler-SK X 2 KX855924.1 II -SK-R27-Broiler-SK X 2 KX855925.1 II -SK-R28-Broiler-SK X 2 KX855926.1 VI-SK-R29-Broiler-SK X 4 KY026178.1 II -SK-R30-Broiler-SK X 2 KY026179.1 VI-SK-R31-Broiler-SK X 4 KY026180.1 VI-SK-R33-Broiler-SK X 4 KY026182.1 IV-SK-R34-Broiler-SK X 6 KY026183.1 II -SK-R35-Broiler-SK X 2 KY026184.1 II -SK-R36-Broiler-SK X 2 KY026185.1 VI-SK-R37-Broiler-SK X 4 KY026186.1 II -SK-R38-Broiler-SK X 2 KY026187.1 35 a Genbank Accession numbers submitted to Genbank as indicated, generally unpublished. 36

37 CHAPTER 3: CHICKEN ASTROVIRUS (CAstV) MOLECULAR STUDIES REVEAL

38 EVIDENCE OF MULTIPLE PAST RECOMBINATION EVENTS IN SEQUENCES

39 ORIGINATED FROM CLINICAL SAMPLES OF WHITE CHICK SYNDROME (WCS)

40 IN WESTERN CANADA

41 3.1 Abstract

42 In this study, we aimed to molecularly characterize 14 whole genome sequences of

43 CAstV isolated and sequenced from samples obtained from WCS outbreaks in western

44 Canada during the period of 2014-2019. Genome sequence comparisons showed all these

45 sequences correspond to the novel Biv group from which no confirmed representatives

46 were published on GenBank. Molecular recombination analyses using recombination

47 detection software (i.e. RDP5, SimPlot) and phylogenetic analyses suggest multiple past

48 recombination events in ORF1a, ORF1b, and ORF2. Our findings suggest that

49 recombination events and the accumulation of point mutations may have contributed to

50 the substantial genetic variation observed in CAstV and evidenced by the current 7

51 antigenic sub-clusters hitherto described. This is the first paper describing recombination

52 events in CAstV and analyzing complete CAstV sequences in Canada.

54 3.2 Introduction

55 Chicken Astrovirus (CAstV)[106], a enteric, non-enveloped, positive-sense RNA virus has

56 recently emerged as an important poultry pathogen in broiler breeder flocks and their progeny

57 across North America, Brazil, China, and several European countries including Poland, Finland,

58 Norway, and United Kingdom [8, 13, 22, 47, 107-109, 112]. Currently, the International

59 Committee of Taxonomy of viruses (ICTV) in the latest 2019 edition has classified CAstV,

60 together with Avian Nephritis Virus (ANV), as members of the Avastrovirus II species within the

61 genus Avastrovirus, in the Astroviridae family [110, 111]. It is worth noting that classification of

62 Astroviruses has changed several times since first descriptions were published in the late 1970s-

63 early 1980s [112-114]. The genetic organization of CAstV is similar to other Astroviruses as it is

64 composed of a small, linear RNA of ~7.5 kb in length, coding for three open reading frames (ORF):

65 a non-structural protein (ORF1a), a viral RNA-dependent RNA polymerase (ORF1b, also named

66 RdRp), and a capsid protein (ORF2) [13, 22, 36, 117]. The capsid protein is highly variable,

67 especially in its 3’ half of the ORF, which forms the external surface of the capsid forming the

68 characteristically five or six-pointed star-like projections of Astroviruses [118-120]. This area

69 interacts with the cell receptor and is exposed to the host immune system [13, 22, 118]. The capsid

70 protein has been divided into 2 major antigen groups with sub-divisions: Group A divided into

71 three subgroups (i.e. Ai, Aii, and Aiii); and Group B divided into four subgroups (i.e. Bi, Bii, Biii,

72 and Biv)[22].

73 Features of the capsid protein of CAstV are believed to drive the pathogenesis into three

74 syndromes/diseases that are not exclusive: 1) Runting-Stunting syndrome (RSS) characterized by

75 malabsorption, enteritis, growth problems, and uneven flock performance [206]; 2) Kidney disease

76 and visceral gout characterized by high mortality in young broilers (up to 40%) [46]; and White

77 Chick Hatchery Disease or White Chick Syndrome (WCS), a disease characterized by transient

78 increase in mid to late embryo deaths, which causes a reduction in hatchability that can be as low

79 as 4-5% and as high as 68% [124]. In WCS, some of hatched chicks are considered “white chicks”,

80 a condition characterized by pale plumage, weakness, slow weight gain, poor condition and

81 eventually death during the first days of life [13, 107, 124]. Lesions can be observed in kidney,

82 liver, feathers, and intestine [13, 22, 107, 124]. Although WCS has been known in Canada since

83 the late 1980s-early 1990s, it has only recently been associated with CAstV in 2012 [8].

84 Improvements in surveillance and diagnostic assays have revealed an increased incidence of the

85 problem, and its associated economic losses have rendered WCS a relevant emerging problem in

86 poultry production in Canada [8, 9, 125].

87 Transmission of CAstV can be horizontal, through the fecal-oral route; and probably vertical,

88 although this has not been experimentally proven [8, 13, 22]. In the case of WCS, the virus can be

89 detected in dead-in-shell embryos, meconium, and young chickens within the first week of life [8,

90 36, 112]. Progenitor broiler breeders of affected broiler flocks usually have a history ranging from

91 no hatchability decrease or a decrease of 68% [8, 13, 22]. Many studies agree that progenitor

92 flocks, naïve to CAstV, are challenged during production, experience a variable decrease in

93 hatchability (with birds hatching as “white chicks”), and return to normal parameters after ~4 week

94 period where they become seropositive by commercial CAstV Group B ELISA testing [13, 22,

95 126].

96 In contrast to our knowledge of the molecular and epidemiologic characteristics of CAstV,

97 our comprehension of CAstV pathogenesis is still scarce. Currently, the control of this disease is

98 difficult due to its large geographical distribution, its horizontal, and likely vertical transmission,

99 the environmental stability of the virus, and CAstV disinfection resistance [13, 22]. The lack of

100 commercially-available vaccines may be in part due to the fact that CAstV is difficult to grow at

101 immunogenic titers preventing cost-effective commercial vaccine production [8, 13, 21]. So far,

102 the Canadian poultry industry is relying on strict biosecurity, increased down time between flocks,

103 and effective disinfection of the premises as suggested by technical publications [13]. In some

104 operations, the controversial practice of controlled-exposure by moving litter from CAstV ELISA-

105 positive flocks into naïve pullet flocks is also used, despite the dangers of exposing naïve birds to

106 other important pathogens such as Mycoplasma or Salmonella species [207, 208].

107 Recently, several outbreaks of WCS were identified across western Canada and Ontario. These

108 outbreaks have caused sizable losses in Canadian poultry operations not only due to the detrimental

109 effects of the disease, but also due to the sudden changes in allocation of day-old broiler chickens,

110 which are of importance in the Canadian supply management system. We hypothesized that WCS

111 cases detected since 2017 were associated with the presence of group B CAstV. Our objective was

112 to characterize these CAstV isolates using Next Generation Sequencing (NGS) as a tool to study

113 the genomic diversity of this virus in western Canada.

114

115 3.3 Materials and Methods

116 3.3.1 Sample collection, histopathology, and processing

117 Between December 2014-June 2019, a total of 17 samples from 12 clinical cases that were

118 diagnosed as WCS by Poultry Health Services (PHS, Airdrie, AB, Canada) were stored at -80 °C.

119 Clinical samples, such as liver and intestines, were obtained from affected dead-in-shell embryos

120 and young birds and tested by the Animal Health Laboratory (University of Guelph, Guelph, ON,

121 Canada) for CAstV using quantitative polymerase chain reaction (qPCR) [38, 125]. Affected

122 tissues from some cases were also submitted to the same laboratory for histopathology examination

123 for confirmation of diagnosis, and 17 samples from these clinical cases were held at -80°C for

124 further processing.

125 The liver and intestine samples were placed into sterile tubes prefilled with 1.0 mm zirconium

126 beads (Benchmark Scientific Sayreville, NJ, USA), and 0.5mL 1X PBS (Gibco, Waltham, MA,

127 USA) on ice, and homogenized (BeadBug, Benchmark Scientific, Sayreville, NJ, USA) during

128 three series of 30 seconds each at 300 RPM. Samples were incubated on ice for 3 minutes (min)

129 in between series. Following disruption, the samples were centrifugated at 7,500 xg for 30 min at

130 4 °C and the supernatant filtered using a 0.2 µM syringe filter (Millipore Sigma, Burlington, MA,

131 USA) and kept on ice for further processing.

132

133 3.3.2 Virus Propagation

134 Chicken Embryo Liver (CEL) cells were prepared using 14-day-old specific pathogen free

135 (SPF) embryos obtained from the Canadian Food Inspection Agency (CFIA) (Ottawa, Canada). It

136 has been shown previously that CEL can be infected with a variety of poultry viruses [134, 209-

137 213], including CAstV [106, 214]. The use of embryos was approved by the institutional animal

138 care committee, Health Science Animal Care Committee (HSACC). Livers were obtained from

139 embryos following aseptic technique, minced, trypsinized (Gibco, Carlsbad, California, USA), and

140 cultured in T25 flasks as previously described [134]. CELs were propagated in Dulbecco’s

141 Modified Eagle’s Medium (DMEM) with 10% fetal bovine serum (FBS), and 100 U/mL penicillin

142 and 100 μg/mL streptomycin (Gibco, Carlsbad, California, USA). After viral infection, with

143 processed samples (supernatants), similar media was used (except that 2% calf serum (CS) was

144 used instead of 10% FBS). Cells were incubated at 37 °C with 5% CO2. Three passages in CEL

145 were performed before RNA-extraction, cDNA conversion and PCR for detection of CAstV by

146 qPCR [38, 125].

147

148 3.3.3 RNA extraction, Reverse Transcription, qPCR and sequencing

149 Total ribonucleic acid (RNA) was extracted from infected CEL culture supernatants, obtained

150 after centrifugation at 7,500 xg for 30 min at 4 °C and the supernatant filtered using a 0.2 µM

151 syringe filter (Millipore Sigma, Burlington, MA, USA), using TRIzol Reagent (Invitrogen,

152 Carlsbad, CA), according to manufacturer’s instructions with modifications. In short, a total of

153 ~1.5 mL of filtrated supernatant was pooled. The extracted RNA was used as template for reverse-

154 transcription (RT) PCR using High-capacity complimentary cDNA reverse transcription kit

155 (Applied Biosystems, Foster City, CA, USA) for cDNA synthesis using random primers following

156 manufacturer’s instructions. The RT-PCR reaction mix consisted of 4μL 10x RT Random Primers,

157 2 μL 10×RT Buffer, 4mM dNTP Mix, 2 μL MultiScribe™ RT, 8.4 μL nuclease free H2O and 20

158 μL RNA template for a total of 40 μL reaction mix. RT-PCR thermocycler conditions consisted of

159 three steps: Step 1-Incubation, 25 °C for 10 min; Step 2-Reverse Transcriptase, 37 °C for 120 min;

160 and Step 3, Reverse transcriptase inactivation, 85 °C for 5 min. The qPCR assay was conducted

161 using PerfeCTa SYBR Green SuperMix (Quantabio, Beverly, MA, USA) using cDNA as a

162 template. The qPCR reaction mix was used using published primers by Smyth et al 2010 [125]

163 and consisted on 12.5 µL PerfeCTa SYBR 2x Buffer, 0.5 µM CAstV Forward Primer (5’-

164 GCYGCTGCTGAAGAWATACAG-3’), 0.5 µM Reverse Primer (5’-

165 CATCCCTCTACCAGATTTTCTGAAA-3’); 5 μL nuclease free H2O and 5 μL cDNA template

166 for a total of 25 μL reaction. The qPCR thermocycler conditions consisted of an initial denaturation

167 cycle of 95 °C for 3 min, and 39 cycles of 95°C for 15 seconds, 60°C for 45 seconds. At the end

168 of the amplification, a melting curve analysis was performed to verify the proper melting

169 temperature of the amplicons. Conditions of the melt curve protocol consisted of 5 seconds at 65°C

170 and then 5 seconds each at 0.5°C increments between 65°C and 95°C. Post-run qPCR amplification

171 and melt-curve data were analyzed using the Bio-Rad CFX Maestro 1.1 software (v4.1.2433.1219)

172 for positive identification of CAstV in the samples. Quantification (Nanodrop 1000,

173 ThermoScientific, Wilmington DE, USA) of the cDNA was performed before submission for NGS

174 using a Nextera XT library and the v3 600 cartridge (MiSeq, Illumina, San Diego, CA, USA) at

175 the Faculty of veterinary medicine of University of Montreal, Montreal, QC, Canada. Prior to

176 second strand synthesis, 1 µl RNAse H (New England Biolabs, MA, USA) was added to 20 µl

177 cDNA to hydrolyze the RNA strand in a DNA: RNA hybrid double strand, followed by a 20

178 minutes incubation at 37°C. Then, 1 µl 60 µM Random Primers and 22 µl of nuclease free H2O

179 were incubated for 5 minutes at 65°C. Second strand synthesis was done using 5 µl 10x Buffer 2

180 and 1 µl Klenow Fragment (3’ → 5’ exo-) at 25°C for 5 minutes, 37°C for 50 minutes, and 75°C

181 for 15 minutes. Synthesized double stranded DNA (dsDNA) was cleaned with 1.8X Axygen

182 AxyPrep Mag PCR Clean-up beads (Corning, NY, USA) following the manufacturer's protocol.

183 Quantification of dsDNA was performed using HS DNA Assay Kit in a Qubit 3.0 Fluorometer

184 (Invitrogen, CA, USA). Libraries were generated using Nextera XT DNA Library Preparation Kit

185 (Illumina, CA, USA). Briefly, 0.3 ng/ml of dsDNA was used to start the libraries. Fragmentation

186 and tagmentation was performed as suggested by the company's protocol. Amplification and

187 indexing were also performed as described in the company’s protocol. Libraries were then purified

188 using AxyPrep Mag™ PCR Clean-up Kits (Corning, NY, USA) as described in the Nextera XT

189 protocol. Library’s quality was assessed using Agilent High Sensitivity DNA Kit in a Bioanalyzer

190 (Agilent, CA, USA). Libraries were normalised using LNB1 beads (Nextera XT protocol).

191 Libraries were sequenced in a v3 600 cartridge using a MiSeq instrument and PhiX at around 1%

192 as control for the sequencing runs (Illumina, CA, USA).

193

194 3.3.4 Data analysis & Phylogenetic analysis

195 NGS short reads were mapped to the CAstV isolate CkP5 (GenBank accession#

196 KX397576), under App Map function of CLC Genomics Workbench v 12.0.2 (Qiagen, Valencia,

197 CA, USA) using default settings. Read depth on the samples had an average of 356, and all depths

198 were higher than the effective depth of 20 necessary for detecting high, low, and intermediate

199 frequencies on gross dissimilar sequences [215], which is the situation when analysing different

200 subgroups of CAstV. Whole genome sequences were aligned using MAFFT v7.450 [216, 217],

201 and phylogenetic trees were generated using RAxML v8.2.11. This was possible by applying the

202 nucleotide model GTR+gamma with Rapid bootstrapping and searching for best-scoring ML tree

203 with 1000 bootstrap replicates, with parsimony random seed 400,000 as in previous studies

204 concerning other RNA-viruses [1, 191, 218]. It is worth to mention that selection of this model

205 over others was done based on its high frequency in similar studies, albeit it is expected that

206 different models will lead to very similar results according to Abadi, et al 2019 [218]. ORF1a,

207 ORF1b, and ORF2 nucleotide and amino acid alignments were performed using Clustal Omega

208 v1.2.2. and phylogenetic trees were generated using RAxML applying the protein model

209 BLOSUM62+gamma with Rapid bootstrapping and search for best-scoring ML tree with 1000

210 bootstrap replicates, with parsimony random seed 400,000. All the sequences were deposited in

211 GenBank (Table 3.2). For phylogenetic analysis on ORF2, 38 amino acid sequences from CAstV

212 reference strains and field sequences from different locations around the world were retrieved from

213 GenBank and included in the study (Table 3.2) [8, 22]. The CAstV classification based on ORF2

214 amino acid sequence was based on two criteria: 1) Bootstrap values of the RAxML phylogenetic

215 trees with 1000 replicates, and 2) Percentage of identity matrix resulting from the RAxML

216 phylogenetic tree as in a previous publication based on a different virus, Avian Reovirus [1].

217

218 3.3.5 Recombination Analysis

219 To identify the presence of recombinant sequences, a multiple sequence alignment was

220 performed including all 24 complete CAstV sequences using MAFFT v7.450 [216, 217] (Table

221 3.2). The sequence analysis was analyzed in RDP5 software v. 5.5 [219-221], which is a software

222 that applies several recombination and analysis methods on a set of data. In this research, data was

223 analyzed using the following recombination methods: 1) RDP method [220]; 2) GENECONV

224 [222]; 3) Bootscan/Recscan method [219]; 4) MaxChi method[223]; 5) Chimaera method[224]; 6)

225 SiScan Method[225]; and 7) 3-seq[226]. Recombination events were detected by at least 6 of these

226 7 methods. Putative recombination sequences were further investigated by using Bootscan analysis

227 within the Simplot program version 3.5.1 [227], using the following parameters: window size=

228 400 bp; step size= 40bp; GapStrip=On; Repetitions= 100; Kimura 2-parameter substitution model;

229 T/t=2; and using the neighbor-joining method [227-229].

230

231 Table 3.1. List and classification of 14 CAstV isolates deposited in GenBank and background information. CAstV Capsid Breeder GenBank # Origin Province Age Clinical Case IDe Genotyping Age Accession 1 14-1235a Biv Liver AB 30W 1 DOAb Flock A. Drop in production, very poor hatchability MT789774 2 14-1235b Biv Intestine AB 30W 1 DOA and poor viability of hatched chicks. MT789775 3 14-1235c Biv Intestine AB 28W 1 DOA Flock B. Drop in production, very poor hatchability MT789776 4 14-1235d Biv Liver AB 28W 1 DOA and poor viability of hatched chicks. MT789777 5 15-1262a Biv Liver AB 32W 1 DOA Flock A. Poor hatchability. Slow hatching eggs. Red MT789778 6 15-1262b Biv Liver AB 32W 1 DOA hocks on many chicks, yellow livers. No white chicks. MT789779 7 15-1262c Biv Liver AB 33W 1 DOA Flock B. Poor hatchability. Slow hatching eggs. MT789780 8 15-1262d Biv Liver AB 33W 1 DOA Increased culls with green livers and white chicks. MT789781 9 17-0773a Biv Liver AB 30W ~20 DOEc Flock A. Poor hatchability. Increased culls were weak MT789782 10 17-0773b Biv Liver AB 30W 1 DOA with green livers and white feathering. MT789783 High first week mortality at 0.25% per day- RSSd with 11 17-0823 Biv Liver AB NDa 6 DOA MT789784 swollen/pale kidneys and mottled livers. Fertility 92%; hatchability 79%. High number of culls, 12 18-0942 Biv Liver SK 40W 1 DOA MT789785 70% of them small and white with bronze/tan livers. Fertility 81%; hatchability 68.9%; Culls 2% - 90% of MT789786 13 19-0935 Biv Liver SK 28W 1 DOA culls were white. Fertility 92.2%; hatchability 84.3%; Culls 1.42% - 25- 14 19-0981 Biv Liver SK 38W 1 DOA MT789787 30% culls are white. 232 aND – No Data. bDOA – Days of Age. cDOE- Days of Embryonation. dRSS – Runting-Stunting Syndrome. e Number on name of CAstV ID correspond to clinical 233 case. Some clinical cases were created by Hatchery. Thus, the letters following the number are used to differentiate some isolates in regards of Farm, organ, or age 234 of bird/embryo.

235 3.4 Results

236 3.4.1 Clinical background, gross lesions, and histopathology

237 The hatching of WCS-affected broilers for the diagnosed clinical cases was characterized by

238 low uniformity, increased culls with green livers and white feathering (Fig 3.1)(Fig 3.2d). Records

239 of hatchability losses, when available, ranged between 5%- 16% - and occurred mainly in the mid

240 and late incubation periods (Table 3.1). Dead-in-shell embryos were characterized by enlarged

241 firm livers ranging from bronze to bright green with occasional necrotic areas with large,

242 underutilized and unabsorbed yolk-sac contents with visible green discoloration (Fig 3.2ab), with

243 frothy intestinal contents and, in few cases, pale kidneys. Some embryos were found covered in

244 what would appear to be urates. Cull chicks were characterized by small size, depression, weak

245 upon stimulation, and frequently white plumage (Fig 3.1a). Upon necropsy, green livers, and dark-

246 green unabsorbed yolks were observed in these birds (Fig 3.2b). In some instances (17-0823), high

247 mortality was observed during the first week of life in flocks apparently mildly affected with WCS

248 during hatching. In this case, 6 day of age (DOA) were submitted with a history of high first week

249 mortality of about 0.25% per day, lack of uniformity compatible with RSS, and swollen/pale

250 kidneys and mottled livers together with yolk sac infection. The age of submission of the cases

251 included in this study was between 18 DOE, and the latest at 6 days of age, with a median of 1

252 DOA. These cases came from Broiler breeder flocks between 28 and 40 weeks of age with most

253 of the cases occurring from progenitors at the beginning of the production cycle, between 28-33

254 weeks. Clinical necropsies and sample collections from submitted cases were performed by

255 veterinarians and trained PHS personnel at the post-mortem facility at the Veterinary Professional

256 Center (Airdrie AB, Canada), following guidelines approved by the Alberta Veterinary Medical

257 Association, the CFIA, and the Public Health Agency of Canada (PHAC).

258 In 14 of the 17 samples tested, we were able to isolate CAstV in CEL (Table 3.1). We speculate

259 that the other 3 samples were not able to be isolated in CEL due to low amount of initial virus

260 (high Ct value) or lack of viable virus (data not shown).

261 Under microscopic examination of livers obtained from clinical cases (Fig 3.2c, d), affected

262 livers showed mild to severe biliary proliferation with periportal stores of immature granulocytes.

263 Bile ducts usually lined with hyperplastic epithelium and many are dilated, containing necrotic

264 heterophils and eosinophilic debris. It is common to find acute peribiliary inflammation with

265 accumulation of necrotic heterophils and accumulations of orange/eosinophilic fluid compatible

266 with bile in the bile ducts and surrounding tissues (Fig 3.2c – black arrows). The same fluid was

267 found pooling in canaliculi (Fig 3.2c-blue arrows), with variably sized foci of acute periportal

268 hepatic necrosis with mild hemorrhage and small periportal aggregates of immature heterophils.

269

270

271 (a) (b) 272 Figure 3.1. Hatching of normal (yellow) and affected (white) chicks. Progenitor broiler

273 breeders had a drop in production, and low hatchability (case 14-1235). Apparently

274 normal chick on the left and an affected “white chick” on the right in (a). Chick box after

275 quality check containing apparently normal chicks on the left, and affected chicks on the

276 right (b).

277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 (a) (b) 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 (c) (d) 314 Figure 3.2. Post-mortem examination on dead-in-shell embryos and culls of case 15-

315 1262a, and histopathology of cases 14-1235a; and 15-1262a respectively. Dead-in-shell

316 embryo with enlarged firm green livers in (a). Day-old culled chick with white plumage

317 showing enlarged firm green liver and unabsorbed yolk-sac contents with visible green

318 discoloration in (b). CAstV microphotographs of histopathological liver lesions on WCS

319 clinical cases. Case 14-1235a shows in 20X (c), proliferating bile ducts in black arrows,

320 bile in canalicular lumens in blue arrows, and heterophils and macrophages in the portal

321 vain in the green arrow. Case 15-1262a (d) shows in 40X one small foci of acute hepatic

322 necrosis (black arrow). Larger microphotographs of Figure 3c and 3d can be found on

323 Supplementary Figure 3.4.

324

325 3.4.2 Whole genome sequencing

326 The complete genome sequences of CAstV isolates (n=14) with their corresponding

327 genome size are shown in Supplemental Table 3.1. Other complete sequences (n=10) were

328 included in the analysis and Genotype, phylogenetic tree constructed, and publication from

329 which they were obtained are shown in Table 3.2. The full coding sequence was obtained for all

330 samples, and most of the 5’ and 3’ non-coding regions were also obtained by Bioinformatic

331 resequencing analysis performed with CLC Genomics Workbench v.12.0.2 (Qiagen, Valencia,

332 CA, USA).

333 In the present study, whole genome phylogenetic analysis was performed on 24 complete

334 CAstV sequences, showed that all 14 CAstV sequences circulating in western Canada clustered

335 with CAstV from United States (US): CC_CkAstV/US/2014, and CkP5/US/2016. The same

336 clustering corresponded to their ORF2 genotype (Figure 3.3). All sequences analyzed in this study

337 were included in a separate cluster within Genotype B, different from Aiii (G059/PL/2014); Bi

338 (Chinese strains: CZ1701/CN/2017; HBLP717-1/CN/2018; NJ1701/CN/2017; GDYHTJ718-

339 6/CN/2018); Bii (US strains: GA2011/US/2011; 4175/US/2011); Biii (Indian strain:

340 ANAND/IN/2016); and in the same cluster as US strains CkP5/US/2016; and

341 CC_CkAstV/US/2014. To our knowledge, no complete CAstV genome characterized as genotype

342 Biv has been uploaded to GenBank. The following findings were observed in the whole genome

343 alignment: 1) Consensus sequence with 7809 nucleotides (nt), with ungapped lengths of 24

344 sequences: Mean=7479.6 nt, Minimum=7008 nt, Maximum=7603nt, Std Dev= 108.45nt; 2) 3,879

345 nt identical sites with 3,930 nt (50%); 3) 86.1% nt pairwise identity; and 4) 204 nt gaps with 43 of

346 those gaps in coding sequences (ORF1a, ORF1b, and ORF2). These changes resulted into 917

347 non-synonymous mutations in ORF1a, ORF1b, and ORF2. Phylogenetic trees (Figures 3.3-3.4)

348 showed Nucleotide RAxML phylogenetic tree of complete CAstV sequences clustered in a similar

349 way as the amino acid (aa) RaxML based phylogenetic tree of ORF2 CAstV sequences, but these

350 two phylogenetic trees (Figures 3.3, and 3.4) clustered differently as aa RAxML phylogenetic trees

351 of ORF1a, and ORF1b (Supplemental Fig 3.1 and 3.2).

352

353

354 Table 3.2. List of all CAstV sequences in the study with GenBank Accession

355 Numbers

Phylogenetic Tree GenBank Paper Sequence Genotype Whole Genome ORF1a ORF1b ORF2 Number published 14-1235a-AB Biv X X X X MT789774 14-1235b-AB Biv X X X X MT789775 14-1235c-AB Biv X X X X MT789776 14-1235d-AB Biv X X X X MT789777 15-1262a-AB Biv X X X X MT789778 15-1262b-AB Biv X X X X MT789779 15-1262c-AB Biv X X X X MT789780 This Study 15-1262d-AB Biv X X X X MT789781 17-0773a-AB Biv X X X X MT789782 17-0773b-AB Biv X X X X MT789783 17-0823-AB Biv X X X X MT789784 18-0942-SK Biv X X X X MT789785 19-0935-SK Biv X X X X MT789786 19-0981-SK Biv X X X X MT789787 HBLP717-1/CN/2018* Bi X X X X MN725025 [47] GDYHTJ718-6/CN/2018* Bi X X X X MN725026 GA2011/US/2011** Bii X X X X JF414802 CkP5/US/2016** Biv X X X X KX397576 [36] CC_CkAstV/US/2014** Biv X X X X KX397575 ANAND/IN/2016*** Biii X X X X KY038163 [44] G059/PL/2014**** Aiii X X X X KT886453 [230] Unpublished 4175/US/2011** Bii X X X X JF832365 , 2011 CZ1701/CN/2017* Bi X X X X MN807051 Unpublished NJ1701/CN/2017* Bi X X X X MK746105 , 2019 612 Ai X JN582317 P22-18.8.00 Ai X JN582318 VF08-56 Ai X JN582319 VF08-60 Ai X JN582320 VF08-54 Aii X JN582323 VF08-18/7 Aii X JN582324 VF08-36 Aii X JN582325 VF08-48 Aii X JN582326 VF08-46 Aiii X JN582321 VF08-65 Aiii X JN582322 1010 Bi X JN582306 11522 Bi X JN582305 [22] 11672 Bi X JN582327 FP3 Bi X JN582328 VF06-1/1 Bi X JN582307 VF06-1/2 Bi X JN582308 VF06-1/4 Bi X JN582309 VF06-7/5 Bi X JN582310 VF06-7/8 Bi X JN582311 05V150/152/154 Bii X JN582312 VF06-7/3 Bii X JN582313 VF07-4/2 Bii X JN582314 VF08-29 Bii X JN582315 VF08-3 Bii X JN582316 PDRC/200/EastZone Biii X JX945853

PDRC/526/NorthZone Biii X JX945857 Unpublished PDRC/573/WestZone Biii X JX945861 , 2013 PDRC/447/SouthZone Biii X KC618323 356 *CN refers to China as origin of the sequence; **US refers to United States as the origin of the sequence; ***IN 357 refers to India as the origin of the sequence; ****PL refers to Poland as the origin of the sequence. 358

359

360

361 Figure 3.3. Nucleotide ML phylogenetic tree of complete CAstV sequences.

362 Different colors indicate different genotypes according to ORF2 analysis described

363 in Smyth et al 2017 (i.e. Aiii, Bi, Bii, Biii, and Biv in red) [22]. The included

364 sequences are described in Suppl Table 3.1 . Canadian sequences are in bold.

