The copyright of this thesis vests in the author. No quotation from it or information derived from it is to be published without full acknowledgement of the source. The thesis is to be used for private study or non- commercial research purposes only.

Published by the University of Cape Town (UCT) in terms of the non-exclusive license granted to UCT by the author.

University of Cape Town THE LOCALIZATION, FUNCTION AND APPLICATIONS OF THE STRESS RESPONSE PROTEIN HSP12P IN THE YEAST SACCHAROMYCES CEREVISIAE.

by

Robert Jan Karreman Town

Cape A thesis submittedof for the degree of Doctor of Philosophy

in the Department of Molecular and Cell Biology, Faculty of Science University of Cape Town, South Africa.

University

March 2006 PREFACE

The work presented in this thesis was perfonned under the supervision of Associate Professors George G. Lindsey and WolfF. Brandt at the Department of Molecular and Cell Biology, University of Cape Town, South Africa. I hereby declare that this thesis, submitted for the degree of Doctor of Philosophy in Molecular and Cell Biology at the University of Cape Town, is the result of my own investigation, except where the work of others is acknowledged.

Robert Jan Karreman University of Cape Town March 2006 University of Cape Town ACKNOWLEDGEMENTS

[ would like to thank the following people and/or organizations:

My supervisor, George Lindsey, for being an excellent and understanding mentor.

My parents, "Rube" Karreman and Louise Karreman, for all their dedication, love and support throughout my studies with special thanks to my dad for all the time on the MS.

My fiance, Carmin Trader, the love of my life, for giving me emotional support and many hugs and laughs.

My in-laws to-be, Denise and Robert Trader, for their love and support.

Dr. Florian Bauer, for the YCP-GFP2 plasmid.

Dr. Peter Meacock, for yeast strains.

Assoc. Prof. Hugh Patterton and members of his laboratory, for the pYES2 plasmid and assorted molecular biology reagents.

Dr. Suhail Rafudeen, for help with Realtime PCR. Town

Prof. Pieter van Wyk, for help with confocal microscopy.

Dr. Fabien Gaboriaud and his wife, for their hospitality and help in Atomic Force Microscopy conducted in Nancy, France. Cape

Etienne Dague, Fabienne Quiles and Jeromeof Duval for their assistance with Atomic Force Microscopy, Raman spectroscopy and electrophoretic mobility assays respectively.

Andrew Kessler, for being my friend since 1st year and helping me get through the tougher times, with many laughs along the way.

John Moore, for his witty comments and infectious humour. Pat Thompson, for helpingUniversity me find things in the lab and for advice. Di James and Pei-yin Ma for DNA sequencing and oligonucleotide synthesis respectively.

All the people in Lab 402 for their great humour and for providing a pleasant atmosphere to work 1D.

The National Research Foundation, for funding throughout the project and for bursaries and a Scarce Skills Scholarship.

The University of Cape Town, for funding a part of my studies and for Research Associateship awards.

The Benfara Trust for funding a part of my studies. I

TABLE OF CONTENTS

ABSTRACT II

ABBREVIATIONS IV

LIST OF FIGURES & TABLES VIII Town

CHAPTER 1 GENERAL INTRODUCTION 1 Cape of THE LOCALIZATION AND CHAPTER 2 24 APPLICATIONS OF HSP12P

CHAPTER 3 THE FUNCTION OF HSP12P 54 University

CHAPTER 4 GENERAL DISCUSSION 114

REFERENCES 117 n

THE LOCALIZATION, FUNCTION AND APPLICATIONS OF THE STRESS RESPONSE PROTEIN HSP12P IN THE YEAST SACCHAROMYCES CEREVISIAE.

by

Robert Jan Karreman March 2006

Department of Molecular and Cell Biology, Faculty of Science University of Cape Town, Cape Town, South Africa

ABSTRACT Since 1990, the yeast Saccharomyces cerevisiae small heat shockTown protein Hsp 12p, has continuously appeared in data associated with stress responses in this organism. Hsp 12p is expressed abundantly in response to a large variety of di fferent stresses, but for many years has eluded researchers as to its function, primarily because the viability of yeast strains lacking HSP 12 are unaffectedCape by osmotic stress and heat shock. Subsequent studies indicated that Hspof 12p played a role in the adaptation of the cell wall of Saccharomyces cerevisiae to conditions of stress. However, the exact in vivo localization, speci fic function and mediation of function of Hsp 12p had yet to be elucidated.

The localization ofUniversity Hsp 12p was determined by fusion to the green fluorescent reporter protein, Gfp2p and a combination of epifluorescent microscopy and confocal imagery. Chemical extraction revealed that Hsp 12p was present in the cell wall while fluorescent imagery was not conclusive. This fluorescent Hsp 12p construct was later employed in a novel application to sense the stress status of yeast, which bears future promise for use in an industrial setting.

The localization of Hsp 12p in the cell wall and its massive induction upon stress prompted the investigation into stress factors affecting cell wall status. Yeast cells were exposed to the cell wall damaging agent, Congo Red (CR) and the viability, morphology and dimorphic (invasive) growth of yeast cells lacking HSP 12 III

investigated. Hsp 12p was found to play an essential role in the viability of yeast cells exposed to CR and in addition, was required for invasive growth in the presence of CR. Since these phenotypes were very similar to those observed in yeast cells lacking another class of proteins, the PIR (proteins with inverted repeats) proteins, levels of these proteins were compared in the wildtype and HSP J2-deficient yeast strains, but no differences were observed. The method by which Hsp 12p mediated its function was investigated by in vitro studies using chitin and CR, which revealed that Hsp 12p bound this polymer and prevented CR binding. The role ofHsp12p in invasive growth was detemlined by assessing the regulation of proteins involved in this process (flocculins) using Realtime PCR. These studies revealed that Hsp 12p did not affect flocculin regulation and thus acted through a different mechanism.

Throughout these experiments, the HSP 12-deficient strain showed an increase in flocculation ability. The nature of this effect was detenninedTown by hydrophobicity studies using octane partitioning, but these studies indicated that Hsp 12p did not affect cell hydrophobicity and thus flocculation occurred through a different mechanism. Cape

These findings implied that Hsp 12p actedof directly on the yeast cell wall and did not affect other proteins in this locus. Thus the direct effects of Hsp 12p on the cell wall were investigated. These studies included the use of agarose as a model system to simulate the yeast cell wall, which showed that Hsp 12p increased cell wall flexibility. Further studies using atomic force microscopy confinned that Hsp 12p increased the flexibility of the cellUniversity walls of live yeast cells. Studies of cell electrophoretic mobility revealed that cells lacking Hsp12p had stiffer cell walls. Finally, cell wall chemistry was assayed with infrared spectroscopy. Decreased phosphorylation of

peptidomannan residues and a lower ~-1 ,3-glucan content was observed in Hsp 12p­ deficient cells, possibly due to differential regulation of calcium ion flux. The decrease in cell wall polysaccharides was proposed to result in a compensatory increase in the amount of chitin in the cell wall. This increase correlated with the flocculation and CR-sensitive phenotype displayed by cells lacking Hsp 12p, since chitin levels must be controlled for optimal cell separation and chitin is the target for CR binding. IV

ABBREVIATIONS

alpha beta delta delta, indicates gene mutations lambda rho sIgma micro, indicates 10-6

degrees Celcius microgram (10-6 g) microliter (10-3 ml)

3-D three dimensional

A adenine AFM atomic force microscopy A. nidl/lans Aspergillus nidulans Town ARE API response element ATP adenosine triphosphate ATR attenuated total reflectance

BCIP 5-bromo-4-chloro-3-indolylCape phosphate BLAST Basic Local Alignment Search Tool bp base pair(s) of BSA bovine serum albumin

C cytosine 2 Ca + calcium ion C. alhicalls Candida alhicans cAMP cyclic adenosine monophosphate cDNA complementary DNA CH3CN Universityacetonitrile CHCA a-cyano-4-hydroxy cinnamic acid CIS cell integrity stress cm centimeter CR Congo Red CSM complete synthetic growth medium cw cell wall

l Da dalton (g.mor ) DNA deoxyribonucleic acid dNTP deoxyribonucleotide triphosphate DTT dithiothreitol

E. coli Escherichia coli EDTA ethylenediaminetetra-acetic acid v

ELISA enzyme-linked immunosorbance assay EtBr ethidium bromide

FTIR Fourier Transform Infrared

G guamne g gram 2 g standard gravitational acceleration (9.8 m.s- ) GFP green fluorescent protein GSR general stress response h hours HIS histidine HOG high osmolarity glycerol Hsp heat shock protein HSE heat shock element HSR heat shock response

IPTG isopropyl-~-D-thiogalactopyranoside IR infrared Town k spring constant KCl potassium chloride kb kilobase pairs (103 bp) KBr potassium bromide kDa kilo dalton (103 Da) Cape kN kilonewton (103 N) KN03 potassi um nitrate of KO hsp12L1 URA3 S. cerevisiae strain

liter LB Luria-Bertani growth medium LEA late embryogenesis-abundant

m meter M Universitymolar (mol.rl) m/z mass per charge mA milliampere (10-3 A) MALDI-TOF matrix assisted laser desorption/ionisation time of flight MAP mitogen-activated protein MCS multiple cloning site mg milligram (10-3 g) MgCb magnesium chloride mm minutes ml milliliter (10-3 I) mm millimeter (10-3 m) mM millimolar (10-3 M) MPa megapascal (103 Pa) mRNA messenger RNA MW molecular weight in daltons VI

n number (of) NaCI sodium chloride NaOH sodium hydroxide (NH4)2S04 ammonium sulphate NH4HC03 ammonium hydrogen carbonate NBT nitro blue tetrazolium NCBT National Centre for Biotechnology Information -<) ng nanogram (lOg) nm nanometer (10-<) m)

OD600 optical density at 600 nm ODU/ml optical density units at 600 nm I ml oligo dT oligonucleotide deoxythymine ORF open reading frame

Pa pascal (pressure) PBS phosphate buffered saline PCR polymerase chain reaction PDS post-diauxic shift PEl polyethyleneimine Town PKA protein kinase A PKC protein kinase C pmol picomole (10- 12 mol)

RNA ribonucleic acid Cape RNAse ri bon uc 1ease ROS reactive oxygen speciesof RSA Republic of South Africa RT room temperature (~23°C) RTPCR realtime polymerase chain reaction s seconds SAB sample application buffer S. cerevisiae Saccharomyces cerevisiae SDS Universitysodium dodecyl sulphate SDS-PAGE sodium dodecyl sulphate-polyacrylamide gel electrophoresis smHsp small heat shock protein S. pomhe Schizosaccharomyces pomhe STRE stress response promoter element

T thymine Tag Thermophilus aquatiC/IS TBE Tris-borate-EDTA TE Tris-EDTA TEMED N,N,N' ,N' -tetramethylethylene-diamine temp. temperature gelation temperature TJ11 melting temperature Tris 2-amino-2-(hydroxylmethyl)-1,3-propanediol VII

Triton X-I 00 4-octylphenol polyethoxylate Tween polyoxyethylenesorbitan monolaurate

U unit of enzyme activity UK United Kingdom URA uracil USA United States of America

V volt v/v volume / volume (1 ml/ 100 ml) w/v weight / volume (1 g / 100 ml) WT wiJdtype S. cerevisiae strain

X-gal 5-bromo-4-chloro-3-indoy I-B-D-galactoside

YEPD yeast extract peptone dextrose (glucose) growth medium YNB-AA yeast nitrogen base Jacking amino acids Town

Cape of

University VIII

LIST OF FIGURES & TABLES

FIGURES PAGE

Figure 1.1. Properties ofHsp12p 7

Figure 1.2. HSP 12 promoter analysis 9

Figure 1.3. HSP 12 promoter deletion analysis 16

Figure 1.4. Model of salt stress regulation of HSP 12 18

Figure 1.5. Model of salt stress / cell integrity pathway regulatory cross- 20 talk in HSP 12 regulation

Figure 2.2.1. The pYES2-HSP12-GFP2 (pYH12G2) construct 33

Figure 2.2.2. Features of the pYES2 plasmid 37 Figure 2.2.3. Verification of the fidelity ofpYH12G2 Town 38 Figure 2.2.4. NaOH extract of cell wall proteins visualized by SDS-PAGE 40

Figure 2.2.5. Western blot to confirm Hsp12p as the major NaOH extracted 42 cell wall protein at 12 kDa Cape Figure 2.2.6. Hsp 12-Gfp2p visualizationof 43 Figure 2.3.l. Salt stress induces Hsp 12-Gfp2p expression 49

Figure 2.3.2. Ethanol and osmotic stress induce Hsp 12-Gfp2p expression 50

Figure 2.3.3. Temperature affects the Hsp 12-Gfp2p expression 51 Figure 3.2.l. CongoUniversity Red (CR) affects the viability of yeast cells 69 Figure 3.2.2. CR alters the morphology of yeast cells 70

Figure 3.2.3. Closer examination of cells exposed to CR 71

Figure 3.2.4. Flocculation of yeast cells exposed to CR 72

Figure 3.2.5. Flocculation of unstressed yeast cells 73

Figure 3.2.6. CR stimulates invasive growth in WT yeast cells 74

Figure 3.2.7. Closer examination of invasive cells 74

Figure 3.2.8. Investigation of prolate spheroids observed under the agar 75 surface by confocal microscopy IX

Figure 3.2.9. Hsp 12p binds chitin in vitro 76

Figure 3.2.10. PIR protein analysis by biotinylation 77

Figure 3.2.11. RTPCR analysis of HSP 12 induction in response to CR 78

Figure 3.3.1. Effects of included sol utes on the gel turbidity and gelation 85 temperature of agarose

Figure 3.3.2. Effects of included solutes on the gel strength of agarose 86

Figure 3.3.3. Effect of the incorporation of increasing concentrations of 87 urea on the turbidity, gelation temperature and gel strength

Figure 3.3.4. Effect of the incorporation of increasing concentrations of 88 Hsp 12p or lysozyme on the gel strength of agarose

Figure 3.4.1. Yeast cell density on AFM slides 96

Figure 3.4.2. AFM height image of WT yeast cells 100 Town Figure 3.4.3. AFM force curves obtained for WT and KO cells 101

Figure 3.4.4. Electrophoretic mobilities ofWT and KO cells 103

Figure 3.4.5. ATR-FTIR spectra ofWT and KOCape yeast cell walls 105 Figure 3.5.1. Model of the roles of Hspof 12p in the yeast cell wall 108

Figure 3.5.2. Model for Hsp 12p function 112

TABLES PAGE

Table 1.1. Concensus sequences for transcription factors in yeast 8 Table 1.2. EffectsUniversity of the deletion of various transcription factors in yeast 15 Table 2.2.1. Peptide masses of dominant peaks obtained for the 11 kDa 41 band using MALDI-TOF and tryptic digestion

Table 3.2.1. R TPCR primers 66

Table 3.4.1. Assignment of ATR-FITR bands obtained for yeast cell walls 104

Table 3.5.1. A summary of the references and findings used to compile the 113 model presented in Figure 3.5.1. Chapter 1 1

CHAPTER! GENERAL INTRODUCTION 1.1. GENERAL INTRODUCTION 2

1.1.1. YEAST STRESS RESPONSES 2

1.1.2. HSP12P 5

1.2. HSP]2 REGULATION 8

1.2.1. HSP 12 POSSESSES A COMPLEX, HIGHLY REGULA TED 8 PROMOTER REGION

1.2.2. HSP 12 IS INDUCED DURING CONDITIONS OF GLUCOSE 10 LIMITATION AND UPON ENTRY INTO STATIONARY PHASE

1.2.3. TEMPERATURE CHANGES INDUCE HSP 12 EXPRESSION 12 1.2.4. BAROMETRIC PRESSURE INDUCES HSP 12 EXPRESSIONTown 13 1.2.5. SAL T STRESS CAUSES INDUCTION OF HSP 12 14

1.2.6. HSP 12 IS INDUCED IN RESPONSE TO CELL WALL DAMAGE 18

1.2.7. OTHER FACTORS RESULTING IN HSP12Cape INDUCTION 19

1.3. HSP12P LOCALIZATION AND FUNCTIONof 21

1.4. APPLICATIONS OF HSP12 22

1.5. MOTIV ATION FOR THE STUDY OF HSP12P IN S. CEREVISIAE 23

University Chapter 1 2

1.1. GENERAL INTRODUCTION

1.1.1. Yeast stress responses

Studies of stress responses in the budding yeast Saccharomyces cerevisiae have been of particular interest to many researchers, since this yeast represents a genetically tractable eukaryotic model organism. These studies have application in the optimisation of femlentation processes in industry and also provide a model of stress responses in higher eukaryotes.

Yeast cells possess a series of stress signalling mechanisms to relay signals from sensing components (usually at the cell surface) to transcription factors within the nucleus culminating in the repression, derepression or induction of target genes. Proteins synthesised in response fulfil various functions such as the balancingTown of osmotic potential, the efflux of toxic substances, the alteration of morphology and other adaptations to the stress. Most signalling mechanisms employ Mitogen-Activated-Protein (MAP) Kinases which mediate a series of phosphorylation events to relay stress signals (Posas et af., 1998). These proteins function by phosphorylating the nextCape MAP Kinase downstream, so that the cascade is usually of the form where aof MAP Kinase Kinase Kinase (MAPKKK) phosphorylates a MAP Kinase Kinase (MAPKK) which in tum phosphorylates a MAP Kinase (MAPK). The MAPK then phosphorylates a variety of transcription factors. In this way, a relatively small signal from a sensor is amplified and converted to a sensitive switching response dependent on the threshold magnitude of the original stress (Ferrell, 1996; Huang and Ferrell,University 1996). Other stress signalling mechanisms include the Target of Rapamycin (Tor) pathway (Thomas and Hall, 1997; Dennis et (II., 1999) and direct sensing mechanisms, where stressful conditions directly affect the conformation and/or localization of specific transcription factors.

The stress responsive pathways in S. cerevisiae can be divided into three major groups: the heat-shock response, the general stress response and the cell integrity pathway. The heat shock response (HSR) pathway is induced upon exposure to sublethal heat shock, alcohol, heavy metals and anoxia (Mager and de Kruijff, 1995). Heat shock factor 1 (Hsfl p) was identified as the effector of the HSR in yeast (Sorger et aI., 1988). This homotrimeric protein responds directly (Harrison et aI., 1994) and binds promoter sequences known as Chapter 1 3 heat shock elements (HSEs), comprising three or more contiguous inverted repeats of the 5- base pair sequence nGAAn (Pelham and Bienz, 1982; Xiao et aI., 1991; Morimoto et aI., 1993; Bonner et aI., 1994;). The HSR results in the expression of a variety of heat shock proteins (HSPs) which are divided into 5 groups on the basis of molecular mass and their ability to induce various downstream events. These groups are: Hsp70p, Hsp lOOp, Hsp90p, Hsp60p, and Small Heat Shock Proteins (smHsps). Heat shock proteins perform a wide variety of protective functions but their general function is to control the accurate folding and translocation of polypeptides in the different cellular compartments under stressful conditions. Hsp 104p, a member of the Hsp 1OOp multi-gene family, is responsible for resolubilisation and reactivation of folded aggregated proteins (Sanchez and Lindquist, 1990). Hsp60p mediates the folding of newly synthesized proteins, thus preventing subsequent formation of undesirable and potentially toxic proteins (Craig et aI., 1993). Hsp90p interacts with non-native proteins that have already attained a high degree of secondary structure, preventing their aggregation and maintainingTown them in folding­ competent conformations that can complete folding upon the addition of other chaperones (Bose et aI., 1996; Freeman and Morimoto, 1996). Hsp70p prevents premature folding of incomplete polypeptides and is crucial for growth processes within the cell. (Craig and Jacobsen, 1984; Wiech et ai., 1993; James et aI.,Cape 1997) The last group, the small Hsps (smHsps), contain a consensus a-crystallin ofdomain (DeJong et aI., 1993) and prevent the aggregation and in some cases promote the renaturation of unfolded polypeptides in vitro (Horwitz, 1992). In vivo, however, their function is largely unknown but it is believed that they may playa protective role (Yeh et ai., 1994) and aid in cytoskeleton assembly (Lavoie et aI., 1993). Small heat shock proteins are often present as large oligomeric complexes (Chang et aI., 1996). University

The general stress response (GSR) pathway is induced by a large variety of stresses including heat shock, osmotic stress, alcohol, sorbate, nitrogen starvation, acidic external pH, oxidative stress (Ruis and SchUller, 1995) and nutrient limitation (Thevelein and de Winde, 1999). Signals within this stress response pathway are modulated mainly by the cAMP-protein kinase A (PKA) pathway (For a review, see Igual and Estruch, 2000) which negatively regulates many stress-responsive genes, including some Hsps. When cells are exposed to nutrient-limiting or certain stressful conditions, levels of cAMP decline, PKA activity decreases and repression is relieved. This pathway also affects the localization and phosphorylation state of the major transcriptional regulators of this system, Msn2p and Chapter 1 4

Msn4p, hereafter referred to as Msn2/4p (Gomer et aI., 1998). These homologous, functionally redundant transcription factors (Marchler et aI., 1993; Ruis and Schuller, 1995; Mager and de Kruijff, 1995; Martinez-Pastor et aI., 1996; Siderius and Mager, 1997) dissociate from the 14-3-3 (footnote 1) protein, Bmh2p (Beck and Hall, 1999) and accumulate in the nucleus under stressful conditions (Gomer et aI., 1998) where they bind sequences known as stress responsive elements (STREs), characterized by the core sequence 5'-AGGGG-3' (Marchler et aI., 1993; Martinez-Pastor et aI., 1996; Schmitt and McEntee, 1996) in the promoters of many stress-responsive genes.

GSR pathways are varied and can be divided according to the type of stress encountered, but it should be noted that there is often regulatory cross-talk between these pathways due to secondary effects. The first type of stress, oxidative stress, is encountered during normal cellular aerobic respiration or when yeast cells are sUbjected to hydrogen peroxide or heavy metals. Yeast cells must activate oxidative stress pathwaysTown to counter the resultant formation of reactive oxygen species (ROS) (Santoro and Thiele, 1997) in these cases. The main mediator of the oxidative stress pathway, Yap 1p, possesses a cysteine-rich domain which serves as a redox state sensor when the cysteines are oxidized (Kuge et al., 1997). It then trans locates to the nucleus (Toone and Jones,Cape 1998) and binds AP I-response elements (AREs) characterized by the sequence TGACTCAof found in the promoters of many antioxidant enzymes (Risse et aI., 1989) Other types of stress, namely heat shock and osmotic stress, are alleviated by the High Osmolarity Glycerol (HOG) pathway, a MAP kinase pathway which is crucial for tolerance to these forms of stress (Brewster et aI., 1993). Components of the HOG Pathway include the plasma membrane-localized osmosensors, Sho 1p Universityand SIn 1p (Maeda et aI., 1995) and the crucial effector Hogl p, which activates Msn2/4p (Brewster et al., 1993; Schuller et aI., 1994), Mcmlp (Maeda et al., 1994) and other transcription factors. Msn2/4p binds STREs and induces many genes, including CTTl (Wieser et aI., 1991), DDR2 (Kobayashi and McEntee, 1993) and HSPJ2 (Varela et aI., 1995) while Mcm 1p stimulates cell cycle control genes via MADS box (footnote 2) type activation (Nurrish et aI., 1995). Thus the GSR can be mediated both through a series of derepressive and inductive events as well as by direct sensing. Footnotes: 1. 14-3-3 proteins are a family of conserved regulatory molecules expressed in eukaryotic cells which bind a variety of functionally diverse signalling proteins, including kinases, phosphatases and transmembrane receptors. These proteins contain a number of known modification domains. 2. "An acronym for the DNA-binding domain of a gene family that is derived from the initials of the founding members MCMl, AGAMOUS, DEFICIENS and SRF, in yeast, Arabidopsi.l. Alltirrhilllll11 and humans, respectively". Chapter 1 5

The final pathway, the cell integrity pathway, is a MAP kinase pathway which responds to stresses which directly affect cell wall assembly and integrity (For a review, see Levin, 2005). Such stresses include mechanical forces, hypo-osmotic conditions (Davenport et aI., 1995), increased temperature (Kamada et aI., 1995), cell wall disrupting agents including Congo Red, caffeine and Calcofluor White (Martin et aI., 2000; Garcia et aI., 2004) and antifungal agents such as chitinases and glucanases (de Nobel et aI., 2000). The protein kinase C (PKC) cell integrity pathway is activated in response to these stresses and comprises the cell wall localized sensors, W sc 1/2/3p (Gray et aI., 1997; Verna et af., 1997) and Mid2p (Ketela et aI., 1999; Rajavel et aI., 1999) which act, via the small GTPases Rho 1p, Rom2p and Sac7p (Philip and Levin, 2001), to activate Protein Kinase C (Pkc 1p). Pkc 1p is the initiator of the MAP kinase cascade acting through Slt2p/Mpkl p. This eventually leads to activation of Swi4/6p, which regulates cell cycle genes (Ogas et aI., 1991) and cell wall biosynthesis (Igual et aI., 1996), and Rlmlp, involved in a variety of regulatory functions, including cell wall synthesis and assemblyTown (lung and Levin, 1999). It has been proposed that cell wall stress is also signalled via the common condition exhibited by all stressed cells, namely plasma membrane stretch, since cells exposed to hypo-osmotic stress, which blocks membrane stretch, cannot activate cell wall integrity pathway components (de Nobel et aI., 2000). This presumablyCape has an effect on stretch-activated ion channel proteins such as Mid 1p (Kanzaki etof aI., 1999; Kanzaki et aI., 2000; Yoshimura et aI., 2004) which affect intracellular ion levels, including calcium. Calcium is involved in the activation of calcineurin, a serine/threonine specific protein phosphatase which dephosphorylates and activates transcription factors such as Crz 1p/Tcn 1p in response to 2 extracellular stress. Moreover, the Ca + /calcineurin and Pkc 1p-Slt2p pathways act synergistically to induceUniversity Fks2p, a subunit of the cell wall biosynthetic enzyme ~-1 ,3-glucan synthase, in response to cell wall damage (Zhao et aI., 1998; Lagorce et aI., 2003).

In summary, therefore, yeast cells display many varied patterns of stress response through intricate pathways. These pathways are often closely related and share common functional aspects, ensuring hannony within the stressed yeast cell.

1.1.2. Hsp12p

Hsp12p is a small 12kDa stress-response protein present in the budding yeast, S. cerevisiae. This protein was discovered almost simultaneously in 1990 by two separate laboratories Chapter 1 6

(Praekelt and Meacock, 1990; Stone et af., 1990). The protein was discovered largely because of its induction due to either removal of glucose from the medium or to an increase in temperature. The HSP 12 gene was initially named GLP 1 (glucose and lipid regulated protein) and was localized to chromosome VI in the yeast genome (Stone et aI., 1990).

Hsp 12p is rich in alanine, glycine and charged amino acids such as aspartic acid, glutamic acid and lysine (Figure 1.1 A). It is believed to possess a random coil structure with one putative alpha helix domain (unpublished data). Due to its high hydrophilic amino acid content (Figure 1.1 A, B) and lack of structure (Figure 1.1 C), this protein is water-soluble at 80°C (Mtwisha et aI., 1998). These factors have prompted it to be classified as a late embryogenesis abundant (LEA)-like protein. LEA proteins are typically found in plants in conditions of water deficit (Mtwisha et aI., 1998). Unlike other small heat shock proteins found in yeasts, such as Hsp26p, Hsp 12p does not possess an a-crystallin domain (Praekelt and Meacock, 1990; Stone et aI., 1990) and is loosely classified Townas a general stress response protein.

Computer-aided searches of protein databases revealed three proteins in other yeast species that are sequence-related to Hsp 12p. These are theCape colony switching protein Whs 11 p in

Candida alhicans (47 % identity), the morphogenicof transition protein, Awhllp 111

Aspergillus nidulalls (41 % identity) and the small heat shock protein Hsp9p 111 Schizosaccharomyces pomhe (40 % identity). Whs 11 p is a cytoplasmic protein active in the spherical, budding growth form but not the elongate hyphal form of C. albicans (Srikantha et al., 1997). Similarly, Awh 11 p, regulated by StuAp, is expressed during the hyphae to budding growth transitionUniversity in A. nidulans (Dutton et aI., 1997). Finally, Hsp9p is expressed in S. pombe under very similar conditions to Hsp 12p in S. cerevisiae, such as heat shock, entry into stationary phase and glucose limitation (lang et aI., 1996). Yeast 2-hybrid assays have suggested that Hsp12p interacts with Cprlp (Ho et aI., 2002), a Cyclosporin A binding protein, but the significance of this interaction remains unclear. Chapter 1 7

A B

05 -~~~'t---~.---, f Name (Symb 01) %mol %w/w mol ::.-, 00 .~ j u -05 !' } ( p.1arune (A) 11.9 8.5 ~ , ' I Co -10 i".rginine (R):+: 2.8 3.8 .£1 .'< >l. ~ "j Asparagine (N):+: 2.8 2.9 ....Co -15 'Cl .~..., Aspa.ttic acid (D):+: 10.1 10.7 ::r:: -2.0 .. Cysteine (C) 0.0 0.0 -L.-, . ..!" Glutamic acid (E):+: 10.1 11.9 -3.0 Glutamine (Q)* 5.5 6.4 1 20 40 60 8CI 100 Glycine (G) 11.9 7.2 Residue Position C Histidine (H)* 1.8 2.3 Town Isoleucine (I) 0.9 1.0 .,.-,~ 1.0 ..:'-' -I " ~.6 '1> 0.8 Leucine (L) 2.9 'Cl ..: Lysine (K):+: 13.8 16.1 ., 0.6 E-< -~ .... Ivlethionine (M) 1.8 2.2 .., 04 Pheny1ala.tune (F) 1.8 2.4 'Cl.... Co 0.2 Cape '10 Proline (P) 2..6 2.5 '.' 0 00 ,--_... _- Sel"ine (S) 7.3 6.2 0 of 20 4U 60 80 100 Threonine (1') 1.8 1.7 1"e sidue Po sition Tryptophan (Iill) 0.0 0.0 D 1 M::~DAG RKGFG EKASE ALKPD SOKSY AEOGK ~, '7 _I ••1 5.3 Tytosine (Y) 31 EYITD KADKV AGKVO PEDNK GVFOG VHDSA Valine (V) 6.4 6.0 61 EKGKD NAEGO GESLA DOARD YMGH. KSKLN ~. HVdror'hobicity< OJ 91 DAVEY VSGRV HGEED PTKK

Figure 1,1. (A) Amino acid composition, (B) Hydrophobicity plot, (C) Structural properties and (D) Amino acid sequence ofUniversity Hsp 12p. Hydrophobicity was plotted according to the method of Kyte and Doolittle (Kyte and Doolittle, 1982). Structural disorder tendency was calculated using IUPRED analysis which calculates total pairwise amino acid interaction energy (Dosztanyi et al., 2005). Hsp 12p has a predicted molecular weight of 11680 Da and a theoretical pI of 5.04, as detennined using DNAMAN 4.13 software (Lynnon Biosoft). Chapter 1 8

1.2. HSP12 REGULATION

1.2.1. HSP12 possesses a complex, highly regulated promoter region

HSP 12 is extensively regulated in S. cerevisiae and responds to nearly all stresses imposed on the yeast cell. The promoter of HSP 12 consequently contains multiple consensus sequences (Table 1.1) for a number of transcription factors modulating stress responses and metabolic programming. Using a combination of in silica analyses, microarray and direct binding experiments, several authors have classified these promoter regions (Figure 1.2). Although the regulation of this gene has been studied extensively, this has predominantly been at the transcriptional level. Some studies have revealed that Hsp 12p protein levels are lower at elevated temperatures whereas mRNA levels are correspondingly higher (Mtwisha ct aI., 1998), implicating mRNA stability and translational control in the regulation of Hsp 12p. In addition, studies of HSP 12 regulation have often involvedTown observations after single mutations, which hinder conclusive statements since the transcription factorls in question may be affected in localization, phosphorylation or even unknown factors by unrelated gene disruptions. Cape

Table 1.1. Known and putative consensus sequencesof for various transcription factors in yeast.

\lame Consensus sequence Regulatory function Reference/s STRE (Msn2/4p) AGGGG General stress Martinez-Pastor et al., 1996. HSE (Hsflp) AAG(GIA)N6AAG Heat shock Sorger and Pelham, 1988. PDS (Gislp) T(T/A)AGGGAT Nutrient limitation Boorstein and Craig, 1990. Dodou and Treisman, 1997; RLMI (C/G)T A(AlT)4TAG Cell wall integrity University Watanabe et al., 1997.

CCCN 10GGC Cell wall integrity Boorsma ct aI., 2004. CRE-like (Skolp) ACGTCA Osmotic stress Proft and Serrano, 1999. Zymolyase response ATGACGT Cell wall integrity Boorsma ct al., 2004. element (?) ABFI (AlG)TC( AlG)( C/T)N sACG Global transcription Miyake et al., 2004 TECI CATTC(C/T)(C/T) Filamentous growth Madhani and Fink, 1997. MIGI GGGG Glucose repression Nehlin ct aI., 1991. RAPI ACCCANNCA General stress Eriksson et al., 2000. ORE (Taclp)* CGGNNNCGG Drug response De Micheli et al., 2002.