365 3.4.3 ORF1a

366 A total of 1,274 nt mutations, and 9 nt gaps were identified in the ORF1a gene, rendering 246

367 aa changes and 3 gaps in a consensus sequence of 1142 aa (21.5%) out of 24 sequences

368 (Supplementary Table 3.1) [36, 44, 47, 230]. Out of the three coding regions in CAstV, ORF1a

369 was the one with the lowest aa variation. Many of the non-synonymous mutations present were

370 specific to genotypes A or B, thus the ORF1a phylogenetic tree in Supplement Figure 3.1, shows

371 that genotypes A and B clustered separately. However, unlike Fig 3.3 (whole genome phylogenetic

372 tree), and Fig 3.4 (ORF2 phylogenetic tree), not all sequences within ORF2 genotype B clustered

373 according to their sub-genotype. For instance, sequence Bii-4175/US/2011 clustered near Biv

374 sequences CkP5/US/2016, and CC_CkAst/US/2014; and sequences Bii-GA2011/US/2011 and

375 Biii-ANAND/IN/2016 close to Canadian isolates obtained in this research during 2014, and 2015

376 (Supplement Fig 3.1).

377

378 3.4.4 ORF1b

379 A total of 1,563 nt mutations, and 3 nt gaps were identified in the ORF1b gene, rendering 139

380 aa changes, and 3 aa gaps in a consensus sequence of 521aa (26.7%) out of 24 sequences

381 (Supplement Table 3.1) [36, 44, 47, 230]. The phylogenetic tree in Supplemental Fig 3.2 shows

382 that genotypes A and B clustered separately. However, unlike Fig 3.3 (whole genome phylogenetic

383 tree), and Fig 3.4 (ORF2 phylogenetic tree), and similarly to Supplemental Fig 3.1 (ORF1a

384 phylogenetic tree) not all sequences within ORF2 genotype B clustered according to their sub-

385 genotype. For instance, sequence Bii-4175/US/2011 clustered in between Canadian CAstV

386 isolated in 2014/2015 and 2017/2018/2019; and Bii-GA2011/US/2011 clustered near Biv

387 sequences CkP5/US/2016, and CC_CkAst/US/2014. This, in contrast with ORF1a tree

388 (Supplement Fig 3.1), and Biii-ANAND/IN/2016 close to Canadian isolates obtained in 2014, and

389 2015 (Supplement Fig 3.1).

390

391 3.4.5 Genotyping and comparison of ORF2

392 Comparison between all previously published ORF2 sequences in research papers (n=14)

393 (Table 3.2) [22, 36, 44, 47, 230], GenBank, and those obtained in the current work (n=38; 52

394 sequences in total), showed the presence of several unique and shared mutations in 1728 nt in a

395 consensus sequence of 2267nt (76.2%) with 49 nucleotide gaps in a consensus sequence. These

396 mutations translated into 591 aa non-synonymous mutations in a 788aa-length with 30 aa gaps in

397 a consensus protein sequence. Out of the three coding regions in CAstV, ORF2 was the one with

398 the highest aa variation.

399 The 14 western Canadian isolates together with CkP5/US/2016 and CC_CkAstV/US/2014

400 clustered into a subgroup different from all published reference strains analyzed (Fig 3.4). As no

401 representative sequence genotyped as Biv CAstV antigenic group was uploaded to GenBank, the

402 authors contacted Dr. Victoria Smyth from the Agri-Food and Bioscience Institute in Belfast,

403 United Kingdom who confirmed that reference strains CkP5/US/2016, CC_CkAst/US/2014, and

404 14-1235a were classified within the Biv subcluster and share 97.8%-98.8% aa similarity with

405 VF11-71, a Canadian Isolate obtained from a case of WCS, and 95.0-96.7% aa similarity with

406 WCS European sequences VF10-26, and VF11-66 [22, 231]. Aa sequence identity between

407 western Canada sequences was of 96.88-100%; and when compared with US sequences

408 corresponding to Biv group, aa sequence identity varied from 97.97-98.51%. Other aa sequence

409 identities within groups were: Group A-75.83-100% : Ai-89.72-99.03%; Aii-99.03-99.45%; Aiii-

410 98.33-100%; Group B-77.05-100%; Bi-95.66-100%; Bii-88.43-98.79; Biii-94.99-98.37%; and

411 Biv-96.88-100%. Groups A and B were dissimilar and only shared 33.53-38.93% of aa identity.

Ai Genotype A

Aiii

Aii

Bii

Genotype B Biv

Biii

412 413 414 Figure 3.4. Amino acid ML phylogenetic tree of 52 ORF2 CAstV sequences.

415 Different colors indicate different genotypes according to ORF2 analysis described

416 in Smyth2017 [22]. The included sequences are described in Supplement Table

417 3.1

418

419 3.4.6 Recombination Analysis

420 There was a total of 36 recombination events found by RDP5 software using the full

421 exploratory recombination scan function, but only 12 were supported by at least 6 of 7 algorithms,

422 as indicated in the Material and Methods section on 24 complete CAstV genomes. Table 3.2 shows

423 a summary of those 12 events, the Recombinant and Major parent (P1) and Minor parent (P2), the

424 number of recombination methods supporting the events, p-value ranges, and most likely position

425 of breaking points.

426

427 Table 3.3. Details on Recombination Events detected by at least 6 methods on

428 alignment of 24-CAstV complete sequences

Recombinant (R)& Position of Event No. of methods P-value range Parents (P1, P2) breaking points (R)- 19-0981/CA-SK/19 ORF2 3 P1- Bii-GA2011/US/2011 6 1.811x10-28-1.695x10-90 Start: 5090 nt P2- 19-0935/CA-SK/19 End: 7750 nt (R)- 19-0981/CA-SK/19 ORF2 4 P1- Bii-4175/US/2011 6 5.440x10-11-8.389x10-86 Start: 5088 nt P2- 19-0935/CA-SK/19 End: 84 nt (R)- Biii-ANAND/IN/2016 ORf2 5 P1- Bi-HBLP717-1/CN/2018 7 7.876x10-06-1.566x10-86 Start: 7770 nt P2- 15-1262b/CA-AB/15 End: 5470 nt (R)- Bi-GDYHTJ718-6/CN/2018 Start: 7606 nt 6 P1- Bi-CZ1701/CN/2017 6 1.501x10-07-2.149x10-32 End: 130 nt P2- CC_CkAstV/US/2014 (R)- 18-0942/CA-SK/18 ORF1a-ORF1b 5.222x10-11-4.321x10-46 7 P1- 19-0981/CA-SK/19 7 Start: 1507 nt * P2- 19-0935/CA-SK/19 End: 5332 nt (R)- 18-0942/CA-SK/18 ORF2 1.613x10-04-1.910x10-14 8 P1- Bi-GDYHTJ718-6/CN/2018 6 Start: ~7294 nt ** P2- Bii-GA2011/US/2011 End: 5620 nt (R)- 19-0935/CA-SK/19 ORF2 9 P1- 17-0773a/CA-AB/17 6 1.129x10-03-1.876x10-13 Start: 5098 nt P2- 19-0981/CA-SK/19 End: 7573 nt (R)- 19-0981/CA-SK/19 ORF2 10 P1- 15-1262b/CA-AB/15 6 3.210x10-07-1.015x10-23 Start: 5133 nt P2- 17-0773a/CA-AB/17 End: 804 nt (R)- CC_CkAstV/US/2014 ORF1a-ORF1b 12 P1- 14-1235d/CA-AB/14 6 1.171x10-05-3.033x10-23 Start: 2818 nt P2- Bii-4175/US/2011 End: ~4929 nt (R)- Bii-GA2011/US/2011 ORF1a-ORF1b 13 P1- Bii-4175/US/2011 6 1.630x10-02-3.383x10-09 Start: 2408 nt P2- 18-0942/CA-SK/18 End: 4012 nt (R)- Bii-GA2011/US/2011 ORF1a 14 P1- 18-0942/CA-SK/18 7 1.088x10-03-9.808x10-08 Start: 1912 nt P2- Biii-ANAND/IN/2016 End: ~2407 nt (R)- Bii-GA2011/US/2011 ORF1a 15 P1- 19-0981/CA-SK/19 7 1.167x10-03-3.633x10-08 Start: 1000 nt P2- CC_CkAstV/US/2014 End: 1327 nt 429 * Beginning breakpoint outside of confidence interval 430 ** Recombination signal may be attributable to a process other than recombination 431 ~ Unknown breaking point, approximate location noted 432 433

434 In addition, ML phylogenetic trees were generated based on each event breakpoints to

435 evidence relations between recombinant and parental sequences (Supplement Fig 3). Putative

436 recombinant sequences Biv-19-0981/CA-SK/19; Biii-ANAND/IN/2016; Bi-GDYHTJ718-

437 6/CN/2018; Biv-18-0942/CA-SK/18; Biv-19-0935/CA-SK/19; Biv-CC_CkAstV/US/2014; and

438 Bii-GA2011/US/2011 were further analyzed using the Bootscan analysis within the Simplot

439 program. (Fig 3.5). Based on all these three previous analysis, the evidence suggests the presence

440 of seven recombinant sequences (Table 3.4).

441

442 Table 3.4 CAstV recombinant sequences and parents/parent-like sequences

443 detected by 6 recombination methods in RDP5, ML phylogenetic trees, and

444 Bootscan analysis in SimPlot software.

Recombinant Recombinant Parental # Parent Sequences Genotype Sequence Genotype Biv CC_CkAstV/US/2014 1 Biv 19-0981/CA-SK/19 Bii GA2011/US/2011 Bii 4175/US/2011 Bi HBLP717-1/CN/2018 2 Biii ANAND/IN/2016 Biv 15-1262b/CA-AB/15 Bi CZ1701/CN/2017 3 Bi GDYHTJ718-6/CN/2018 Biv CC_CkAstV/US/2014 Biv 19-0981/CA-SK/19 4 Biv 18-0942/CA-SK/18 Biv 19-0935/CA-SK/19 Biv 17-0773a/CA-AB/17 5 Biv Biv-19-0935/CA-SK/19 Biv 19-0981/CA-SK/19 Biv 14-1235d/CA-AB/14, 6 Biv CC_CkAstV/US/2014 Bii GA2011/US/2011 Bii 4175/US/2011 Bii 4175/US/2011, Biv 19-0981/CA-SK/19, 7 Bii GA2011/US/2011 Biv CC_CkAstV/US/2014, Biii ANAND/IN/2016 Biv 18-0942/CA-SK/18 445

446 447 448 449 450 451 452 453 454 Query Sequence Query Sequence 455 19(a)-0981/CA - SK/19 (b) Biii-ANAND/IN/2016 456 457 458 459 460 461 462 463

464 Query Sequence Query Sequence 465 Bi-GDYHTJ718(c) - 6/CN/2018 (d) 18-0942/CA-SK/18 466 467 468 469 470 471 472 473

474 Query Sequence Query Sequence 475 19(e)-0935/CA - SK/19 (f) CC_CkAstV/US/2014 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 Query Sequence 492 (g) Bii-GA2011/US/2011 493 494 Figure 3.5. Bootscan analysis of recombinant CAstV sequences for confirming

495 recombination was performed using Simplot program v3.5.1. Each analysis considers

496 different parent sequences (different colors) plotted in a graph considering in the vertical-

497 axis Percentage of permuted trees, and on the horizontal axis, position on the genome of

498 the query sequence. Recombinant CAstV query sequences are: 19-0981/CA-SK/19

499 (Supplement Fig 3.3a); Biii-ANAND/IN/2016 (Supplement Fig 3.3b); Bi-GDYHTJ718-

500 6/CN/2018 (Supplement Fig 3.3c); 18-0942/CA-SK/18 (Supplement Fig 3.3d); 19-

501 0935/CA-SK/19 (Supplement Fig 3.3e); CC_CkAstV/US/2014 (Supplement Fig 3.3f); Bii-

502 GA2011/US/2011 (Supplement Fig 3.3g).

503 504 3.5 Discussion

505 For the last 30 years, WCS has been increasingly gaining relevance in North America and

506 Europe [22, 124, 232-235].

507

508 It is thought that this trapped bile is the responsible of the characteristic green color of some

509 affected livers seen in WCS cases.

510

511 Thus, it is crucial to understand the antigenic variation of the field challenge in our production

512 systems in order to implement better control strategies. The objective of the present study was to

513 molecularly characterize complete sequences of CAstV isolates causing WCS in western Canada

514 since 2014. The tissue culture level of passage of the isolates used in this study was only of 3

515 passages, which lowers the possibility of genetic adaptations to in-vitro system and not originally

516 found in the isolate. This is supported by one study and two regulatory agencies. The study,

517 published in 2008 examined the highly variable S protein of Infectious Bronchitis virus (IBV), in

518 8 strains for up to 10 passages in vitro (egg passage); in this study, six strains had no changes, two

519 had 2 non-synonymous changes, and only one non-synonymous change [236]. Furthermore,

520 regulatory agencies in Europe [237]and US [238]consider that the production of a licensed

521 commercial vaccine should occur within 5 passages from the virus master seed as to warrant

522 preservation of Master Seed characteristics based on internal testing. This is specified in case of

523 the US regulation (9CFR) for the following poultry viral vaccines: Avian Encephalomyelitis virus,

524 Avian Poxvirus, Infectious Bronchitis vaccine, Infectious Laryngotracheitis virus, Newcastle

525 Disease, Infectious Bursal Disease, and Avian Reovirus [238].

526 All 14 CAstV sequences circulating in western Canada clustered together with CAstV from

527 the US: CC_CkAstV/US/2014, and CkP5/US/2016 in a sub-cluster within the B genotype.

528 Interestingly, these US sequences are linked not to a WCS case but to an RSS case in broilers in

529 the US, in which CC_CkAstV/Us/2014 corresponds to the isolation in Leghorn Male Hepathoma

530 (LMH) cells and CkP5/US/2016 to the 5th passage of this parent virus in chickens[36]. This finding

531 provides circumstantial evidence suggesting that some Canadian CAstV isolates obtained from

532 WCS may have a RSS phenotype as well, which would have to be confirmed by animal studies.

533 The genome organization (ORF1a, ORF1b, and ORF2) in the sequences described in this work

534 were similar to the ones described previously [36, 44, 47, 230]. Further classification of ORF2

535 coding sequence showed that, in agreement with the complete genome sequence analysis—but not

536 with ORF1a, and ORF1b phylogenetic trees--, all these sequences grouped together in a cluster

537 within group B but independent from subgroups Bi, Bii, and Biii. Dr. Victoria Smyth from the

538 Agri-Food and Bioscience Institute in Belfast, United Kingdom kindly confirmed the location of

539 representative strains within the subcluster Biv [22, 231]. Thus, we considered all these Canadian

540 sequences to be part of the subcluster Biv of CAstV, in agreement with other literature describing

541 WCS phenotype hitertho in genotyps Biv, and Aiii [230].

542 Other CAstV were detected circulating in Ontario, Canada, in recent years by Long et al [8,

543 9]. The 31 sequences described by Long et al 2018 were originally classified as Bii group;

544 however, this classification was based using only a partial ORF2 sequence consisting of 644nt of

545 a ~2269nt ORF2 consensus, which represents a ~29% coverage. After analyzing the sequences

546 from this study adjusted to ~644 nt, many of the sequences classified as Biv and Biii groups, were

547 classified as Bii (data not shown). Thus, it is possible that these Canadian sequences originally

548 classified as Bii using a partial sequence analysis, would be classified as Biv or Biii genotypes

549 when the entire ORF2 gene is analyzed. Furthermore, the authors identify that this issue poses a

550 major risk for epidemiology: due to its high variability, laboratory identification needs to be

551 uniform and rely on the analysis of the entire CAstV ORF2 gene prior to classification lest

552 misclassify relevant outbreaks. This is particularly relevant when designing an autogenous vaccine

553 program.

554 Upon analyzing the data more closely, we observed that the ORF1a and ORF1b phylogenetic

555 trees did not follow the cluster pattern observed on the whole genome and Capsid protein (ORF2)

556 phylogenetic trees, which is suggestive of a recombination event. Upon analyzing the sequences

557 for recombination, we found 12 novel recombination events between viruses of the Genotype B

558 groups, which suggests cocirculation of these different viruses in each point in their evolution. One

559 third (n=4, Events 7, 8, 9, and 10) of these events occurred between members of the same

560 subcluster (Biv) producing a recombinant from the same subcluster Biv; while only one (n=1,

561 Event 15) produced a recombinant classified as a different subcluster (Bii). One half of these events

562 (n=6, Events 3, 4, 5, 6, 12, 13) involved one parent from a Biv group and another from Bii group,

563 producing a variety of recombinant sequences (3 Biv, 1 Biii, 1 Bi, and 1 Biv). Finally, one last

564 event (n=1, Event 14), considered one parent from subgroup Biv and another from Biii, producing

565 a Bii recombinant.

566 Recombination events and mutations (i.e. large-scale, and small-scale) [239] are the main

567 drivers of evolution in RNA viruses, and such both events need to be considered and studied [98,

568 100, 240, 241]. Although mutations can be analyzed by phylogenetic trees and used for tracking

569 the spread of a virus sequence, these trees are built under the assumption of no recombination [242,

570 243]. Thus, observations of high phylogenetic diversity, such as the one found in the present work,

571 have been suggestive or indicative of recombination events [244, 245]. Based on our evaluation of

572 different genes using six different recombination detection algorithms using the RDP5 software,

573 further confirmation with Bootscan analysis in Simplot program, and multiple phylogenetic trees

574 generated on the suspected recombinant sequences, we can provide enough evidence for 7

575 recombination events. Astrovirus recombination events have been described in poultry such as

576 turkeys [246, 247], ducks[248], and guinea fowl [249]. To the best of our knowledge, no

577 recombination event has been described in chickens, albeit interspecies recombination has been

578 suggested [44, 230]. Events between Astroviruses from the same species [250-252] or, more rarely,

579 from different species, may cause a change in host or tissue tropism [253-255], and are more

580 difficult to study when only partial genomes are collected, as many of the recombination events

581 do not occur solely in the antigenic proteins [256]. Research in CAstV has been focused more on

582 partial or complete analysis of coding sequences, as currently there are 310 CAstV sequences

583 available in GenBank, from which only 115 (~37%) correspond to complete or partial ORF2, 184

584 (~59%) to partial ORF1b, and only 11 (~3.5%) correspond to whole genome sequences.

585 To date, it is recognized that recombination is the result of coinfection of a host cell with two

586 distinct astrovirus strains [256, 257]. A possible mechanism would be that of template exchange

587 during negative strand synthesis, as it has been described in other RNA, non-enveloped virus with

588 a similar genome size: poliovirus [258]. This mechanism has been referred as “copy-choice”[259].

589 In brief, the RNA polymerase copies the 3’ end of one parenteral positive strand in order to

590 generate a negative strand, and then, for unknown causes, (e.g. pause of the RNA polymerase,

591 template damage) detaches from the original positive RNA strand and attaches to a different

592 positive RNA strand [260, 261]. A better understanding of the mechanism responsible for

593 recombination in this family of viruses is necessary to truly understand the risk of these new

594 emergent recombinant CAstV [21, 132, 257]

595

596 3.6 Conclusions

597 In the present study, we isolated 14 CAstV sequences from WCS cases. These were genotyped

598 and classified within the novel Biv sub-cluster of CAstV, according to the ORF2 (capsid)

599 genotypic classification. The molecular characterization and phylogenetic studies suggested

600 multiple past recombination events with several CAstV sequences, some of them from US origin,

601 linked to RSS-cases. Our findings suggest that recombination events and the accumulation of point

602 mutations may have contributed to the great genetic variation observed in CAstV and evidenced

603 by the current 7 antigenic sub-clusters described above. This is the first paper describing

604 recombination events in CAstV and analyzing complete CAstV sequences in Canada. Based on

605 the information presented on this paper, whole genome sequencing methods are also a powerful

606 and useful tool that allows better characterization of the CAstV strains circulating in the field.

607

608 3.7 Supplementary Materials

609 The following are available online, Table S1: Genome Sizes of complete CAstV Sequences;

610 Figure 3.1: Amino acid ML phylogenetic tree of ORF1a; Figure 3.2: Amino acid ML phylogenetic

611 tree of ORF1b. Figure 3.3: Nucleotide ML phylogenetic analyses on CAstV on each of the

612 recombination events described on Table 2. .

613 Supplement Table 3.1. Genome sizes of complete CAstV sequences

ID ORF1a ORF1b ORF2 Genome size

14-1235a-AB 3,423 1,560 2,217 7,501 14-1235b-AB 3,423 1,560 2,217 7,501 14-1235c-AB 3,423 1,560 2,217 7,459 14-1235d-AB 3,423 1,560 2,217 7,459 15-1262a-AB 3,423 1,560 2,217 7,506 15-1262b-AB 3,423 1,560 2,217 7,495 15-1262c-AB 3,423 1,560 2,217 7,504 15-1262d-AB 3,423 1,560 2,217 7,507 17-0773a-AB 3,420 1,560 2,217 7,452 17-0773b-AB 3,420 1,560 2,217 7,490 17-0823-AB 3,420 1,560 2,217 7,502 18-0942-SK 3,420 1,560 2,217 7,490 19-0935-SK 3,420 1,560 2,217 7,481 19-0981-SK 3,420 1,560 2,217 7,452 614

615 616 617

618 Supplemental Fig 3.1. Amino acid ML phylogenetic tree of ORF1a CAstV

619 sequences. Different colors indicate different genotypes (i.e. Aiii, Bi, Bii, Biii, and

620 Biv in red) according to ORF2 analysis described in Smyth2017 [22]. The included

621 sequences are described in Table 3.2. Canadian sequences are in bold.

622

623

100

624 625 Supplement Fig 3.2. Amino acid ML phylogenetic tree of ORF1b CAstV sequences.

626 Different colors indicate different genotypes (i.e. Aiii, Bi, Bii, Biii, and Biv in red)

627 according to ORF2 analysis described in Smyth2017 [22]. The included sequences are

628 described in Table 3.2 . Canadian sequences are in bold.

629 630 631 632

633

101

634 (R) 635 (P2) 636 637 (P1) 638 Event #3- Event #4- 639 5090-7750nt (P1) 5088-84nt (R) 640 (P2) 641 642 643 644 645 646 647 648 649 650 651 652 653 654 (R) 655 (P1) 656 657 Event #5- Event #6- 7770-5470nt 7606-130nt 658 (R) 659 660 (P1) 661 662 (P2) 663 664 665 666 (P2) 667 668 669 (R) 670 671 (P1) 672 673 (R) (P2) 674 Event #7- (P2) Event #8- 675 1632 -5124nt ~7294-5620nt (P1) 676 * ** 677 678 679 680 681 682 683 684 685 686

102

687 (P2) 688 (R) 689 690 691 (P1) 692 Event #9- Event #10- (R) 693 5098-7573nt 5133-804nt (P2) 694 695 696

697 (P1) 698 699 700 701 702 703 704 705 706 (P1) 707 (P2) 708 (R) (R) 709 (P2) 710 Event #13- 711 Event #12- 2408-~4012nt 712 2818 -~4929nt 713 714

715 (P1) 716 717 718 719 720 (P2) (P1) 721 (R) (R) 722 (P2) 723 724 725 726 727 728 (P1) 729 730 731 Event #14- 732 Event #15- 1912-~2407nt 733 1000-~1327nt 734 735 Supplement Fig 3.3. Nucleotide ML phylogenetic analyses of CAstV on each of the

736 Recombination Events described on Table 3.2. Recombination events with genome

737 positions as follows: Event#3-5090-7750nt; Event#4-5088-84nt; Event#5-7770-

103

738 5470nt; Event#6-7606-130nt; Event#7-1632-5124nt; Event#8-~7294-5620nt;

739 Event#9-5098-7573nt; Event #10-5133-804nt; Event#12-2818-~4929nt; Event#13-

740 2408-~4012nt; Event#14-1912-~2407nt; and Event#15-1000-~1327nt. Different

741 colors indicate different genotypes according to ORF2 analysis described in Smyth et

742 al 2017 (i.e. Aiii, Bi, Bii, Biii, and Biv in red) [22]. The trees were built using RAxML

743 v 8.2.11 plugin of Geneious v.10.2.6. on an alignment obtained by Clustal Omega v

744 1.2.2. (R) Recombinant; (P1) Major Parent; (P2) Minor Parent. * Beginning breakpoint

745 outside of confidence interval. ** Recombination signal may be attributable to a

746 process other than recombination; ~ Unknown breaking point, approximate location

747 noted.

748

104

749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 (a)

105

779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 (b) 803 Supplement Figure 3.4. CAstV microphotographs of histopathological liver lesions on WCS clinical cases. Case 14-1235a

804 shows in 20X (c), proliferating bile ducts in black arrows, bile in canalicular lumens in blue arrows, and heterophils and

805 macrophages in the portal vain in the green arrow. Case 15-1262a (d) shows in 40X one small foci of acute hepatic necrosis

806 (black arrow).

106

807 3.8 Funding

808 This research was funded by Alberta Agriculture and Forestry, grant number 2018F162R. The

809 APC was funded by Alberta Agriculture and Forestry, grant number 2018F162R. The graduate

810 studies of V.P.T. are supported by Mitacs® Accelerate grant, Mitacs Inc, Canada grant received

811 by F.A.C. (IT15623).

812

813

107

814 CHAPTER 4: MOLECULAR CHARACTERIZATION OF HEMORRHAGIC

815 ENTERITIS VIRUS (HEV) OBTAINED FROM CLINICAL SAMPLES IN WESTERN

816 CANADA 2017–2018 [3]

817 4.1 Abstract

818 Hemorrhagic enteritis virus (HEV) is an immunosuppressive adenovirus that causes an acute

819 clinical disease characterized by hemorrhagic gastroenteritis in 4-week-old turkeys and older.

820 Recurrent incidence of secondary infections (e.g., systemic bacterial infections, cellulitis, and

821 elevated mortality), may be associated with the presence of field-type HEV in Canadian turkey

822 farms. We speculate that field-type HEV and vaccine/vaccine-like strains can be differentiated

823 through analysis of the viral genomes, hexon genes, and the specific virulence factors (e.g., ORF1,

824 E3, and fib knob domain). Nine out of sixteen spleens obtained from cases suspected of

825 immunosuppression by HEV were analyzed. The limited data obtained showed that: (1) field-type

826 HEV circulates in many non-vaccinated western Canadian flocks; (2) field-type HEV circulates in

827 vaccinated flocks with increased recurrent bacterial infections; and (3) the existence of novel point

828 mutations in hexon, ORF1, E3, and specially fib knob domains. This is the first publication

829 showing the circulation of wild-type HEV in HEV-vaccinated flocks in western Canada, and the

830 usefulness of a novel procedure that allows whole genome sequencing of HEV directly from

831 spleens, without passaging in cell culture or passaging in vivo. Further studies focusing more

832 samples are required to confirm our observations and investigate possible vaccination failure.

833

834

108

835 4.2 Introduction

836 Hemorrhagic enteritis virus (HEV) or Turkey siadenovirus A, a member of the family

837 Adenoviridae, genus Siadenovirus, is a ubiquitous poultry pathogen. HEV has a linear, double-

838 stranded DNA genome of 26.6 kilo base pairs (kb) [137] and codes for eight open reading frames

839 (ORFs) distributed in two clusters [139]. Within these, the hexon and fiber proteins are important

840 for their involvement in cell attachment and entry, plus the induction of neutralizing antibodies

841 and protection against the disease [140-142]. HEV is the etiological agent of hemorrhagic enteritis

842 (HE), a disease characterized by immunosuppression in turkeys of >4-weeks of age. The disease

843 has two presentations: (1) clinical disease consisting of depression, gastrointestinal hemorrhages,

844 and transient immunosuppression followed by increased mortality (up to 80% for highly virulent

845 strains due to blood loss and secondary infection with opportunists like Escherichia coli) [14, 23,

846 146]; and (2) subclinical infection, consisting in immunosuppression and causing economical

847 losses because of secondary bacterial infection, especially from Escherichia coli, and processing

848 plant condemnations [146-148]. The immunosuppression caused by the subclinical infection

849 increases the birds susceptibility to secondary bacterial infections which poses a problem for the

850 judicious antibiotic use in farm animals, both being important problems for the turkey industry

851 [24]

852 The rate of clinical disease (bloody feces and acute mortality) has become low due to

853 vaccination and circulation in the field of HEVs isolates that do not cause clinical disease when

854 inoculated into naïve poults, but subclinical infection (avirulent HE) [14, 27, 28], yet, many reports

855 have suggested that avirulent strains are able to trigger subclinical infection in turkeys, causing

856 strong immunosuppression and losses due to exacerbation of viral and bacterial diseases [50, 146].