* This element has only been classified in C. albicans. Chapter I

CCACT AACGGCCCA(j(;CGAAAA TGGAAAAAj:H GGC:trCGGItJA TGTGTeieiG[(JC CAGCTGGCGGIjAGC AA TQACGACGTGITGACGct:CCC1TG",TCTTGGf:l,ACAA GO Acr AGAAGCCAAAAGCCAGAGGCGGT AAAAA T A(j(;/v\GAk'lA(;4A lAnlen TGGCA TCTGlT AI "..G(.r(j(Y.TATG lTGCAACTTG(iA £~",:c-jGcc,G(, ACAAAA T AAC , AT AGAAACGTAGT AAAQAGOGf44. AA AGGAAAAGGA AAAGGAAAAGGAAGGA i AAAAAAcccAl1ru\cGT"\AGAAAlTGAAAGAAGGAAAGGTATACGCAACiCATf AA TAC AACCCACAAACACAGACC AGAiAGCXC:j ( -I AG1\0]GAGAGT AACT AGA

TCTACA<.t CCC'IP

Cape STRh 4 _37710_373 of STRE 3 -132 to -128 STRE 2 _1'JOlo_lll(' S I Rh I Orange -33210-327 Z}loolyase response . Ierne,,! DaIl green _ 14-~ 10 - 13'! -77lO-72 TATA 00" Pnrple o lfSP120RF 1.1ghl blue _16.\ 10 _1~3 Abnp bindinguOOU\;n Dar\.. blu. _'>1-210 _~36 Toc I Jl bi'I

FlgurC 1,1, Analym or ~hc HS!' 12 promOlC' n;"eal, manl Jluta]I\'e regulalory clemml., Only 606 bp upslrcalll arc dcJllCwd. 'inee rn"C'ealcd ~hal I"" i, lhc minim"m region rcquin;d lor proper iud,-.ollOll (Varci" of aI.. 1995), Some regul"lOf)' moufs ",-crbp. f,.- example the Mlglp gluco

1.2.2. HSP12 is induced during conditions of glucose limitation, and upon entry into stationary phase

Adenylate cyclase activity is diminished when yeast cells enter stationary phase, are grown on non-fermentable carbon sources or when glucose is limited. This causes yeast cells to produce lower levels of cyclic AMP (cAMP) which directly affects protein kinase A (PKA) activity as cAMP is required for activation of its catalytic subunits, Tpkl/2/3p (Thevelein and de Winde, 1999). This leads to derepression of many stress responsive genes including HSP 12. Initially, the induction of HSP J 2 by nutrient limitation was thought to be controlled by the general stress transcription factors, Msn2/4p, since (i) these proteins accumulate in the nucleus upon starvation (Gomer et al.., 1998; Smith et aI., 1998), (ii) PKA phosphorylates and activates these factors (Chi et al., 2001) and (iii) the promoter of HSP 12 contains many stress-responsive elements (STREs), the binding sites for these proteins. Indeed, STRE mutations led to complete loss of earlyTown stationary phase induction of HSP 12 (Varela et aI., 1995). However, recent findings showed that when PKA activity is abolished, thus simulating starvation conditions, HSP 12 is induced independently of Msn2/4p (Ferguson et aI., 2005). Instead, inductionCape appeared to be heat shock factor (Hsfl p) dependent, indicating possible regulatory cross-talk between the heat shock response and glucose-limiting response, whenof PKA activity is abolished. Alternatively, Hsfl p might directly induce HSP 12 via the STREs under nutrient limiting conditions. Further regulatory complexities are revealed by the fact that another level of nutrient limiting control is mediated via the post-diauxic shift (PDS) elements, which are acted upon by the effector of Rim 15p, Gis 1p (Pedruzzi et aI., 2000). Since the promoter of HSP 12 contains a putative UniversityPDS element (Figure 1.2) and a gis 1iJ strain exhibits defective derepression of HSP 12 (Pedruzzi et aI., 2000), we would envisage that HSP J 2 is controlled via both Hsfl p and Gis 1p mediated derepression. Other authors have suggested another mechanism of glucose-mediated control, the Ph085p pathway (Timblin and Bergman, 1997). Ph085p is a cyclin dependent glycogen synthase kinase catalytic subunit which associates with Ph080p to repress many stress-responsive genes, including HSP 12 (Measday et aI., 1997). Ph085p is inactivated by glucose 6-phosphate (Huang et aI., 1997; Pederson et aI., 2004), which functions during early stationary phase as a trigger to stimulate cells to hyper-accumulate glycogen via the predominant yeast glycogen synthase, Gsy2p (Lillie et al., 1980; Francois et aI., 1997). This may explain another mechanism of Chapter 1 11

Hsp 12p induction upon entry into stationary phase since Ph085p inhibition by glucose-6- phosphate would lead to consequent derepression of Hsp 12p.

HSP 12 is also induced when yeast cells are grown in the presence of non-fermentable carbon sources such as oleic acid (Stone et al., 1990). The exact mechanism governing this process is not known, but experimental evidence points to the involvement of inositolphosphoceramide-phospolipase C (lsc I p), since removal of this protein from yeast cells results in a 4 fold increase in HSP 12 transcript levels (Cowart et a/. , 2005). A possible mechanism is that oleic acid acts via negative feedback to inhibit Isc 1p, which in tum inhibits Sst2p and increases HSP 12 induction. Another possibility is that oleic acid acts directly on protein kinase C (PKC), since PKC in human cells, which is homologous to yeast PKC (Jacoby et a/., 1997), displays increased activity when exposed to oleic acid (Khan et aI., 1992). PKC is the main mediator of the cell integrity pathway in yeast, which is a known inducer of HSP 12. However, no studies have been Townconducted on the effect of oleic acid on protein kinase C in yeast cells.

HSP 12 is rapidly repressed when glucose is added to starved cells. This process is evident even at very low concentrations (0.02 % w/v) ofCape glucose (de Groot et aI., 2000). A role independent of the Mig 1P general glucose repressionof pathway for glucose-6-phosphate has been proposed in this process via an unknown mechanism affecting STRE2 at position -232 in the HSP 12 promoter (de Groot et aI., 2000). Intriguingly, it was later demonstrated that glycogen synthase kinase (Gsk2p) is essential for Msn2p/STRE binding complex stabilization (Hirata et aI., 2003). Since glucose 6-phosphate inactivates Gsk2p (Huang et (//., 1997), this wouldUniversity lead to Msn2p/STRE instability and consequently HSP 12 expression would be halted.

Thus it appears that glucose-6-phosphate is a major factor governing HSP 12 expression in response to nutrient limitation by Ph085p-mediated derepression, and to nutrient abundance by loss of Gsk2p stabilization of Msn2p/STRE complexes and down-regulation of HSP J2. However, how the regulatory pathways respond differentially to glucose-6-phosphate under both extremes is not known, but may involve differences in cAMP synthesis and/or removal, which would affect transcription factor localization. Chapter 1 12

1.2.3. Temperature changes induce HSPI2 expression

Heat stress affects many physiological processes of the yeast cell, including increased plasma membrane fluidity and protein denaturation. HSP 12 acquired its name since it was originally identified as a gene which was induced in response to heat shock (Praekelt and Meacock, 1990). Although several authors have subsequently validated this finding, Mtwisha et al. demonstrated that Hsp 12p levels are lower during growth at elevated temperatures (Mtwisha et al., 1998), suggesting the presence of other regulatory mechanisms in the heat shock response.

As detailed previously, the promoter of HSP12 contains two putative Hsflp heat shock elements (HSEs) (Sorger et aI., 1988). These elements, however, appear not to be important for HSP 12 induction in response to heat stress, since disruption of all these elements had little effect on HSP 12 induction. In contrast, disruption of Townthe second most proximal CCCCT motif (STRE2), caused a dramatic decrease in HSP 12 induction (Varela et al., 1995). This finding was later confirmed using a strain lacking Hsfl p activity, although Hsfl p was required for optimal HSP 12 induction Capein response to heat stress (Treger et aI., 1998). HSP 12 induction upon heat shock is also mediated independently of the STRE­ binding transcriptional activator, Yaplp (Gounalakiof and Thireos, 1994; Varela et aI., 1995). This transcription factor possesses a cysteine-rich domain, which acts as a redox sensor which responds directly to oxidative stress, independently of cell surface localized sensors. Thus HSP 12 cannot be induced directly by stress, but its expression is instead accurately controlled by MAP kinase pathways. In addition, HSP 12 is not activated by heat stress when intracellular PKAUniversity activity is elevated (Varela et al., 1995), probably due to unavailability of the Msn2/4p transcriptional activators (Gomer et al., 1998). Finally, since heat shock can result in activation of the cell integrity pathway, the cell integrity responsive transcription factor, RIm 1p, may playa role in HSP 12 induction upon this form of stress (Kamada et al., 1995). Thus, in summary, HSP 12 is induced during heat shock by an Hsfl p and Yap 1p-independent mechanism putatively involving Msn2/4p and RIm 1p, which act via binding to STREs and the RIm 1p domain respectively in the promoter of this gene.

In the inverse situation, yeast must also cope with cold stress. Upon exposure to cold, membrane fluidity decreases leading to impaired membrane transport functions (Vigh et aI., 1998) and upon freezing, water forms jagged crystals which can readily rupture cell walls Chapter 1 13 and membranes and interfere with protein structure. In addition, yeast cells must maintain a basal level of translational activity and metabolism to survive extended cold periods. Yeast cells have thus evolved a cold stress response, which has not been extensively studied. Recently, investigations have revealed that when yeast cells are exposed to temperatures between 10°C and near freezing, several genes encoding proteins involved in trehalose synthesis are reversibly induced (Kandror et aI., 2004; Schade et aI., 2004). This results in an increased level of intracellular trehalose, which acts as a compatible solute, thus protecting membranes (Iwahashi et al., 1995; Hochachka and Somero, 2002) and proteins (Viner and Clegg, 2001) by minimizing water crystal formation. Besides trehalose synthesis, cells also respond by inducing the expression of general stress response proteins, including Hsp12p (Kandror et aI., 2004; Schade et aI., 2004). Interestingly, the heat shock protein Hsp26p, which is often co-regulated with Hsp 12p in response to stress, was not induced in response to cold (Kandror et aI., 2004). Since the promoter of HSP26 and HSP 12 both contain several STREs, this suggests that the responseTown of HSP 12 to cold stress is regulated by elements other than STREs. However, the transcription factors Msn2/4p, which bind STREs, are required for viability and optimal Hsp 12p expression following cold stress response (Kandror et aI., 2004; Schade et al., 2004). This may indicate that the Msn2/4p transcription factors affect other transcriptionCape factors modulating HSP 12 expression, but not HSP26 expression, suchof as the PKC cell integrity pathway effector, Rlmlp.

1.2.4. Barometric pressure induces HSP12 expression

In the environment, Universityyeast cells are rarely subjected to barometric stress. Yeast cells can survive pressures of up to 220 MPa (Palhano et aI., 2004) and respond to this stress by inducing the synthesis of small heat shock proteins such as Hsp 12p, Hsp26p and Hsp30p (Femandes et aI., 2004). The transcription factors involved in the regulation of these genes in response to barometric stress are not known, since the heat shock protein Hsp30p possesses no known stress response regulatory elements (Seymour and Piper, 1999). This has prompted researchers to believe that the pressure stress response is due to regulatory overlap rather than a specific response, as an increased hydrostatic pressure causes protein denaturation (Silva et aI., 2001), reduced membrane fluidity (Mentre et aI., 1999) and cell wall damage (F emandes et al., 2001; Motshwene et aI., 2004), all factors common to heat shock and cell integrity stresses. However, the effect of hydrostatic pressure is more drastic Chapter 1 14 than these stresses alone as pressure-stressed cells take longer than heat shocked cells to resume normal growth after relief of the stress (Palhano et al., 2004). It has been proposed that trehalose plays a role in the acquisition of yeast barotolerance. However, cells unable to synthesize trehalose can be rescued after high pressure stress by prior heat treatment, implying a role for heat shock response proteins in the acquisition of barotolerance (Fernandes et aI., 2001). Indeed, a direct relationship between Hsp12p interaction with the yeast cell wall and the barotolerance of yeast cells has been recently documented (Motshwene et aI., 2004).

1.2.5. Salt stress causes induction of HSP12

HSP12 is induced to high levels upon salt stress (Varela et aI., 1995; Siderius et aI., 1997). The main pathway responsible for the modulation of HSP 12 in response to salt stress is the High Osmolarity Glycerol (HOG) MAP kinase pathway (ForTown a review, see Hohmann, 2002) since induction of HSP12 is impaired in hoglil strains (Varela et aI., 1995; Siderius et aI., 1997). Upon salt stress, Hog 1p is phosphorylated by Pbs2p and rapidly migrates to the nucleus (Ferrigno et af., 1998; Reiser et aI., 1999) where its export is inhibited by a number of factors including Msn2/4p (Reiser et aI.,Cape 1999), Hotl p and Msn 1p (Rep et aI., 1999). Hoglp activates Msn2/4p (Schi.ilIer etof aI., 1994), Hotlp (Rep et aI., 1999), Skolp (Proft et aI., 2001), Sgdlp (Akhtar et aI., 2000), Gen4p (Pascual-Ahuir et al., 2001) and Skn7p (Brown et aI., 1994) to induce osmotic stress responsive genes, including HSP12. Hoglp also acts directly on the promoter of HSP12 via various mechanisms. Firstly, Hoglp interacts physically with the histone deacetylase Rpd3p, which facilitates entry of RNA polymerase II to chromatinUniversity and induces HSP 12 expression (De Nadal et aI., 2004). Secondly, Hogl p appears to have a direct effect on Msn2/4p regulatory activity, but physical interactions have not been demonstrated (Rep et aI., 2000). In summary, the regulation of HSP 12 in response to salt stress appears to require the full complement of transcription factors, namely Hogl p, Hotl p, Msn 1p and Msn2/4p (Table 1.2) with Hog 1p recruiting Hotlp (Alepuz et al., 2001). Chapter 1 15

Table 1.2. The effects of deletion of various transcription factors on HSP 12 gene expression in response to 0.7 M NaCl. Grey and white background alternations depict separate experiments.

Level Max level, time at Change in Mutation after 60 Reference/s max level max level min None 100% 100%,60 min 0% Rep et aI., ] 999 hot1 77% 77%,60 min -23% msn1 64% 75%,45 min -36% msn2/4 20% 20%,60 min -80% hot1 msn1 40% 45%,45 min -60% msn1 msn2/4 18% 19%,45 min -82% hotl msn2/4 2% 2%,60 min -98% hot1 msn1 msn2/4 1% 1%,60 min -99% None 100% 100%,90 min 0% Siderius et al., 1997 tpk2 tpk3 87% 87%,60 min -13% tpk1,tpk2,tpk3 87% 114%,45 min -13% tpk2,tpk3,bcy1 2% 2%,60 min -98% None 100% 100%,60 min 0% Siderius et aI., 1997 hog] 50% 88%,120 min -50% Town msn2/4 18% 20%,90 min -82% None 100%,30 min 0% Varela et al., 1995 tpk2,tpk3,bcy1 25%,30 min -75% tpk 1, tpk2, tpk3 350%,30 min Cape+250% tpk1,tpk2,tpk3,bcy1 580%,30of min +480%

An extensive deletion analysis of the HSP 12 promoter is response to salt stress has been conducted (Varela et al., 1995) and is summarized in Figure 1.3. This study showed that removal of the region between -606 and -535 had little effect, but further deletion of the region between -535University and -513 caused a substantial drop in salt stress induction. Interestingly, this region contains a putative Rlm1p cell integrity regulatory motif, GCCN]()GGG (Boorsma et aI., 2004) and no STREs. This provides evidence of the regulatory relationship between salt stress and the cell integrity pathway. Chapter 1 16

120

u -650 -600 -550 -500 -450 -400 -350 -300 -250 -200 -150 -100 -50 o Position (bp relative to ATG)

Figure 1.3. Analysis of promoter deletions assembled from the data of Varela et aI., 1995, in response to salt stress. Activity was determined relative to control levels, hence in certain cases, derepression is not indicated, but this indeed occurred when the region from -260 to -150 was deleted. Zero (0) on the X-axis represents the start codon for the HSP 12Town ORF. Further deletions of successively -513 to -460 resulted in an almost linear loss of salt stress induction. Deletions from -460 to -448 had no effect but deletions from -448 to -336 showed another almost linear loss of activity, coincidingCape with the loss of STRE5 (-435 to - 431), STRE4 (-414 to -410) and STRE3 (-377of to -373). A subsequent deletion from -336 to -260 had little effect except mild stress-independent HSP12 induction, possibly by removal of glucose repression elements. This region contains a putative binding site at -333 for Sko 1p, a transcription factor regulated by Hog 1p in response to either osmotic stress (Proft and Serrano, 1999) or cell integrity stress (Boorsma et aI., 2004). Skolp would therefore not appear to be essential for HSP 12 induction upon salt stress. A subsequent deletion of - 260 to -234 resultedUniversity in partial restoration of the stress response. Interestingly, this region contains a putative binding site for the global transcription factor, Abfl p (-265 to -253). However, subsequent point deletions of this region indicated no contribution of Abfl p in the salt stress response, but since the rest of the promoter was present in this case, the contribution of upstream regulatory elements cannot be ignored. Nevertheless, this region (- 336 to -150) appears to play an important role in glucose repression. Further deletions from -234 to -228 caused a sharp decline in HSP 12 induction, probably due to removal of STRE2 (-232 to -228). Interestingly, this particular STRE has also been shown to be essential for proper glucose repression, heat shock and early stationary phase induction, indicating multiple roles for STRE2 in HSP 12 modulation (Varela et a/., 1995; de Groot et ([/., 2000). Subsequent deletions from -228 to -194 again resulted in a mild restoration of Chapter 1 17 salt stress inducibility but this was curtailed by subsequent deletion of -194 to -173, presumably due to loss of the last remaining STRE, STRE 1 (-190 to -186). Finally, deletions from -173 to -150 resulted in a slight restoration of HSP 12 induction while deletions from -150 to -41, which resulted in TATA box (-145 to -139 and -77 to -72) removal, gradually caused a total loss of activity.

In summary, Hogl, Hot!, Msnl, Msn2/4 acting on the STREs (primarily STRE2) and RIm 1p acting through its binding site playa vital role in salt stress induction of HSP 12. The Abfl p region appears to playa repressive role, possibly by enhancing glucose repression, but the mechanism of this is unknown. Taken together, these data can be represented as a model for the HSP 12 salt stress response (Figure 1.4). In this model, contributions of various factors are indicated by percentages. Thus when Hotl p and Msn 1p are removed, induction drops by ~60% by allowing Hog1p export from the nucleus. When Hoglp is removed, induction drops to ~50%, and when Msn2/4p is removed,Town low levels of induction (~20%) are observed, possibly due to Rlmlp. Thus Msn2/4p and Rlmlp account for ~50% net induction, which is enhanced to ~ 100% by Hog 1p, possibly by histone deacetylase recruitment. The discrepancy between Hotl p and Msn 1p combined effects (60%) and Hoglp overall contribution (50%) may indicate enhancementCape of Hoglp activity by these transcription factors in addition to nuclear retention.of Another possibility is that Msn2/4p itself plays a role in preventing export of Hoglp from the nucleus, thus enhancing its apparent activity (Reiser et aI., 1999). Future experiments to verify this model should include analysis of an msn1 i1 hot 1i1 hog 1i1 mutant, which should be equivalent to an msn2f.1i1 mutant and an rlm1i1 mutant to investigate the contribution of this factor in response to salt, sinceUniversity RIm 1p plays an essential role in HSP 12 induction in response to cell wall damage (Garcia et aI., 2004). Chapter 1 18

cAMP

PKA +

8 ....:J +NaCI8 ::: S ..;:: .... /~oc ...- <..> o 0 ""n - ~. ..;3 o ... ~ E-<

--<: :::: Nuclear membrane

Town HSP120RF

Cell integrity __...;'. pathway? .,. Cape of Figure 1.4. A simplified model of HSP 12 induction following salt stress. Question marks represent unknown mechanisms and/or upstream pathways. Arrows represent positive effects, blunt lines repressive effects. Effects are quantified by percentages indicative of effects of mutations on overall HSP 12 expression levels, with positive and negative values depicting enhancement and impairment of HSP 12 induction respectively.

1.2.6. HSP12 is inducedUniversity in response to cell wall damage

Most stressful conditions encountered by yeast cells have an effect on the cell wall of this organism. Salt (hyper-osmotic) stress causes cell shrinkage (Motshwene et a/., 2004), while hypo-osmotic stress causes the cell to swell (Smits et aI., 1999). Temperature influences the kinetics of molecules in the cell wall and also the effect of various intracellular enzymes on the wall. Certain compounds such as Congo Red (CR) or Calcofluor White respectively cause hyper-accumulation (Kopecka and Gabriel, 1992) or coating of cell wall components (Bartnicki-Garcia et aI., 1994). Finally, antifungal agents such as chitinases and glucanases Chapter 1 19 specifically target and destroy this vital cellular component (Garcia et al., 2004). Most of the studies of HSP 12 expression in response to cell wall damage have been conducted using CR or Zymolyase (a cocktail of chitinases and glucanases) as the source of stress. The effects exerted by these compounds can however be extrapolated to the cell integrity response in general, since a large cluster of stress responsive genes, including HSP 12, responds to a variety of different cell wall stresses (Boorsma et aI., 2004; Garcia et al., 2004).

Recently, Hsp12p has been localized to the yeast cell wall, where it has been proposed to increase cell wall flexibility (Motshwene et al., 2004). Accordingly, authors have reported strong Hsp 12p induction following cell integrity stress, particularly after Zymolyase treatment (Garcia et al., 2004). The transcription factors modulating these events are primarily components of the protein kinase C (Pkc 1p) pathway, since over-expression of Pkclp or its sensor Rholp, results in a massive induction of HSP12Town (Garcia et al., 2004). Pkclp serves to activate the downstream MAP Kinases, S1t2p/Mpklp and the final targets RIm 1p and Swi4/6p, both of which are involved in cell wall construction and growth phase­ dependent events (For a review, see Levin, 2005). Interestingly, regulatory overlap is again observed when cells are treated with the cell wall damagingCape agent Congo Red, since HSP 12 induction in this case is Hoglp dependent of(Rodriguez-Pena et al., 2005). As mentioned previously, salt stress also depends on Hog! p and since the promoter of HSP 12 contains a regulatory motif for the cell integrity factor, Rlmlp, this leads to the possibility that Hoglp and Slt2p/Mpklp both exert an effect on Rlmlp, thus linking the two pathways (Figure 1.5). Further evidence is provided by the fact that cells lacking Hoglp are hypersensitive to cell wall degrading enzymesUniversity (Alonse-Monge et al., 2001) and cells lacking Rlmlp display virtually no HSP12 induction upon cell integrity stress (Garcia et aI., 2004). Thus, in summary, Slt2p/Mpklp and to a lesser extent, Hoglp, act synergistically via the transcription factor, RIm 1p, to induce HSP 12 and other cell integrity responsive proteins upon cell integrity stress.

1.2.7. Other factors resulting in HSP12 induction

Aside from "common" stress conditions, a number of studies have shown HSP 12 induction in response to a diverse array of agents. These include metals such as copper (van Bakel et al., 2005), cadmium (Momose and Iwahashi, 2001) and lithium (Bro et al., 2003) as well as Chapter 1 20

DNA damaging agents such as cisplatin, methyl methane sulfonate (MMS), bleomycin and neocarzinostatin (Treger et al., 1998; Schaus et al., 2001; Caba et aI., 2005). HSP 12 is also induced in response to toxins such as herbicides (Simoes et aI., 2003; Teixeira et al., 2005). The multiple stress-responsive behaviour of this protein thus makes it potentially useful as an environmental sensor as well as having several applications in other areas (Section 1.4).

Unfortunately, the role of Hsp 12p in the yeast cell in these responses has not been reported and these findings are merely mentioned to further demonstrate the multitude of stresses that induce HSP 12 expression.

Town

Cape of

HSPll Pt"Omotel' 11 P HSP1l0RF binding domain Figure 1.5. Simplified model of regulatory crosstalk to induce HSP 12 via both salt stress and cell integrity stress. CR: Congo Red. University Chapter 1 21

1.3. HSP12P LOCALIZATION AND FUNCTION

Studies concerning the function ofHsp12p were initially hampered by the fact that the most commonly tested stress states, heat shock and osmotic stress, had the same effect on cells whether they possessed Hsp 12p or not (Praekelt and Meacock, 1990). The discovery of Hsp 12p in the cell wall vicinity by a combination of immunocytochemistry and chemical extraction (Sales et aI., 2000; Motshwene et aI., 2004) and the discovery that biofilm fonnation in a sherry yeast strain was Hspl2p-dependent (Zara et aI., 2002) prompted investigations into the effects of CR, a cell wall damaging agent, on cells lacking Hsp12p (hsp12iJURA3 cells). Hsp12p was found to be necessary for proper growth in the presence of this compound. In addition, when these cells were exposed to elevated barometric pressure, they displayed a marked loss of viability compared to wild type strains (Motswhene et aI., 2004). Further evidence of a cell wall location for Hsp12p is that cells exposed to the cell wall destructive agent Zymolyase displayed a 35-fold induction of HSP12 (Garcia et aI., 2004). In addition, an Hsp12p homologue,Town Hsp9p, was able to suppress a CDC4 mutation in S. pombe which resulted in improper septation, implying a further role for Hsp 12p in cell wall modelling (J ang et aI., 1996). It is intriguing to note that this yeast does not replicate by budding, but via binaryCape fission. This may therefore exclude the possibility that Hsp 12p is involved in theof actual budding process of S. cerevisiae.

The regulation of Hsp12p also implicates Hsp12p interaction with the cell wall, since as shown previously, most stressful conditions affect cell wall integrity (Levin, 2005). This may explain why cells pre-treated with less severe stresses display markedly enhanced survival rates following subsequent severe stress, since in this case cell integrity proteins, including Hsp 12p, mayUniversity "adapt" the cell wall to counter other stresses. Chapter 1 22

1.4. APPLICATIONS OF HSP12

Due to the multi stress-responsive behaviour of this protein, many investigators have demonstrated the use of HSP J 2 expression as a reliable method to quantify the stress status of yeast cells. One such use is in an agriculture, where herbicides such as 2,4- dichlorophenoxyacetic acid are frequently employed to combat invasive vegetation. HSP J 2 was used as an indicator of the potential detrimental effects on secondary, non-target organisms in the environment (Teixeira et aI., 2005). Other environmental studies involved the use of HSP J 2 induction as an indicator in a bioassay system screening for cadmium, a potent cell poison (Momose and Iwahashi, 2001). Another form of assay using HSPJ2 induction as a marker has been developed to discriminate between genotoxic and cytotoxic compounds (Caba et aI., 2005). From a commercial aspect, an important area of investigation is the monitoring of fermentative processes. HSP J2 has been used as a marker to quantify stresses during the first few hours of fermentation (Perez-TorradoTown et aI., 2002), during fenl1entation (Ivorra et ai., 1999; Higgins et aI., 2003; Perez-Torrado et ai., 2005) and during aging of sherries and wines (Aranda et aI., 2002). In this way, new potentially stress-resistant industrial strains of yeast can beCape identified (Carrasco et aI., 2001). In addition, the promoter of HSP J 2 has been fused upstream of various genes to allow growth-phase specific regulation of these genesof during fermentation (Donalies and Stahl, 2001). Thus HSP J 2 has proved very useful and it will be interesting to see future applications of this uniquely responsive and intriguing protein.

University Chapter 1 23

1.5. MOTIVATION FOR THE STUDY OF HSP12P IN S. CEREVISIAE

Large amounts of Hsp 12p accumulate in yeast cells upon exposure to stress, yet the phenotype of yeast cells lacking this protein is largely unaffected by stresses such as heat shock and osmotic stress. It was thus desirable to determine the function of such a highly induced protein with no apparent function and to see why this strain of yeast had retained the gene encoding this protein. Furthermore, identification of the location of such a highly expressed protein would be important since Hsp12p is highly hydrophilic and may affect the chemistry of other molecules in the target locus. Finally, it was important to determine the expression characteristics and identify possible applications of this stress-responsive, highly expressed protein.

Investigations were conducted to: • Determine the location ofHsp12p in yeast cells in vivo. Town • Identify applications of Hsp 12p in biosensors as a marker for compounds which may affect yeast cells and hence other eukaryotic organisms. • Gain further understanding of regulatory systemsCape in yeast, since Hsp 12p is induced by a variety of stresses, enabling the elucidation of regulatory cross-talk between various stress pathways. of • Determine the function of Hsp 12p in yeast cells.

University Chapter 2 24

CHAPTER 2 THE LOCALIZATION AND APPLICATIONS OF HSP12P 2.1. SUMMARY 26

2.2. LOCALIZA TION STUDIES 27

2.2.1. INTRODUCTION 27

2.2.2. MATERIALS AND METHODS 28

2.2.2.1. MATERIALS 28

2.2.2.2. ORGANISMS AND CULTURE CONDITIONS 28

2.2.2.3. CELL WALL PROTEIN EXTRACTION AND CLASSIFICATION 29 2.2.2.3.1. f3-ELIMINATION REACTION 29 2.2.2.3.2. SDS-POLYACRYLAMIDE GEL ELECTROPHORESIS 29 2.2.2.3.3. HSP12P PURIFICATION Town 29 2.2.2.3.4. ANTI-HSP12P ANTIBODY PRODUCTION, ELISA & WESTERN 30 BLOTTING 2.2.2.3.5 MALDI-TOF-ASSISTED PEPTIDE FINGERPRINTING 31

2.2.2.4. CONSTRUCTION OF PYES2-HSP12-GFP2Cape (PYH12G2) 32 2.2.2.4.1. OUTLINE 32 2.2.2.4.2. AGAROSE GEL ELECTROPHORESISof 33 2.2.2.4.3. PLASMID DNA EXTRACTION AND PURIFICATION 34 2.2.2.4.4. AGAROSE GEL EXTRACTION 34 2.2.2.4.5. ETHIDIUM BROMIDE DNA QUANTIFICATION 34 2.2.2.4.6. POLYMERASE CHAIN REACTION 34 2.2.2.4.7. RESTRICTION ENDONUCLEASE DIGESTION 35 2.2.2.4.8. BACTERIAL TRANSFORMATION 35 2.2.2.4.9. YEAST TRANSFORMATION 36 2.2.2.4.1 O. LIGATIONUniversity INTO PYES2 AND FIDELITY TESTING 36

2.2.2.5. CELL WALL STAINING, EPIFLUORESCENT AND CONFOCAL 38 MICROSCOPY

2.2.3. RESULTS 40

2.2.3.1. CELL WALL PROTEIN EXTRACTION AND ANALYSIS 40

2.2.3.2. EXPRESSION AND VISUALISATION OF THE HSP12-GFP2P 42 FUSION PROTEIN

2.2.4. DISCUSSION 44 Chapter 2 25

2.3. APPLICATIONS OF YEAST CELLS EXPRESSING FLUORESCENT 45 HSP12P

2.3.1. INTRODUCTION 45

2.3.2. MATERIALS AND METHODS 47

2.3.2.1. MATERIALS 47

2.3.2.2. ORGANISMS AND CULTURE CONDITIONS 47

2.3.2.3. STRESS ASSAYS AND FLUORIMETRY 47

2.3.3. RESULTS 48

2.3.3.1. SALT INDUCES HSP12 IN A CONCENTRATION-DEPENDENT 48 MANNER

2.3.3.2. OSMOTIC SHOCK AND ETHANOL STRESS INDUCETown HSP12 48

2.3.3.3. HEAT SHOCK BUT NOT COLD STRESS INDUCES HSP12P 50 SYNTHESIS

2.3.4. DISCUSSION Cape 52 of

University Chapter 2 26

2.1. SUMMARY

Immunocytochemical analysis and alkali extraction revealed that Hsp12p had a cell wall location. In order to confirm this finding, the HSP 12 gene and its promoter was inserted upstream of the fluorescent marker protein, Gfp2p, in the yeast shuttle vector, p YES2. Subsequent expression, epifluorescent microscopy and confocal microscopy indicated that Hsp12p was predominantly localized near the cell periphery. This fluorescence was dependent on the growth phase of the cell, a determinant for Hsp 12p expression. Studies into whether the amount of fluorescence produced was proportional to the stress conditions affecting the yeast cell were therefore undertaken. It was found that the cells emitted fluorescence commensurate with the amount of stress (salt, ethanol, mannitol and temperature stress) the cells were subjected to and this fluorescence could be readily quantified using fluorimetry. The cells were subjected to stress and the intensity of fluorescence measured. Results indicated that 400 mM NaCI represented the most severe stress while ethanol and temperature effects were not as pronounced. Thus the yeast cells expressing an Hsp12-Gfp2p fusion protein can be used as a reliable and non-invasive indicator of the stress status of yeast cells, with possible future application in industrial fermentation processes such as ethanol production.

University of Cape Town Chapter 2 27

2.2. LOCALIZATION STUDIES

2.2.1. INTRODUCTION

Hsp 12p is expressed at high levels in yeast cells upon exposure to many forms of stress (Varela et al., 1995). Previous immunocytochemical studies revealed that this protein was localised near the cell membrane (Sales et aI., 2000). However, subsequent studies using cryo-immunocytochemistry revealed that Hsp 12p was in fact mainly present in the cell wall (Motshwene et aI., 2004). Since Hspl2p possesses no known cell wall targeting sequence, cell wall proteins were extracted with alkali solutions and analysed for the presence of Hsp 12p. Furthermore, a fusion protein comprising Hsp 12p and green t1uorescent protein (Gfp2p) was produced to investigate the kinetics of translocation to the cell wall after expression. Gfp2p is a commonly used proteinTown marker and allowed viewing of expressed Hsp 12p directly via epit1uorescent and confocal scanning mIcroscopy. Cape of

University Chapter 2 28

2.2.2. MATERIALS AND METHODS

2.2.2.1. Materials

Yeast extract, peptone, tryptone and bacteriological agar were supplied by Biolabs (RSA). All chemicals used were of high purity. Double distilled water was used for all experiments except for PCR experiments, where double distilled water passed through a Milli-Q filtration apparatus (Millipore, USA) was used.