857 Despite this, some Canadian farmers do not regularly vaccinate their turkey flocks against HE due

109

858 to the absence of clinical disease amidst seroconversion in the flocks, disregarding the potential

859 immunosuppressive nature of these avirulent strains. Currently, HEV is immunosuppressive and

860 responsible for morbidity and mortality [23, 25, 149].

861 Transmission of HEV can be horizontal through fecal-oral/cloacal routes [150-153] and,

862 unlike other adenoviruses there is no evidence of vertical transmission [23, 137], insect vectors are

863 not known. Recent data suggests that recovered birds can become persistently infected and in some

864 cases become long term virus shedders [154], in this way, contributing to the persistence of the

865 pathogen in the population. Being an adenovirus, it is resistant when it is protected from drying

866 [155, 156], and it will remain viable for up to 7 weeks in contaminated carcasses or feces [137].

867 This environmental resistance contributes to the HEV survival despite activities such as cleaning,

868 and disinfection in between production cycles.

869 Upon ingestion or cloacal entry, the virus replicates in the gastrointestinal tract leading to a

870 primary viremia from which the virus spreads to other internal organs, such as the bursa of

871 Fabricius and spleen. As HEV is considered a lymphotropic and lymphocytopathic virus [157,

872 158], it primarily targets IgM bearing B-lymphocytes in the bursa of Fabricius and spleen [159],

873 notably, HEV targets macrophages [160]. Transient immunosuppression, characterized by reduced

874 antibody production by B cells, and diminished phagocytosis activity by macrophages, becomes

875 evident during acute phase of the infection [161, 162]. At the same time, high levels of virus can

876 be observed in the small intestine lamina propria together with intestinal congestion and

877 hemorrhage, probably caused by the release of prostaglandins and histamine by mast cells [23,

878 158]. This transient immunosuppressive effect will be more profound in HE caused by virulent

879 strains with hemorrhagic enteritis; compared to avirulent strains [163, 164]. However, avirulent

880 strains are not apathogenic and could also cause immunosuppression [50, 137, 146]. It is known

110

881 that pathogenic and apathogenic viral sequences may be differentiated using a process known as

882 whole genome sequencing, which determines the complete nucleic acid sequence of an organism

883 genome. This technique has become a useful tool for investigating the presence of virulence factors

884 and epidemiological surveillance [262, 263]. However, this process requires researchers to have a

885 great concentration and proportion of viral DNA in the analyzed sample, which is usually obtained

886 by viral propagation. There are limited options for propagating HEV as isolation mainly occur in:

887 (1) naïve ≥6-week-old specific pathogen-free (SPF) turkeys which are scarce and difficult to obtain

888 [165], and (2) the immortalized cell-line RP19 [166], which grows in suspension, requires

889 extensive paperwork for its use, and may not work for all isolates. Thus, in this paper we propose

890 a new method to study the virus by whole genome sequencing, without the need of passaging HEV

891 in expensive/difficult systems.

892 HEV seems to have only one serotype, and research in the 70s showed that avirulent strains

893 prevented clinical disease caused by virulent strains [167]. This led to the development of the

894 Domermuth strain which is still used as a vaccine (splenic) in Europe. Cell-mediated role in the

895 protection against clinical signs is not well understood [14, 147, 161, 162]; however, maternal

896 antibodies are important, as it is expected to find passive immunity in the progeny of vaccinated

897 turkey breeders and to protect the poults for the first 2–3 weeks of life [14, 168]. Currently, three

898 types of vaccine are used in poultry operations worldwide: (a) live, commercial, or autogenous

899 “splenic” vaccines, produced from spleens of HEV-infected SPF turkeys; (b) live, tissue culture

900 derived vaccines, available in most countries and currently the only vaccine type available in

901 Canada; and (c) inactivated vaccines, used more commonly in countries where no live vaccines

902 are available [14, 27]. Use of either live vaccine variants (a and b) will induce seroconversion and

903 lead to protection against virus challenge [169], however, the splenic vaccines induce a strong and

111

904 immediate immunity and can be given as emergency vaccine during an outbreak [14]. Because of

905 this, splenic vaccines are regarded as a more potent vaccine compared to the tissue culture vaccine

906 and requires less revaccinations in the field to achieve a protective antibody titer [14, 168].

907 The Canadian turkey meat industry, with ~160 million kg of turkey meat in 2019 [59], is small

908 in comparison with other countries, such as the United States (3.25 billion kg in 2019) [264]. This

909 is of importance as the access to some vaccines, drugs, and ELISA kits is limited due to market

910 constrains. In Canada, the tissue culture vaccine is the only vaccine approved for HEV control and

2.6 911 is applied once, using a full dose (≥10 TCID50) between 3.5–6 weeks of age, or twice, using a

2.4 912 lower dose (e.g., 2/3 of a dose or ≥10 TCID50) at days 25 and 35. This strategy is designed to

913 reduce field HEV circulation in susceptible birds by immunizing birds with low maternal

914 antibodies with the first vaccine delivery (day 25), and to infect those who were not immunized at

915 the first vaccination due to high levels of neutralizing maternal antibodies or low vaccine intake

916 (day 35). In addition, some farmers rely on circulation and protection generated by field avirulent

917 strains and will, therefore, not vaccinate as there is no manifestation of clinical disease,

918 overlooking the immunosuppressive potential of these field HEV viruses.

919 Recently, several virulence factors of HEV were identified (i.e., hexon, open reading frame 1

920 (ORF1), E3, and fib knob domain) [27, 28]. HEV variants containing these factors are circulating

921 in vaccinated flocks leading to subclinical infections [26, 27]. Our objective was to characterize

922 these HEV-positive samples based on whole genome sequencing and/or gene sequences (i.e.,

923 hexon, ORF1, E3, fib knob domain) for determination of HEV origin.

924

925

112

926 4.3 Material and Methods

927 4.3.1 Sample collection, Processing, and Ultracentrifugation

928 Between July 2017–September 2018, a total of 16 spleen samples from Alberta (AB), British

929 Columbia (BC), and Ontario (ON) were collected from turkey clinical cases submitted to Poultry

930 Health Services (PHS) (Airdrie, AB, Canada), a private veterinary practice, by concerned growers

931 with commercial turkey flocks experiencing increased mortality or secondary bacterial infections

932 when compared with industry average, management guides, and/or current literature [265, 266].

933 The clinical cases were characterized by cellulitis, systemic bacterial infection, and gangrenous

934 dermatitis (Figure 4.1). Animals aged 44–117 days (average 76 days) were subjected to necropsy

935 and sample collection at the post-mortem facility at the Veterinary Professional Centre (VPC)

936 (Airdrie, AB, Canada).

937 Of the 16 spleen samples, 9 were HEV-positive by qPCR method [267], which was conducted

938 at the Institute for Applied Poultry Technologies (IAPT). The positive samples were aliquoted in

939 1.5 mL tubes and stored at −80 °C until further processing. Moreover, samples from two

940 commercially-available HE vaccines, namely Oralvax HE (Intervet Inc., Merck Animal Health,

941 Omaha, NE, USA), and H.E. Vac (Arko Laboratories, LTD., Jewell, IA, USA) were obtained from

942 PHS, aliquoted, and stored at −80 °C until further processing (Table 4.1).

943 Spleen samples added to sterile tubes prefilled with 1.0 mm zirconium beads (Benchmark

944 Scientific Sayreville, NJ, USA) on ice, and homogenized (BeadBug, Benchmark Scientific,

945 Sayreville, NJ, USA) during three series of 30 s each at 300 RPM. Samples were kept on ice for 3

946 min in between series. Following disruption, the samples were centrifugated at 7500× g for 20 min

947 at 4 °C and the supernatant filtered using a 0.2 µM syringe filter (Millipore Sigma, Burlington,

948 MA, USA) and kept on ice for further processing.

113

949 A purification method using ultracentrifugation technique with Optiprep as an iodixanol

950 gradient was used to purify and concentrate HEV [268, 269]. Briefly, the technique was adapted

951 by adjusting the volumes for use with 3.3 mL ultracentrifuge tubes (Optiseal, Beckman Coulter,

952 Fullerton, CA, USA). The highest concentration of virus genome [143] in relation of concentration

953 of host genome [270] was detected by qPCR on phases 8 and 9 (area between 25% iodixanol and

954 40% iodixanol) and those were collected and processed for DNA extraction.

955

114

956 Table 4.1. Details of the samples used in this study in chronological order.

HE Age Type of ID Tissue Province/Source Clinical Case Vaccination (Days) Sequence Program a H.E. Vac Vaccine Arko Labs N/A N/A N/A Vaccine Oralvax Vaccine MSD N/A N/A N/A Vaccine HE 17-0495 Spleen ON 44 ↑ Mortality-Surveillance No Field 17-0699 Spleen BC 69 ↑ Mortality-Surveillance No Field ↑ Mortality-Systemic Bacterial 18-0374 Spleen AB 52 Infections. Escherichia coli in No Field Pericardium ↑ Mortality-Cellulitis- Escherichia coli; Staphylococcus 18-0430 Spleen AB 110 aureus; Enterococcus faecalis; Yes Field Lactobacillus agilis in Subcutaneous tissue ↑ Mortality-Systemic Bacterial 18-0665 Spleen AB 91 Infections-Escherichia coli in Air Yes Field Sac and Liver ↑ Mortality-Surveillance 18-0723 Spleen BC 62 Escherichia coli in Air Sac and No Field Liver ↑ Mortality-Gangrenous Dermatitis Escherichia coli; Staphylococcus saprophyticus; Bacillus pumilus; 18-0943 Spleen AB 61 Bacillus altitudinis; Yes Vaccine Staphylococcus chromogenes; Staphylococcus chromogenes; Clostridium perfringes; Staphylococcus lentus in Subcutaneous tissue ↑ Mortality-Cellulitis- Escherichia coli; Staphylococcus 18-0988 Spleen AB 117 Yes Field aureus; Enterococcus in Subcutaneous tissue ↑ Mortality-Systemic Bacterial Infections- 18-1234 Spleen AB 77 No Vaccine Escherichia coli in Pericardium and Air Sac

957 a Hemorrhagic enteritis (HE)-vaccination program refers to using a full dose of vaccine (≥102.6 TCID50) 958 between 3.5–6 weeks of age, or twice using a lower dose (e.g., 2/3 of a dose or ≥102.4 TCID50) at days 25 and 959 35. 960 ↑ Increased. 961

115

962 4.3.2 DNA Extraction, PCR, and Sequencing

963 Total DNA was extracted from reconstituted vaccine vials, and ultracentrifugation phases

964 using a QIAamp DNA Mini Kit according to manufacturers’ instruction (Qiagen, Valencia, CA,

965 USA). Invitrogen Platinum SuperFi PCR Master Mix (ThermoFisher Scientific, Waltham, MA,

966 USA) was used for whole genome amplification, while Platinum Hot Start Taq PCR Master Mix

967 (2×) (ThermoFisher Scientific, Waltham, MA, USA) was used for ORF1, E3, and fib knob gene

968 amplification. Due to the high level of host DNA (nuclear and mitochondrial) in the spleen, low

969 levels of HEV virus in persistently-infected spleens due to HEV seroconversion of the flock at the

970 end of production [154], and multiplex Illumina sequencing, it was not possible to obtain the entire

971 HEV genome without pre-amplification of the sample.

972 The entire HEV genome was amplified using the primers: THEV-Whole-F1, and THEV-

973 Whole-R1 (Table 4.2) targeting conserved parts at the N and C terminus of the viral genome. The

974 reaction consisted of 1 µM forward primer THEV-Whole-F1, 1 µM reverse primer THEV-Whole-

975 R1, 12.5 µL 2× Platinum Superfi and 10 µL of DNA template for a total of 25 µL reaction mix.

976 PCR thermocycler conditions consisted of opening denaturation (95 °C, 2 min) and 35 cycles of

977 95 °C for 10 s, 59 °C for 10 s, 68 °C for 14 min, and a terminal extension (68 °C, 5 min) resulting

978 in a 26.1 kb amplicon. Following clean up (ExoSAP-IT Express PCR Product Cleanup, Applied

979 Biosystems, Santa Clara, CA, USA) and quantification (Nanodrop 1000, ThermoScientific,

980 Wilmington DE, USA) the DNA was submitted for next generation sequencing (NGS) using a

981 Nextera XT library and the v3600 cartridge (MiSeq, Illumina, San Diego, CA, USA) at the

982 Université de Montréal, QC, Canada. Sanger sequencing for ORF1, E3, and fib genes using

983 primers on Table 4.2, was used to confirm NGS data, and for the two sequences which render

116

984 incomplete NGS (17-0495; and 18-0430). Samples were submitted at different times to the

985 sequencing facility, where they were bar-coded and tested.

986

987 988 Figure 4.1. Systemic bacterial infection in 52-day-old turkeys (case 18-0374). This case

989 was submitted due to elevated mortality in a flock without hemorrhagic enteritis virus

990 (HEV) vaccination. The HEV sequence recovered from the spleen was found to be

991 different from vaccine strains and to have missense mutations on the three virulence

992 factors described by Beach et al. 2009 [28], and in the hexon protein. Airsacculitis lesions

993 can be observed in (a,b); while pericarditis lesions can be observed in (c). Escherichia

994 coli was isolated from pericardium and spleen.

995

117

996 Samples which rendered an incomplete whole genome sequencing were subjected to Sanger

997 Sequencing of the ORF1, E3, and fib genes. The ORF1 gene (1508 bp out of 1553 bp) was

998 amplified using 1 set of primers (Alkie-HEV-ORF1-F1, and Alkie-HEV3’Rev) resulting in a 1508

999 bp amplicon. An additional primer was used for sequencing (HEV3’For-951) (Table 4.2). The

1000 reaction for ORF1, E3, and fib consisted of 5 µM forward primer, 5 µM reverse primer, 12.5 µL

1001 2x Master Mix, 7.5 µL of nuclease-free H2O, and 2.5 µL of DNA template for a total of 25 µL

1002 reaction mix. PCR thermocycler conditions consisted of initial denaturation (94 °C, 3 min) and 30

1003 cycles of 94 °C for 30 s, annealing for 30 s, 72 °C for extension, and a final extension (68 °C, 7

1004 min). Different conditions than the previous PCR reactions were due to manufacturer’s

1005 recommendations based on the size of the amplicon to be obtained. Annealing temperatures and

1006 extension times specific to each primer pair can be found in Table 4.2.

1007 The PCR fragments were cleaned with E.Z.N.A. Gel Extraction Kit (Omega Bio-tek Inc.,

1008 Norcross, GA, USA) and Sanger sequenced using primers depicted in Table 4.1 (University of

1009 Calgary, Core DNA services, Calgary, AB, Canada). Hexon gene comparisons were done only

1010 using sequences obtained using NGS (Table 4.3), both Sanger and NGS derived sequences where

1011 used for the analysis of the other genes. Reference strains used are shown in Table 4.3.

1012

1013 4.3.3 Data Analysis

1014 NGS short reads were mapped to the splenic vaccine strain (Dindoral SPF; Merial GmbH,

1015 Hallbergmoos, Germany) (GenBank accession #AY849321.1) [40, 41] under App Map function

1016 on CLC Genomics Workbench v 12.0.2 (Qiagen, Valencia, CA, USA) using default settings,

1017 corresponding to internal protocols at Université de Montréal, QC, Canada, and complemented

1018 using Geneious assembler v10.2.6 (Biomatters LTD., Auckland, New Zealand) [49]. Whole

118

1019 genome sequences were aligned with MAFFT v7.450 [50, 51], and phylogenetic trees were

1020 generated using Randomized Axelerated Maximum Likelihood (RAxML) v8.2.11 by applying the

1021 nucleotide model GTR+gamma [52]. Hexon, ORF1, E3, and fib knob domain nucleotide and

1022 amino acid alignments were performed using Clustal Omega v1.2.2., and phylogenetic trees were

1023 generated using RAxML applying the protein model BLOSUM62+gamma. All the sequences were

1024 deposited in GenBank (Table 4.3). Fib knob domain sequences were further evaluated using both

1025 the NetNGlyc (http://www.cbs.dtu.dk/services/NetNGlyc/) and NetOGlyc

1026 (http://www.cbs.dtu.dk/services/NetOGlyc/) online prediction services (DTU Bioinformatics,

1027 Department of Bio and Health Informatics, DTU Health Tech, Lyngby, Denmark). Structural

1028 locations of amino acid mutations on 3-D structure of published fowl adenovius-1 (FAdV-1) hexon

1029 protein (PDB code 2INY [53]), human adenovirus (HAdV) 2 and 5 (PDB codes 1P2Z, and 1P30

1030 [54, 55]), and HEV fib knob domain (PDB code 4CW8 [4]), were carried out using PYMOL v.4.6.0

1031 (Shrödinger LLC, Cambridge MA, USA).

119

1032 Table 4.2. Primer sequences used to amplify the HEV genome and open reading frame (ORF)1 gene. N/A refers to a sequence

1033 that was design for this study and not obtained from another publication. Genome positions refer to the splenic vaccine strain

1034 (GenBank accession # AY849321.1).

Name Sequence Target Reference Position Amplicon Annealing T Extension THEV-Whole-F1 ATGCTTGGGAGGGGATTTCG THEV This study 21-40 26,129 59 °C 14 min THEV-Whole-R1 AACCGGAAAAGAAGGCGGAT THEV This study 26,131-26,150 Alkie-HEV-ORF1-F1 CTGACCTTGTCGTCCGTGC ORF1 [26] 283-301 HEV3’For-951 TGGCGGCAATGGCTTAGTAA ORF1 This study 951-970 1537 62 °C 2 min Alkie-HEV3’Rev GGATACAATTGACCATTGGAAG ORF1 [26] 1799-1820 THEV-E3-Fw CTCCCCTAGTCACCTGACCA E3 This study 20,738-20,757 1807 59 °C 2 min THEV-E3-Rv AACGCTTTCCAGGAGTAGCC E3 This study 22,525-22,544 THEV-Fib-Fw GGCTACTCCTGGAAAGCGTT fib This study 22,525-22,544 2021 59 °C 2.5 min THEV-Fib-Rv GTCAGCTTGCAACCACCAAG fib This study 24,550-24,569 THEV-Fib-Fw GGCTACTCCTGGAAAGCGTT fib This study 22,525-22,544 1502 59 °C 2 min THEV-Fib-Rv2 GCGCACCTGCAAAGTCAAAT fib This study 24,007-24,026 1035

1036

1037

1038

1039

1040

120

1041 4.4 Results

1042 4.4.1 Whole Genome Sequencing

1043 The complete genome sequences of HEV positive samples with their respective GenBank

1044 number and publication are shown in Table 4.3, whereas genome size and classification are shown

1045 in Table 4.1. These sequences were grouped within two clusters. The first cluster included four

1046 sequences: Two commercial vaccines available in Canada (H.E.Vac, and Oralvax HE), and two

1047 HEV sequences 18-0943-AB-2018, and 18-1234-AB-2018; a second cluster included seven

1048 sequences distributed in two sub clusters, the first subcluster containing four sequences 18-0374-

1049 ON-2018, 18-0665-AB-2018, 17-0699-BC-2017, and 18-0723-BC-2018; and a second subcluster

1050 containing three sequences splenic vaccine, Virulent-IL-1998, and 18-0988-AB-2018 (Figure

1051 4.2a). The following are the findings of the whole genome alignment when comparing the

1052 consensus sequence with each sequence: (1) 127 point-mutations; (2) a 3-bp change; (3) a 3-bp

1053 insertion; (4) a 2-bp change; (5) a 1-bp insertion (ORF1 Frameshift on Virulent-IL-1998); and (6)

1054 a 53-bp segment on a non-coding region showing great variability between strains with a 22-bp

1055 insertion in some strains. These changes resulted into 52 non-synonymous mutations in ORF1,

1056 IVa2, polymerase (AdPol), preterminal protein (pTP), pVII, hexon, DBP, 100K, 33K, E3, fiber

1057 (outside and inside the fib domain), and ORF7 (Supplement Table 4.1). Upon amino acid

1058 alignment analysis of the whole genome sequences, amino acid differences in structural proteins

1059 were located in the hexon (two amino acid changes) and fiber (eight amino acid changes) proteins.

1060 Phylogenetic trees (Figures 4.2, 4.3, and 4.4) showed that most of the sequences differed from the

1061 vaccine sequences included in the analysis (seven out of nine).

121

1062 Table 4.3. List of all HEV sequences in the study with GenBank accession numbers.

Phylogenetic Tree Sequencea Whole GenBank Number Genome Size (nt) Paper Published Hexon ORF1 E3 fib Knob Domain Genome H.E.Vac X X X X X MT603863 26,289 Oralvax HE X X X X X MT603864 26,270 17-0495-ON-2017 X X X MT603862 3850 17-0699-BC-2017 X X X X MT603869 26,115 18-0374-AB-2018 X X X X MT603871 25,997 18-0430-AB-2018 X X X MT603861 3850 This study 18-0665-AB-2018 X X X X MT603865 25,717 18-0723-BC-2018 X X X X MT603870 26,115 18-0943-AB-2018 X X X X MT603866 26,289 18-0988-AB-2018 X X X X MT603867 26,100 18-1234-AB-2018 X X X X MT603868 26,120 Virulent-IL-1998 b X X X X X AF074946 26,263 [139] Splenic Vaccine X X X X X AY849321 26,266 Virulent-US-VA-1996 b X X X DQ868929 3857 Virulent1-US-VA-2005 b X X X DQ868931 3857 Virulent2-US-VA-2005 b X X X DQ868932 3857 Virulent3-US-VA-2005 b X X X DQ868933 3857 Virulent4-US-VA-2005 b X X X DQ868934 3857 [28] Marble spleen vaccine X X X DQ868930 3857 Tissue culture vaccine A X X X DQ868935 3857 Tissue culture vaccine B X X X DQ868936 3857 Tissue culture vaccine C X X X DQ868937 3857 Tissue culture vaccine D X X X DQ868938 3857 Case1-DE-1989 X KX944266 1481 Case2-DE-2010 X KX944267 1388 Case3-DE-2012 X KX944268 1433 [26] Case4-DE-2008 X KX944269 1412 Case5-DE-2008 X KX944270 1296

122

Case6-DE-2008 X KX944271 1385 Case7-DE-2008 X KX944272 1492 Case8-DE-2008 X KX944273 1492 Case9-DE-UNK X KX944274 1326 Case10-DE-2008 X KX944275 1326 Case11-DE-2008 X KX944276 1326 Case12-DE-2008 X KX944277 1493 Case13-DE-2012 X KX944278 1274 Case14-DE-2012 X KX944279 1265 Case15-DE-2012 X KX944280 1265 Case16-DE-2008 X KX944281 1385 Case17-DE-2012 X KX944282 1500 1063 a Origin of the strain in name. IL—Israel; DE—Germany; US-VA—United States Virginia; AB—Canada, Alberta; BC—Canada, British Columbia; ON— 1064 Canada, Ontario. b Sequences defined as “Virulent”: Were proven to cause hemorrhagic enteritis when inoculated in susceptible turkeys in the relevant 1065 publication.

1066

1067

1068

1069

123

1070 4.4.2 Hexon Gene

1071 Using the NGS sequences, thirteen single-point mutations were located in the hexon gene

1072 (2721 bp) of which 11 were silent. Two non-synonymous mutations consisted of a ntA231C

1073 (aaE77D) on 18-0665, and a ntG2598C (aaE866D) mutation in H.E. Vac, Oralvax HE and vaccine-

1074 like sequences 18-0943-AB-2018 and 18-1234-AB-2018 (Supplement Table 4.1) were sequenced

1075 in this study. The phylogenetic tree in Figure 4.2b clusters in one branch all commercial vaccines

1076 and the HEV sequences 18-0943-AB-2018, and 18-1234-AB-2018.

1077 There is no 3D crystalized molecular structure for HEV hexon protein on which test or analyze

1078 the location of these mutations. Although amino acid identities between HAdV-2, HAdV-5, and

1079 FAdV-1 range between 47.8%–51.36% identity, the overall structure is similar between these

1080 viruses consisting on trimers of protein II distributed as three separate “towers” [144]. The location

1081 of the mutations was tested on available 3D structures on hexon proteins of HAdV-2, HAdV-3,

1082 and FAdV-1 using PYMOL. Both mutations, A231C (aaE77D), and G2598C (aaE866D), were

1083 speculated to be located at the bottom of the densely packed pedestal regions (P1, P2) in contact

1084 with the penton base found in the capsid interior surface [271, 272].

124

1085 1086 Figure 4.2. Nucleotide RAxML-based phylogenetic tree of complete HEV sequences

1087 (a); and amino acid RaxML-based phylogenetic trees of hexon gene (b), respectively.

1088 The included sequences are described in Table 4.3, and Supplement Table 4.1

1089 Sequences in bold green are the vaccines sequences derived in the present study, bold

1090 red are sequences derived from non-vaccinated flocks, and bold blue from vaccinated

1091 flocks. Sequences obtained in this study are marked with a black asterisk. GenBank

1092 accession numbers and naming structure can be found at Table 4.3.

1093

1094 4.4.3 ORF1 Region

1095 Comparison between all previously published ORF1 sequences [26, 28] and those obtained

1096 from the current work showed the presence of several unique and shared mutations. A number of

1097 mutations (n = 39) were detected, of which 17 were synonymous and 22 were non-synonymous

125

1098 (Supplement Table 4.1). Some mutations were detected in both vaccine sequences (ntG1485A;

1099 aaQ495R) and in German sequences obtained from vaccinated flocks suspected to have subclinical

1100 HE with increased mortality and higher incidence of Escherichia coli infections (Cases 7, 8, 12,

1101 and 17) [26] (ntG1274A; aaI425V) (Supplement Table 4.1). The phylogenetic tree in Figure 4.3

1102 shows ORF1 genes of virus 18-1234-AB-2018; 18-0943-AB-2018; and 18-0665-AB-2018

1103 clustering with ORF1 sequences derived from vaccine strains, ORF1 sequences consist of a

1104 separate group.

1105

1106 4.4.4 E3 Gene

1107 Eight-point mutations were located in the E3 gene (903 bp), of which five were non-

1108 synonymous. Some point mutations were common to many sequences, such as ntC497A

1109 (aaP166H), which included most US isolates from Virginia, and ntA517C (aaT173P), which

1110 included some vaccine and vaccine-like sequences (Supplement Table 4.1). The phylogenetic tree

1111 in Figure 4.4a shows sequences 18-1234-AB-2018; 18-0943-AB-2018; and 18-0665-AB-2018

1112 clustering together with vaccine strains, while all the other sequences clustered in a separate group.

1113

1114 4.4.5 Fib knob Domain

1115 Ten point mutations were located in the fib knob domain, and similarly to previous research,

1116 none of them was silent [28] (Supplement Table 4.1). None of the four non-synonymous mutations

1117 present in the Canadian sequences was shared with previously published strains from US and Israel

1118 [28]. These corresponded to: A ntC214A (aaR72S); a ntG252T (aaL84F); a ntG401A (aaG134D);

1119 and a ntG414T (aaM138I). The phylogenetic tree in Figure 4.4b shows sequences 18-1234-AB-

1120 2018; and 18-0943-AB-2018 clustering together with vaccine strains, while all the other sequences

126

1121 clustered apart from vaccine strains. There is a 3D crystalized molecular structure for HEV fib

1122 knob domain on which to analyze the location of these mutations. The amino acid sequences

1123 analyzed shared an identity of 97.58%–100%. All these mutations can be found in the most exterior

1124 part of the domain; three of them were shown to be part of linear loops on the exposed surface of

1125 the domain (ntC214A (aaR72S); ntG252T (aaL84F); ntG401A (aaG134D); and the last one,

1126 ntG414T (aaM138I), was found to be part of a beta sheet that is also exposed (See Figure 4.5).

1127 Some non-synonymous mutations on the Canadian sequences could be found in the same loop/area

1128 than other mutations present in virulent sequences from USA and Israel (See Figure 4.5).

1129

1130 4.4.6 pTP

1131 Twelve-point mutations, a four-nucleotide change, and a three-nucleotide insertion were

1132 located in the pTP gene, from which seven corresponded to non-synonymous mutations at aa296,

1133 362, 460, 521, 522–523, 524, and 529. Interestingly, the non-synonymous mutations

1134 corresponding to 521–524 are unique to the commercial vaccines and vaccine-like sequences

1135 analyzed (Supplement Table 4.1).