2.2.2.2. Organisms and culture conditions

The S. cerevisiae yeast strain used in this study was from the W303 genetic background (ala, ade2-1/ade2-1, trpl-lItrp1-1, leu2-3/1eu2-112, his3-1 lIhis3-15,Town ura3/ura3, canr1- lOa/CAN) and was used in the haploid form. Yeast cells were routinely cultured in 1 %

(w/v) yeast extract, 2 % (w/v) peptone, 2 % (w/v) glucose (YEPD) media at 30°C. Aeration was achieved by continuous shakingCape on a rotary shaker. For solid media (plates), agar was added to a final concentrationof of 1.S % (w/v). Positive transformants were selected on synthetic complete dropout media with uracil omitted (SC-URA). This contained 0.67 % (w/v) yeast nitrogen base without amino acids (YNB-AA, Difco, USA), 0.077 % (w/v) complete synthetic medium without uracil (CSM-URA, BIO-I01, USA) and 2 (Yc) (w/v) glucose. Yeast growth, determined by measuring the optical density at 600 nm (OD600) of the culture, was expressed as optical density units I ml (ODU/ml), where 1 ODU I ml is equivalentUniversity to ca. 1 X 107 yeast cells.

E. coli DHSa (F ~801acZ~M1S ~(lacZYA-argF)UI69 deaR recAI endAI hsdR17

(rk·, mk+) phaA sllpE44 thi-l gyrA96 relAI A:) competent cells were a kind gift from C. Hendrickse (University of Cape Town, Cape Town, RSA). These cells were cultured in Luria-Bertani (LB) broth comprising 1 (Yo (w/v) tryptone, O.S % (w/v) yeast extract and O.S % (w/v) NaCI. For solid media (Luria plates), agar was added to a final concentration of I.S % (w/v). Positive transformants were selected on Luria plates supplemented with

100 ~lg I ml ampicillin (Boehringer Mannheim GmbH, Germany). Chapter 2 29

2.2.2.3. Cell wall protein extraction and classification

_._._.77731/3-1··· .. e llI11natIOIl reactIOn.

Yeast cells from overnight cultures were collected by centrifugation at 3000 x g for 10 min at 10°e. Cells were washed twice with 50 mM phosphate, 150 mM NaCl pH 7.4 (PBS) and the wet mass of the pellet determined. The pellet was resuspended in 1 ).11 0.6 M NaOH/mg cells and incubated on ice for 30 min before being centrifuged at 5000 x g for 10 min at 4°e. The supernatant was kept at -20°C for subsequent experiments.

2.2.2.3.2. Sodium dodecyl sulphate polyaClylamide gel electrophoresis (SDS-PAGE)

Proteins were separated on the basis of mass and visualised by TownSDS-PAGE as previously described (Laemmli, 1970). A total extract of chicken histones served as a standard, with approximate molecular weights (kDa) of: HI: 22.5; H5: 20.6; H3: 15.4; H2B: 13.7; H2A: 14.0 and H4: 11.2. Cape of 2.2.2.3.3 Hsp12p purification

A crude cell wall protein extract which contained Hsp 12p was extracted usmg the B-elimination method but from wet packed baker's yeast (Anchor Yeast, RSA) to maximise Hsp 12p quantity. The extract was dialysed against 10 I of distilled water overnight and driedUniversity by Iyophilisation. Approximately 50 mg extract in 5 ml deionised water was applied to a Sephadex G-50 (Amersham Biosciences AB, Sweden) gel filtration column (100 X 3 cm) equilibrated with 50 mM phosphate buffer pH 7.4 at 4°e. Approximately two hundred 5 ml fractions were collected over two days and assayed for protein content by spectrophotometric determination at 230 nm. Ten samples corresponding to the tubes exhibiting the greatest absorbance were pooled, dialysed overnight as before and Iyophilised. The Iyophilate was weighed and resuspended to 20 mg/ml in deionised water. Purity was checked by SDS-PAGE gel which confirmed that Hsp 12p was 90 % pure in the collected fractions. Chapter 2 30

2.2.2.3.4 Anti-Hsp12p antibody production, ELISA and western blotting

Anti-Hspl2p antibody was produced by inoculating 1 mg 90 % pure Hsp12p in Freund's complete adjuvant (Difco, USA) into rabbits. Rabbits were given further weekly booster injections of protein over 4 weeks followed by a final inoculation after a two week interval. Rabbits were bled at weekly intervals and the presence of antibody detem1ined by enzyme-linked immunosorbance assay (ELISA): ca. 1 Ilg of pure protein antigen was applied to 6 wells of a 96-well plate microarray plate (Nunclon, USA) and incubated at 4°C for 20 h. The plate was washed 3 times with PBS containing 0.05 % (v/v) Tween (PBS-T) after which the wells were blocked to eliminate non-specific binding by incubation in 1 % (w/v) bovine serum albumin (BSA) in PBS at RT for 1 h with shaking. After washing the plate 3 times with PBS-T, the primary antibody (anti-HspI2p) was added in various dilutions between 10- 1 to 10-6 in PBS, and incubatedTown at RT for 1 h. The plate was then washed with PBS, after which goat anti-rabbit antibody conjugated to alkaline phosphatase (Pierce, USA) diluted 1: 100 in PBS was added. The plate was incubated for a further 30 min. AntibodiesCape were detected using 300 Ilg p­ nitrophenylphosphate (N-4645, Sigma-Aldrich, USA), 10 % (v/v) diethanolamine (D-

8885, Sigma-Aldrich, USA) pH 9.6 and ofthe absorbance determined at 405 nm 111 a Titertek Multiscan PLUS MKII instrument (Labsystems, Helsinki, Finland).

Proteins were separated on SDS-PAGE gels and transferred to Nitrobind nitrocellulose (Osmonics Inc., USA) by electroblotting: the gel was rinsed with 192 mM glycine, 20 % (v/v) methanol, 25 UniversitymM Tris-HCI pH 8.5 (transfer buffer) and applied to a pre-soaked (in transfer buffer) nitrocellulose membrane supported on pre-soaked Whatman 3 MM paper (Whatman, UK) which was in tum supported on a pre-soaked absorbent cloth on a carbon block (anode). The gel was covered with pre-soaked Whatman 3 MM paper and another absorbent cloth followed by another carbon block (cathode). Proteins were transferred to the nitrocellulose at 80 rnA for 5 h. Nitrocellulose blots were visualised by Ponceau staining by immersing blots in 0.1 % (w/v) Ponceau S (P-3504, Sigma-Aldrich, USA), 5 % (v/v) acetic acid for 5 min, followed by washing with shaking in PBS for 20 min. Blots were blocked in 10 ml PBS containing 5 %) (w/v) skim milk powder for 30 min at RT Chapter 2 31 with shaking. Primary anti-Hspl2p antibody was added to a final dilution of 1:500 after which blots were incubated overnight at 4°C with shaking. The blot was washed 3 times with PBS-T and once with PBS. The blot was then incubated for 1 h at RT in PBS containing the secondary goat anti-rabbit antibody conjugated to alkaline phosphatase (1 :5000 dilution) and 5 % (w/v) skim milk powder. The blot was washed a further 3 times with PBS-T and once with 10 mM Tris-CI, 150 mM NaCI pH 7.4. Finally, the blot was incubated for 5 min at RT in 10 ml 100 mM NaCI, 100 mM MgCb, 100 mM Tris-CI pH 9.5 with 0.25 mg/ml nitro blue tetrazolium (NBT, N-6876, Sigma Aldrich, USA) and 0.25 mg/ml 5-bromo-4-chloro-3-indolyl phosphate (BCIP, B-8503, Sigma Aldrich, USA) to visualise proteins. Once the colour had developed to an appropriate extent, the blot was washed in deionised water and allowed to air dry.

2.2.2.3.5. MALDI-TOF- assisted peptidejingerprinting Town

Proteins were identified by in-gel tryptic digestion followed by matrix-assisted laser desorption ionisation, time-of-flight (MALDI-CapeTOF)-assisted peptide fingerprinting essentially as previously described (Shevchenko et aI., 1996). Protein bands of interest were excised from SDS-PAGE gels and cutof into small blocks (1 x 1 mm). The gel blocks were washed by sequential incubation in 50 % (v/v) acetonitrile (CH3CN) for 5 min, in

50 (Yo (v/v) CH3CN, 50 mM NH4HC03 for 30 min and in 50 % (v/v) CH3CN, 10 mM

NH4HC03 for 30 min. Gel pieces were dried under vacuum in a microcentrifuge for 30 min and rehydrated with a minimal volume of 1 mg/ml trypsin (Promega, USA) in 10 mM NH4HC03. TheUniversity sample was incubated at 37°C for 20 h after which 1 III was mixed with 1 III a-cyano-4-hydroxy cinnamic acid (CHCA, C-2020, Sigma-Aldrich, USA), applied to a gold-plated MALDI-TOF sample plate and allowed to dry. Sample plates were inserted into a Perseptive Biosystems MALDI-TOF mass spectrometer (Perseptive Biosystems GmbH, Germany) and analysed using the following conditions: Method: HCDI002, Mode: linear positive ion, Accelerating voltage: 20000 V, Grid voltage: 94 %, Guide wire voltage: 0.05 %, Laser intensity: 2200, Low mass gate: 600 Da. Chapter 2 32

2.2.2.4. Construction ofpYES2-HSP12-GFP2 (pYH12G2)

2.2.2.4.1. Olltline

GFP (GFP Mutant 2, Connack et at., 1996) was amplified from YCplac22-GFP (a gift from F. Bauer, Stellenbosch University, Stellenbosch, RSA) with the flanking restriction sites, EcoRI (5') and XbaI (3'). The PCR product was digested with EcoRI and XbaI, gel purified and ligated into the plasmid shuttle vector p YES2 (Invitrogen, USA) to produce the vector p YES2-GFP. This plasmid was transfonned into E. coli DH5a competent cells using standard methods. After positive transfonnant selection, the presence of GFP in the construct was verified by PCR.

HSP12 and its promoter (HSPI2+PROM) were amplified fromTown pGEM-T-HSPI2 (a kind gift from A. Kessler, University of Cape Town, Cape Town, RSA) with XhoI (5') and EcoRI (3 ') flanking restriction sites. The resulting fragment was digested with BamHI (the HSP12 promoter contains a naturally occurringCape BamHI site at position -606) and EcoRI, gel purified and ligated into the pYES2-GFP construct to produce pYES2-HSP12- GFP2 (Figure 2.2.1), designated pYH12G2.of This plasmid was transfomled into E. coli DH5a and the fidelity of the construct was verified by PCR and sequencing. The plasmid was then transfonned into yeast cells and the presence of the construct verified by colony PCR. University Chapter 2 33

'129

PYES2-HSP 12-GFP2 7441bp

Figure 2.2.1. The pYES2-HSP12-GFP (pYH12G2) construct. GFP2Town was inserted into pYES2 using EcoRI and XbaI restriction sites. HSP 12 and its promoter were cloned upstream of GFP2 using BamHI and EcoRI sites. The construct was verified by DNA sequencing.

2.2.2.4.2. Agarose gel electrophoresis Cape of DNA was visualised on 1 % (w/v) agarose (DI-LE, Hispanagar, Spain) slab gels in a horizontal tank containing 0.09 M Tris-CI, 0.09 M boric acid, 0.002 M ethylenediaminetetraacetic acid (EDTA, Biolabs, RSA) pH 8.0 (TBE). Prior to casting the gel, 5 ~tl of 10 mg/ml ethidium bromide (EtBr, Boehringer Mannheim GmbH, Gennany) was added per 50 ml agarose solution. Samples were mixed with 5 III DNA sample applicationUniversity buffer (DNA-SAB) which contained 0.25 % (w/v) bromophenol blue, 40 % (w/v) sucrose and 20 mM EDTA pH 8.0, applied to the gel and run at a constant voltage of 120 V for ca. 1 h at RT. DNA was visualized by viewing the gels on an ultraviolet light source, photographed and printed. In all cases the standard was a digestion of A phage DNA (0-1501, Prom ega, USA) with Pst! or BamHI and HindIII. Chapter 2 34

2.2.2.4.3. Plasmid DNA extraction and purification

Plasmid DNA was extracted and purified from E. coli cells usmg a QIAprep Spin Miniprep kit (Qiagen, Germany) as per manufacturer's instructions.

2.2.2.4.4. Agarose gel extraction

DNA fragments of interest were purified by agarose gel electrophoresis and gel extraction using a QIAquick gel extraction kit (Qiagen, Germany) as per manufacturer's instructions.

2.2.2.4.5. Ethidium bromide DNA quantification Town The concentration of sample DNA was estimated by visual comparIson with known amounts 00" phage DNA (5 ng, 10 ng and 20 ng DNA) on 1 % (w/v) agarose gels. Cape 2.2.2.4.6. Polymerase chain reaction (peR)of

The GFP2 sequence was obtained using provided sequence information and the Pubmed Basic Local Alignment Search Tool (BLAST) at the National Centre for Biotechnology Infonnation (NCBI, http://www.ncbi.nlm.nih.gov/blast). The HSP12 gene and its promoter sequence were obtained from the S. cerevisiae genome database (http://www.yeastgenome.org).University All PCR reactions were performed in a Sprint Thermal Cycler (Hybaid, UK). Taq polymerase, Taq polymerase reaction buffer and MgCI2 were from Promega (USA). PCR primers were from the Synthetic DNA Synthesis Facility at the University of Cape Town, Cape Town, RSA and were produced on a 1000M DNA synthesizer (Beckman-Coulter, USA) using the high purity program. Nucleotides (dNTPs) were obtained from Bioline (USA).

The oligonucleotide primers for GFP2 had the following sequences (restriction sites underlined): forward primer: 5'-ACG-AAT-TCA-TGA-GTA-AAG-GAG-AAG-3' and Chapter 2 35 reverse pnmer: 5'-CGT-CTA-GAT-TAT-TTG-TAT-AGT-TCA-TC-3'. The PCR reaction mixture contained 50 pmol forward primer, 50 pmol reverse primer, 2 III 6.25 mM dNTPs, 5 11125 mM MgClz, 5 III lOX Taq reaction buffer, 2 U Taq polymerase and Milli-Q water to yield a final reaction volume of 50 Ill. PCR conditions were as follows: 92°C (5 min); 5 cycles of 92°C (30 s), 44°C (30 s), noc (30 s); 25 cycles of 92°C (30 s), 68°C (30 s), noc (30 s); noc (5 min) and finally 4°C (10 min).

The following oligonucleotide primers were used to amplify HSP 12 and its promoter (restriction sites underlined): forward primer: 5'-CAC-TCG-AGG-CAA-ATC-CAA­ GTG-AAA-ATC-TC-3' and reverse primer: 5'-CGG-AAT-TCC-TTC-TTG-GTT-GGG­ TCT -TC-3'. 50 pmol forward primer, 50 pmol reverse primer, 2 III 6.25 mM dNTPs, 5 III 25 mM MgCh, 5 III lOX Taq reaction buffer, 2 U Taq polymerase and Milli-Q water to yield a final reaction volume of 50 Ill. PCR conditions were asTown follows: 92°C (5 min); 5 cycles of 92°C (30 s), 50°C (30 s), noc (30 s); 25 cycles of 92°C (30 s), 70°C (30 s), noc (30 s); noc (5 min) and finally 4°C (10 min). Cape 2.2.2.4.7. Restriction endonuclease digestionof

All restriction enzymes and digestion buffers were obtained from Roche, Germany. DNA fragments and plasmids were digested using the following general protocol: Approximately 1.5 Ilg DNA was incubated in the presence of 2 III lOX Buffer B (100 mM Tris-Cl, 50 mM MgClz, 1 M NaCl, 10 mM 2-mercapto-ethanol pH 8.0), 2 U of each restriction enzymeUniversity (BamHI, EcoR! or XbaI) and Milli-Q water to a final volume of 20 Ill. Reactions were incubated for 3 hat 37°C and stopped with 5 III DNA-SAB. Agarose gel DNA standards were prepared in the same manner except 20 Ilg A phage DNA and 40 U enzymes were used.