1136 The sequences included in each of the phylogenetic trees can be observed on Table 4.3. The

1137 single point mutations are given in Supplement Table 4.1. The sequences studied on this project,

1138 in comparison to the H.E. Vac, and Oralvax were found to share: (a) 99.0% to 99.9% nucleotide

1139 identity in whole genome sequence (Figure 4.2a); (b) 99.7% to 100% aa identity in hexon gene

1140 (Figure 4.2b); (c) 99.0% to 99.8% aa identity in the ORF1 gene (Figure 4.3); (d) 99.3% to 100%

1141 aa identity in E3 gene (Figure 4.4a); and (e) 98.8% to 100% aa identity in the fib knob domain

1142 (Figure 4.4b).

127

1143 1144 Figure 4.3. ORF1 maximum likelihood (ML) tree. Sequences shows all ORF1 HEV

1145 sequences previously published in GenBank, and those obtained in the present project.

128

1146 Sequences in bold green were obtained from vaccines in the present study, bold red

1147 from non-vaccinated flocks, and bold blue from vaccinated flocks. Sequences obtained

1148 in this study are marked with a black asterisk. GenBank accession numbers and

1149 naming structure can be found at Table 4.3.

1150

1151 1152 Figure 4.4. E3 (a) and fib knob domain (b) ML trees. Sequences in bold green were

1153 obtained from vaccines in the present study, bold red from non-vaccinated flocks, and

1154 bold blue from vaccinated flocks. Sequences obtained in this study are marked with a

1155 black asterisk. GenBank accession numbers and naming structure can be found at

1156 Table 4.3.

129

1157 1158 Figure 4.5. Structure of the HEV fib knob domain. Trimeric structure can be seen from

1159 side (a) and from the top (b). Side views of a monomer observed from the outside of

1160 the molecule (c) and the inside (d) with amino-terminus (Nt), and carboxy-terminus

1161 (Ct) signaled. Mutations found in HEV Canadian sequences marked in magenta, HEV

1162 virulent sequences on red, and one mutation found in an HEV vaccine in yellow. For

1163 total list of viruses see Table 4.3. Figure was constructed following Singh et al. 2015

1164 [141]. M65I and M87T are mutations of Virulent-IL-1998 when compared with an

1165 avirulent strain (splenic vaccine) resulting in a 3D change in C’C” loop [141]. R72S,

1166 and L84F mutations of sequences 17-0699-BC-2017; 18-0723-BC-2018; and 18-

1167 0665-AB-2018 target the same area (C’C”-loop).

130

1168 4.4.7 Prediction of O-Linked Glycosylation Sites in fib Knob by NetOGlyc Service

1169 Twenty-two aa sequences of fib knob domain obtained in this study and previously published

1170 were subjected to analysis by the NetOGlyc Server 4.0 service software [273]. This analysis

1171 predicted 6 O-glycosylation sites at amino acids 13, 18, 19, 22, 24, and 26 with tight scores within

1172 each site in the sequences regarded as vaccine or vaccine-like (Table 4.3). The same glycosylation

1173 spots were located when most of the field strains were analyzed, however higher score variations

1174 within each glycosylation areas were found in comparison with the vaccine and vaccine-like

1175 sequences. Two sequences, 18-0430, and Virulent-IL-1998, were found to have one extra site at

1176 amino acid 10 for a total of seven O-glycosylation sites. Differences with the vaccine profile are

1177 marked in red and showed in Table 4.4.

1178

131

1179 Table 4.4 List of 22 fib knob sequences and their corresponding NetOGlyc 4.0 Server

1180 prediction results (threshold score ≥ 0.5).

O-Glycosylation ID Type of Sequence Score O-Glyc Results Site H.E. Vac 13 0.76–0.77 Oralvax HE TC Vaccine A 18 0.63 TC Vaccine B 19 0.61 TC Vaccine C Positive-6 Vaccine TC Vaccine D 22 0.54 locations Marble Spleen Vaccine Splenic Vaccine 24 0.65 18-1234 26 0.71 18-0943 17-0495 13 0.76–0.77 17-0699 18-0374 18 0.62–0.66 18-0665 18-0723 19 0.59–0.61 Positive-6 18-0988 Field locations Virulent-US-VA-2005 22 0.53–0.59 Virulent-1-US-VA-2005 24 0.62–0.66 Virulent-2-US-VA-2005 Virulent-3-US-VA-2005 26 0.65–0.72 Virulent-4-US-VA-2005 10 0.5 13 0.77 18 0.63–0.64 18-0430 Positive-7 Field 19 0.62 Virulent-IL-1998 locations 22 0.54–0.55 24 0.66 26 0.71–0.72 1181

1182 4.4.8 Prediction of N-Linked Glycosylation Sites in fib Knob by NetOGlyc Service

1183 Twenty-two amino acid sequences of fib knob domain obtained in this study and previously

1184 published were subjected to analysis by the NetNGlyc Server 1.0 service software [273]. This

1185 analysis predicted 10 N-glycosylation sites at amino acids 32, 61, 67, 73, 89, 90, 97, 117, 118, 133,

1186 135, 143, and 148 in the sequences regarded as vaccine or vaccine-like (Table 4.5). Comment

132

1187 “PRO-X1” on the side of a probable glycosylation site, refers to when a proline is located after an

1188 asparagine, deeming highly unlikely that the asparagine get glycosylated due to conformational

1189 limitations. The Sequon ASN-XAA-SER/THR comment refers to a sequence of consecutive

1190 amino acids that is highly likely to get glycosylated (Table 4.5). Most of the N-glycosylation areas

1191 were located in the remaining strains, but some important differences were observed when

1192 compared with most of the vaccine sequences profile: TC Vaccine D had a different agreement at

1193 aa143 and aa148, with an extra predicted N-glycosylation site at amino acid 143; Virulent-IL-1998

1194 had a different agreement at aa67, 89, and 90 with an stronger N-glycosylation prediction at aa61;

1195 Virulent-US-VA-1996 had a different agreement at aa90 and 148, with one missing glycosylation

1196 site at aa89 and a stronger N-glycosylation prediction at aa90; 17-0699, 18-0723, and 18-0665 had

1197 a lower agreement at aa67, with one missing glycosylation site at aa67; Virulent-2-US-VA-2005,

1198 Virulent-3-US-VA-2005, and Virulent-4-US-VA-2005 had a lower agreement at aa32, and 148,

1199 with a weaker glycosylation site prediction at aa32; Virulent-1-US-VA-2005 had a lower

1200 agreement at 148; 18-0430 showed a lower agreement at aa135; and 17-0495 and 18-0374 had a

1201 lower agreement at aa148 with neither of these sequences having changes in their glycosylation

1202 profile when compared with the vaccine profile. Differences with the vaccine profile are marked

1203 in red and showed in Table 4.5.

1204

133

1205 Table 4.5. List of 22 fib knob sequences and their corresponding NetNGlyc 1.0 Server

1206 prediction results (threshold score ≥ 0.5).

Type of N-Glycosylation N-Glyc ID Potential Agreement Comments Sequence Site Results c 32-NGQF 0.6786 (9/9) ++ 61-NIGV 0.7398 (9/9) ++ a H.E. Vac Vaccine PRO-X1 . Sequon ASN- 67-NPTF 0.5111 (6/9) + b Oralvax HE Vaccine XAA-SER/THR TC Vaccine A Vaccine 73-NKSI 0.6818 (9/9) ++ Sequon ASN-XAA- TC Vaccine B Vaccine 89-NNTY 0.6219 (8/9) + SER/THR TC Vaccine C Vaccine 90-NTYI 0.6121 (8/9) + Marble Spleen Vac. Vaccine 97-NGGV 0.6647 (9/9) ++ Splenic Vaccine Vaccine 117-NNSS 0.5110 (5/9) + Sequon ASN-XAA- 18-1234 Vaccine 118-NSSF 0.4376 (7/9) - SER/THR 18-0943 Vaccine 133-NGNP 0.1234 (9/9) --- 18-0988 Field 135-NPHM 0.5491 (7/9) + PRO-X1 143-NPVP 0.1229 (9/9) --- 148-NIKM 0.6002 (8/9) + 32-NGQF 0.6784 (9/9) ++ 61-NIGV 0.7398 (9/9) ++ PRO-X1a. Sequon ASN- 67-NPTF 0.5111 (6/9) + XAA-SER/THRb 73-NKSI 0.6818 (9/9) ++ Sequon ASN-XAA- 89-NNTY 0.6219 (8/9) + SER/THR 90-NTYI 0.6121 (8/9) + TC Vaccine D Vaccine 97-NGGV 0.6648 (9/9) ++ 117-NNSS 0.5110 (5/9) + Sequon ASN-XAA- 118-NSSF 0.4377 (7/9) - SER/THR 133-NGNP 0.1234 (9/9) --- 135-NPHM 0.5493 (7/9) + PRO-X1 143-NPVS 0.5489 (6/9) + 148-NIKM 0.5516 (6/9) + 32-NGQF 0.6786 (9/9) ++ 61-NIGV 0.7589 (9/9) +++ PRO-X1a. Sequon ASN- 67-NPTF 0.5039 (4/9) + XAA-SER/THRb 73-NKSI 0.6810 (9/9) ++ Sequon ASN-XAA- 89-NNTY 0.6149 (7/9) + SER/THR 90-NTYI 0.5604 (7/9) + Virulent-IL-1998 Field 97-NGGV 0.6506 (9/9) ++ 117-NNSS 0.5112 (5/9) + Sequon ASN-XAA- 118-NSSF 0.4377 (7/9) - SER/THR 133-NGNP 0.1233 (9/9) --- 135-NPHM 0.5494 (7/9) + PRO-X1 143-NPVP 0.1229 (9/9) --- 148-NIKM 0.6004 (8/9) + 1207

134

32-NGQF 0.6786 (9/9) ++ 61-NIGV 0.7400 (9/9) ++ PRO-X1a. Sequon ASN- 67-NPTF 0.5110 (6/9) + XAA-SER/THRb Sequon ASN-XAA- 73-NKSI 0.6818 (9/9) ++ SER/THRb Virulent-US-VA- 90-NTYI 0.6771 (9/9) ++ Field 1996 97-NGGV 0.6619 (9/9) ++ 117-NNSS 0.5109 (5/9) + Sequon ASN-XAA- 118-NSSF 0.4378 (7/9) - SER/THR 133-NGNP 0.1234 (9/9) --- 135-NPHM 0.5493 (7/9) + PRO-X1 143-NPVP 0.1229 (9/9) --- 148-NIKM 0.6001 (7/9) + 32-NGQF 0.6786 (9/9) ++ 61-NIGV 0.7399 (9/9) ++ PRO-X1a. Sequon ASN- 67-NPTF 0.5111 (6/9) + XAA-SER/THRb 73-NKSI 0.6817 (9/9) ++ Sequon ASN-XAA- 89-NNTY 0.6220 (8/9) + SER/THRb 90-NTYI 0.6122 (8/9) + 18-0430 Field 97-NGGV 0.6647 (9/9) ++ 117-NNSS 0.5111 (5/9) + Sequon ASN-XAA- 118-NSSF 0.4379 (7/9) - SER/THR 133-NGNP 0.1278 (9/9) --- 135-NPHI 0.5884 (6/9) + PRO-X1 143-NPVP 0.1086 (9/9) --- 148-NIKM 0.5840 (8/9) + 32-NGQF 0.6786 (9/9) ++ 61-NIGV 0.7398 (9/9) ++ PRO-X1a. Sequon ASN- 67-NPTF 0.5110 (6/9) + XAA-SER/THRb 73-NKSI 0.6818 (9/9) ++ Sequon ASN-XAA- 89-NNTY 0.6219 (8/9) + SER/THRb 17-0495 Field 90-NTYI 0.6120 (8/9) + 18-0374 Field 97-NGGV 0.6647 (9/9) ++ 117-NNSS 0.5108 (5/9) + Sequon ASN-XAA- 118-NSSF 0.4378 (7/9) - SER/THR 133-NDNP 0.1003 (9/9) --- 135-NPHM 0.5519 (7/9) + PRO-X1 143-NPVP 0.1249 (9/9) --- 148-NIKM 0.6000 (7/9) + 1208

135

32-NGQF 0.6786 (9/9) ++ 61-NIGV 0.7398 (9/9) ++ 67-NPTF 0.4794 (4/9) - Sequon ASN-XAA- 73-NKSI 0.7094 (9/9) ++ SER/THRb 89-NNTY 0.6257 (8/9) + 17-0699 Field 90-NTYI 0.6410 (8/9) + 18-0723 Field 97-NGGV 0.6649 (9/9) ++ 18-0665 Field 117-NNSS 0.5111 (5/9) + Sequon ASN-XAA- 118-NSSF 0.4378 (7/9) - SER/THR 133-NGNP 0.1234 (9/9) --- 135-NPHM 0.5494 (7/9) + PRO-X1 143-NPVP 0.1229 (9/9) --- 148-NIKM 0.5999 (7/9) + 32-NGQF 0.6773 (9/9) ++ 61-NIGV 0.7398 (9/9) ++ PRO-X1a. Sequon ASN- 67-NPTF 0.5110 (6/9) + XAA-SER/THRb 73-NKSI 0.6818 (9/9) ++ Sequon ASN-XAA- 89-NNTY 0.6219 (8/9) + SER/THRb Virulent-1-US-VA- 90-NTYI 0.6120 (8/9) + Field 2005 97-NGGV 0.6647 (9/9) ++ 117-NNSS 0.5108 (5/9) + Sequon ASN-XAA- 118-NSSF 0.4378 (7/9) - SER/THR 133-NGNP 0.1234 (9/9) --- 135-NPHM 0.5492 (7/9) + PRO-X1 143-NPVP 0.1229 (9/9) --- 148-NIKM 0.6000 (7/9) + 32-NGQF 0.6771 (8/9) + 61-NIGV 0.7397 (9/9) ++ PRO-X1a. Sequon ASN- 67-NPTF 0.5108 (6/9) + XAA-SER/THRb 73-NKSI 0.6817 (9/9) ++ Virulent-2-US-VA- Sequon ASN-XAA- SER/THRb 2005 89-NNTY 0.6219 (8/9) + Field Virulent-3-US-VA- 90-NTYI 0.6121 (8/9) + Field 2005 97-NGGV 0.6646 (9/9) ++ Field Virulent-4-US-VA- 117-NNSS 0.5107 (5/9) + Sequon ASN-XAA- 2005 118-NSSF 0.4378 (7/9) - SER/THR 133-NGNP 0.1234 (9/9) --- 135-NPHM 0.5591 (7/9) + PRO-X1 143-NHVP 0.1038 (9/9) --- 148-NIKM 0.5943 (6/9) + 1209 a Pro-X1: When a Pro residue is located immediately after an Asn residue. Most likely the Asn is not 1210 glycosylated due to conformational limitations. b Sequon ASN-XAA-SER/THR indicates a sequence of 1211 consecutive amino acids where a polysaccharide can attach. c N-Glyc results: Any potential location crossing 1212 the threshold of 0.5 would represent a predicted glycosylated site. Potential of N-glycosylation predicted site 1213 is predicted as low “+” or strong “++”, “+++” potential; whereas scores with “-“,”--“, and “---” indicate that 1214 the site is most likely not glycosylated. Glycosylation pattern different from H.E. Vac and Oralvax HE, are 1215 underlined in bold.

1216

136

1217 4.5 Discussion

1218 In the present study, whole genome phylogenetic analysis shows the separation of seven

1219 whole genome field sequences into two clusters: (1) the first (Cluster 1) considering vaccine and

1220 vaccine-like strains (99.82%–99.96% nt similarity), and (2) Cluster 2 (99.71%–99.98%), including

1221 virulent and suspected-virulent strains together with the splenic vaccine, which is not

1222 commercially available in Canada. Similarly, as with previous publications, all major ORFs were

1223 located as expected [28, 139]. As in previous research [23, 26, 28], no major changes in either of

1224 the genes analyzed were discovered, only single point mutations that may influence the virus

1225 ability to cause disease [23, 26, 28].

1226 Recently, several virulence factors of HEV have been identified (i.e., ORF1, E3, and fib knob

1227 domain) [28]. Although some of the functions of these virulence factors remain to be discovered,

1228 there are speculations on their functions. For instance, the protein coded by the ORF1, resembles

1229 bacterial sialidases, a group of enzymes that cleave glycosydic linkages of neuraminic acids [49].

1230 These proteins may act as virulence factors for microbial [274, 275] and viral infections [276,

1231 277]; and may control HEV interactions with host cellular components and, thus, have an effect

1232 on pathogenicity and virulence [139]. Interestingly, the product of ORF1 a sialidase, has been

1233 recently confirmed as an structural component in the THEV virion, which opens the need for

1234 further research on its potential function in the virion [278, 279]. Although the E3 gene shares

1235 minimal sequence homology with other adeno viruses outside the genus Siadenovirus, it seems to

1236 resemble the E1A protein of Mastadenoviruses and may code for a transcriptional regulator, this

1237 based on the cysteine-rich regions resembling the zinc-binding CR3 domain present in E1A from

1238 Mastadenovirus [28, 278]. The expression pattern of E3 suggests a possible function in the virus

1239 life cycle but its function has not been fully elucidated [278]. The non-synonymous mutations

137

1240 found on the hexon gene are speculated to be in the base of the trimeric hexon protein, perhaps

1241 close to the penton with little to no exposure to the host, thus with apparent little importance for

1242 antigenicity or pathogenicity. However, according to research conducted on HAdV2 and HAdV5,

1243 the area below the protein is important in pH-dependent conformational change of the capsid

1244 within the endosome, leading to penetration of the membrane and release of the virus genome into

1245 the cytoplasm [271, 272, 280, 281]. Furthermore, upon analysis of 15 HAdV, Crawford–Miksza

1246 et al. [271] detected seven hyper variable regions (HVR), from which HVR-1 has a segment that

1247 can be found buried in the protein, interacting with the base of the protein. This HAdV HVR-1 has

1248 been hypothesized to have an effect on pH-dependent disassembly [272, 281]. Further research is

1249 needed, including a sound 3D structure imaging of the HEV hexon protein to provide more

1250 evidence to this hypothesis.

1251 The fib knob is implicated in the attachment to the host receptor and it is the only adenoviral

1252 protein that is glycosylated [28]; thus, an alteration of the amino acid sequence may alter the

1253 glycosylation of the protein, resulting in increased infectivity and/or decrease virus neutralization

1254 thus modifying the virulence of the virus [28, 282]. Interestingly, differences in software-predicted

1255 O-linked and N-linked glycosylation areas were witnessed between vaccine/vaccine-like HEV

1256 sequences and field HEV sequences; one extra O-linked glycosylation site; and different N-linked

1257 profiles. It is worth noting that these software-predicted glycosylation sites would have to be

1258 confirmed with relevant techniques, such as liquid chromatography-mass spectrometry (LC-

1259 MS/MS) experiments, and that glycosylation patterns vary in different host cell types. Because of

1260 the wide different glycosylation scores found in the field HEV sequences, it can be possible that

1261 different glycosylation profiles occur between sequences, as some potential sites might be

1262 inefficiently glycosylated or miss the chance of post-translational modification [283]. As described

138

1263 before, the proteins relevant for inducing neutralizing antibodies are the hexon protein, and the

1264 fiber protein. Although HEV is considered as one serotype, and there is cross-protection between

1265 isolates, it has been known for some years that there are differences in monoclonal antibodies

1266 profiles between avirulent strains (splenic vaccine) and virulent strains (Virulent-IL-1998) [284].

1267 Research in the location of specific antigenic sites for HEV is scarce; however, recent research by

1268 Singh et al. 2015, found a crucial difference between the fib knob domain structures of avirulent

1269 (splenic vaccine—GenBank AY849321), and virulent virus (Virulent-IL-1998—AF074946). In

1270 short, they found that non-synonymous mutations M65I (at the C’C”-loop), and M87T located

1271 (C’-strand) were responsible for a difference of 3Å upwards in the C’C”loop, changing the

1272 configuration of the protein. In the present work, we found changes on the same area (R72S, and

1273 L84F on sequences 17-0699-BC-2017; 18-0723-BC-2018; and 18-0665-AB-2018), as well as

1274 others that also may cause further change in the 3-D configuration of the protein, however, further

1275 crystallography studies would have to be conducted (Figure 4.5).

1276 The existence of HEV variants in vaccinated flocks with subclinical infections has also been

1277 shown [26]. In agreement with the later study, we showed that turkey farms with recurrent

1278 morbidities (e.g., systemic bacterial infections, cellulitis, and elevated mortality), with or without

1279 HEV vaccination, have subclinical HEV infections caused by HEV different from vaccine strains.

1280 Our objective was to characterize these HEV-positive samples based on whole genome sequencing

1281 and/or gene sequences (i.e., hexon, ORF1, E3, and fib knob domain).

1282 Following analysis of previously published virulence factors ORF1, E3, and fib knob [28] as

1283 well as the hexon gene, only two out of nine analyzed sequences were deemed tissue culture

1284 vaccine-like strains (one sequence obtained from a vaccinated flock, and the other one from a non-

1285 vaccinated flock); while seven out of nine were classified as field strain (three sequences obtained

139

1286 from vaccinated flocks, and the other four from non-vaccinated flocks) (Table 4.3). Although all

1287 flocks present in this study were suspected to have an immunosuppression component, due to a

1288 perceived increased susceptibility to secondary bacterial infections [24], it is interesting to note

1289 that out of four sequences obtained from HE-vaccinated flocks and with secondary bacterial

1290 infections (e.g., cellulitis, systemic bacterial infection, and gangrenous dermatitis) (18-0430; 18-

1291 0665; 18-0943; and 18-0988) (Table 4.1), three were classified as HEV field virus with no recovery

1292 of any vaccine sequence. Recovery of a vaccine sequence was expected after successful HE

1293 vaccination in these farms as vaccine is expected to reduce clinical signs, but not virus infection

1294 (Table 4.3). The absence of vaccine-like sequences in these vaccinated flocks, and the presence of

1295 field sequences may be considered as evidence suggestive of a vaccine failure scenario.

1296 Insufficient vaccine-induced immunity or failure to persistently infect the vaccinated turkeys may

1297 be due to genomic changes increasing the virulence of field strains that are able to escape the

1298 immunity provided by the vaccine or to infect the poults amidst presence of maternal antibodies

1299 before vaccination, or perhaps poor vaccine delivery.

1300 Unlike previous research conducted on virulent and avirulent (commercial splenic) sequences

1301 [28], in the present work there were five unique amino acid changes conserved in tissue culture

1302 vaccine and vaccine-like sequences distributed in two proteins: (1) the hexon protein (1 aa change)

1303 and (2) pTP (4 aa mutations). Variations on the hexon gene were only found in one previous paper

1304 by Giovanardi, et al. [27] describing insufficient immunity generated by a commercially-available

1305 inactivated splenic vaccine used in Italy. The presence of alterations in amino acid sequence in the

1306 pTP protein in tissue culture vaccine and vaccine-like sequences may be related to its passage in

1307 cell culture system, as the pTP protein is involved in viral replication forming a heterodimer

1308 involving AdPol and functions as a protein primer [285]. It is unclear if these aa changes in pTP

140

1309 would influence the replication rate of a given virus under field conditions, but pTP and hexon

1310 protein changes can be powerful markers for identifying tissue culture vaccine-like strains.

1311 Furthermore, many novel non-synonymous mutations were observed upon analysis of the fib,

1312 interestingly, in Canadian field-HEV sequences, these amino acid changes were found in close

1313 proximity with other amino acid changes also detected in virulent sequences from Israel and US,

1314 suggesting that these mutations are located in functional important locations, perhaps areas

1315 targeted by the host immune system. Given that HEV neutralizing antibodies are generated against

1316 the hexon and fiber knob proteins, any non-synonymous mutation is potentially important as it

1317 may interfere with the induction of immunity induced by vaccines and/or increased virulence of

1318 wild type HEV strains [26]. However, it is unclear if these differences in hexon, ORF1, and E3 are

1319 responsible for the reported superior immunity strength conferred by splenic vaccines when

1320 compared with tissue cultured vaccines [14, 168]. It is worth considering that tissue culture

1321 vaccines have been manufactured in the 1980s from the Domermuth strain originally used for

1322 splenic vaccination since 1970s and that fib knob sequences between these strains are identical

1323 [167, 169, 286]. Like previous research on the ORF1 protein, non-synonymous mutations tend to

1324 cluster at the terminal portions of ORF1 but in E3, most of the Canadian HEV sequences differ

1325 from tissue culture vaccines at location amino acid 173 E3, and a more reduced group of sequences

1326 at aa27. These non-synonymous mutations were not only located half way of the E3 protein (aa167,

1327 aa146, and aa173) as previous findings [28], but also, at the beginning (aa27) and towards the end

1328 of the protein (aa239) which may suggest other biological important areas within the protein.

1329 Changes in these two proteins, the sialidase coded by ORF1 and E3, have been hypothesized to

1330 modulate virulence by triggering inflammatory shock responses causing intestinal lesions and

1331 mortality due to its ability to cause apoptosis [24, 28, 146].

141

1332 The potential efficacy of a given vaccine is determined by the antigenic similarity of the

1333 viruses (vaccine and wild type) involved and the neutralization titer generated by the vaccine

1334 towards the wild type virus. In general, double-stranded DNA viruses, such as HEV, have the

1335 lowest viral mutation rate (ranging between 2 × 10−7 to 9.8 × 10−8 substitutions per nucleotide per

1336 cell infection) [98, 100]. HEV studies have found no major deletions, insertions nor evidence of

1337 recombination between viral sequences; grouping of isolates has occurred based on single point

1338 mutations discovered within genes of interest such as hexon [27], and mainly ORF1, E3, and fib

1339 knob domain [26, 28]. The main objective of the current study was to characterize HEV-positive

1340 spleen samples obtained from clinical cases in turkey flocks in which immunosuppression was

1341 suspected, as in the last 10 years there has been an increase in flocks with unusual increased

1342 mortality or secondary bacterial infections. These cases were found in turkey meat operations with

1343 or without an HEV-vaccination program, which was performed only with commercially available

1344 tissue culture HEV vaccines. These vaccines are the only live vaccines authorized in Canada,

1345 unlike other parts of North America and Europe which have commercial and autogenous splenic

1346 HEV vaccines, as well as HEV inactivated vaccines [14, 23, 27]. Based on field data recollected

1347 by PHS and publications by other researchers [26, 28], it can be suggested that field HEV viruses

1348 may have acquire adaptive changes perhaps due to vaccine pressure. Thus, the whole genome

1349 sequencing of the HEV present in spleens of clinical samples was important to understand the type

1350 of virus (if vaccine-related or not) is the main wild type HEV present in these farms. Proper

1351 phylogenetic analysis would give the industry insight on this answer and infer virulence given

1352 previous research [26, 28].

1353 Although the current study yielded valuable data, our samples did not represent the whole

1354 meat turkey industry in Canada. We also do not know whether HEV could be recovered from

142

1355 apparently healthy turkey flocks since our focus was to isolate and characterize HEV from clinical

1356 samples.

1357

1358 4.6 Conclusions

1359 The analysis of the HEV sequences have revealed the circulation of field type HEV strains in

1360 Canadian turkey flocks with a history of vaccination as well as no vaccination. These strains may

1361 be responsible for seroconversion, instead of low-virulent tissue-culture-origin strains. Results

1362 suggest that HEVs variability in the field may not be as low as previously thought, as some

1363 sequences suggest that some adaptive changes, perhaps caused by an increased vaccine pressure,

1364 have occurred and may induce immune evasion (BC strains—fib knob domain gene). Finally, as

1365 this works shows the circulation of field viruses in vaccinated flocks, and the failure to recover

1366 such sequences from clinical samples obtained from vaccinated flocks, a revision/audit of current

1367 vaccination practices by the poultry industry is recommended.

1368

1369 4.7 Supplementary Materials

1370 The following table is available online at www.mdpi.com/xxx/s1, Table 4.1: Sequence

1371 differences in hexon, ORF1, E3, and fib knob domain.

1372

143

1373 Supplement Table 4.1. Sequence differences in Hexon, ORF1, E3, and fib knob domain.

1374 X##Y; X corresponds to consensus nucleotide/amino acid, ## to position, and Y to the

1375 changing nucleotide/amino acid.

1376 1377 1378 Aa Nt Mutation Gene Sequences affected Mutation A82G I28V 18-0374-AB-2018; 17-0495-ON-2018; Virulent-1-US-VA-2005; Virulent-2-US-VA-2005; Virulent-3-US-VA- G84A I28M 2005; Virulent-4-US-VA-2005; Marble Spleen Vaccine. G100C A34P Case2-DE-2010 G122T G41V Case2-DE-2010 -147T NA Virulent-IL-1998 A161C I54L Case2-DE-2010 G176C E59Q Case2-DE-2010 C216T A72V Case2-DE-2010 C246G A82G Virulent-US-VA-1996 TT267-268GC V89G Case2-DE-2010 C297T A99V Case2-DE-2010 G353A V118I Case2-DE-2010 T416C P139S Case2-DE-2010. T455K L152V/L 18-0374-ON-2018 T522C V174A ORF1 Case2-DE-2010 T525Y V175A/V Oralvax-HE; H.E.Vac T525C V175A TC Vaccine D G603C S201T Case2-DE-2010 18-0374-ON-2018; 17-0495-ON-2017; 18-0988-AB-2018; 18-0430-AB- A1157G T386A 2018 Virulent-IL-1998; Case1-DE-1989; Case2-DE-2010; Splenic Vaccine; 18- 0988-AB-2018; 18-0430-AB-2018; 18-0374-AB-2018; 17-0495-ON-2017; A1274G I425V 17-0699-BC-2017; 18-0723-BC-2018; Splenic Vaccine; Virulent-US-VA- 1996; Virulent1-US-VA-2005; Virulent2-US-VA-2005; Virulent3-US-VA- 2005; Virulent4-US-VA-2005; Marble Spleen Vaccine. A1420C Q473H Splenic Vaccine Oralvax-HE; H.E.Vac; TC Vaccine A-B-C-D; Case12-DE-2008; Case8- A1485G Q495R DE-2008; Case7-DE-2008; Case17-DE-2008; 18-1234-AB-2018; 18-0943- AB-2018; 18-0665-AB-2018 G1534T L511F Virulent-US-VA-1996 C235G H79D Virulent-IL-1998 Iva2 G433A D145N Virulent-IL-1998 (RC)* G490T D164Y 18-0665 C316T H106Y Virulent-IL-1998 G800A R267Q 17-0699; 18-0723; 18-0665 A1259G N420S 17-0699; 18-0723 AdPol G1640C C547S Virulent-IL-1998 (Reverse C2092A P698T 18-0665 Complem G2312A R771K 18-0723 ent G2566A D856N 18-0988 T3004A Y1002N Virulent-IL-1998 G3097A E1033K Splenic Vaccine

144

T888G N296K 18-0665-AB-2018 18-0665-AB-2018; 18-0374-ON-2018; 17-0699-BC-2017; 18-0723-BC- G1085A G362E 2018 A1378G I460V 18-0988-AB-2018 ACTC1561- T521Q pTP Oralvax-HE; H.E.Vac; 18-1234-AB-2018; 18-0943-AB-2018. 1564CAAG ---1566- Q522- Oralvax-HE; H.E.Vac; 18-1234-AB-2018; 18-0943-AB-2018. 1568ACA 523EQ C1571A A524E Oralvax-HE; H.E.Vac; 18-1234-AB-2018; 18-0943-AB-2018. C1585G L529V Splenic Vaccine C217G Q73E Splenic Vaccine pVII C286T P96S 18-1234 A231C E77D 18-0665-AB-2018 Hexon G2598C E866D Oralvax-HE; H.E.Vac; 18-1234-AB-2018; 18-0943-AB-2018. C30G D10E DBP (RC) 18-0723 G193T A65S 18-0988 C224G A75G 18-0723; 18-0374; 18-0665; 17-0699 A414C K138N 18-0723; 18-0374; 18-0665; 17-0699 100K C665T T222I 18-0723 G1249A T417A 18-0374 G1792A V598I 18-0988 A354C K118N 33K 18-0665 C80T A27V 18-0430-AB-2018; 18-0988-AB-2018 A437C K146T Virulent-IL-1998 Virulent1-US-VA-2005; Virulent2-US-VA-2005; Virulent3-US-VA-2005; C497A P166H E3 Virulent4-US-VA-2005. TC Vaccine A-B-C-D; Oralvax-HE; H.E. Vac; 18-1234-AB-2018; 18- A517C T173P 0943-AB-2018; 18-0665-AB-2018. G717C K239N Splenic Vaccine T149G V51G 18-0665 C350T T118I 17-0699; 18-0723; 18-0374 G859A V288I 18-1234 G1062A M355I Fiber Virulent-IL-1998 C1081A R362S 17-0699; 18-0665; 18-0723 G1119T L374F 17-0699; 18-0665; 18-0723 T1127C M377T Virulent-IL-1998 Virulent1-US-VA-2005; Virulent2-US-VA-2005; Virulent3-US-VA-2005; G83A(1268) G28D (424) Virulent4-US-VA-2005. G195A(1380) M65I (461) Virulent-IL-1998 C214A(1399) R72S (468) fib knob 18-0723-BC-2018; 18-0665-AB-2018; 17-0699-BC-2017 domain G252T(1437) L84F (480) 18-0723-BC-2018; 18-0665-AB-2018; 17-0699-BC-2017; (Part of T260C(1445) M87T (483) Virulent-IL-1998 Fiber A265G(1450) N89D (485) Virulent-US-VA-1996 gene) G401A(1586) G134D(530) 18-0374-ON-2018; 17-0495-ON-2017

G414T(1599) M138I(534) 18-0374-ON-2018 C431A(1616) P144H(540) Virulent2-US-VA-2005; Virulent3-US-VA-2005; Virulent4-US-VA-2005 C436T(1621) P146S(542) TC Vaccine D C152T P51L ORF7 17-0699; 18-0374; 18-0665; 18-0723 1379 * RC-Reverse Complement 1380

1381

145

1382 4.8 Funding

1383 This research was funded by Alberta Agriculture and Forestry, grant number 2018F174R. The

1384 graduate studies of V.P.T. are supported by Mitacs Accelerate grant, Mitacs Inc, Canada grant

1385 received by F.A.C. (IT15623).

146

1386 CHAPTER 5: DISCUSSION AND CONCLUSIONS

1387 The viruses, ARV, CAstV, and THEV are impacting poultry operations across the globe due to

1388 clinical and subclinical infections in chickens and turkeys [1, 4, 8, 9, 26, 28, 49]. The control of

1389 the diseases caused by these viruses relies on biosecurity and vaccination [12-14]. The biosecurity

1390 measures focus on decreasing the likelihood of infections by reducing the environmental viral load

1391 and by decreasing the possibility of viral entry into the barns by cleaning, disinfection, and

1392 entry/exit control. However, intensification of poultry production has had difficulties in reaching

1393 these objectives [172, 287]. The vaccination strategies focus on decreasing the susceptibility of

1394 chickens to pathogens or strain of pathogens commonly affecting birds in a particular geographical

1395 area [172, 287, 288]. Whether the strategy is to vaccinate poultry breeders (e.g. broiler, turkey,

1396 and/or layer) to generate maternal antibodies, or the progeny for protection against the field

1397 challenge once maternal antibodies have waned, vaccination is performed using: 1) classical

1398 standard licensed vaccines, which require extensive testing (i.e. safety, purity, efficacy, and

1399 potency) and thus are costly and slow to license; 2) conditional licensed vaccines, requiring

1400 moderate testing (i.e. safety, purity, and reasonable expectation of efficacy and potency), and thus

1401 less costly, requiring a moderate regulatory process; and 3) autogenous vaccine, which require

1402 basic testing (i.e. basic purity, basic safety) [238, 289-293]. The advantages and disadvantages of

1403 these vaccine types are indicated in Table 5.1. Purity, safety, efficacy, and potency require to be

1404 tested at different degrees in these types of vaccine. Purity refers that only the target organism(s)

1405 should be present in the master seed, production seed, and final vaccine product. Safety requires

1406 testing at normal and overdosing administration with no or minimal consequences for the target

1407 animals, perhaps requiring reversion-to-virulence studies, shed spread data, and safety in non-

1408 target species. Efficacy studies focus on revealing statistically significant, and clinically relevant

147

1409 protective or therapeutic effect. Potency studies show that the product contains the adequate

1410 amount of antigen to elicit protection and that the vaccine stability is maintained during the lifetime

1411 of the product [238, 289, 292, 294-296] (Table 5.1). Consequently, the first step when

1412 implementing a vaccination control strategy would be to study the characteristics of the field

1413 challenge (e.g. antigenic diversity, virulence markers), which will shed light to what vaccine to

1414 use and how to implement the vaccination program.

1415 Despite the fact that these three poultry enteric viruses have been described decades ago and that

1416 enteric diseases generate large economic losses to the poultry industry, there is still an important

1417 gap in basic and applied research knowledge regarding these viruses [15-18]. In Canada, these

1418 diseases have gained importance as a result of the costly disruptions they cause to the Canadian

1419 Supply Management system, as well as the economic losses caused to the industry, in feed

1420 conversion, high number of culls/first week mortality, and processing plant condemnations [1, 4,

1421 8, 9, 11].

1422 A basic level of knowledge on diversity of the virus is needed for all diseases and can be done by

1423 analyzing particular protein(s) of importance. In case of ARV, the σC protein is commonly studied

1424 and studies can be found in USA [6, 29], Canada [1, 4], Europe [30, 31], China [32, 33], and

1425 Middle East [34, 35]; for CAstV, the ORF2 or capsid protein, is being studied in USA [36, 37],

1426 Canada [8, 9], UK [22, 38], Europe[39], Brazil [18, 40-42], India [43-46], China[47], and Africa

1427 (Nigeria) [48]; and for HEV, the hexon, fib knob domain of the fiber protein, E3, and ORF1

1428 proteins are being studied in USA [28, 49], Europe (i.e. Germany, Italy, Poland) [26, 27, 50], and

1429 now in Canada [3].

148

1430 Table 5.1 Advantages and disadvantages of main types of vaccines based on licensing requirements. VBG – Veterinary Biologics

1431 Guidelines

Vaccine type Advantage Disadvantage

Standard License - Full studies on purity, safety, potency, and efficacy.

CFIA/VBG 3.1-1 - Facilities need to be inspected and approved - Very slow process (e.g. 5-10 years).

USDA/9CFR §101-§118) - USDA/CFIA confirmatory test (Seeds, cells, and product)

- Used in an emergency, absence of effective standard

license vaccine, limited market, etc. - Still requires time (i.e. years) to license.

- Full purity and safety studies on Master Seed. - Efficacy is still uncertain, although with

Conditional License - Reasonable expectation of potency and efficacy (in-vivo). evidence suggestive of acceptable efficacy

CFIA - Not limited to selected operation(s). - Potency test not required for each serial

USDA/9CFR§102.6 - Faster availability than a Standard license vaccine, not as - Limited distribution

fast as an autogenous vaccine.

- Can lead to a standard license vaccine

- Less stringent inspection on facilities

149

- Used in an emergency. Faster availability time of new

isolates (6 months-1 year) - Host animal safety, potency, and efficacy Autogenous - Basic studies on purity (no extraneous not well established. bacteria/fungi/yeast. - Limited distribution to selected operation(s), CFIA/VBG 3.13E - Basic safety (either lab animals or limited number of host usually only flock of origin/complexes animals) within company. USDA/9CFR§113.113 - Only inactivated microorganisms - Limited testing on seeds - Requires Vet-Client relationship

- Less stringent inspection on facilities

1432

150

1433 Thus, the overall aim of this thesis was to investigate the molecular diversity of ARV, CAstV, and

1434 HEV in samples obtained from clinical cases in western Canada either diagnosed with Viral

1435 Arthritis (ARV), White Chicken Syndrome (CAstV) or associated with immunosuppression (HEV

1436 subclinical infection), and to further advance the database of poultry viral genes and genome

1437 sequences.

1438 In this thesis, results on divergence from standard licensed vaccines (i.e. ARV, HEV), and the

1439 diversity of virus and presence of recombinants (i.e. CAstV) are consequential for the Canadian

1440 poultry industry, as this knowledge is paramount for the effort of vaccine candidate selection (e.g.

1441 different classification systems amongst researchers), vaccine development, which is one of the

1442 most effective control strategies for these diseases. Previous chapters have analyzed the diversity

1443 of ARV, CAstV, and HEV using mainly two strategies, Sanger sequencing of a partial segment of

1444 the σC protein coding region (ARV), and whole genome sequencing (CAstV, and HEV). This

1445 chapter underscores the key take-home messages and limitations of each of these chapters and

1446 discusses future knowledge gaps for developing vaccines leading to the control of these diseases

1447 for the benefit of poultry industry.

1448 5.1 Chapter 2. Molecular characterization of emerging avian reovirus variants isolated

1449 from viral arthritis cases in western Canada 2012-2017 based on partial σC gene [1].

1450 Published in “Virology” in July 2018.

1451 o Study hypothesis: ARV sequences obtained from clinical VA cases detected since

1452 2011 in western Canada, are associated with the presence of variant ARVs

1453 (antigenically different from classical vaccine strains, indirectly defined as having an

1454 aa identity equal or less than 85%).

151

1455 o Findings: All ARVs isolated from clinical VA cases in western Canada were variant

1456 strains with low percent identity (less than or equal to 85% aa identity) when compared

1457 with classical commercially available vaccines according to partial molecular

1458 characterization of the σC protein. Furthermore, all six worldwide reported ARV

1459 clusters were obtained from clinical VA cases in Canada. So far, the best way to

1460 control diseases not covered by classical vaccine strains in any disease, has been using

1461 an autogenous vaccine strategy [12, 297].

1462 o Limitations: We have identified 4 limitations on this paper that have to do with

1463 coverage of the genome sequencing, subpopulation detection, number of samples, and

1464 number of passages of the isolates.

1465 ▪ Coverage of the σC protein. The study was based on partial Sanger sequencing of

1466 (300 aa) of the σC protein (326aa) [298]. Considering that the entire protein

1467 sequence entails 326 aa length and the first 300 aa were compared, the coverage

1468 corresponds to ~92%, not 100%. The hypervariable region of the σC protein is

1469 included in the coverage; however, changes in the last segment (26aa) of the

1470 protein were not analyzed and may be of importance. Unfortunately, this is a

1471 limitation of Sanger Sequencing and the specific ARV primers developed by Kant

1472 in 2003 [76]. Once new technologies (e.g. Next generation Sequencing-NGS) are

1473 made more affordable, data obtained will be more comprehensive and will not be

1474 limited to the design of general primers or the sequencing length inherent to Sanger

1475 Sequencing [299]. Furthermore, the use of NGS will allow the study of other viral

1476 genes and virulence/tropism markers on the query sequence correlating with in-

1477 vivo studies.

152

1478 ▪ Subpopulation detection. Partial σC amplified segments were analyzed by Sanger

1479 sequencing between 2 and 4 times (once or twice with forward and reverse

1480 primers). The scarce double peaks detected in the Sanger Sequencing

1481 chromatographs, the fact that the isolates were obtained from a reference lab, and

1482 low inoculum used for serial passaging, render the likelihood of presence of

1483 subpopulations in the samples very low. However, it cannot be concluded that

1484 neither of the isolates is absent from subpopulations bearing important mutations

1485 variant from the consensus sequence [299]. Plaque purifications, and/or NGS

1486 techniques would be more suited to better correct for this possibility as the

1487 presence of variants would be detected by the observation of several ambiguous

1488 bases in the consensus sequence [300].

1489 ▪ Number and origin of the samples. The study was based on 38 isolates received

1490 from Animal Health Centre (Abbotsford BC, Canada), obtained from 34 out of the

1491 total 94 clinical total cases diagnosed by Poultry Health Services (PHS), a private

1492 veterinary practice located in Airdrie, AB, Canada. First, not all cases were

1493 submitted for viral isolation; and second, not all cases submitted for viral isolation

1494 render an isolated virus. The criteria for selection was that submitted samples were

1495 obtained from cases representative of a cluster of farms, which were suspected to

1496 have been caused by the same ARV (e.g. same broiler breeder origin). However,

1497 it can be argued that this selection may have overrepresented or underrepresented

1498 a given ARV cluster. Another argument is that PHS is not the only poultry

1499 veterinary practice in western Canada diagnosing viral arthritis in broilers, albeit

1500 one of the most important based on case submissions.

153

1501 A powerful counter-argument against all these observations would be based on a

1502 key concept in probability theory: the central limit theorem (CLT) [301-303]. In

1503 brief, the theorem determines that the distribution of a sample means approximates

1504 a normal distribution as the sample size gets greater, thus a sufficiently large

1505 sample could be used for predicting the characteristics of a given population. One

1506 of the practical applications of this theorem is that when the sample size is ≥30,

1507 the sampling distribution approximates the standard normal distribution that is the

1508 distribution of the population [301]. In other words, if a sample is obtained

1509 containing many observations, as when one is to flip a coin several times (≥30),

1510 the probability of obtaining heads or tails will approach a normal distribution (at

1511 half the total number of flips)[304]. This principle is applicable to our sample size,

1512 as a total of 34 cases were included in the study, it is expected this sample size can

1513 be used for predicting the features of the total number of outbreaks. Other real

1514 applications of this theorem can be found in probability distribution, the

1515 explanation of the common appearance of “bell curve” of the normal

1516 distribution[305], laying the basis of statistics, which is at the heart of phylogenetic

1517 trees models used in this dissertation, and a central contributor to the field of

1518 evolutionary biology [306-308].

1519 ▪ Number of Passages. No more than three passages were conducted for propagation

1520 of the isolates [1]. Although RNA viruses are known for having a high level of

1521 mutation [98, 100], it is widely recognized that sequences within the 10 passages

1522 in RNA viruses contain no to minimal changes/adaptations when compared with

1523 the original sample [236]. This can be observed in Infections Bronchitis Virus

154

1524 [236], which for wild isolates can be up to 10−2 to 10−3 substitutions/site/year [236,

1525 309], while Human Astroviruses have been found to have a rate of 3.7 × 10–3

1526 nucleotide substitutions per site per year, and for the synonymous changes, 2.8 ×

1527 10–3 nucleotide substitutions per site per year [252]. In addition, regulatory bodies

1528 in the European Union [237], and the USA [238], require vaccines to be within the

1529 5th passage from the approved Master Seed as to not include unwanted

1530 changes/adaptations not present in the thoroughly tested Master Seed. Thus, by

1531 maintaining the number of passages below 5, we controlled for the possibility of

1532 including unwanted mutations corresponding to the propagation system.

1533 o Actions based on findings: Considering that vaccines covering all six clusters, and

1534 their sub-clusters would be prohibitively expensive, representatives from the two most

1535 common sub-clusters, namely Clusters 4.2 and 5 were selected, tested for virulence,

1536 purified, and used in an autogenous vaccine program in western Canada by PHS. Also,

1537 selected isolates may be sequenced using NGS (This unpublished data is not part of

1538 this dissertation).

1539

1540 5.2 Chapter 3. Chicken Astrovirus (CAstV) Molecular studies reveal evidence of multiple

1541 past recombination events in sequences originated from clinical samples of White

1542 Chicken Syndrome (WCS) in western Canada (Submitted for publication to journal

1543 “Viruses”)

1544 o Study hypothesis: WCS cases detected between 2014-2019 in western Canada are

1545 associated with the presence of group B CAstV.

155

1546 o Findings: All CAstV isolated from WCS cases in western Canada were classified into

1547 the novel Biv subcluster. Isolates obtained in the study shared 96.75-100% amino acid

1548 identity. In addition, there is evidence that some CAstV isolates are, in fact,

1549 recombinants of US strains or US strain-like associated with RSS.

1550 o Limitations: We have identified two limitations in this paper that have to do with

1551 subpopulation detection/reliability of recombination detection, and number of

1552 passages of the isolates.

1553 ▪ Subpopulation detection/reliability of recombination detection. It can be suggested

1554 that the recombination events described on the paper correspond to coinfection by

1555 CAstV from different genotypes. Two pieces of evidence against this hypothesis

1556 can be expressed as follows:

1557 • CAstV sequences from different genotypes are quite different, with a similarity

1558 oscillating between 72.88-87.98% in nucleotides when complete sequences are

1559 analyzed. The likelihood of such different sequences not being detected by

1560 NGS is very low considering the read depth should be able to show low,

1561 intermediate and high frequencies on dissimilar sequences [215]. Thus,

1562 evidence for co-infection would show NGS data with areas of ambiguous bases

1563 on segments in which these genotypes differ. However, the data shows a lack

1564 of ambiguous bases obtained after assembling the reads in each of the

1565 sequences. Interestingly, plaque purification or dilution of virus for singling

1566 out a particular viral population would have been a tool hindering the

1567 likelihood of finding co-infection of CAstV in the samples.

156

1568 • It stands to reason that, in a coinfection scenario, CAstVs would be present in

1569 different ratios according to the tissue analyzed. In many instances, different

1570 organs (e.g. liver, gut) from the same case were analyzed. The CAstV

1571 sequences obtained from NGS performed by our collaborators at the

1572 University of Montreal, together with all molecular analysis performed were

1573 distributed amongst the authors and showed to share a high level of similarity

1574 between each other and no presence of ambiguous bases suggestive of co-

1575 infection.

1576 ▪ Number of Passages. No more than three passages were conducted for propagation

1577 of the isolates. Although RNA viruses are known for having a high level of

1578 mutation [98, 100], it is widely recognized that sequences within the 10 passages

1579 in RNA viruses contain no to minimal changes/adaptations when compared to the

1580 original sample [236]. This can be observed in Infections Bronchitis Virus [236],

1581 which for wild isolates can be up to 10−2 to 10−3 substitutions/site/year [236, 309],

1582 while Human Astroviruses have been found to have a rate of 3.7 × 10–3 nucleotide

1583 substitutions per site per year, and for the synonymous changes, 2.8 × 10–3

1584 nucleotide substitutions per site per year [252]. In addition, regulatory bodies in

1585 the European Union [237], and USA [238], require vaccines to be within the 5th

1586 passage from the approved Master Seed as to not include unwanted

1587 changes/adaptations not present in the thoroughly tested Master Seed. Thus, by

1588 maintaining the number of passages below 5, we controlled for the possibility of

1589 including unwanted mutations corresponding to the propagation system.

157

1590 o Actions based on findings: As it is expected that many CAstV are apathogenic, a

1591 challenge model was designed and infected in-ovo into susceptible embryos. As

1592 isolates may have the potential to cause RSS, according to clinical data collected by

1593 PHS, the challenge model was design to assess this pathotype as well as embryo

1594 mortality. (This unpublished data is not part of the thesis).

1595

1596 5.3 Chapter 4. Molecular Characterization of Hemorrhagic Enteritis Virus (HEV)

1597 Obtained from Clinical Samples in western Canada 2017-2018 [310]. Published on

1598 “Viruses” in August 2020.

1599 o Study hypothesis: Characterization of HEV-positive samples from flocks with

1600 recurrent secondary bacterial infection and suspected of immunosuppression detected

1601 in western Canada in 2017-2018 would evidence circulation of Wild type HEV.

1602 o Findings: Field HEV (not vaccine-related) sequences were detected in 4 out of 5 non-

1603 vaccinated flocks. Field HEV, and not vaccine-HEV, was also detected in 3 out of 4

1604 HEV-vaccinated flocks. In addition, some of the field HEV shared non-synonymous

1605 point mutations at the same areas of the fib knob domain of the fiber gene with

1606 published virulent HEV sequences, indicating that these HEVs may be virulent. The

1607 results suggest that HEV circulates in vaccinated turkey flocks and which is suggestive

1608 of vaccine failure.

1609 o Limitations: We have identified 2 limitations on this study that have to do with the

1610 low number of samples analyzed, and the study design.

1611 ▪ Number and origin of the samples. The study was based on 9 sequences obtained

1612 from 16 spleens submitted from Alberta (AB), British Columbia (BC), and Ontario

158

1613 (ON) collected from turkey clinical cases submitted to PHS veterinary practice by

1614 concerned growers with commercial turkey flocks experiencing increased

1615 mortality or secondary bacterial infections. At first glance, 9 HEV-positive spleens

1616 out of a total 16 spleens submitted in a year would seem a low number to make an

1617 inference about the entire industry. However, it is important to consider that the

1618 Canadian Turkey industry is small and produces 20 times less turkey meat than

1619 USA sometimes unconsciously used as comparison for disease incidence. This is

1620 an important argument, in particular when we see other diseases being analyzed

1621 under this argument, for instance, in recent years, there has been an average of 55

1622 reported cases per year of blackhead disease in US turkeys [311], while there has

1623 been more 10 cases of black head disease in Western Canada in this year, which

1624 proportionally represents a larger problem than US should considerations like size

1625 of production would not be taken into consideration [312]. In addition, as per the

1626 Canadian Supply Management System, each Canadian farmer decides what

1627 vaccine(s) to apply to the birds and how to apply them. The farmer also decides if

1628 and where s/he wants to submit birds for further investigation. It is the

1629 understanding of the authors that the possible involvement of subclinical infection

1630 of field-HEV is commonly overlooked in western Canada.

1631 ▪ Study Design. A better study design would have considered a slightly different

1632 hypothesis: the presence of recurrent incidence of secondary infection in turkey

1633 farms is associated with field HEV strains. However, this hypothesis is not

1634 falsifiable [313, 314] by the data analyzed as we lacked a group of spleens obtained

1635 from unaffected flocks to show increased presence of HEV in affected flocks. The

159

1636 reason for this is that farmers do not submit samples of healthy flocks, and it is

1637 difficult to match clinical history of a flock with processing plant sampling as these

1638 parts of the production are managed by two different entities (i.e. grower, and

1639 processor) in our Canadian Supply Management system, thus we lacked this kind

1640 of sample.

1641 o Actions based on findings: Promote HEV vaccination on turkey flocks where

1642 vaccination was not practiced. Implementation of vaccine audits or further training to

1643 avoid errors in vaccination process that decrease the effectivity of vaccination.

1644

1645 5.4 Future directions

1646 For vaccination strategies to successfully control ARV, CAstV, and HEV field challenges,

1647 gaps in knowledge need to be addressed, especially in the area of vaccine design and proper

1648 execution vaccination practices. These correspond to: 1) selection of a commercial vaccine or

1649 conditional license/ autogenous vaccine candidate (i.e. ARV, CAstV, HEV); overcome limitations

1650 in propagation technology (i.e. CAstV, HEV); and simplified vaccine testing (i.e. efficacy,

1651 protection, safety, purity) that allow vaccines to be produced at a lower price while meeting all

1652 requirements needed by regulatory agencies (i.e. USDA 9CFR, CFIA) [238, 292, 296, 315].

1653 Currently, animal studies findings for identification of virulent challenge strains, and propagation

1654 technologies for the successful propagation in vitro of ARV, CAstV, and HEV that would allow

1655 enough titers for vaccine manufacturing are being researched by our group to the benefit of the

1656 poultry industry in Canada.

1657

160

1658 5.5 References

1659 1. Palomino-Tapia, V.; Mitevski, D.; Inglis, T.; van der Meer, F.; Abdul-Careem, M. F.,

1660 Molecular characterization of emerging avian reovirus variants isolated from viral

1661 arthritis cases in Western Canada 2012-2017 based on partial sigma (sigma)C gene.

1662 Virology 2018, 522, 138-146.

1663 2. Palomino-Tapia, V.; Mitevski, D.; Inglis, T.; van der Meer, F.; Martin, E.; Brash, M.;

1664 Provost, C.; Gagnon, C. A.; Abdul-Careem, M. F., Chicken Astrovirus (CAstV) molecular

1665 studies reveal evidence of multiple past recombination events in sequences originated

1666 from clinical samples of White Chick Syndrome (WCS) in western Canada. Viruses 2020,

1667 12, (10), 1096.

1668 3. Palomino-Tapia, V.; Mitevski, D.; Inglis, T.; van der Meer, F.; Abdul-Careem, M. F.,

1669 Molecular characterization of Hemorrhagic Enteritis Virus (HEV) obtained from clinical

1670 Samples in western Canada 2017-2018. Viruses 2020, 12, (9).

1671 4. Ayalew, L. E.; Gupta, A.; Fricke, J.; Ahmed, K. A.; Popowich, S.; Lockerbie, B.; Tikoo, S. K.;

1672 Ojkic, D.; Gomis, S., Phenotypic, genotypic and antigenic characterization of emerging

1673 avian reoviruses isolated from clinical cases of arthritis in broilers in Saskatchewan,

1674 Canada. Scientific reports 2017, 7, (1), 3565.

1675 5. (OAHN), O. A. H. N. Quarterly producer report - Quarter 3 2017; Ontario Animal Health

1676 Network (OAHN): http://www.poultryindustrycouncil.ca 2017.

1677 6. Sellers, H. S., Current limitations in control of viral arthritis and tenosynovitis caused by

1678 avian reoviruses in commercial poultry. Veterinary microbiology 2016.

161

1679 7. Nham, E. G. An Epidemiological Investigation of Avian Reovirus Among Commercial

1680 Broiler Chicken Flocks in Ontario. The University of Guelph, Guelph, 2013.

1681 8. Long, K. E.; Ouckama, R. M.; Weisz, A.; Brash, M. L.; Ojkic, D., White Chick Syndrome

1682 associated with Chicken Astrovirus in Ontario, Canada. Avian diseases 2018, 62, (2), 247-

1683 258.

1684 9. Long, K. E.; Hastie, G. M.; Ojkic, D.; Brash, M. L., Economic impacts of White Chick

1685 Syndrome in Ontario, Canada. Avian diseases 2017, 61, (3), 402-408.

1686 10. Inglis, T., Personal Communication- THEV PCR positive in submitted turkey cases with

1687 bacterial infections suspected to have immunosuppression. In Palomino-Tapia, V., Ed.

1688 2017.

1689 11. Anholt, R. M.; Russell, M.; Inglis, T.; Mitevski, D.; Hall, D., Information needs, sources,

1690 and decision-making by hatching egg and broiler chicken producers: A qualitative study

1691 in Alberta, Canada. The Canadian veterinary journal. La revue veterinaire canadienne

1692 2017, 58, (5), 482-487.