2.2.2.4.8. Bacterial transformation

Eppendorf tubes (1.5 ml) containing ligation reactions were centrifuged briefly in a microcentrifuge and 2 III of each reaction mixture transferred to a fresh 1.5 ml Eppendorf Chapter 2 36

tube. Thawed E. coli DH5a competent cells (50 ~l) were transferred carefully to each tube, the tube gently flicked and incubated on ice for 30 min. Cells were heat shocked by incubation at 42°C for 45 s followed by incubation on ice for 2 min. An aliquot of 950 ~l 1.6 % (w/v) tryptone, 1 % (w/v) yeast extract, 0.5 % (w/v) NaCI growth medium was added to each tube and incubated for 2 h at 3rc. Cells were screened for successful transformation by plating 100 ~l aliquots on LB agar plates containing 0.1 mg/ml ampicillin, 0.5 mM 5-bromo-4-chloro-3-indolyl-~-0-galactoside (X-Gal, Bioline, USA) and 80 ~g/ml isopropyl-~-O-thiogalactopyranoside (IPTG, Bioline, USA).

2.2.2.4.9. Yeast transformation

Electro-competent yeast cells were prepared as follows: an overnight W303 wildtype yeast culture was diluted to an optical density at 600nm (OD600Town) of ca. 25 00 units/ml (ca. 2.5 x 108 cells/ml), harvested by centrifugation at 3000 x g for 10 min at 4°C, washed twice with ice-cold sterile water, washed twice with ice-cold 1 M sorbitol, and then resuspended in a minimal volume of ice-cold 1 MCape sorbitol. Then, 1 ~g DNA was added to 50 ~tl yeast cells and pulsed once for of5.1 ms on the SC2 setting using a Biorad Micropulser (Biorad, CA, USA). A 500 ~tl aliquot of ice-cold 1 M sorbitol was added immediately and the cells were plated on SC-URA medium containing 1 M sorbitol to select for positive transformants.

2.2.2.4.10. Ligation into pYES2 andfidelity testing University pYES2 is a 5.9 kb episomal shuttle vector designed for expreSSIOn of recombinant proteins in S. cerevisiae. The multiple cloning site (MCS) and other features are depicted in Figure 2.2.2.

PCR products and the p YES2 plasmid were digested with the appropriate restriction enzymes and gel purified to remove contaminating fragments. The following ligation conditions were used for production of p YES2-GFP2: To obtain a vector:insert ratio of

1:1 and a final DNA concentration of 1 pmol/~I, 39.1 ng pYES2 and 4.7 ng GFP2 was Chapter 2 37 mixed with 2 III 2X Rapid Ligation Buffer (60 mM Tris-Cl, 20 mM MgCh, 20 mM dithiothreitol (DTT), 2 mM adenosine triphosphate (ATP), 10 % (v/v) polyethylene glycol MWSOOO, Promega, USA), 3 U T4 DNA Ligase (Promega, USA) and Milli-Q water to a final volume of 10 Ill. The reaction was incubated at 4°C overnight and transfonned into E.coli DH5a competent cells. pYES2-HSPI2+PROM-GFP2 (p YH 12G2) was produced in a similar manner except that 43.S ng p YES2-GFP2 and 6.16 ng HSP 12+PROM was used. This product was transfonned into E. coli DH5a and extracted.

Town

,)naB I pYES2Cape 5.9kbof

Figure 2.2.2. Vector map of the pYES2 yeast shuttle vector depicting the multiple cloning site, ampicillin resistance and uracil biosynthesis (URA3) genes, replication origins (2 11 ori, f1 ori and pUC ori), tem1inatorUniversity (eYC]), T7 primer, the galactose promoter (PGALl) and various restriction digestion sites (Invitrogen).

The fidelity of the construct was verified by PCR using GFP2 forward and reverse primers or HSP 12 forward and reverse primers to verify the presence of GFP2 and HSP 12 respectively (Figure 2.2.3). The sequence of the construct was verified on a MegaBACE 500 DNA sequencer (Amersham Biosciences, UK) (data not shown) using the GAL] forward and reverse primers supplied with the p YES2 plasmid as per manufacturer's instructions. The construct was therefore deemed valid for insertion into yeast cells by transfonnation. Yeast cells were transfonned with the construct by Chapter 2 38 clcrtropmation and tran,formation verified by colony PCR (data not shown). For colon:~i

PCR, yeast cells were picked directly from freshly grown SC-URA plates and suspend~d in 100 fIl 0.2 % (wiv) SDS. Aller incuhation for 10 min at 95°C, 5 ~d wa~ u~ed il~ a template in PCR using lfSP12 forv'lard and en'2 reverse primers. The PCR reaction mixture contained 50 pmol forward prLm~r. 50 pmol rc,ww prim~r. 2 ,lLl 6.25 mM dNTPs.5 fll 25 mM MgCb. 5 fli 10 X Tay reaction huffer. 2 L' Taq polymera~e and

Milli-Q water to yield a final reaction volume 01'50 ~d . PCR conditions were as follows: 92"C (5 min): 5 cycles of92"C (30 s), 44"C (30 s). noc (30 s); 25 cycles of92"C (30 s),

6~ o C (30 s), noc (30 s): 72°C (5 min) and finally 4°C (10 min).

1 2 J 5 6 7 , GFP2 FPiRP HSPI2 FPiRP Town

Cape of

300

Figur" 2.2.3. ConfLn11ati{", of the fidelity of the p YH 12G2 pla'mid. T",o individual clcme., (A and R) containing putative pYHI2G2 were picked trOlH selectiv" "8o"r pl"tes, cultured. pl"smid D'\IA "xfmcted aoo5ubjecteJUniversity 10 PCR with citllCr GFP2 (tallC 1 _. 4) or HSP12 (Lalle 5 ·- 8) primer" L"ne 1: pYHl2G2 template A; Lane 2: pYHl2G2 t~mplate 13; Lane 3: Not~mplat"; Lane 4: pYES2-GFP2 template: Lane 5: pYHI2G2 template A: Lan" tic pYlI12G2 template R: Lane 7: 1\0 t"mplate: Lan¢ H: rGFM. T.IISP 12 template. Approx imate fragment ienglils (b"se pairs) are indicated on tfie lell

2.2.2.5. Cdl wall staining, c pi fluOl'cs~cn t and c"nfocal mic""s"OI'Y

Difli:r~ntial cell ,,~11 staining w~s perlormed by susp~nsicm of cell~ ('" 0.5 x 10' cells/ml) in 100 .ul of I mglml soilltion of Caicolluor Whit~ (Fluoresc~nt Brightener 28, F-354J·1 G, Sigma· Aldrich, USA) at RT for 10 min, Th,s stain binds to chitin (found onl} Chapter 2 39 in the cell wall of yeast) and fluoresces with similar excitation and emission wavelengths to Gfp2p.

Fluorescence and phase contract microscopy was performed using an Axiovert 200-m microscope (Zeiss, USA) equipped with a 1OO-fold magnification oil immersion objective lens. Fluorescence data were obtained using 488 nm excitation and 515 - 565 nm emission filters and captured using an Axiocam camera equipped with Axiovision 3.1 software. Optical sections (1 /-lm) were captured using the Z-stack module of the Axiovision software, and the images were deconvoluted using the 3-D deconvolution module. Confocal microscopy was performed at the University of the Orange Free State (UOFS), Bloemfontein, RSA using a Nikon TE-2000 confocal laser scanning microscope (Nikon, Japan) with the assistance of Prof. P.W.J. van Wyk. Town

Cape of

University Chapter 2 40

2.2.3. RFSl lLTS

2 . 2 .~.1. Cell wall protein extrarti{lll and analysis

Cell wall prowin' wcre cx!ractoo from stationary phasc yeast cdls using 0.61>'1 ~aOl ] and scparated by SDS-PAGE (Figure 2.2.4) ..~ large barld corresponding 10 J mo lecu lar weight of appro xu nat ely II k])a w~:; l1(lted (~I1UW).

s

115'" - -- Town "mD 112A " - • - Cape

Fil!U'C 2.2,.l, SDS-l'N:iE of pr,>4cms c., I",cl",1of Mlh 0,6 M NJOH fu)m ",hole y ~ ast cei l> , Th~ bund Corr ~ 'p

This b~rId was cxcised and ,ubj ected to in-gel trypti c dige,ti on and peptide fingerprinting using MALDI-TOFUniversity m~" 'l""clrometry i11C trypTlC fragment peaks werc 3n~lysed using

Pcptillcnt (hltr :l/ www.exp~sy.ch / t()o l :; /pept i dem . httnj) which confimlCcl that lhe band corresponded to IIsp12p, The pepuoc mJ-SCs ()bt~ined ii-om MA.I.Ol-TOF are pre:;emed

III T~hle 2.2. 1. Chapter 2 41

Table 2.2.1. Peptide masses of the predominant 0.6 M NaOH extractable protein band digested with trypsin and subjected to MALDI-TOF mass spectrometry. Peaks not present (X) in Hsp12p were from trypsin, which digests itself during the digestion reaction.

Mass (Da) Presence in Hsp 12 805.7594 X 827.6368 ./ 849.527 ./ 1059.664 ./ 1140.249 ./ 1175.255 ./ 1223.244 ./ 1273.976 ./ 1297.448 ./ 1314.939 ./ 1438.48 ./ 1501.445 ./ Town 1531.938 ./ 1561.46 ./ 1601.676 ./ 1746.323 Cape./ 1784.302 ./ 1845.984 of ./ 1887.962 ./ 1941.41 ./ 2009.966 ./ 2083.552 ./ 2162.563 X 2201.232 ./ 2276.541 X University2353.591 ./ 2412.908 ./ 2464.507 ./ 2530.556 ./ 2569.614 ./ 2614.217 ./ 2647.797 ./ 2722.394 ./ 2800.927 X 3000.932 ./ Chapter 2 42

The gel was repeated and subjected to western blotting using the anti-Hspl2p antibody. Unfortunately, the antibody was not of good quality and displayed cross-reactivity by displaying an affinity for Hsp 12p as well as two other proteins (data not shown).

2.2.3.2. Expression and visualisation of the Hsp12-Gfp2p fusion protein

Yeast cells containing pYH12G2 were grown in YEPD for approximately 6 h till the culture had attained an optical density of approximately 0.3 ODU/ml. No green fluorescent protein (GFP) fluorescence was observed when exponentially growing yeast cells, grown in glucose-containing medium, were examined using an epifluorescent microscope. This agrees with previous studies that expression of HSP 12 is suppressed by even small quantities of glucose in the growth medium (de Groot et al., 2000). Continued growth into the stationary phase (ca. 5 ODU/ml) resultedTown in the yeast appearing fluorescent (Figure 2.2.6 B). All the yeast cells appeared to fluoresce to approximately the same extent, suggesting that HSP 12 was uniformly induced under these conditions.

The HSP12-GFP2 fusion protein product (HspI2-Gfp2p)Cape was localized throughout the yeast cell, except in the dark region in theof centre of the cell. This was assumed to be a vacuole because an outline was visible under phase contrast microscopy (Figure 2.2.6 A). Yeast ade2 cells grown under adenine-limiting conditions are known to accumulate a pink pigment in the vacuole (Weisman et al., 1987). This pigment coincidentally fluoresces with similar excitation and emission maxima to Gfp2p, allowing the use of the same filter set on the fluorescence microscope. Examination of yeast cells containing pYH12G2 grown Universityunder adenine-limiting conditions displayed fluorescence throughout the cell (Figure 2.2.6 C). Thus the dark region in the centre of the yeast cell was indeed the central vacuole and Hspl2-Gfp2p was present throughout the remainder of the cell. Chapt.,,- 2 4J

Figure 2,2,6, The Hsp 12-Gfp2p f"sion protein is localized to the cytoplasm, the cell wall, and (he tonoplast of (he yeast cell. Pha", contra,( microscopy (A) and corresponding cpin"o,"sc,ncc microscopy (Il-D). Th e large nonnUO,.",cen( region in the ~",l(rc of the cdl (R) is (he .'acuok In (C), tn, va<;U

Previous srndics haw

2.2.4. DISCUSSION

A host of proteins in the yeast cell have recently been discovered in the cell wall. These proteins, including metabolic enzymes such as enolase (Pardo et al., 1999) and phosphoglycerate mutase (Motshwene et al., 2003), have no apparent cell wall localization sequences and the mechanism of translocation and indeed the function of these proteins in this locus remains a mystery. One possible explanation is that during periods of stress, the yeast cell must rapidly remodel its cell wall (Firon et al., 2004) to accommodate for changes in cell volume and membrane fluidity. This is achieved by energy-dependent vesicular transport of cell wall supporting enzymes such as p-glucan synthases and chitin synthases. Thus, metabolic enzymes may produce the energy needed for these processes. Town The presence of Hsp12p and Hsp26p (van Rooyen, 1., unpublished data) in the cell wall is peculiar. These proteins possess no known targeting sequences but are produced in the cell wall in abundance during stressful conditions.Cape However, other proteins possessing no signal sequence have been reported to exit the yeast cell via non-classical protein export pathways (Cleves et al., 1996). of

The fact that Hsp 12p is extractable by p-elimination using NaOH indicates that the protein is attached either via a strong alkali-labile linkage or is simply free in the periplasmic space. Confocal microscopy revealed that Hsp12-Gfp2p is strongly expressed throughout the cytoplasmUniversity and near the tonoplast but not in the cell wall, although it can be argued that this is due to Gfp2p interfering with Hsp 12p targeting either sterically (Gfp2p is three times larger than Hsp 12p) or by Gfp2p blocking unknown targeting sequences. This may also explain the findings obtained in the S. cerevisiae protein localization project (Huh et al., 2003) where Hsp12p is described as possessing a cytoplasmic locus. Indeed these authors also found that several other known cell wall proteins were not localized to the cell wall. Chapter 2 45

2.3. APPLICATIONS OF YEAST CELLS EXPRESSING FLUORESCENT HSP12P

2.3.1. INTRODUCTION

S. cerevisiae is an essential industrial organism used in the baking industry as well as for many fermentative and biotechnological applications. This yeast is often subjected to a variety of stressful conditions during these processes, which may adversely affect the final industrial product. As an example, during the brewing process the yeast is subjected to stresses including osmotic, temperature and mechanical as well as to increasing concentrations of ethanol as fermentation progresses. Currently brewers assess the number of fermentatively active yeast cells by determining the viability of the cells using methylene blue exclusion. Since this method has been reported to both under- and over­ represent the number of cells present, flow cytometric methodsTown have been recently introduced to more accurately evaluate the number of viable cells present in a culture (Boyd et aI., 2003). Since viability is not an indicator of fermentative capacity and since yeast is used reiteratively in the brewing process,Cape the brewing industry requires a method to relate the stress status of the yeast to the fermentative capacity. This will allow industrial applications to be tailored to minimallyof stress the yeast whilst still allowing optimal output.

The synthesis of Hsp 12p is induced by a wide variety of stresses including high osmolarity, oxidative stress, heat shock, the presence of ethanol, nutrient limitation by growth on non-fermentableUniversity carbon sources and by agents affecting cell wall integrity (Praekelt and Meacock, 1990; Gupta et aI., 1994; Varela et aI., 1995; Siderius et al., 1997; Mtwisha et al., 1998; Sales et al., 2000; Garcia et aI., 2004). The HSP12 promoter region contains numerous known stress-related response elements within 700 bp of the start of transcription, thus emphasising the importance of this gene in the stress response of S. cerevisiae (Chapter 1, section 1.2.1). It is therefore not surprising that HSP 12 expression was one marker used to analyse the stress resistance of commercial wine yeast strains (Carrasco et aI., 2001). Analysis of gene expression is widely used as a determinant of changes that occur due to changes in, for example, growth conditions. Chapter 2 46

Such analyses assume that the corresponding protein synthesis occurs, although it has been documented that this is not always the case (Gygi ct a!., 1999; Li ct a!., 2003). Additionally it has been shown that yeast grown continually at elevated temperature have decreased Hsp 12p present (Mtwisha ct a!., 1998) despite evidence that HSP 12 expression is up-regulated after heat shock (Praekelt and Meacock, 1990).

Experiments were thus performed to ascertain whether fluorescent Hsp12p might be a good indicator of yeast stress. Such a fluorescent protein would not only reassure the investigator that protein synthesis had indeed occurred but determining the fluorescence of a yeast culture would be a far simpler, quicker and cheaper methodology than either northern blotting or flow cytometry. A fusion protein was constructed by fusing the green fluorescent protein (GFP2) gene downstream and in-frame to that of HSP12 and using the HSP 12 promoter to drive synthesis of this construct. TownIt was found that yeast containing this plasmid were not fluorescent when grown on media containing glucose but responded to a variety of stresses by exhibiting significant fluorescence, which could readily be quantified. Cape of

University Chapter 2 47

2.3.2. MATERIALS AND METHODS

2.3.2.1. Materials

Materials for the production, selection and growth of the yeast cells expressing Hsp 12- Gfp2p fusion proteins (pYH12G2 cells) are detailed in section 2.2. All chemicals used were of high purity and water was deionised and distilled.