1693 12. Pitcovski, J.; Goyal, S., Avian Reovirus infections. In Diseases of Poultry, 2020; pp 382-

1694 400.

1695 13. Saif, Y. M.; Guy, J. S.; Day, J. M.; Cattoli, G.; Hayhow, C. S., Viral enteric infections. In

1696 Diseases of Poultry, Swayne, D., Ed. 2020; pp 401-445.

1697 14. Fitzgerald, S. D.; Rautenschlein, S.; Mahsoub, H. M.; Pierson, F. W.; Reed, W. M.; Jack, S.

1698 W., Adenovirus Infections. In Diseases of Poultry, 2020; pp 321-363.

162

1699 15. Pantin-Jackwood, M. J.; Strother, K. O.; Mundt, E.; Zsak, L.; Day, J. M.; Spackman, E.,

1700 Molecular characterization of avian astroviruses. Archives of virology 2011, 156, (2),

1701 235-44.

1702 16. Spackman, E.; Day, J. M.; Pantin-Jackwood, M. J., Astrovirus, reovirus, and rotavirus

1703 concomitant infection causes decreased weight gain in broad-breasted white poults.

1704 Avian diseases 2010, 54, (1), 16-21.

1705 17. de Wit, J. J.; Dam, G. B.; de Laar, J. M.; Biermann, Y.; Verstegen, I.; Edens, F.; Schrier, C.

1706 C., Detection and characterization of a new astrovirus in chicken and turkeys with

1707 enteric and locomotion disorders. Avian pathology : journal of the W.V.P.A 2011, 40, (5),

1708 453-61.

1709 18. Nunez, L. F. N.; Piantino Ferreira, A. J., Viral agents related to enteric disease in

1710 commercial chicken flocks, with special reference to Latin America. World's Poultry

1711 Science Journal 2013, 69, (4), 853-864.

1712 19. Jones, R. C.; Georgiou, K., Reovirus-induced tenosynovitis in chickens the influence of

1713 age at infection. Avian pathology : journal of the W.V.P.A 1984, 13, (3), 441-57.

1714 20. Kerr, K. M.; Olson, N. O., Control of infectious synovitis. 14. The effect of age of chickens

1715 on the susceptibility to three agents. Avian diseases 1964, 8, (2), 256-263.

1716 21. Pantin-Jackwood, M.; Todd, D.; Koci, M. D., Avian Astroviruses. In Astrovirus Research:

1717 Essential Ideas, Everyday Impacts, Future Directions, Schultz-Cherry, S., Ed. Springer New

1718 York: New York, NY, 2013; pp 151-180.

1719 22. Smyth, V. J., A review of the strain diversity and pathogenesis of Chicken Astrovirus.

1720 Viruses 2017, 9, (2).

163

1721 23. Dhama, K.; Gowthaman, V.; Karthik, K.; Tiwari, R.; Sachan, S.; Kumar, M. A.; Palanivelu,

1722 M.; Malik, Y. S.; Singh, R. K.; Munir, M., Haemorrhagic enteritis of turkeys - current

1723 knowledge. The Veterinary quarterly 2017, 37, (1), 31-42.

1724 24. Kaboudi, K., Virus-induced immunosuppression in turkeys (Meleagris gallopavo): A

1725 review. Open Vet J 2020, 9, (4), 349-360.

1726 25. Hoerr, F. J., Clinical aspects of immunosuppression in poultry. Avian diseases 2010, 54,

1727 (1), 2-15.

1728 26. Alkie, T. N.; Guenther, R.; Rautenschlein, S., Molecular characterization of Hemorrhagic

1729 Enteritis Viruses (HEV) detected in HEV-Vaccinated commercial turkey flocks in

1730 Germany. Avian diseases 2017, 61, (1), 96-101.

1731 27. Giovanardi, D.; Lupini, C.; Pesente, P.; Rossi, G.; Ortali, G.; Catelli, E., Longitudinal field

1732 studies of avian metapneumovirus and turkey hemorrhagic enteritis virus in turkeys

1733 suffering from colibacillosis associated mortality. Veterinary research communications

1734 2014, 38, (2), 129-37.

1735 28. Beach, N. M.; Duncan, R. B.; Larsen, C. T.; Meng, X. J.; Sriranganathan, N.; Pierson, F. W.,

1736 Comparison of 12 turkey hemorrhagic enteritis virus isolates allows prediction of genetic

1737 factors affecting virulence. The Journal of general virology 2009, 90, (Pt 8), 1978-85.

1738 29. Lu, H.; Tang, Y.; Dunn, P. A.; Wallner-Pendleton, E. A.; Lin, L.; Knoll, E. A., Isolation and

1739 molecular characterization of newly emerging avian reovirus variants and novel strains

1740 in Pennsylvania, USA, 2011-2014. Scientific reports 2015, 5, 14727.

1741 30. Farkas, S. L.; Marton, S.; Dandar, E.; Kugler, R.; Gal, B.; Jakab, F.; Balint, A.; Kecskemeti,

1742 S.; Banyai, K., Lineage diversification, homo- and heterologous reassortment and

164

1743 recombination shape the evolution of chicken orthoreoviruses. Scientific reports 2016,

1744 6, 36960.

1745 31. Troxler, S.; Rigomier, P.; Bilic, I.; Liebhart, D.; Prokofieva, I.; Robineau, B.; Hess, M.,

1746 Identification of a new reovirus causing substantial losses in broiler production in

1747 France, despite routine vaccination of breeders. The Veterinary record 2013, 172, (21),

1748 556.

1749 32. Zhang, X.; Lei, X.; Ma, L.; Wu, J.; Bao, E., Genetic and pathogenic characteristics of newly

1750 emerging avian reovirus from infected chickens with clinical arthritis in China. Poultry

1751 science 2019.

1752 33. Chen, H.; Yan, M.; Tang, Y.; Diao, Y., Pathogenicity and genomic characterization of a

1753 novel avian orthoreovius variant isolated from a vaccinated broiler flock in China. Avian

1754 pathology : journal of the W.V.P.A 2019, 48, (4), 334-342.

1755 34. Amer, M. M.; Mekky, H. M.; Fedawy, H. S., Molecular identification of Mycoplasma

1756 synoviae from breeder chicken flock showing arthritis in Egypt. Vet World 2019, 12, (4),

1757 535-541.

1758 35. Al-Ebshahy, E.; Mohamed, S.; Abas, O., First report of seroprevalence and genetic

1759 characterization of avian orthoreovirus in Egypt. Tropical animal health and production

1760 2019.

1761 36. Kang, K. I.; Linnemann, E.; Icard, A. H.; Durairaj, V.; Mundt, E.; Sellers, H. S., Chicken

1762 astrovirus as an aetiological agent of runting-stunting syndrome in broiler chickens. The

1763 Journal of general virology 2018, 99, (4), 512-524.

165

1764 37. Sellers, H.; Linneman, E.; Icard, A. H.; Mundt, E., A purified recombinant baculovirus

1765 expressed capsid protein of a new astrovirus provides partial protection to runting-

1766 stunting syndrome in chickens. Vaccine 2010, 28, (5), 1253-63.

1767 38. Smyth, V. J.; Todd, D.; Trudgett, J.; Lee, A.; Welsh, M. D., Capsid protein sequence

1768 diversity of chicken astrovirus. Avian pathology : journal of the W.V.P.A 2012, 41, (2),

1769 151-9.

1770 39. Lima, D. A.; Cibulski, S. P.; Tochetto, C.; Varela, A. P. M.; Finkler, F.; Teixeira, T. F.; Loiko,

1771 M. R.; Cerva, C.; Junqueira, D. M.; Mayer, F. Q.; Roehe, P. M., The intestinal virome of

1772 malabsorption syndrome-affected and unaffected broilers through shotgun

1773 metagenomics. Virus research 2019, 261, 9-20.

1774 40. Nunez, L. F. N.; Parra, S. H. S.; De la Torre, D.; Catroxo, M. H.; Buim, M. R.; Chacon, R. V.;

1775 Ferreira, C. S. A.; Piantino Ferreira, A. J., Isolation of avian nephritis virus from chickens

1776 showing enteric disorders. Poultry science 2018, 97, (10), 3478-3488.

1777 41. De la Torre, D. I.; Nunez, L. F.; Astolfi-Ferreira, C. S.; Piantino Ferreira, A. J., Enteric virus

1778 diversity examined by molecular methods in Brazilian poultry flocks. Vet Sci 2018, 5, (2).

1779 42. Nunez, L. F.; Santander Parra, S. H.; Carranza, C.; Astolfi-Ferreira, C. S.; Buim, M. R.;

1780 Piantino Ferreira, A. J., Detection and molecular characterization of chicken astrovirus

1781 associated with chicks that have an unusual condition known as "white chicks" in Brazil.

1782 Poultry science 2016.

1783 43. Panigrahi, S.; Jindal, N.; Kumar, P.; Barua, S.; Kumar, N.; Riyesh, T.; Chander, Y.,

1784 Molecular characterization of chicken astroviruses in gout-affected commercial broiler

1785 chickens in Haryana, India. Virusdisease 2019, 30, (4), 551-561.

166

1786 44. Patel, A. K.; Pandit, R. J.; Thakkar, J. R.; Hinsu, A. T.; Pandey, V. C.; Pal, J. K.; Prajapati, K.

1787 S.; Jakhesara, S. J.; Joshi, C. G., Complete genome sequence analysis of chicken

1788 astrovirus isolate from India. Veterinary research communications 2017, 41, (1), 67-75.

1789 45. Gowthaman, V.; Singh, S.; Dhama, K.; Barathidasan, R.; Srinivasan, P.; Saravanan, S.;

1790 Gopalakrishnamurthy, T.; Deb, R.; Mathapati, B.; Ramakrishnan, M., Detection and

1791 partial genetic characterisation of a novel variant of Avian nephritis virus in Indian

1792 poultry flocks showing diverse clinical signs. Acta veterinaria Hungarica 2015, 63, (4),

1793 499-507.

1794 46. Bulbule, N. R.; Mandakhalikar, K. D.; Kapgate, S. S.; Deshmukh, V. V.; Schat, K. A.;

1795 Chawak, M. M., Role of chicken astrovirus as a causative agent of gout in commercial

1796 broilers in India. Avian pathology : journal of the W.V.P.A 2013, 42, (5), 464-73.

1797 47. Xue, J.; Han, T.; Zhao, Y.; Yang, H.; Zhang, G., Complete genome sequence and

1798 phylogenetic analysis of novel avastroviruses circulating in China from 2016 to 2018.

1799 Virus research 2020, 278, 197858.

1800 48. Adebiyi, A. I.; Tregaskis, P. L.; Oluwayelu, D. O.; Smyth, V. J., Investigation of enteric

1801 viruses associated with Runting and Stunting in day-old chicks and older broilers in

1802 southwest Nigeria. Front Vet Sci 2019, 6, 239.

1803 49. Beach, N. M. Characterization of avirulent Turkey Hemorrhagic Enteritis Virus: A study of

1804 the molecular basis for variation in virulence and the occurrence of persistent infection.

1805 Virginia Polytechnic Institute and State University Virginia Tech, 2006.

167

1806 50. Tykalowski, B.; Koncicki, A., Studies concerning the role of hemorrhagic enteritis virus in

1807 the pathology of turkeys conducted in the Department of Poultry Diseases in Olsztyn

1808 over the last 30 years. Medicina Weterynaryjna 2017, 73, (9), 522-527.

1809 51. Hoelzer, K.; Bielke, L.; Blake, D. P.; Cox, E.; Cutting, S. M.; Devriendt, B.; Erlacher-Vindel,

1810 E.; Goossens, E.; Karaca, K.; Lemiere, S.; Metzner, M.; Raicek, M.; Collell Surinach, M.;

1811 Wong, N. M.; Gay, C.; Van Immerseel, F., Vaccines as alternatives to antibiotics for food

1812 producing animals. Part 1: challenges and needs. Veterinary research 2018, 49, (1), 64.

1813 52. Hoelzer, K.; Bielke, L.; Blake, D. P.; Cox, E.; Cutting, S. M.; Devriendt, B.; Erlacher-Vindel,

1814 E.; Goossens, E.; Karaca, K.; Lemiere, S.; Metzner, M.; Raicek, M.; Collell Surinach, M.;

1815 Wong, N. M.; Gay, C.; Van Immerseel, F., Vaccines as alternatives to antibiotics for food

1816 producing animals. Part 2: new approaches and potential solutions. Veterinary research

1817 2018, 49, (1), 70.

1818 53. Meeusen, E. N.; Walker, J.; Peters, A.; Pastoret, P. P.; Jungersen, G., Current status of

1819 veterinary vaccines. Clinical microbiology reviews 2007, 20, (3), 489-510, table of

1820 contents.

1821 54. Swayne, D. E., Diseases of poultry. In Fourteenth edition. ed.; Wiley-Blackwell,:

1822 Hoboken, NJ, 2020; p 1 online resource.

1823 55. FAO Poultry meat food supply quantity (Kg/Capita/Yr).

1824 http://www.fao.org/faostat/en/#data/FBS (28Jul20),

1825 56. Ritchie, H. Meat and dairy production. https://ourworldindata.org/meat-

1826 production#which-countries-eat-the-most-meat

1827 57. OECD; Food; Nations, A. O. o. t. U., Meat. 2020.

168

1828 58. Bedford, E. Per capita meat consumption in Canada by type 1998-2019.

1829 https://www.statista.com/statistics/442461/per-capita-meat-consumption-by-type-

1830 canada/#:~:text=Per%20capita%20meat%20consumption%20in%20Canada%20by%20ty

1831 pe%201998%2D2019&text=Chicken%20was%20the%20most%20consumed,pounds%20

1832 per%20capita%20since%201998. (28Jul20),

1833 59. Canada, A. a. A.-f. Canada's poultry and egg industry profile.

1834 https://www.agr.gc.ca/eng/animal-industry/poultry-and-eggs/poultry-and-egg-market-

1835 information/industry-profile/?id=1384971854389 (15-Jul-2020),

1836 60. Canada, A. a. A.-f. Canada's Chicken Industry. http://www.agr.gc.ca/eng/industry-

1837 markets-and-trade/statistics-and-market-information/by-product-sector/poultry-and-

1838 eggs/poultry-and-egg-market-information/sub-sector-

1839 reports/chicken/?id=1384971854392 (07 Nov 2016),

1840 61. CFIA Poultry production report. https://www.agr.gc.ca/eng/animal-industry/poultry-

1841 and-egg-market-information/production/?id=1384971854421 (10-Aug-2020),

1842 62. Olukomaiya, O.; Fernando, C.; Mereddy, R.; Li, X.; Sultanbawa, Y., Solid-state fermented

1843 plant protein sources in the diets of broiler chickens: A review. Anim Nutr 2019, 5, (4),

1844 319-330.

1845 63. Heminthavong, K., Canada's Supply Management System. In Economics, R. a. I. A. D.-P. I.

1846 a. R. S., Ed. Library of Parliament: Ottawa, Canada, 2018.

1847 64. Jones, R. C., Reovirus Infections. In Diseases of poultry, 13th ed.; Swayne, D. E., Ed. John

1848 Wiley & Sons: Ames, Iowa, 2013; pp p.351-373.

169

1849 65. Fahey, J. E.; Crawley, J. F., Studies on Chronic Respiratory Disease of chickens. VII. The

1850 nature of infection with the Pleuropneumonia-Like Organisms. Canadian journal of

1851 comparative medicine and veterinary science 1956, 20, (1), 7-19.

1852 66. Walker, E. R.; Friedman, M. H.; Olson, N. O., Electron microscopic study of an avian

1853 reovirus that causes arthritis. Journal of ultrastructure research 1972, 41, (1), 67-79.

1854 67. Sabin, A. B., Reoviruses. A new group of respiratory and enteric viruses formerly

1855 classified as ECHO type 10 is described. Science 1959, 130, (3386), 1387-9.

1856 68. Phillips, R., Reovirus infections in broiler breeders and progeny - Prevention strategies.

1857 In Shering-Plough Animal Health: New Jersey, ?

1858 69. Schat, K. A.; Van Santen, V. L., Chicken Infectious Anemia and Circovirus infections in

1859 commercial flocks. In Diseases of Poultry, 2020; pp 284-320.

1860 70. Saif, Y. M.; Marlier, D.; Smyth, V.; Noormohammadi, A.; Guy, J. S.; Suarez, D. L.; Meng, X.

1861 J.; Shivaprasad, H. L., Other viral infections. In Diseases of Poultry, 2020; pp 498-547.

1862 71. Egana-Labrin, S.; Hauck, R.; Figueroa, A.; Stoute, S.; Shivaprasad, H. L.; Crispo, M.;

1863 Corsiglia, C.; Zhou, H.; Kern, C.; Crossley, B.; Gallardo, R. A., Genotypic characterization

1864 of emerging Avian Reovirus genetic variants in California. Scientific reports 2019, 9, (1),

1865 9351.

1866 72. Dobson, K. N.; Glisson, J. R., Economic-impact of a documented case of Reovirus

1867 infection in broiler breeders. Avian diseases 1992, 36, (3), 788-791.

1868 73. Sharafeldin, T. A.; Mor, S. K.; Bekele, A. Z.; Verma, H.; Noll, S. L.; Goyal, S. M.; Porter, R.

1869 E., Experimentally induced lameness in turkeys inoculated with a newly emergent turkey

1870 reovirus. Veterinary research 2015, 46, 11.

170

1871 74. Rosenberger, J. K.; Sterner, F. J.; Botts, S.; Lee, K. P.; Margolin, A., Invitro and invivo

1872 characterization of Avian Reoviruses .1. Pathogenicity and antigenic relatedness of

1873 several Avian Reovirus isolates. Avian diseases 1989, 33, (3), 535-544.

1874 75. Sharafeldin, T. A.; Mor, S. K.; Bekele, A. Z.; Verma, H.; Goyal, S. M.; Porter, R. E., The role

1875 of avian reoviruses in turkey tenosynovitis/arthritis. Avian pathology : journal of the

1876 W.V.P.A 2014, 43, (4), 371-8.

1877 76. Kant, A.; Balk, F.; Born, L.; van Roozelaar, D.; Heijmans, J.; Gielkens, A.; ter Huurne, A.,

1878 Classification of Dutch and German avian reoviruses by sequencing the sigma C protein.

1879 Veterinary research 2003, 34, (2), 203-12.

1880 77. Takehara, K.; Kimura, Y.; Tanaka, Y.; Yoshimura, M., Preparation and characterization of

1881 monoclonal-antibodies against an Avian Reovirus. Avian diseases 1987, 31, (4), 730-734.

1882 78. Tang, Y.; Lu, H., Whole genome alignment based one-step real-time RT-PCR for universal

1883 detection of avian orthoreoviruses of chicken, pheasant and turkey origins. Infection,

1884 genetics and evolution : journal of molecular epidemiology and evolutionary genetics in

1885 infectious diseases 2016, 39, 120-6.

1886 79. De Gussem, J.; Swam, H.; Lievens, K.; De Herdt, P., Reovirus tenosynovitis in a flock of

1887 layer breeders. Avian pathology : journal of the W.V.P.A 2010, 39, (3), 169-70.

1888 80. Benavente, J.; Martinez-Costas, J., Avian reovirus: structure and biology. Virus research

1889 2007, 123, (2), 105-19.

1890 81. Goldenberg, D.; Pasmanik-Chor, M.; Pirak, M.; Kass, N.; Lublin, A.; Yeheskel, A.; Heller,

1891 D.; Pitcovski, J., Genetic and antigenic characterization of sigma C protein from avian

1892 reovirus. Avian pathology : journal of the W.V.P.A 2010, 39, (3), 189-99.

171

1893 82. Huang, W. R.; Chi, P. I.; Chiu, H. C.; Hsu, J. L.; Nielsen, B. L.; Liao, T. L.; Liu, H. J., Avian

1894 reovirus p17 and sigmaA act cooperatively to downregulate Akt by suppressing mTORC2

1895 and CDK2/cyclin A2 and upregulating proteasome PSMB6. Scientific reports 2017, 7, (1),

1896 5226.

1897 83. Teng, L.; Xie, Z.; Xie, L.; Liu, J.; Pang, Y.; Deng, X.; Xie, Z.; Fan, Q.; Luo, S., Complete

1898 genome sequences of an Avian Orthoreovirus isolated from Guangxi, China. Genome

1899 announcements 2013, 1, (4), e00495-13.

1900 84. Huang, W. R.; Wang, Y. C.; Chi, P. I.; Wang, L.; Wang, C. Y.; Lin, C. H.; Liu, H. J., Cell entry

1901 of avian reovirus follows a caveolin-1-mediated and dynamin-2-dependent endocytic

1902 pathway that requires activation of p38 mitogen-activated protein kinase (MAPK) and

1903 Src signaling pathways as well as microtubules and small GTPase Rab5 protein. The

1904 Journal of biological chemistry 2011, 286, (35), 30780-94.

1905 85. Flint, S. J.; Racaniello, V. R.; Rall, G. F.; Skalka, A. M.; Enquist, L. W., Principles of virology.

1906 4th edition. ed.; ASM Press: Washington, DC, 2015; p volumes.

1907 86. Maclachlan, N. J.; Dubovi, E. J.; Fenner, F., Fenner's veterinary virology. Fifth edition. ed.;

1908 2016; p xix, 581 pages.

1909 87. Dermody, T. S.; Parker, J.; Sherry, B., Orthoreoviruses. In Fields virology, 6th ed.; Fields,

1910 B. N.; Knipe, D. M.; Howley, P. M., Eds. Wolters Kluwer Health/Lippincott Williams &

1911 Wilkins: Philadelphia, 2013; pp 1304-1346.

1912 88. van der Heide, L., The history of avian reovirus. Avian diseases 2000, 44, (3), 638-641.

1913 89. Van Der Heide, L., Viral arthritis/tenosynovitis: a review. Avian pathology : journal of the

1914 W.V.P.A 1977, 6, (4), 271-84.

172

1915 90. Jones, R. C.; Onunkwo, O., Studies on experimental tenosynovitis in light hybrid

1916 chickens. Avian pathology : journal of the W.V.P.A 1978, 7, (1), 171-81.

1917 91. Menendez, N. A.; Calnek, B. W.; Cowen, B. S., Experimental egg-transmission of Avian

1918 Reovirus. Avian diseases 1975, 19, (1), 104-111.

1919 92. al Afaleq, A. I.; Jones, R. C., Localisation of avian reovirus in the hock joints of chicks

1920 after entry through broken skin. Research in veterinary science 1990, 48, (3), 381-2.

1921 93. Savage, C. E.; Jones, R. C., The survival of avian reoviruses on materials associated with

1922 the poultry house environment. Avian pathology : journal of the W.V.P.A 2003, 32, (4),

1923 419-25.

1924 94. Walker, E. R.; Friedman, M. H.; Olson, N. O.; De Nee, P. B., Ultrastructural study of avian

1925 synovium infected with an arthrotropic reovirus. Arthritis and rheumatism 1977, 20, (6),

1926 1269-77.

1927 95. Kibenge, F. S.; Jones, R. C.; Savage, C. E., Effects of experimental immunosuppression on

1928 reovirus-induced tenosynovitis in light-hybrid chickens. Avian pathology : journal of the

1929 W.V.P.A 1987, 16, (1), 73-92.

1930 96. van der Heide, L.; Kalbac, M.; Brustolon, M., Development of an attenuated apathogenic

1931 reovirus vaccine against viral arthritis/tenosynovitis. Avian diseases 1983, 27, (3), 698-

1932 706.

1933 97. Goldenberg, D.; Lublin, A.; Rosenbluth, E.; Heller, E. D.; Pitcovski, J., Optimized

1934 polypeptide for a subunit vaccine against avian reovirus. Vaccine 2016, 34, (27), 3178-

1935 83.

173

1936 98. Sanjuan, R.; Domingo-Calap, P., Mechanisms of viral mutation. Cellular and molecular

1937 life sciences : CMLS 2016, 73, (23), 4433-4448.

1938 99. Combe, M.; Sanjuan, R., Variation in RNA virus mutation rates across host cells. PLoS

1939 pathogens 2014, 10, (1), e1003855.

1940 100. Sanjuan, R.; Nebot, M. R.; Chirico, N.; Mansky, L. M.; Belshaw, R., Viral mutation rates.

1941 Journal of virology 2010, 84, (19), 9733-48.

1942 101. Ayalew, L. E.; Ahmed, K. A.; Mekuria, Z. H.; Lockerbie, B.; Popowich, S.; Tikoo, S. K.; Ojkic,

1943 D.; Gomis, S., The dynamics of molecular evolution of emerging avian reoviruses

1944 through accumulation of point mutations and genetic re-assortment. Virus Evol 2020, 6,

1945 (1), veaa025.

1946 102. Pantin-Jackwood, M. J.; Spackman, E.; Day, J. M., Pathology and virus tissue distribution

1947 of Turkey origin reoviruses in experimentally infected Turkey poults. Veterinary

1948 pathology 2007, 44, (2), 185-95.

1949 103. Zhong, L.; Gao, L.; Liu, Y.; Li, K.; Wang, M.; Qi, X.; Gao, Y.; Wang, X., Genetic and

1950 pathogenic characterisation of 11 avian reovirus isolates from northern China suggests

1951 continued evolution of virulence. Scientific reports 2016, 6, 35271.

1952 104. Wickramasinghe, R.; Meanger, J.; Enriquez, C. E.; Wilcox, G. E., Avian reovirus proteins

1953 associated with neutralization of virus infectivity. Virology 1993, 194, (2), 688-96.

1954 105. Martinez-Costas, J.; Grande, A.; Varela, R.; Garcia-Martinez, C.; Benavente, J., Protein

1955 architecture of avian reovirus S1133 and identification of the cell attachment protein.

1956 Journal of virology 1997, 71, (1), 59-64.

174

1957 106. Baxendale, W.; Mebatsion, T., The isolation and characterisation of astroviruses from

1958 chickens. Avian pathology : journal of the W.V.P.A 2004, 33, (3), 364-70.

1959 107. Sajewicz-Krukowska, J.; Pac, K.; Lisowska, A.; Minta, Z.; Kroliczewska, B.; Domanska-

1960 Blicharz, K., Astrovirus induced 'white chicks' condition - field observation, virus

1961 detection and preliminary characterization. Avian pathology : journal of the W.V.P.A

1962 2015, 1-36.

1963 108. Pantin-Jackwood, M. J.; Day, J. M.; Jackwood, M. W.; Spackman, E., Enteric viruses

1964 detected by molecular methods in commercial chicken and turkey flocks in the United

1965 States between 2005 and 2006. Avian diseases 2008, 52, (2), 235-44.

1966 109. McNulty, M. S.; Connor, T. J.; McNeilly, F.; McFerran, J. B., Biological characterisation of

1967 avian enteroviruses and enterovirus-like viruses. Avian pathology : journal of the

1968 W.V.P.A 1990, 19, (1), 75-87.

1969 110. Walker, P. J.; Siddell, S. G.; Lefkowitz, E. J.; Mushegian, A. R.; Dempsey, D. M.; Dutilh, B.

1970 E.; Harrach, B.; Harrison, R. L.; Hendrickson, R. C.; Junglen, S.; Knowles, N. J.; Kropinski,

1971 A. M.; Krupovic, M.; Kuhn, J. H.; Nibert, M.; Rubino, L.; Sabanadzovic, S.; Simmonds, P.;

1972 Varsani, A.; Zerbini, F. M.; Davison, A. J., Changes to virus taxonomy and the

1973 International Code of Virus Classification and Nomenclature ratified by the International

1974 Committee on Taxonomy of Viruses (2019). Archives of virology 2019, 164, (9), 2417-

1975 2429.

1976 111. ICTV Astroviridae Taxonomy. https://talk.ictvonline.org/ictv-

1977 reports/ictv_9th_report/positive-sense-rna-viruses-

1978 2011/w/posrna_viruses/247/astroviridae (24 May 2020),

175

1979 112. Spackman, D.; Gough, R. E.; Collins, M. S.; Lanning, D., Isolation of an enterovirus-like

1980 agent from the meconium of dead-in-shell chicken embryos. The Veterinary record

1981 1984, 114, (9), 216-8.

1982 113. McNulty, M. S.; Curran, W. L.; McFerran, J. B., Detection of astroviruses in turkey faeces

1983 by direct electron microscopy. The Veterinary record 1980, 106, (26), 561.

1984 114. McNulty, M. S.; Curran, W. L.; Todd, D.; McFerran, J. B., Detection of viruses in avian

1985 faeces by direct electron microscopy. Avian pathology : journal of the W.V.P.A 1979, 8,

1986 (3), 239-47.

1987 115. Kim, H. R.; Kwon, Y. K.; Jang, I.; Bae, Y. C., Viral metagenomic analysis of chickens with

1988 runting-stunting syndrome in the Republic of Korea. Virology journal 2020, 17, (1), 53.