2.3.2.2. Organisms and culture conditions

The yeast strain containing the pYH12G2 plasmid expressmg Hsp12-Gfp2p was constructed as described in section 2.2.2.4. Yeast cells were cultured as previously described in section 2.2.2.2. Town

2.3.2.3. Stress assays and fluorimetry Cape Yeast cells containing pYH12G2 were grown in YEPD at 30°C to early log phase (0.3 - 0.5 ODU/ml). For stress studies, cells wereof subjected to various stresses by adding the stressing agent (NaCl, ethanol or mannitol) directly to the culture after which samples were taken after various times. In the case of temperature shock, cells were shifted to 3rC for heat shock or 4c C for cold shock. In a typical assay, 500 ).11 of culture was transferred to a 1.5 ml Eppendorf tube at each timepoint, the cells pelleted by centrifugation in aUniversity microcentrifuge for 5 seconds, the cell pellets snap-frozen in liquid nitrogen and stored at -20°C. Once all samples were collected, frozen cell pellets were resuspended in 1 ml PBS and the fluorescence was measured using an Aminco SPF-500 fluorimeter (American Instrument Company, USA) using an excitation wavelength of 450nm and an emission wavelength of 507 nm (Cormack et aI., 1996). The A(,oo was detell11ined using a Shimadzu UV -2201 spectrophotometer (Shimadzu Corporation, Japan). Chapter 2 48

2.3.3. RESULTS

2.3.3.1. Salt induces HSP12 in a concentration-dependent manner

Yeast cells harbouring the p YH 12G2 plasmid were grown to early log phase in YEPD medium, at which time various concentrations of salt were added. Cells were removed after 40, 60 and 80 minutes and the relative fluorescence determined (Figure 2.3.1). Whereas no fluorescence was observed if salt was omitted from the growth medium, the presence of 200 mM salt resulted in noticeable fluorescence after 40 min. No change in the fluorescence was observed after 60 min growth and a decreased fluorescence was observed after 80 min growth. When the NaCI concentration was increased to 400 mM, the fluorescence observed after 40 min increased to approximately 150 (Yo of that observed with 200 mM salt. In addition, the fluorescence continuedTown to increase, with the fluorescence observed after 60 min being approximately 30 % greater than that observed after 40 min and approximately double that observed in the presence of 200 mM NaCI after 60 minutes. The fluorescence observed at Cape60 min was the maximum fluorescence observed, with a slight decrease found after 80 min growth. In contrast, the presence of 800 mM salt resulted in a slight increasedof fluorescence only after 80 min growth. Interpretation of this data is that the presence of salt in the medium resulted in the production of Hsp 12-Gfp2p despite the presence of glucose. The amount of Hsp 12-Gfp2p synthesised reflected the stress that the yeast were subjected to, up to 400 mM salt.

2.3.3.2. Osmotic shockUniversity and ethanol stress induce HSP12

Yeast containing the p YH12G2 plasmid were grown to early log phase, at which time 800 mM mannitol was added to the medium. This concentration was chosen as it resulted in the same increase in medium osmolality as the addition of 400 mM NaCI. Cells were removed at various times and the relative fluorescence determined (Figure 2.3.2). The timing of the response of these yeast cells to mannitol appeared very similar to that seen when the medium osmolality was increased by the addition of 400 mM NaCI with a peak after 65 min and a slight decrease thereafter. Chapter 2 49

J!l 0.9 ·c ::J 0.8 ~ ~ 0.7 :.c ~ 06 /l) g 0.5 /l) o

(; ~l!l 0.40.3 /l) ~~~======t===:t===: ~ 0.2 Qj 0:: 0.1 o o 20 40 60 80 Time (mins) Town

Figure 2.3.l. Various concentrations ofNaCI were added to exponentially growing yeast cells and the fluorescence detem1ined at various times thereafter. Control (YEPD only): e; 200 mM NaCI: 0: 400 mM NaCI: .A.; 800 mM NaCI: o. The data shown are the means and standard deviations from three separate experiments. Error bars not visibleCape are within the data points.

Previous studies have shown that the presenceof of 5 % ethanol in the growth medium resulted in the induction of Hsp 12p and that Hsp 12p protected the yeast cell against the deleterious effects of ethanol (Sales et aI., 2000). To investigate the effect of ethanol on Hsp 12p synthesis, yeast cells containing the p YH 12G2 plasmid were grown to mid-log phase (ca. 0.5 ODU/ml), at which time 7 % v/v ethanol was added to the medium. This concentration was Universitychosen since this concentration was used by another study which investigated the global gene response of S. cerevisiae to ethanol (Alexandre et al., 2001). The kinetics of the response to ethanol was markedly different to those observed for NaCI and mannitol, with fluorescence only observed after 50 min incubation; thereafter the fluorescence continued to increase throughout the duration of the experiment (Figure 2.3.2). Chapter 2 50

0.9 ·cJ!l ::::l 0.8 ~ ~ 0.7 :e 0.6 ~

0 0 20 40 60 80 Time (mins) Town Figure 2.3.2.7 % ethanol (0) or 800 mM mannitol ( .. ) was added to exponentially growing yeast cells and the fluorescence determined at various times thereafter. Control (YEPD only): e. The response to 400 mM NaCl (0) is shown for comparison since 800 mM mannitol imparts an equivalent increased osmolality to 400 111M NaCI. The data shown are the means and standard deviations from three separate experiments. Cape 2.3.3.3. Heat shock but not cold stress inducesof Hsp12p synthesis

Yeast containing the pYH12G2 plasmid were grown to early log phase at 30DC before the growth temperature was changed to 37"C. This heat shock resulted in a fluorescent response with a magnitude similar to that seen with 200 mM NaCI (Figure 2.3.3). In contrast, changing the temperature to 4°C resulted in little fluorescence being observed (Figure 2.3.3). University Chapter 2 51

0.7

'iil 'E 0.6 ::> ~ 0.5 :e~ ~ OA Q) o c Q) ~ 0.3 Q) (; ::::I ;;::: 0.2 Q) :;::;> ~ 0.1 0:: o o 20 40 60 80 Time (mins)

Figure 2.3.3. The growth temperature (30°C) of exponentially growingTown yeast cells was changed to either 37°C (D) or to 4 °C ( .. ) and the fluorescence determined at various times thereafter. Control (continued growth at 30°C): e. The data shown are the means and standard deviations from three separate experiments. Error bars not visible are within the data points. Cape of

University Chapter 2 52

2.3.4. DISCUSSION

Yeast containing the p YH 12G2 plasmid grew with a normal appearance and at the same rate as yeast without this plasmid. No GFP fluorescence was observed when exponentially growing yeast grown in glucose-containing medium were examined using a fluorescence microscope. This agrees with previous studies that expression of the HSP 12 gene is suppressed by even small quantities of glucose in the growth medium (de Groot et al., 2000). Continued growth into stationary phase resulted in the yeast appearing fluorescent, which was due to HSP 12 induction upon entry into stationary phase (Varela et a/. , 1995). All the yeast cells appeared to fluoresce to approximately the same extent, suggesting that the HSP 12 gene was uniformly induced under stressful conditions.

Upon salt stress, yeast cells activate the High Osmolarity GlycerolTown (HOG) pathway, which acts to synthesize glycerol and stress-responsive proteins to alleviate the symptoms of this stress (Brewster et al., 1993). When cells containing pYH12G2 were stressed with various concentrations of salt, Hsp 12-Gfp2p wasCape expressed in a dose-dependent manner analogous to native Hsp 12p and could be used as a marker to quantify the extent of induction of stress-responsive proteins andof hence the stress status of the cell. The anomalous result after the addition of 800 mM salt was attributed to the fact that such a severe stress either inhibited the yeast transcriptional and translational machinery or that the transcriptional and translational machinery was dedicated to systems involved in Na + efflux, such as the Ca2+/calmodulin-dependent phosphoprotein phosphatase (calcineurin) pathway (Hirata et Universityat., 1995).

Previous studies have shown that the presence of 800 mM mannitol in the growth medium results in the additional induction of HSP12 during early (and late) stationary phase (Mtwisha et al.. 1998). The magnitude of the mannitol response was slightly lower than that with NaCI suggesting that NaCI triggered expression of HSP 12 by mechanisms in addition to the HOG pathway, such as the cell integrity pathway (Garcia et aI., 2004). Chapter 2 53

The mechanism of induction of Hsp 12p by ethanol was clearly different to that by osmolytes. It has been shown that one effect of ethanol on yeast cells is that there is a change in the lipid composition (Gupta et aI., 1994) and it has been postulated that the resultant change in membrane fluidity somehow triggers expression of HSP 12 (Piper, 1995) since heat shock, which also causes increased membrane fluidity, is a potent stimulant of HSP 12 expression (Praekelt and Meacock, 1990).

Finally, when yeast cells were exposed to heat stress, HSP 12 was again induced, but to a lesser extent than salt stress. Interestingly, despite several reports that HSP 12 is induced by cold stress (Rodriguez-Vargas et aI., 2002; Sahara et aI., 2002; Kandror et al., 2004), very little fluorescence was detected in these experiments, but it should be noted that induction of cold-responsive genes often takes several hours (Kandror et aI., 2004). Town In slmunary, the construct presented here, a fusion protein between the stress response protein Hsp 12p and the fluorescent indicator protein Gfp2p, allowed quantification of the response of S. cerevisiae to a variety of differentCape forms of stress typically encountered both in an industrial and a laboratory environment. In addition, this construct allowed conclusions to be drawn regarding the regulatoryof mechanisms of HSP 12, since relative fluorescence indicated the extent of regulation of HSP 12 in response to various stress conditions. Thus HSP 12 was induced most strongly following salt stress, followed by general hyper-osmotic shock, ethanol, heat and cold shock. This correlates well with assumptions made in Chapter 1, section 1.2.5, where salt stress was postulated to act via other pathways in additionUniversity to the HOG pathway.

It is envisaged that this fluorescent construct will be useful to allow processes to be adapted to result in the minimal stress to the yeast whilst allowing maximum output. This will be of particular importance for processes that use the yeast preparation reiteratively. Chapter 3 54

CHAPTER 3 THE FUNCTION OF HSP12P

3.1. SUMMARY 56

3.2. HSP12P ENHANCES THE ADAPTATION OF YEAST CELLS IN 59 RESPONSE TO CELL WALL DAMAGE BY CONGO RED (CR) AND IMPAIRS THE FLOCCULATION OF YEAST CELLS

3.2.1. INTRODUCTION 59

3.2.2. MATERIALS AND METHODS 62

3.2.2.1. MATERIALS 62

3.2.2.2. ORGANISMS AND CULTURE CONDITIONS 62

3.2.2.3. CONGO RED (CR) ASSAYS 62 3.2.2.3.1. MORPHOLOGY, VIABILITY AND FLOCCULATIONTown 62 3.2.2.3.2. INV ASIVE GROWTH 63 3.2.2.3.3. IN VITRO CHITIN BINDING 64 3.2.2.4. PIR PROTEIN ANALYSIS Cape 64 3.2.2.5. QUANTIFICATION OF FLOCCULIN REGULATION 65 3.2.2.5.1. OUTLINE of 65 3.2.2.5.2. PRIMER DESIGN 65 3.2.2.5.3. RNA EXTRACTION AND CDNA SYNTHESIS 66 3.2.2.5.4. REALTIME QUANTITATIVE PCR (qPCR) 68

3.2.3. RESULTS 69

3.2.3.1. EFFECTS OF CR 69 3.2.3.1.1. VIABILITY 69 3.2.3.1.2. MORPHOLOGYUniversity AND FLOCCULATION 70 3.2.3.1.3. INVASION 73 3.2.3.1.4. CHITIN INTERACTION 76

3.2.3.2. PIR PROTEINS 76

3.2.3.3. FLOCCULINS 77

3.2.4. DISCUSSION 79 Chapter 3 55

3.3. HSPJ2P INCREASES THE FLEXIBILITY OF THE YEAST CELL 81 WALL IN RESPONSE TO STRESS: AN AGAROSE MODEL- BASED APPROACH

3.3.1. INTRODUCTION 81

3.3.2. MATERIALS AND METHODS 83

3.3.2.1. MATERIALS 83

3.3.2.2. GELATION TEMPERATURE AND GEL STRENGTH ASSAYS 83

3.3.3. RESULTS 85

3.3.4. DISCUSSION 90

3.4. INVESTIGATION INTO THE EFFECTS OF HSP12P ON CELL 93 WALL PARAMETERS BY DIRECT MEASUREMENTS ON LIVE YEAST CELLS Town

3.4.1. INTRODUCTION 93 3.4.2. MATERIALS AND METHODS Cape 95 3.4.2.1. MATERIALS of 95 3.4.2.2. ORGANISMS AND CULTURE CONDITIONS 95

3.4.2.3. ATOMIC FORCE MICROSCOPY 95

3.4.2.4. ELECTROPHORETIC MOBILITY ASSAYS 96

3.4.2.5. INFRARED SPECTROSCOPY 97

3.4.3. RESUL TS University 99

3.4.3.1. A TOMIC FORCE MICROSCOPY 99

3.4.3.2. ELECTROPHORETIC MOBILITY ASSAYS 101

3.4.3.3. INFRARED SPECTROSCOPY 104

3.4.4. DISCUSSION 106

3.5. GENERAL DISCUSSION 107 Chapter 3 56

3.1. SUMMARY

The expression of Hsp 12p under stressful conditions and the localization of this protein in the yeast cell wall prompted investigations into whether Hsp 12p was responsible for cell wall adaptations and integrity in response to stress conditions. Yeast cells were treated with the cell wall damaging agent, Congo Red (CR), and assayed for changes in viability and morphology. CR affected the cells dramatically and to determine whether Hsp12p was involved in these differences, yeast cells lacking Hsp12p (the hsp1211URA3 / knockout / KO strain) were exposed to similar conditions and assayed. The KO strain displayed an increased sensitivity to CR. In addition, only the WT strain displayed dimorphic growth (invasive growth) when grown for prolonged periods on CR­ supplemented agar plates. The morphology and nature of invasive growth was investigated, since the W303 yeast strain does not normally exhibitTown this property. Cells under the agar surface were examined microscopically and found to form clumps and prolate spheroids. Restoration of invasive growth in W303 by CR was attributed to the fomlation of cellular chains, which allowed agarCape penetration, sub-surface cell division, water depletion, cracking of the agar and spheroid formation. CR also affected the aggregation of cells and resulted in flocculationof solely in KO cells, implicating Hsp 12p in the prevention of cell aggregation. Furthermore, KO cells displayed a marked increase in clumping, even in the absence of CR. Since clump formation resulted in flocculation, settling experiments were conducted to quantify these observations. Stationary phase KO cells settled faster than WT cells, implicating Hsp12p in the flocculation process. Hsp12p may have mediatedUniversity these effects by altering cell surface hydrophobicity, a factor affecting flocculation, due to its high hydrophilic amino acid content (Chapter 1, section 1.1.2). Hydrophobicity was thus compared in the WT and KO strains, but was not markedly different in the two strains. This implied a different mechanism whereby Hsp 12p affected flocculation, which possibly involved alteration of the cell wall chitin content. Furthermore, Hsp 12p inhibited CR binding to chitin ill vitro, suggesting that Hsp 12p may act as a chitin protectant. Chapter 3 57

The Hsp12p and CR-dependent invasion and flocculation may also have been due to restoration of function of flocculin activity in W303, which cannot normally induce Flo 11 p expression due to a lack of the Fl08p transcription factor (Liu et al., 1996). The regulation of the flocculins, FL01, FL05, FL08, FL09 and FLOIl was therefore investigated by real-time quantitative polymerase chain reaction (qPCR), but results indicated that flocculin expression was not restored in either strain. Thus CR acted independently of flocculins on yeast cell division to stimulate invasion and flocculation.

These phenotypes (cellular aggregation and sensitivity to CR) were similar to those observed for cells lacking cell wall-localised PIR proteins (proteins with inverted repeats). These proteins, like Hspl2p, were alkali-extractable and possessed no known function. The WT and KO strains were thus tested for differences in the expression of these PIR proteins by biotinylation and mild alkaline extraction,Town but no difference was observed.

Motshwene et al. showed that Hsp 12p was requiredCape to enhance the barotolerance of yeast cells, possibly by increasing cell wall flexibility (Motshwene et aI., 2004). This hypothesis was tested by employing agaroseof as a model system for the yeast cell wall. Studies on this polymer indicated that various stresses, including salt and alcohols, hardened the agarose matrix, whereas Hsp 12p softened it.

The effects of Hsp12p on cell wall properties were ascertained for live yeast cells using Atomic Force MicroscopyUniversity (AFM). AFM measurements confirmed that Hsp12p played a role in promoting cell wall flexibility. Further studies of the permeability of WT and KO cells by electrophoretic mobility assays revealed that KO cells were slightly more permeable and exhibited impaired mobility, possibly due to an increase in cell wall stiffness. Furthermore, the KO strain had altered cell wall chemistry, as revealed by infrared spectroscopy, with lowered levels of phosphorylated peptidomannans and glucans. These differences were possibly due to decreased cell wall flexibility. Chapter 3 58

In summary, the results suggest that Hsp 12p may function in the cell wall as: • A protectant, by shielding chitin from cell wall damaging agents such as CR which allows invasive growth and viability. • A plasticizer to maintain cell wall flexibility, which is required for the control of calcium flux and consequently the amount of polysaccharides in the cell wall.