1989 116. Devaney, R.; Trudgett, J.; Trudgett, A.; Meharg, C.; Smyth, V., A metagenomic

1990 comparison of endemic viruses from broiler chickens with runting-stunting syndrome

1991 and from normal birds. Avian pathology : journal of the W.V.P.A 2016, 45, (6), 616-629.

1992 117. Mendez, E.; Arias, C. F., Astroviruses. In Fields Virology, 5th edition ed.; Knipe, D. M.;

1993 Howley, P. M., Eds. Lippincott Williams & Wilkins: Philadelphia, 2013; pp 609-628.

1994 118. Arias, C. F.; DuBois, R. M., The Astrovirus capsid: A review. Viruses 2017, 9, (1).

1995 119. Toh, Y.; Harper, J.; Dryden, K. A.; Yeager, M.; Arias, C. F.; Mendez, E.; Tao, Y. J., Crystal

1996 structure of the Human Astrovirus capsid protein. Journal of virology 2016, 90, (20),

1997 9008-17.

1998 120. Dryden, K. A.; Tihova, M.; Nowotny, N.; Matsui, S. M.; Mendez, E.; Yeager, M., Immature

1999 and mature human astrovirus: structure, conformational changes, and similarities to

2000 hepatitis E virus. Journal of molecular biology 2012, 422, (5), 650-658.

176

2001 121. Brinker, J. P.; Blacklow, N. R.; Herrmann, J. E., Human astrovirus isolation and

2002 propagation in multiple cell lines. Archives of virology 2000, 145, (9), 1847-56.

2003 122. Jang, S. Y.; Jeong, W. H.; Kim, M. S.; Lee, Y. M.; Lee, J. I.; Lee, G. C.; Paik, S. Y.; Koh, G. P.;

2004 Kim, J. M.; Lee, C. H., Detection of replicating negative-sense RNAs in CaCo-2 cells

2005 infected with human astrovirus. Archives of virology 2010, 155, (9), 1383-9.

2006 123. Parker, J.; Pesavento, P., Chapter 27 - Caliciviridae and Astroviridae. In Fenner's

2007 Veterinary Virology (Fifth Edition), MacLachlan, N. J.; Dubovi, E. J., Eds. Academic Press:

2008 Boston, 2017; pp 497-510.

2009 124. Smyth, V.; Trudgett, J.; Wylie, M.; Jewhurst, H.; Conway, B.; Welsh, M.; Kaukonen, E.;

2010 Perko-Makela, P., Chicken astrovirus detected in hatchability problems associated with

2011 'white chicks'. The Veterinary record 2013, 173, (16), 403-4.

2012 125. Smyth, V. J.; Jewhurst, H. L.; Wilkinson, D. S.; Adair, B. M.; Gordon, A. W.; Todd, D.,

2013 Development and evaluation of real-time TaqMan(R) RT-PCR assays for the detection of

2014 avian nephritis virus and chicken astrovirus in chickens. Avian pathology : journal of the

2015 W.V.P.A 2010, 39, (6), 467-74.

2016 126. Skibinska, A.; Lee, A.; Wylie, M.; Smyth, V. J.; Welsh, M. D.; Todd, D., Development of an

2017 indirect ELISA test for detecting antibodies to chicken astrovirus in chicken sera. Avian

2018 pathology : journal of the W.V.P.A 2015, 1-28.

2019 127. Reynolds, D. L.; Saif, Y. M., Astrovirus: a cause of an enteric disease in turkey poults.

2020 Avian diseases 1986, 30, (4), 728-35.

177

2021 128. Thouvenelle, M. L.; Haynes, J. S.; Reynolds, D. L., Astrovirus infection in hatchling

2022 turkeys: histologic, morphometric, and ultrastructural findings. Avian diseases 1995, 39,

2023 (2), 328-36.

2024 129. Moser, L. A.; Carter, M.; Schultz-Cherry, S., Astrovirus increases epithelial barrier

2025 permeability independently of viral replication. Journal of virology 2007, 81, (21), 11937-

2026 45.

2027 130. Nighot, P. K.; Moeser, A.; Ali, R. A.; Blikslager, A. T.; Koci, M. D., Astrovirus infection

2028 induces sodium malabsorption and redistributes sodium hydrogen exchanger

2029 expression. Virology 2010, 401, (2), 146-54.

2030 131. CEVA, R., Update on the Runting Stunting Syndrome. 2012.

2031 132. De Benedictis, P.; Schultz-Cherry, S.; Burnham, A.; Cattoli, G., Astrovirus infections in

2032 humans and animals - molecular biology, genetic diversity, and interspecies

2033 transmissions. Infection, genetics and evolution : journal of molecular epidemiology and

2034 evolutionary genetics in infectious diseases 2011, 11, (7), 1529-44.

2035 133. Mor, S. K.; Abin, M.; Costa, G.; Durrani, A.; Jindal, N.; Goyal, S. M.; Patnayak, D. P., The

2036 role of type-2 turkey astrovirus in poult enteritis syndrome. Poultry science 2011, 90,

2037 (12), 2747-52.

2038 134. Villegas, P., PDRC Laboratory Manual. In Georgia, T. U. o., Ed. Athens, GA, 2008.

2039 135. Jindal, N.; Patnayak, D. P.; Chander, Y.; Ziegler, A. F.; Goyal, S. M., Comparison of capsid

2040 gene sequences of turkey astrovirus-2 from poult-enteritis-syndrome-affected and

2041 apparently healthy turkeys. Archives of virology 2011, 156, (6), 969-77.

178

2042 136. Pomeroy, B. S.; Fenstermacher, R., Hemorrhagic Enteritis in Turkeys*. Poultry science

2043 1937, 16, (6), 378-382.

2044 137. Pierson, F. W.; Fitzgerald, S. D., Hemorrhagic Enteritis and related infections. In Diseases

2045 of poultry, 13th ed.; Swayne, D. E., Ed. John Wiley & Sons: Ames, Iowa, 2013; pp 309-

2046 316.

2047 138. Silim, A.; Thorsen, J., Hemorrhagic enteritis: virus distribution and sequential

2048 development of antibody in turkeys. Avian diseases 1981, 25, (2), 444-53.

2049 139. Pitcovski, J.; Mualem, M.; Rei-Koren, Z.; Krispel, S.; Shmueli, E.; Peretz, Y.; Gutter, B.;

2050 Gallili, G. E.; Michael, A.; Goldberg, D., The complete DNA sequence and genome

2051 organization of the avian adenovirus, hemorrhagic enteritis virus. Virology 1998, 249,

2052 (2), 307-15.

2053 140. Pitcovski, J.; Fingerut, E.; Gallili, G.; Eliahu, D.; Finger, A.; Gutter, B., A subunit vaccine

2054 against hemorrhagic enteritis adenovirus. Vaccine 2005, 23, (38), 4697-702.

2055 141. Singh, A. K.; Berbis, M. A.; Ballmann, M. Z.; Kilcoyne, M.; Menendez, M.; Nguyen, T. H.;

2056 Joshi, L.; Canada, F. J.; Jimenez-Barbero, J.; Benko, M.; Harrach, B.; van Raaij, M. J.,

2057 Structure and sialyllactose binding of the carboxy-terminal head domain of the fibre

2058 from a Siadenovirus, Turkey Adenovirus 3. PloS one 2015, 10, (9), e0139339.

2059 142. van den Hurk, J. V.; van Drunen Littel-van den Hurk, S., Protection of turkeys against

2060 haemorrhagic enteritis by monoclonal antibody and hexon immunization. Vaccine 1993,

2061 11, (3), 329-35.

2062 143. Mahsoub, H. M. Real Time PCR-based infectivity assay and characterization of cell

2063 surface receptors for Turkey Hemorrhagic Enteritis Virus. Virginia Tech, 2016.

179

2064 144. Chapter 10 - Adenoviridae. In Fenner's Veterinary Virology (Fifth Edition), MacLachlan,

2065 N. J.; Dubovi, E. J., Eds. Academic Press: Boston, 2016; pp 217-227.

2066 145. Tidona, C. A.; Darai, G., The Springer index of viruses. 2nd ed.; Springer: New York, 2011.

2067 146. Tykalowski, B.; Smialek, M.; Koncicki, A.; Ognik, K.; Zdunczyk, Z.; Jankowski, J., The

2068 immune response of young turkeys to haemorrhagic enteritis virus infection at different

2069 levels and sources of methionine in the diet. BMC veterinary research 2019, 15, (1), 387.

2070 147. Koncicki, A.; Tykalowski, B.; Stenzel, T.; Smialek, M.; Pestka, D., Effect of infection of

2071 turkeys with haemorrhagic enteritis adenovirus isolate on the selected parameters of

2072 cellular immunity and the course of colibacillosis. Polish journal of veterinary sciences

2073 2012, 15, (2), 215-20.

2074 148. Chandra, R.; Kumar, A., Haemorrhagic enteritis of turkeys and related infections of

2075 pheasants and domestic fowl: a review. World's Poultry Science Journal 1998, 54, (3),

2076 253-269.

2077 149. Saif, Y. M., Infectious bursal disease and hemorrhagic enteritis. Poultry science 1998, 77,

2078 (8), 1186-9.

2079 150. Iltis, J. P.; Jakowski, R. M.; Wyand, D. S., Transmission of marble spleen disease in

2080 turkeys and pheasants. American journal of veterinary research 1975, 36, (1), 97-101.

2081 151. Gross, W. B., Lesions of hemorrhagic enteritis. Avian diseases 1967, 11, (4), 684-93.

2082 152. Gross, W. B.; Moore, W. E., Hemorrhagic enteritis of turkeys. Avian diseases 1967, 11,

2083 (2), 296-307.

2084 153. Itakura, C.; Carlson, H. C.; Lang, G. N., Experimental transmission of haemorrhagic

2085 enteritis of turkeys. Avian pathology : journal of the W.V.P.A 1974, 3, (4), 279-92.

180

2086 154. Beach, N. M.; Duncan, R. B.; Larsen, C. T.; Meng, X. J.; Sriranganathan, N.; Pierson, F. W.,

2087 Persistent infection of turkeys with an avirulent strain of turkey hemorrhagic enteritis

2088 virus. Avian diseases 2009, 53, (3), 370-5.

2089 155. Domermuth, C. H.; Gross, W. B., Effect of chlorine on the virus of hemorrhagic enteritis

2090 of turkeys. Avian diseases 1972, 16, (4), 952-3.

2091 156. Domermuth, C. H.; Gross, W. B., Effect of disinfectants and drying on the virus of

2092 hemorrhagic enteritis of turkeys. Avian diseases 1971, 15, (1), 94-7.

2093 157. Fitzgerald, S. D.; Reed, W. M., Pathogenesis of marble spleen disease in bursectomized

2094 and non-bursectomized ring-necked pheasants following oral inoculation with cell-

2095 culture-propagated virus. Avian diseases 1991, 35, (3), 579-84.

2096 158. Hussain, I.; Choi, C. U.; Rings, B. S.; Shaw, D. P.; Nagaraja, K. V., Pathogenesis of

2097 hemorrhagic enteritis virus infection in turkeys. Zentralblatt fur Veterinarmedizin. Reihe

2098 B. Journal of veterinary medicine. Series B 1993, 40, (9-10), 715-26.

2099 159. Rautenschlein, S.; Suresh, M.; Neumann, U.; Sharma, J. M., Comparative pathogenesis of

2100 haemorrhagic enteritis virus (HEV) infection in turkeys and chickens. Journal of

2101 comparative pathology 1998, 119, (3), 251-61.

2102 160. Suresh, M.; Sharma, J. M., Hemorrhagic enteritis virus induced changes in the

2103 lymphocyte subpopulations in turkeys and the effect of experimental immunodeficiency

2104 on viral pathogenesis. Veterinary immunology and immunopathology 1995, 45, (1-2),

2105 139-50.

2106 161. Rautenschlein, S.; Suresh, M.; Sharma, J. M., Pathogenic avian adenovirus type II induces

2107 apoptosis in turkey spleen cells. Archives of virology 2000, 145, (8), 1671-83.

181

2108 162. Rautenschlein, S.; Sharma, J. M., Immunopathogenesis of haemorrhagic enteritis virus

2109 (HEV) in turkeys. Developmental and comparative immunology 2000, 24, (2-3), 237-46.

2110 163. Sponenberg, D. P.; Domermuth, C. H.; Larsen, C. T., Field outbreaks of colibacillosis of

2111 turkeys associated with hemorrhagic enteritis virus. Avian diseases 1985, 29, (3), 838-

2112 42.

2113 164. Larsen, C. T.; Domermuth, C. H.; Sponenberg, D. P.; Gross, W. B., Colibacillosis of turkeys

2114 exacerbated by hemorrhagic enteritis virus. Laboratory studies. Avian diseases 1985, 29,

2115 (3), 729-32.

2116 165. Nazerian, K.; Fadly, A. M., Further studies on in vitro and in vivo assays of hemorrhagic

2117 enteritis virus (HEV). Avian diseases 1987, 31, (2), 234-40.

2118 166. van den Hurk, J. V., Propagation of group II avian adenoviruses in turkey and chicken

2119 leukocytes. Avian diseases 1990, 34, (1), 12-25.

2120 167. Domermuth, C. H.; Gross, W. B.; Douglass, C. S.; DuBose, R. T.; Harris, J. R.; Davis, R. B.,

2121 Vaccination for hemorrhagic enteritis of turkeys. Avian diseases 1977, 21, (4), 557-65.

2122 168. Weier, S., Improved immunoprophylaxis against Haemorrhagic Enteritis Virus (HEV) in

2123 turkeys with repeated drinking water vaccination. Praktische Tierarzt 2013, 94, (8),

2124 732...739.

2125 169. Barbour, E. K.; Poss, P. E.; Brinton, M. K.; Johnson, J. B.; Nabbut, N. H., Evaluation of cell

2126 culture propagated and in vivo propagated hemorrhagic enteritis vaccines in turkeys.

2127 Veterinary immunology and immunopathology 1993, 35, (3-4), 375-83.

182

2128 170. Domermuth, C. H.; Gross, W. B.; DuBose, R. T.; Mallinson, E. T., Experimental

2129 reproduction and antibody inhibition of marble spleen disease of pheasants. Journal of

2130 wildlife diseases 1975, 11, (3), 338-42.

2131 171. Domermuth, C. H.; Weston, C. R.; Cowen, B. S.; Colwell, W. M.; Gross, W. B.; DuBose, R.

2132 T., Incidence and distribution of "avian adenovirus group II splenomegaly of chickens".

2133 Avian diseases 1980, 24, (3), 591-4.

2134 172. Collett, S. R.; Smith, J. A.; Boulianne, M.; Owen, R. L.; Gingerich, E.; Singer, R. S.; Johnson,

2135 T. J.; Hofacre, C. L.; Berghaus, R. D.; Stewart-Brown, B., Principles of disease prevention,

2136 diagnosis, and control. In Diseases of Poultry, Swayne, D. E.; Boulianne, M.; Logue, C. M.;

2137 McDougald, L. R.; Nair, V.; Suarez, D. L.; Wit, S.; Grimes, T.; Johnson, D.; Kromm, M.;

2138 Prajitno, T. Y.; Rubinoff, I.; Zavala, G., Eds. 2020.

2139 173. Moharam, I.; Sultan, H.; Hassan, K.; Ibrahim, M.; Shany, S.; Shehata, A. A.; Abo-ElKhair,

2140 M.; Pfaff, F.; Hoper, D.; El Kady, M.; Beer, M.; Harder, T.; Hafez, H.; Grund, C., Emerging

2141 infectious bronchitis virus (IBV) in Egypt: Evidence for an evolutionary advantage of a

2142 new S1 variant with a unique gene 3ab constellation. Infection, genetics and evolution :

2143 journal of molecular epidemiology and evolutionary genetics in infectious diseases 2020,

2144 85, 104433.

2145 174. Witter, R. L.; Calnek, B. W.; Buscaglia, C.; Gimeno, I. M.; Schat, K. A., Classification of

2146 Marek's disease viruses according to pathotype: philosophy and methodology. Avian

2147 pathology : journal of the W.V.P.A 2005, 34, (2), 75-90.

183

2148 175. Vasserman, Y.; Eliahoo, D.; Hemsani, E.; Kass, N.; Ayali, G.; Pokamunski, S.; Pitcovski, J.,

2149 The influence of reovirus sigma C protein diversity on vaccination efficiency. Avian

2150 diseases 2004, 48, (2), 271-278.

2151 176. Crespo, R.; Shivaprasad, H. L., Rupture of gastrocnemius tendon in broiler breeder hens.

2152 Avian diseases 2011, 55, (3), 495-8.

2153 177. Davis, J. F.; Kulkarni, A.; Fletcher, O., Reovirus infections in young broiler chickens. Avian

2154 diseases 2013, 57, (2), 321-5.

2155 178. Franca, M.; Crespo, R.; Chin, R.; Woolcock, P.; Shivaprasad, H. L., Retrospective study of

2156 myocarditis associated with reovirus in turkeys. Avian diseases 2010, 54, (3), 1026-31.

2157 179. Rosenberger, J. K.; Rosenberger, S. C.; Markis, M.; Rosenberger, J. P. In Pathogenicity

2158 and control of recent (2011-2012) Reovirus isolates from broiler and turkey flocks

2159 presenting with Viral Arthritis and Tenosynovitis, 2013-AAAP, Chicago, 23-Jul-13, 2013;

2160 Chicago, 2013.

2161 180. Tang, Y.; Lin, L.; Sebastian, A.; Lu, H., Detection and characterization of two co-infection

2162 variant strains of avian orthoreovirus (ARV) in young layer chickens using next-

2163 generation sequencing (NGS). Scientific reports 2016, 6, 24519.

2164 181. Goldenberg, D.; Lublin, A.; Rosenbluth, E.; Heller, E. D.; Pitcovski, J., Differentiating

2165 infected from vaccinated animals, and among virulent prototypes of reovirus. Journal of

2166 virological methods 2011, 177, (1), 80-6.

2167 182. Hellal Kort, Y.; Bourogaa, H.; Gribaa, L.; Scott-Algara, D.; Ghram, A., Molecular

2168 characterization of avian reovirus isolates in Tunisia. Virology journal 2013, 10, 12.

184

2169 183. Tang, Y.; Lu, H., Genomic characterization of a novel avian arthritis orthoreovirus variant

2170 by next-generation sequencing. Archives of virology 2015.

2171 184. Tang, Y.; Lu, H., Genomic characterization of a broiler reovirus field strain detected in

2172 Pennsylvania. Infection, genetics and evolution : journal of molecular epidemiology and

2173 evolutionary genetics in infectious diseases 2015, 31, 177-82.

2174 185. Tang, Y.; Lu, H.; Sebastian, A.; Yeh, Y. T.; Praul, C. A.; Albert, I. U.; Zheng, S. Y., Genomic

2175 characterization of a turkey reovirus field strain by Next-Generation Sequencing.

2176 Infection, genetics and evolution : journal of molecular epidemiology and evolutionary

2177 genetics in infectious diseases 2015, 32, 313-21.

2178 186. Kawaguchi, T.; Nomura, K.; Hirayama, Y.; Kitagawa, T., Establishment and

2179 characterization of a chicken hepatocellular carcinoma cell line, LMH. Cancer research

2180 1987, 47, (16), 4460-4.

2181 187. Fuchs, W.; Veits, J.; Helferich, D.; Granzow, H.; Teifke, J. P.; Mettenleiter, T. C., Molecular

2182 biology of avian infectious laryngotracheitis virus. Veterinary research 2007, 38, (2), 261-

2183 79.

2184 188. Gomis, S.; Goodhope, A. R.; Ojkic, A. D.; Willson, P., Inclusion body hepatitis as a primary

2185 disease in broilers in Saskatchewan, Canada. Avian diseases 2006, 50, (4), 550-5.

2186 189. Ojkic, D.; Martin, E.; Swinton, J.; Binnington, B.; Brash, M., Genotyping of Canadian field

2187 strains of infectious bursal disease virus. Avian pathology : journal of the W.V.P.A 2007,

2188 36, (5), 427-33.

185

2189 190. Heggen-Peay, C. L.; Qureshi, M. A.; Edens, F. W.; Sherry, B.; Wakenell, P. S.; O'Connell, P.

2190 H.; Schat, K. A., Isolation of a reovirus from poult enteritis and mortality syndrome and

2191 its pathogenicity in turkey poults. Avian diseases 2002, 46, (1), 32-47.

2192 191. Stamatakis, A., RAxML version 8: a tool for phylogenetic analysis and post-analysis of

2193 large phylogenies. Bioinformatics 2014, 30, (9), 1312-3.

2194 192. Liu, H. J.; Lee, L. H.; Hsu, H. W.; Kuo, L. C.; Liao, M. H., Molecular evolution of avian

2195 reovirus: evidence for genetic diversity and reassortment of the S-class genome

2196 segments and multiple cocirculating lineages. Virology 2003, 314, (1), 336-49.

2197 193. Wilcox, G. E.; Compans, R. W., Cell fusion induced by Nelson Bay virus. Virology 1982,

2198 123, (2), 312-22.

2199 194. Nham, E. G.; Pearl, D. L.; Slavic, D.; Ouckama, R.; Ojkic, D.; Guerin, M. T., Flock-level

2200 prevalence, geographical distribution, and seasonal variation of avian reovirus among

2201 broiler flocks in Ontario. The Canadian veterinary journal. La revue veterinaire

2202 canadienne 2017, 58, (8), 828-834.

2203 195. Mirbagheri, S. A.; Hosseini, H.; Ghalyanchilangeroudi, A., Molecular characterization of

2204 avian reovirus causing tenosynovitis outbreaks in broiler flocks, Iran. Avian pathology :

2205 journal of the W.V.P.A 2020, 49, (1), 15-20.

2206 196. De Carli, S.; Wolf, J. M.; Graf, T.; Lehmann, F. K. M.; Fonseca, A. S. K.; Canal, C. W.;

2207 Lunge, V. R.; Ikuta, N., Genotypic characterization and molecular evolution of avian

2208 reovirus in poultry flocks from Brazil. Avian pathology : journal of the W.V.P.A 2020, 1-

2209 10.

186

2210 197. Chong, Y.; Ikematsu, H., Is seasonal vaccination a contributing factor to the selection of

2211 influenza epidemic variants? Human vaccines & immunotherapeutics 2018, 14, (3), 518-

2212 522.

2213 198. Moore, S. M.; Hanlon, C. A., Rabies-specific antibodies: measuring surrogates of

2214 protection against a fatal disease. PLoS neglected tropical diseases 2010, 4, (3), e595.

2215 199. Li, C. P.; Schaeffer, M., Serum neutralization tests in mice and in tissue culture against

2216 three types of poliomyelitis virus. Journal of immunology 1954, 72, (2), 123-30.

2217 200. Takase, K.; Fujikawa, H.; Yamada, S., Correlation between neutralizing antibody titre and

2218 protection from tenosynovitis in avian reovirus infections. Avian pathology : journal of

2219 the W.V.P.A 1996, 25, (4), 807-15.

2220 201. Yang, Z. J.; Wang, C. Y.; Lee, L. H.; Chuang, K. P.; Lien, Y. Y.; Yin, H. S.; Tong, D. W.; Xu, X.

2221 G.; Liu, H. J., Development of ELISA kits for antibodies against avian reovirus using the

2222 sigmaC and sigmaB proteins expressed in the methyltropic yeast Pichia pastoris. Journal

2223 of virological methods 2010, 163, (2), 169-74.

2224 202. van der Heide, L.; Kalbac, M., Infectious tenosynovitis (viral arthritis): characterization of

2225 a Connecticut viral isolant as a reovirus and evidence of viral egg transmission by

2226 reovirus-infected broiler breeders. Avian diseases 1975, 19, (4), 683-8.

2227 203. Carman, W. F.; Zanetti, A. R.; Karayiannis, P.; Waters, J.; Manzillo, G.; Tanzi, E.;

2228 Zuckerman, A. J.; Thomas, H. C., Vaccine-induced escape mutant of hepatitis B virus.

2229 Lancet 1990, 336, (8711), 325-9.

2230 204. Fox, C. H.; Johnson, F. B.; Whiting, J.; Roller, P. P., Formaldehyde fixation. J Histochem

2231 Cytochem 1985, 33, (8), 845-53.

187

2232 205. Cavanagh, D., Coronavirus avian infectious bronchitis virus. Veterinary research 2007,

2233 38, (2), 281-97.

2234 206. McNeilly, F.; Connor, T. J.; Calvert, V. M.; Smyth, J. A.; Curran, W. L.; Morley, A. J.;

2235 Thompson, D.; Singh, S.; McFerran, J. B.; Adair, B. M.; McNulty, M. S., Studies on a new

2236 enterovirus-like virus isolated from chickens. Avian pathology : journal of the W.V.P.A

2237 1994, 23, (2), 313-27.

2238 207. Dekich, M. A., Broiler industry strategies for control of respiratory and enteric diseases.

2239 Poultry science 1998, 77, (8), 1176-80.

2240 208. Evans, R. D.; Hafez, Y. S.; Orthel, F. W., Mycoplasma gallisepticum vaccination-challenge:

2241 an egg-production model. Avian diseases 1992, 36, (4), 956-63.

2242 209. Deol, P.; Kattoor, J. J.; Sircar, S.; Ghosh, S.; Banyai, K.; Dhama, K.; Malik, Y. S., Avian

2243 group D Rotaviruses: Structure, epidemiology, diagnosis, and perspectives on future

2244 research challenges. Pathogens 2017, 6, (4).

2245 210. Wlliams, S. M.; American Association of Avian Pathologists., A laboratory manual for the

2246 isolation, identification and characterization of avian pathogens. 6th ed.; American

2247 Association of Avian Pathologists: Jacksonville, Fl., 2016; p xii, 400 pages.

2248 211. Hess, M., Detection and differentiation of avian adenoviruses: a review. Avian pathology

2249 : journal of the W.V.P.A 2000, 29, (3), 195-206.

2250 212. Jones, R. C.; Islam, M. R.; Kelly, D. F., Early pathogenesis of experimental reovirus

2251 infection in chickens. Avian pathology : journal of the W.V.P.A 1989, 18, (2), 239-53.

2252 213. Kohn, F. S.; Henneman, S. A., Preparation of primary chicken embryo livers cells. 1975.

188

2253 214. Schultz-Cherry, S., Astrovirus infections. In Diseases of poultry, 13th ed.; Swayne, D. E., Ed.

2254 John Wiley & Sons: Ames, Iowa, 2013; pp p.391-395.

2255 215. Illingworth, C. J. R.; Roy, S.; Beale, M. A.; Tutill, H.; Williams, R.; Breuer, J., On the

2256 effective depth of viral sequence data. Virus Evol 2017, 3, (2), vex030.

2257 216. Katoh, K.; Misawa, K.; Kuma, K.; Miyata, T., MAFFT: a novel method for rapid multiple

2258 sequence alignment based on fast Fourier transform. Nucleic acids research 2002, 30,

2259 (14), 3059-66.

2260 217. Katoh, K.; Standley, D. M., MAFFT multiple sequence alignment software version 7:

2261 improvements in performance and usability. Mol Biol Evol 2013, 30, (4), 772-80.

2262 218. Abadi, S.; Azouri, D.; Pupko, T.; Mayrose, I., Model selection may not be a mandatory

2263 step for phylogeny reconstruction. Nature communications 2019, 10, (1), 934-934.

2264 219. Martin, D. P.; Posada, D.; Crandall, K. A.; Williamson, C., A modified bootscan algorithm

2265 for automated identification of recombinant sequences and recombination breakpoints.

2266 AIDS research and human retroviruses 2005, 21, (1), 98-102.

2267 220. Martin, D.; Rybicki, E., RDP: detection of recombination amongst aligned sequences.

2268 Bioinformatics 2000, 16, (6), 562-3.

2269 221. Martin, D. P.; Murrell, B.; Golden, M.; Khoosal, A.; Muhire, B., RDP4: Detection and

2270 analysis of recombination patterns in virus genomes. Virus Evol 2015, 1, (1), vev003.

2271 222. Padidam, M.; Sawyer, S.; Fauquet, C. M., Possible emergence of new geminiviruses by

2272 frequent recombination. Virology 1999, 265, (2), 218-25.

2273 223. Smith, J. M., Analyzing the mosaic structure of genes. J Mol Evol 1992, 34, (2), 126-9.

189

2274 224. Posada, D.; Crandall, K. A., Evaluation of methods for detecting recombination from DNA

2275 sequences: computer simulations. Proceedings of the National Academy of Sciences of

2276 the United States of America 2001, 98, (24), 13757-62.

2277 225. Gibbs, M. J.; Armstrong, J. S.; Gibbs, A. J., Sister-scanning: a Monte Carlo procedure for

2278 assessing signals in recombinant sequences. Bioinformatics 2000, 16, (7), 573-82.

2279 226. Lam, H. M.; Ratmann, O.; Boni, M. F., Improved algorithmic complexity for the 3SEQ

2280 recombination detection algorithm. Mol Biol Evol 2018, 35, (1), 247-251.

2281 227. Lole, K. S.; Bollinger, R. C.; Paranjape, R. S.; Gadkari, D.; Kulkarni, S. S.; Novak, N. G.;

2282 Ingersoll, R.; Sheppard, H. W.; Ray, S. C., Full-length human immunodeficiency virus type

2283 1 genomes from subtype C-infected seroconverters in India, with evidence of

2284 intersubtype recombination. Journal of virology 1999, 73, (1), 152-60.

2285 228. Lee, S. W.; Markham, P. F.; Coppo, M. J.; Legione, A. R.; Markham, J. F.;

2286 Noormohammadi, A. H.; Browning, G. F.; Ficorilli, N.; Hartley, C. A.; Devlin, J. M.,

2287 Attenuated vaccines can recombine to form virulent field viruses. Science 2012, 337,

2288 (6091), 188.

2289 229. Hassan, M. S. H.; Ojkic, D.; Coffin, C. S.; Cork, S. C.; van der Meer, F.; Abdul-Careem, M.

2290 F., Delmarva (DMV/1639) Infectious Bronchitis Virus (IBV) variants isolated in eastern

2291 Canada show evidence of recombination. Viruses 2019, 11, (11).

2292 230. Sajewicz-Krukowska, J.; Domanska-Blicharz, K., Nearly full-length genome sequence of a

2293 novel astrovirus isolated from chickens with 'white chicks' condition. Archives of virology

2294 2016, 161, (9), 2581-7.

2295 231. Smyth, V., Personal Communication. In 2020.

190

2296 232. Stayer, P. A.; Riley, E. G.; French, J. D.; Ferro, P. J.; Vanhooser, S. L.; Banda, A.;

2297 Baughman, B. In Incursion and recursion of ‘‘white chicks’’ in U.S. commercial broiler

2298 production., Annual Meeting of the American Veterinary Medical Association, San

2299 Antonio, TX, USA, 2016; San Antonio, TX, USA, 2016; p 8.

2300 233. Brash, M.; Ojkic, A. D.; Ouckama, R.; Long, K. E.; Weisz, A. In Etiologic investigations into

2301 white chick syndrome in Ontario., 65th Western Poultry Disease Conference, Vancouver,

2302 BC, Canada, 2016; Vancouver, BC, Canada, 2016; p 30.

2303 234. Bishop, R. In Poor hatchability and increased cull chicks associated

2304 with White Chick Syndrome as experienced in Eastern Canada in 2009., 59th Western Poultry

2305 Disease Conference, Vancouver, BC, Canada, 2010; Vancouver, BC, Canada, 2010; p 118.

2306 235. Martin, E.; Brash, M.; Ojkic, A. D.; Ouckama, R.; Long, K. E. In White chick syndrome in

2307 Ontario: clinical features, pathology and viral etiology., Annual Meeting of the American

2308 Veterinary Medical Association, San Antonio, TX, USA, 2016; San Antonio, TX, USA,

2309 2016; p 53.

2310 236. McKinley, E. T.; Hilt, D. A.; Jackwood, M. W., Avian coronavirus infectious bronchitis

2311 attenuated live vaccines undergo selection of subpopulations and mutations following

2312 vaccination. Vaccine 2008, 26, (10), 1274-84.

2313 237. CVMP, Guideline on data requirements for the replacement of established Master Seeds

2314 (MS) already used in authorised immunological veterinary medical products (IVMPs) by

2315 new Master Seed of the same origin. In (CVMP), C. f. M. P. f. V. U., Ed. 2010.

2316 238. Administration, U. N. A. a. R., Code of Federal Regulations - Title 9. In 9, Administration,

2317 U. N. A. a. R., Ed. US National Archives and Record Administration: 2015.

191

2318 239. Houle, D.; Kondrashov, A. S., Mutation. In Principles of evolutionary genetics, Syrawood

2319 Publishing House: New York, NY, 2018.

2320 240. Duffy, S., Why are RNA virus mutation rates so damn high? PLoS Biol 2018, 16, (8),

2321 e3000003.

2322 241. Malpica, J. M.; Fraile, A.; Moreno, I.; Obies, C. I.; Drake, J. W.; Garcia-Arenal, F., The rate

2323 and character of spontaneous mutation in an RNA virus. Genetics 2002, 162, (4), 1505-

2324 11.

2325 242. Lanier, H. C.; Knowles, L. L., Is recombination a problem for species-tree analyses?

2326 Systematic Biology 2012, 61, (4), 691-701.

2327 243. Posada, D., How does recombination affect phylogeny estimation? Trends in Ecology &

2328 Evolution 2000, 15, (12), 489-490.

2329 244. Bousalem, M.; Douzery, E. J.; Fargette, D., High genetic diversity, distant phylogenetic

2330 relationships and intraspecies recombination events among natural populations of Yam

2331 mosaic virus: a contribution to understanding potyvirus evolution. The Journal of

2332 general virology 2000, 81, (Pt 1), 243-55.

2333 245. Worobey, M.; Holmes, E. C., Evolutionary aspects of recombination in RNA viruses. The

2334 Journal of general virology 1999, 80 ( Pt 10), 2535-2543.

2335 246. Strain, E.; Kelley, L. A.; Schultz-Cherry, S.; Muse, S. V.; Koci, M. D., Genomic analysis of

2336 closely related astroviruses. Journal of virology 2008, 82, (10), 5099-103.

2337 247. Pantin-Jackwood, M. J.; Spackman, E.; Woolcock, P. R., Molecular characterization and

2338 typing of chicken and turkey astroviruses circulating in the United States: implications

2339 for diagnostics. Avian diseases 2006, 50, (3), 397-404.

192

2340 248. Liu, N.; Wang, F.; Shi, J.; Zheng, L.; Wang, X.; Zhang, D., Molecular characterization of a

2341 duck hepatitis virus 3-like astrovirus. Veterinary microbiology 2014, 170, (1-2), 39-47.

2342 249. De Battisti, C.; Salviato, A.; Jonassen, C. M.; Toffan, A.; Capua, I.; Cattoli, G., Genetic

2343 characterization of astroviruses detected in guinea fowl (Numida meleagris) reveals a

2344 distinct genotype and suggests cross-species transmission between turkey and guinea

2345 fowl. Archives of virology 2012, 157, (7), 1329-37.

2346 250. Martella, V.; Pinto, P.; Tummolo, F.; De Grazia, S.; Giammanco, G. M.; Medici, M. C.;

2347 Ganesh, B.; L'Homme, Y.; Farkas, T.; Jakab, F.; Banyai, K., Analysis of the ORF2 of human

2348 astroviruses reveals lineage diversification, recombination and rearrangement and

2349 provides the basis for a novel sub-classification system. Archives of virology 2014, 159,

2350 (12), 3185-96.

2351 251. De Grazia, S.; Medici, M. C.; Pinto, P.; Moschidou, P.; Tummolo, F.; Calderaro, A.;

2352 Bonura, F.; Banyai, K.; Giammanco, G. M.; Martella, V., Genetic heterogeneity and

2353 recombination in human type 2 astroviruses. Journal of clinical microbiology 2012, 50,

2354 (11), 3760-4.

2355 252. Babkin, I. V.; Tikunov, A. Y.; Zhirakovskaia, E. V.; Netesov, S. V.; Tikunova, N. V., High

2356 evolutionary rate of human astrovirus. Infection, genetics and evolution : journal of

2357 molecular epidemiology and evolutionary genetics in infectious diseases 2012, 12, (2),

2358 435-42.

2359 253. Graham, R. L.; Baric, R. S., Recombination, reservoirs, and the modular spike:

2360 Mechanisms of Coronavirus cross-species transmission. Journal of virology 2010, 84, (7),

2361 3134-3146.

193

2362 254. Simmonds, P., Recombination and selection in the evolution of Picornaviruses and Other

2363 mammalian positive-stranded RNA viruses. Journal of virology 2006, 80, (22), 11124-

2364 11140.

2365 255. Sánchez, C. M.; Izeta, A.; Sánchez-Morgado, J. M.; Alonso, S.; Sola, I.; Balasch, M.; Plana-

2366 Durán, J.; Enjuanes, L., Targeted recombination demonstrates that the spike gene of

2367 transmissible gastroenteritis coronavirus is a determinant of its enteric tropism and

2368 virulence. Journal of virology 1999, 73, (9), 7607-7618.

2369 256. Cortez, V.; Meliopoulos, V. A.; Karlsson, E. A.; Hargest, V.; Johnson, C.; Schultz-Cherry, S.,

2370 Astrovirus biology and pathogenesis. Annu Rev Virol 2017, 4, (1), 327-348.

2371 257. Wohlgemuth, N.; Honce, R.; Schultz-Cherry, S., Astrovirus evolution and emergence.

2372 Infection, genetics and evolution : journal of molecular epidemiology and evolutionary

2373 genetics in infectious diseases 2019, 69, 30-37.

2374 258. Jarvis, T. C.; Kirkegaard, K., Poliovirus RNA recombination: mechanistic studies in the

2375 absence of selection. The EMBO journal 1992, 11, (8), 3135-45.

2376 259. Kirkegaard, K.; Baltimore, D., The mechanism of RNA recombination in poliovirus. Cell

2377 1986, 47, (3), 433-43.

2378 260. Muslin, C.; Mac Kain, A.; Bessaud, M.; Blondel, B.; Delpeyroux, F., Recombination in

2379 Enteroviruses, a Multi-Step Modular Evolutionary Process. Viruses 2019, 11, (9).

2380 261. Muslin, C.; Joffret, M. L.; Pelletier, I.; Blondel, B.; Delpeyroux, F., Evolution and

2381 Emergence of Enteroviruses through Intra- and Inter-species Recombination: Plasticity

2382 and Phenotypic Impact of Modular Genetic Exchanges in the 5' Untranslated Region.

2383 PLoS pathogens 2015, 11, (11), e1005266.

194

2384 262. Ranganathan, S.; Gribskov, M. R.; Nakai, K.; Schönbach, C., Encyclopedia of

2385 bioinformatics and computational biology. In Amsterdam Boston Heidelberg Elsevier

2387 263. Maurier, F.; Beury, D.; Flechon, L.; Varre, J. S.; Touzet, H.; Goffard, A.; Hot, D.; Caboche,

2388 S., A complete protocol for whole-genome sequencing of virus from clinical samples:

2389 Application to coronavirus OC43. Virology 2019, 531, 141-148.

2390 264. Austin, A. US turkey production falls by 5% in 2019.

2391 https://www.wattagnet.com/articles/39503-us-turkey-production-falls-by-5-in-

2392 2019?v=preview#:~:text=According%20to%20the%20annual%20survey,industry%20pro

2393 duced%207.451%20billion%20pounds. (15-Jul-2020),

2394 265. Hybrid, Technical guide for Hybrid Turkeys commercial products. In Hybrid, Hybrid, Ed.

2395 Hendrix Genetics: Mauges-sur-Loire, France, 2020.

2396 266. Boulianne, M.; American Association of Avian Pathologists., Avian disease manual. 7th

2397 ed.; American Association of Avian Pathologists: Jacksonville, Fla., 2013; p iv, 300 p.

2398 267. Mahsoub, H. M.; Evans, N. P.; Beach, N. M.; Yuan, L.; Zimmerman, K.; Pierson, F. W.,

2399 Real-time PCR-based infectivity assay for the titration of turkey hemorrhagic enteritis

2400 virus, an adenovirus, in live vaccines. Journal of virological methods 2017, 239, 42-49.

2401 268. Manninen, A.; Verkade, P.; Le Lay, S.; Torkko, J.; Kasper, M.; Fullekrug, J.; Simons, K.,

2402 Caveolin-1 is not essential for biosynthetic apical membrane transport. Molecular and

2403 cellular biology 2005, 25, (22), 10087-96.

195

2404 269. Optiprep Application sheet V07 - Purification of group I (ds)DNA viruses: adenovirus and

2405 removal of helper virus. https://www.axis-shield-density-gradient-media.com/V07.pdf

2406 (01Feb2020),

2407 270. Kesmen, Z.; Yetiman, A. E.; Sahin, F.; Yetim, H., Detection of chicken and turkey meat in

2408 meat mixtures by using real-time PCR assays. Journal of food science 2012, 77, (2), C167-

2409 73.

2410 271. Crawford-Miksza, L.; Schnurr, D. P., Analysis of 15 adenovirus hexon proteins reveals the

2411 location and structure of seven hypervariable regions containing serotype-specific

2412 residues. Journal of virology 1996, 70, (3), 1836-44.

2413 272. Stewart, P. L.; Fuller, S. D.; Burnett, R. M., Difference imaging of adenovirus: bridging the

2414 resolution gap between X-ray crystallography and electron microscopy. The EMBO

2415 journal 1993, 12, (7), 2589-99.

2416 273. Blom, N.; Sicheritz-Ponten, T.; Gupta, R.; Gammeltoft, S.; Brunak, S., Prediction of post-

2417 translational glycosylation and phosphorylation of proteins from the amino acid

2418 sequence. Proteomics 2004, 4, (6), 1633-49.

2419 274. Yang, L.; Connaris, H.; Potter, J. A.; Taylor, G. L., Structural characterization of the

2420 carbohydrate-binding module of NanA sialidase, a pneumococcal virulence factor. BMC

2421 Struct Biol 2015, 15, 15.

2422 275. Rothe, B.; Rothe, B.; Roggentin, P.; Schauer, R., The sialidase gene from Clostridium

2423 septicum: cloning, sequencing, expression in Escherichia coli and identification of

2424 conserved sequences in sialidases and other proteins. Molecular & general genetics :

2425 MGG 1991, 226, (1-2), 190-7.

196

2426 276. von Itzstein, M.; Dyason, J. C.; Oliver, S. W.; White, H. F.; Wu, W. Y.; Kok, G. B.; Pegg, M.

2427 S., A study of the active site of influenza virus sialidase: an approach to the rational

2428 design of novel anti-influenza drugs. Journal of medicinal chemistry 1996, 39, (2), 388-

2429 91.

2430 277. Anderson, P. J., Factors promoting pathogenicity of influenza virus. Seminars in

2431 respiratory infections 1991, 6, (1), 3-10.

2432 278. Aboezz, Z. R.; Mahsoub, H. M.; El-Bagoury, G.; Pierson, F. W., In vitro growth kinetics

2433 and gene expression analysis of the turkey adenovirus 3, a siadenovirus. Virus research

2434 2019, 263, 47-54.

2435 279. Kumar, P.; van den Hurk, J.; Ayalew, L. E.; Gaba, A.; Tikoo, S. K., Proteomic analysis of

2436 purified turkey adenovirus 3 virions. Veterinary research 2015, 46, 79.

2437 280. Rux, J. J.; Kuser, P. R.; Burnett, R. M., Structural and phylogenetic analysis of adenovirus

2438 hexons by use of high-resolution x-ray crystallographic, molecular modeling, and

2439 sequence-based methods. Journal of virology 2003, 77, (17), 9553-66.

2440 281. Rux, J. J.; Burnett, R. M., Type-specific epitope locations revealed by X-ray

2441 crystallographic study of adenovirus type 5 hexon. Molecular therapy : the journal of the

2442 American Society of Gene Therapy 2000, 1, (1), 18-30.

2443 282. Arnberg, N.; Mei, Y.; Wadell, G., Fiber genes of adenoviruses with tropism for the eye

2444 and the genital tract. Virology 1997, 227, (1), 239-44.

2445 283. Zheng, J.; Yamada, Y.; Fung, T. S.; Huang, M.; Chia, R.; Liu, D. X., Identification of N-linked

2446 glycosylation sites in the spike protein and their functional impact on the replication and

197

2447 infectivity of coronavirus infectious bronchitis virus in cell culture. Virology 2018, 513,

2448 65-74.

2449 284. van den Hurk, J. V.; van Drunen Littel-van den Hurk, S., Characterization of group II avian

2450 adenoviruses with a panel of monoclonal antibodies. Canadian journal of veterinary

2451 research = Revue canadienne de recherche veterinaire 1988, 52, (4), 458-67.

2452 285. Webster, A.; Leith, I. R.; Nicholson, J.; Hounsell, J.; Hay, R. T., Role of preterminal protein

2453 processing in adenovirus replication. Journal of virology 1997, 71, (9), 6381-9.

2454 286. Fadly, A. M.; Nazerian, K.; Nagaraja, K.; Below, G., Field vaccination against hemorrhagic

2455 enteritis of turkeys by a cell-culture live-virus vaccine. Avian diseases 1985, 29, (3), 768-

2456 77.

2457 287. Brugère-Picoux, J.; Vaillancourt, J.-P.; Bouzouaia, M.; Shivaprasad, H. L.; Venne, D.;

2458 Association française pour l'avancement des sciences., Manual of poultry diseases.

2459 2015; p xvii, 701 pages.

2460 288. Abdul-Cader, M. S.; Palomino-Tapia, V.; Amarasinghe, A.; Ahmed-Hassan, H.; De Silva

2461 Senapathi, U.; Abdul-Careem, M. F., Hatchery vaccination against poultry viral diseases:

2462 Potential mechanisms and limitations. Viral immunology 2018, 31, (1), 23-33.

2463 289. (CFIA), C. F. I. A. Veterinary Biologics Guideline 3.1-3 - Guidance for Preparation of New

2464 Product Licensing (Registration) Submissions for Veterinary Biologics Manufactured in

2465 Foreign Countries Other Than the United States.

2466 http://www.inspection.gc.ca/animals/veterinary-biologics/guidelines-forms/3-1e/3-1-

2467 3e/eng/1328589715402/1328589788740 (28 Oct 2015),

198

2468 290. (CFIA), C. F. I. A. Veterinary Biologics Guideline 3.33 - Guideline for Commercial

2469 Importers of Veterinary Biologics in Canada.

2470 http://www.inspection.gc.ca/animals/veterinary-biologics/guidelines-forms/3-

2471 33e/eng/1328602497891/1328602563687 (28 Oct 2015),

2472 291. (CFIA), C. F. I. A. Veterinary Biologics Guideline 3.22E - Guideline for the Submission,

2473 Testing and Reporting of Veterinary Biological Samples (and Master seeds).

2474 http://www.inspection.gc.ca/animals/veterinary-biologics/guidelines-forms/3-

2475 22e/eng/1328633535386/1328633736420 (28 Oct 2015),

2476 292. (CFIA), C. F. I. A. Veterinary Biologics Guideline 3.13E -Guideline for Autogenous

2477 Veterinary Biologics. http://www.inspection.gc.ca/animals/veterinary-

2478 biologics/guidelines-forms/3-1e/3-1-1e/eng/1328588172336/1328588294122 (28 Oct

2479 2015),

2480 293. (CFIA), C. F. I. A. Veterinary Biologics Guideline 3.1E - Guidance for Preparation of New

2481 Product Licensing (Registration) Submissions for Veterinary Biologics.

2482 http://www.inspection.gc.ca/animals/veterinary-biologics/guidelines-forms/3-

2483 1e/eng/1328225508353/1328225600916 (28 Oct 2015),

2484 294. (CFIA), C. F. I. A. Veterinary Biologics Guideline 3.1-2 - Guidance for Preparation of New

2485 Product Licensing (Registration) Submissions for Veterinary Biologics Manufactured

2486 and/or Licensed in the United States. http://www.inspection.gc.ca/animals/veterinary-

2487 biologics/guidelines-forms/3-1e/3-1-2e/eng/1328588942405/1328589059540 (28 Oct

2488 2015),

199

2489 295. (CFIA), C. F. I. A. Veterinary Biologics Guideline 3.1-1 - Guidance for Preparation of New

2490 Product Licensing (Registration) Submissions for Veterinary Biologics Manufactured in

2491 Canada. http://www.inspection.gc.ca/animals/veterinary-biologics/guidelines-forms/3-

2492 13e/eng/1328594554673/1328594626360 (28 Oct 2015),

2493 296. (CFIA), C. F. I. A. Veterinary Biologics Guideline 3.7 - Guideline for Preparation of

2494 Outlines of Production, Special Outlines and Summary of Changes for Veterinary

2495 Biologics. http://www.inspection.gc.ca/animals/veterinary-biologics/guidelines-

2496 forms/3-7/eng/1328593707114/1328593780036 (28 Oct 2015),

2497 297. Günther, R., Autogenous vaccines as a management tool to improve flock health. 2011.

2498 298. Guardado Calvo, P.; Fox, G. C.; Hermo Parrado, X. L.; Llamas-Saiz, A. L.; Costas, C.;

2499 Martínez-Costas, J.; Benavente, J.; van Raaij, M. J., Structure of the carboxy-terminal

2500 receptor-binding domain of avian reovirus fibre sigmaC. Journal of molecular biology

2501 2005, 354, (1), 137-49.

2502 299. Gomes, A.; Korf, B., Chapter 5 - Genetic testing techniques. In Pediatric Cancer Genetics,

2503 Robin, N. H.; Farmer, M. B., Eds. Elsevier: 2018; pp 47-64.

2504 300. Ari, Ş.; Arikan, M., Next-Generation Sequencing: Advantages, disadvantages, and future.

2505 In Plant Omics: Trends and Applications, Hakeem, K. R.; Tombuloğlu, H.; Tombuloğlu, G.,

2506 Eds. Springer International Publishing: Cham, 2016; pp 109-135.

2507 301. Kwak, S. G.; Kim, J. H., Central limit theorem: the cornerstone of modern statistics.

2508 Korean J Anesthesiol 2017, 70, (2), 144-156.

200

2509 302. DAW, R. H.; PEARSON, E. S., Studies in the history of probablity and statistics. XXX.

2510 Abraham De Moivre's 1733 derivation of the normal curve: A bibliographical note.

2511 Biometrika 1972, 59, (3), 677-680.

2512 303. de Moivre, A., Approximatio ad summam terminorum binomii (a+b)n in seriem expansi.

2513 In 1733; p 7 pages offprint. .

2514 304. Avigad, J.; Hölzl, J.; Serafin, L., A Formally Verified Proof of the Central Limit Theorem.

2515 Journal of Automated Reasoning 2017, 59, (4), 389-423.

2516 305. Ruggieri, E., Visualizing the Central Limit Theorem Through Simulation. PRIMUS 2016,

2517 26, (3), 229-240.

2518 306. Dinh, V.; Darling, A. E.; Matsen Iv, F. A., Online Bayesian Phylogenetic Inference:

2519 Theoretical Foundations via Sequential Monte Carlo. Syst Biol 2018, 67, (3), 503-517.

2520 307. Fischer, M.; Galla, M.; Herbst, L.; Steel, M., The most parsimonious tree for random

2521 data. Mol Phylogenet Evol 2014, 80, 165-8.

2522 308. Chang, H.; Fuchs, M., Limit theorems for patterns in phylogenetic trees. J Math Biol

2523 2010, 60, (4), 481-512.

2524 309. McKinley, E. T.; Jackwood, M. W.; Hilt, D. A.; Kissinger, J. C.; Robertson, J. S.; Lemke, C.;

2525 Paterson, A. H., Attenuated live vaccine usage affects accurate measures of virus

2526 diversity and mutation rates in avian coronavirus infectious bronchitis virus. Virus

2527 research 2011, 158, (1-2), 225-34.

2528 310. Palomino-Tapia, V.; Mitevski, D.; Inglis, T.; van der Meer, F.; Abdul-Careem, M. F.,

2529 Molecular Characterization of Hemorrhagic Enteritis Virus (HEV) Obtained from Clinical

2530 Samples in Western Canada 2017–2018. Viruses 2020, 12, (9), 941.

201

2531 311. Lauer, D.; Mason, S.; Akey, B.; Badcoe, L.; Baldwin, D.; Breitmeyer, R.; Brennan, D.;

2532 Brennan, P.; Clark, S.; Cobb, R.; Crawford, S.; Crnic, T.; Culp, S.; DeLiberto, T.; Doss, B.;

2533 Dunn, J.; Elchos, B.; Ferguson-Noel, N.; Forgey, L.; Forshey, T.; Frank, N.; Frazier, T.;

2534 Gimeno, I.; Gingerich, E.; Glisson, J.; Graham, T.; Grimm, J.; Grosdidier, P.; Gustin, S.;

2535 Halstead, S.; Hartmann, W.; Helm, J.; Herrin, M.; Hickam, L.; Hirst, H.; Donald Hoenig;

2536 Hohenhaus, G.; Hughes, D.; Hughes, D.; Huntley, J.; Iselt, R.; Jackwood, M.; Jagne, J.;

2537 Jensen, E.; Jones, A.; Kelly, D.; Keough, B.; King, B.; Kopp, M.; Krushinskie, E.; Lautner, E.;

2538 Lawyer, C.; Levings, R.; Lichtenwalner, A.; Lin, T. L.; Mary Lis, C.; Marshall, D.; Massengill,

2539 R.; McReynolds, S.; Mehlenbacher, S.; Miller, G.; Mize, S.; Myers, L.; Myers, T.; Ng, J.;

2540 Olson, S.; Pabilonia, K.; Pantin-Jackwood, M.; Parr, B.; Pittenger, W.; Plumley, J.; Reed,

2541 W.; Ritter, G. D.; Keith Roehr; Rollo, S.; Rosales, A. G.; Sato, Y.; Travis Schaal; Schmitt, D.;

2542 Schwartz, A.; Shaw, S.; Marilyn Simunich; Smith, J.; Stacy, D.; Stonger, P.; Styles, D.;

2543 Suarez, D.; Tamassia, M.; Torres, A.; Trock, S.; Voss, S.; Waltman, D.; Watson, J.; Weber,

2544 S.; Wilkes, R.; Wu, C. C.; Andrea Zedek, S.; Bereket Zekarias, K.; Ernest Zirkle, N., Report

2545 of the committee on transmitible diseases of poultry and other avian species. In

2546 Proceedings of the 119th Annual Meeting of the U.S. Animal Health Association., USAHA,

2547 Ed. USAHA: Providence, Rhode Island, 2015; p 436.

2548 312. Veterinarians, O. A. o. P., OAPV Virtual Meeting Version 5 Nov 23. Black head cases in BC

2549 and Western Canada. In Palomino-Tapia, D. V., Ed. 2020.

2550 313. Popper, K. R., The logic of scientific discovery. 6th impression revised. ed.; Hutchinson:

2551 London, 1972; p 480 p.

202

2552 314. Popper, K. R., Logik der Forschung; zur Erkenntnistheorie der modernen

2553 Naturwissenschaft. J. Springer: Wien,, 1935; p vi, 248 p.

2554 315. Government, U., Autogenous vaccine production.

2555

2556

203

2557 5.6 Appendices

2558 5.6.1 Appendix A: Copyright permissions

2559 1. As the co-authors that contributed to the paper “Palomino-Tapia, V.; Mitevski, D.; Inglis,

2560 T.; van der Meer, F.; Abdul-Careem, M. F., Molecular characterization of emerging avian

2561 reovirus variants isolated from viral arthritis cases in western Canada 2012-2017 based

2562 on partial sigma (sigma)C gene. Virology 2018, 522, 138-146”, we permit using this

2563 paper as Chapter 2 of Victor Palomino-Tapia’s thesis entitled “Molecular characterization

2564 of economically important poultry viruses in western Canada” that will be submitted to

2565 the Faculty of Graduate Studies at the University of Calgary in December 2020.

2566

Co-Author Signature Date

Faizal Abdul-Careem

Frank van der Meer

Darko Mitevski

Tom Inglis

2567

2568

2569

2570

2571

2572

2573

204

2574 2. As the co-authors that contributed to the paper “Palomino-Tapia, V.; Mitevski, D.; Inglis,

2575 T.; van der Meer, F.; Martin, E.; Brash, M.; Provost, Ch.; Gagnon C.; Abdul-Careem, M.

2576 F. Chicken Astrovirus (CAstV) molecular studies reveal evidence of multiple past-

2577 recombinations events in sequences originated from clinical samples of White Chick

2578 Syndrome (WCS) in western Canada –Viruses 2020, 12, (10), 1096”, we permit using

2579 this paper as Chapter 3 of Victor Palomino-Tapia’s thesis entitled “Molecular

2580 characterization of economically important poultry viruses in western Canada” that will

2581 be submitted to the Faculty of Graduate Studies at the University of Calgary in December

2582 2020.

2583

Co-Author Signature Date

Faizal Abdul-Careem

Frank van der Meer

Emily Martin

Marina Brash

Chantale Provost

Carl Gagnon

Darko Mitevski

Tom Inglis

2584

2585

205

2586 3. As the co-authors that contributed to the paper “Palomino-Tapia, V.; Mitevski, D.; Inglis,

2587 T.; van der Meer, F.; Abdul-Careem, M. F., Molecular characterization of Hemorrhagic

2588 Enteritis Virus (HEV) obtained from clinical samples in western Canada 2017-2018.

2589 Viruses 2020, 12, (9)”, we permit using this paper as Chapter 4 of Victor Palomino-

2590 Tapia’s thesis entitled “Molecular characterization of economically important poultry

2591 viruses in western Canada” that will be submitted to the Faculty of Graduate Studies at

2592 the University of Calgary in December 2020.

2593

Co-Author Signature Date

Faizal Abdul-Careem

Frank van der Meer

Darko Mitevski

Tom Inglis

2594

2595

206