Town

Cape of

University Chapter 3 59

3.2. HSP12P ENHANCES THE ADAPTATION OF YEAST CELLS IN RESPONSE TO CELL WALL DAMAGE BY CONGO RED (CR) AND IMPAIRS THE FLOCCULATION OF YEAST CELLS

3.2.1. INTRODUCTION

Under favourable growth conditions, cells of the budding yeast Saccharomyces cerevisiae exist predominantly in the unicellular "globular" form (Kron et aI., 1997). However, when cells are exposed to a variety of stressful conditions including nutrient limitation, mild heat shock, osmotic stress, the presence of aliphatic alcohols, cell wall damaging agents or an increase in the extracellular cAMP concentration, certain strains of yeast undergo a morphological transition (Gimeno et al., 1992; Zaragoza and Gancedo, 2000). The type of transition is determined by the ploidy of the yeast cell.Town Pseudohyphal growth occurs during nitrogen-limiting conditions in diploid cells. The cells elongate, bud in a unipolar fashion, do not separate and appear as chains of multinucleated hyphal structures. In contrast, haploid cells display invasiveCape growth when cultured for extended periods on nutrient rich agar plates. Invasive growth is similar to pseudohyphal growth, but elongation is not as pronounced andof multinucleated structures are not observed (Gimeno et aI., 1992; Roberts and Fink, 1994). Many laboratory strains, including the commonly used W303 strain, have been selected for their inability to flocculate and invade nutrient rich agar plates (Liu et aI., 1996). The inability to undergo these adaptations has been ascribed to a lack of flocculin function, particularly Flo 11 p. Flo 11 P is involved in morphologicalUniversity adaptations and calcium-dependent cell-cell adhesion in response to nutrient deprivation (Lo and Dranginis, 1996).

Invasive growth has been reported to occur after addition of the dye, Congo Red (3,3'­ [[ 1,1' -biphenyl]-4,4'-diylbis(azo )]-bis[ 4-amino-l-naphtalenesulfonic acid] disodium salt), even in strains such as W303 not normally associated with this form of growth (Zaragoza and Gancedo, 2000). This dye interferes with cell wall assembly and cell separation by complexing with chitin (poly-N-acetyl-D-glucosamine) present in the cell walls of yeast (Pancaldi et aI., 1985; Vannini et aI., 1985; Kopecka and Gabriel, 1992). Electron Chapter 3 60 diffraction studies have demonstrated an interaction between CR and newly synthesised chitin ill vitro (Bartnicki-Garcia et al., 1994). Chitin, an important constituent of the yeast cell wall, is found in small amounts dispersed over the entire cell periphery in normally growing unbudded yeast cells (Molano et al., 1980). Chitin is the primary component of the primary septum, a stabilising ring which facilitates cytokinesis during the budding process (Cabib, 1981). Chitin is thus essential for cell separation (Bulawa, 1993; Cabib et al., 2001). Furthermore, chitin appears to act as a compensatory element for cell wall integrity, since chitin levels are enhanced in response to cell integrity stress and in cell wall mutants (Popolo et aI., 1997; Dallies et aI., 1998; Ram et al., 1998). These mutants include those lacking glucan synthase (Fks 1p) activity and gas 111 mutants, which cannot insert ~-1 ,3-glucans into the cell wall but instead secrete this compound into the medium (Ram et al., 1998). Town A recent microarray study showed that incubation of yeast cells with CR or Zymolyase resulted in the induction of numerous genes including HSP 12. These authors did not detect any difference in sensitivity to CR betweenCape the BY4741 strain used and an hsp1211 mutant of this strain (Garcia et al., 2004). However, Motshwene et al. found that W303 KO cells were more sensitive to CR (Motshweneof et al., 2004). The genetic background of the yeast strain used is thus of paramount importance for the display of phenotypes due to certain mutations, as has been noted by other authors (Rondon et al., 2003).

Flocculation is the process whereby yeast cells aggregate into clumps (flocs) and sediment (lager yeasts)University or rise (ale yeasts) out of solution (Verstrepen et al., 2003). This process is exploited in the brewing industry to allow for the rapid separation and re-use of yeast cells in the fermentation process. Flocculation is governed by the presence of proteins known as tlocculins, which are activated by calcium and bind mannose residues in other cells (Bony et al., 1997). Two types of flocculation have been identified, dependent on the specificity for mannose residues. NewFlo type flocculation is inhibited by the presence of glucose, maltose, mannose and sucrose whereas Flo 1 type flocculation is inhibited only by mannose (Stratford and Assinder, 1991). Most laboratory strains, including W303, tend not to flocculate due to lack of flocculin induction by the Fl08p Chapter 3 61 transcription factor (Sieiro et al., 1995; Liu et aI., 1996). Besides flocculin-mannose interactions, flocculation is dependent on physical interactions between cells. This includes the frequency of collisions between celis, the hydrophobicity and the number of negatively charged groups in the cell wall (Stratford, 1992). Yeast cell texture also appears to playa role, since older cells often have a rougher surface texture, facilitating adherence and settling faster than younger cells (Barker and Smart, 1996). Furthermore, pH, temperature and ethanol content influence flocculation, presumably by alteration of cell surface charge, flocculin conformation or flocculin expression (Jin and Speers, 2000, Jin et aI., 2001). These parameters are, however, strain specific (Jin and Speers, 2000). Flocculation is typically initiated during stationary phase, when nutrients are limited (Stratford, 1992). This process appears to be dependent on oxygen content, since poorly aerated cultures display early, incomplete flocculation, while normal aeration results in delayed, strong flocculation. Addition of oleic acid or ergosterolTown to poorly aerated cultures, however, restores normal flocculation ability, indicating that oxygen may act indirectly by regulating unsaturated fatty acid and sterol synthesis (Straver et aI., 1993). Cape of

University Chapter 3 62

3.2.2. MATERIALS AND METHODS

3.2.2.1. Materials

Yeast extract, peptone, tryptone and bacteriological agar for growth media were supplied by Biolabs (RSA). All other chemicals used were of high purity. Double distilled water was used for all experiments except for PCR and Realtime PCR reactions, where double distilled water filtered through a Milli-Q filtration apparatus (Millipore, USA) was used.

3.2.2.2. Organisms and culture conditions

The S. cerevisiae yeast strains used were from the W303 background (a/a, ade2-1/ade2- I, trp1-1/trpl-1, leu2-3/1eu2-112, his3-11/his3-15, ura3/ura3, canrl-JOO/CAN)Town and were used in the haploid form. Yeast strains were kind gifts from Dr P. Meacock, University of Leicester, Leicester, U.K (wildtype, WT and h.sp12L1 URA3, knockout, KO). The KO strain was constructed and tested as described (PraekeltCape and Meacock, 1990). Yeast cells were routinely grown in 1 % (w/v) yeast extract, 2 % (w/v) peptone, 2 % (w/v) glucose (YEPD) media at 30°C on a rotary shaker ofat ca. 200 rpm. For solid media (plates), agar was added to a final concentration of 1.5 % (w/v). Yeast growth was monitored by measurement of the optical density of the culture at 600nm and expressed in optical density units (ODU)/ml.

3.2.2.3. Congo RedUniversity (CR) assays

3.2.2.3.1. MOIphology, viability (lndjloccuiation

A 1 ml aliquot from an overnight culture of WT or KO yeast cells was inoculated into 50 ml fresh YEPD medium and allowed to grow to mid-exponential phase (0.5 - 0.6 ODU/ml). Cell viability was determined by spotting 10 /-11 volumes of 10-fold serial dilutions onto YEPD agar plates containing 0.01, 0.02 and 0.03 mg/ml CR (BDH Laboratory Supplies, England). The plates were inspected and photographed after growth Chapter 3 63 at 30°C for 2 days. For morphology studies, CR was added to mid-exponential phase cells to a final concentration of 0.01,0.02, O.OS, 0.1, 0.2 or 0.3 mg/ml which were then allowed to grow at 30D C for a further 20 h. Cells were then examined using an Olympus CK40-F200 microscope (Olympus Optical Co., Japan). CR-dependent flocculation was quantified by transferring 1 ml culture to a 3 ml spectrophotometric cuvette, vigorously shaking and then allowing the cells to settle whilst measuring the decrease in solution turbidity over time using a Beckman DU-6S0 Spectrophotometer (Beckman, CA, USA) at 600 nm. CR-independent flocculation was determined by transferring S ml of an overnight culture of WT or KO cells to a glass test tube (13 x 100 mm) and vortexing. Cultures were then allowed to settle and photographed at various time intervals. Flocculation rate, which resulted in a gradual decline of the turbidity of the solution, was detern1ined by measuring the rate of change of the cleared height of the cells in solution. Spectrophotometry was not used as for CR-dependent flocculationTown experiments since yeast cells sedimented ca. 12X slower and the clear region was above the incident beam of the spectrophotometer. The contribution of hydrophobicity to CR-independent flocculation behaviour was quantified as describedCape (Reynolds and Fink, 2001). Briefly, WT or KO cells were grown in YEPD to mid-exponential phase, washed once in water, and resuspended in 1 % (w/v) yeast extract,of 2 % (w/v) peptone, 0.1 % (w/v) glucose to a concentration of ca. O.S ODU/ml. Cells were incubated at RT for 3 h after which the

00600 was measured. A 1.2 ml aliquot of the culture was transferred to a borosilicate glass test tube (13 mm X 100 mm), 600 III octane added and the tube vortexed for 3 min.

Aqueous and organic phases were allowed to separate, the 00600 of the aqueous layer measured and comparedUniversity to the initial OD600 before octane addition.

3.2.2.3.2. Invasive growth

A 10 ~tl aliquot of mid-exponential phase cultures of WT or KO cells in YEPD medium was spotted onto YEPD plates with or without a sublethal dose of CR (0.02 mg/ml). The plates were incubated for up to 6 days at 30°C; non-invasive colonies were removed under running water whilst rubbing the surface with a latex rubber gloved finger (Zaragoza and Gancedo, 2000). Plates were photographed before and after washing. Chapter 3 64

Since abnonnal structures and growth were observed when invasive yeast cells were observed microscopically, yeast cells were examined using confocal microscopy. The experiment was therefore repeated using a yeast strain containing the fluorescent Hsp12p construct (p YH 12G2) produced as outlined in Chapter 2. This provided fluorescence to allow for 3-D imaging using a Nikon TE-2000 confocal laser scanning mIcroscope (Nikon, Japan), since Hspl2p-Gfp2p was induced in response to CR.

3.2.2.3.3. In vitro chitin binding

The in vitro interaction between Hsp12p and chitin was investigated by suspending crab shell chitin (C-9213, Sigma-Aldrich, USA) at a final concentration of 15 mg/ml in distilled water together with purified Hsp12p up to a final concentration of 2.5 mg/ml at RT. CR solution (final concentration 5 Ilg/ml) was added after 5Town min and after a further 5 min, the suspension was centrifuged (12000 x g, 5 min) and the absorbance of the supernatant at 500 nm detennined. Cape 3.2.2.4. PIR protein analysis of The clumping and CR sensitivity phenotypes observed were similar to those observed in cells lacking the cell wall-localised PIR proteins, Ccw5p, Ccw6p, Ccw7p and Ccw8p. These PIR proteins, members of a family of proteins containing one or more internal repeats and an N-tenninal signal peptide, have unknown functions (Toh-E et al., 1993; Mrsa and Tanner, University1997). These proteins are putatively O-linked to ~-1 ,3-glucans in the cell wall and are extractable with mild alkali solutions. Potential differences in the protein expression levels of these PIR proteins in WT and KO cells were investigated by biotinylation essentially as previously described (Mrsa et al., 1999). Overnight cultures (50 ml) of WT and KO cells were harvested by centrifugation at 3000 x g for 10 min at 10°e. Cells were resuspended in 1 ml 50 mM potassium phosphate buffer pH 8.0 (Buffer K), transferred to a 1.5 ml Eppendorf tube, washed once with the same buffer by microcentrifugation for 30 seconds at 4°C and resuspended in 1 ml of 1 mg/ml EZ-Link Sulpho-NHS-LC-Biotin (#21335, Pierce Biotechnology, USA). After incubation for 1 h Chapter 3 65 at RT, cells were washed once with 50 mM Tris-Cl pH 7.5, twice with Buffer K after which 200 ).11 glass beads (425 - 600 ).1m, G-9268, Sigma-Aldrich, USA) were added. Tubes were vortexed for 3 min (30 seconds vortex, 1 min on ice for 6 cycles) to rupture cell walls and release cytoplasmic contents. Beads and cell walls were collected by microcentrifugation as before and the supernatant discarded. Cell walls were separated from glass beads by puncturing the tube and eluting into a 1.5 ml Eppendorf tube by a quick spin in a microcentrifuge. Cell walls were washed 3 times with Buffer K and treated twice with 200 ).11 0.075 M Tris-Cl pH 6.8, 2 % (w/v) SDS, 20 % (v/v) glycerol, 5 % (v/v) 2-mercaptoethanol for 10 min at 95°C to remove non-alkali-extractable mannoproteins (Mrsa et aI., 1997). Finally, cell walls were washed twice with Buffer K.

Biotinylated proteins were extracted from prepared cell walls by resuspension in 100 ).11 30 mM NaOH and overnight incubation at 4°C. Cell wallsTown were collected by microcentrifugation and the supernatant retained. The supernatant was subjected to SDS­ PAGE and then western blotted (Chapter 2, section 2.3.3.4), except that a 1:5000 dilution of Imglml Immunopure streptavidin conjugated Capeto alkaline phosphatase (#21324, Pierce Biotechnology, USA) was used to detect biotinylatedof proteins.

3.2.2.5. Quantification of flocculin regulation

3.2.2.5.1. Outline

The expression ofUniversity flocculins was examined using realtime quantitative PCR (qPCR), which allowed comparison of RNA levels. RNA was extracted from unstressed as well as CR-stressed WT and KO cells.

3.2.2.5.2. Primer design

Primers for qPCR (Table 3.2.1) were designed using DNAMAN (Lynnon Biosoft) according to the following parameters: (i) the melting temperature (T m) of forward and reverse primers should be approximately equal, (ii) primers should be 15-30 bases in Chapter 3 66 length, (iii) the G / C content should be 30-80%, (iv) runs of four or more Gs are not allowed, (v) the total number of Gs or Cs in the last 5 nucleotides at the 3' end of the primer may not exceed two, (vi) maximum product size must not exceed 200 bases and (vii) there should be more Cs than Gs.

Table 3.2.1. Primers designed for qPCR quantification of flocculin expression.

Primer GC Product Forward primer sequence (FP) Gene length content size Tm (DC) Reverse primer sequence (RP) (bases) (%) (bases) FP:TGTTCTAATAGTCAAGGAATTGCAT 25 32 142 58.4 FLOI RP:CAACTGTAGCAAACTTGAATGTGT 24 42 58.4 FP:TGTCTACATGTATGCAGGCTACTATTAT 28 36 58.8 FL05 139 RP:AGAGTAAACGTACCCTTCAAAGTTATC 27 37 58.8 FL08 FP:AATGGCAACGAATAGTGAACA 21 38 132 58.2 RP:TTGAGCGTATTCTTGCAGTT 21 43 58.2 FP:CGTCACATTGCTGGGATTA 19 47 58.1 FL09 132 RP:TTCGAATATGTGGAGGAATCTC 22 41 58.1 FP:CCGAAGGAACTAGCTGTAATTCT 23 Town43 58.2 FLOll 105 RP:AAGTCACATCCAAAGTATACTGCAT 25 38 58.2 HSP12 FP:CACTGACAAGGCCGACAA 18 56 149 59.3 RP:CCATGTAATCTCTAGCTTGGTCTG 24 46 59.3 ACT! FP:TTACTCACGTCGTTCCAATTTAC 23 39 107 58.2 RP:ACTCAAGATCTTCATCAAGTAGTCAGTCape 27 37 58.2

3.2.2.5.3. RNA extraction and eDNA synthesisof

Eight flasks containing 50 ml YEPD were inoculated with either 1 ml of an overnight culture of WT (4 flasks) or KO (4 flasks) and grown to an optical density of 0.6 ODU / ml. At this point, CR was added to a final concentration of 0.02 mg / ml to two of the flasks from each strainUniversity and all cultures grown for a further 4 h. Yeast cells were harvested by centrifugation at 3000 x g for 10 min at 10°C, washed twice with 50 mM phosphate, 150 mM NaCl pH 7.4 buffer (PBS) and resuspended in a minimal volume of PBS. RNA was extracted by the phenollguanidinium thiocyanate/chloroform method (Chomczynski and Sacchi, 1987). Approximately 50 ODU (ca. 5 x 109 cells / ml) of harvested cells was resuspended in 1 ml 4 M guanidinium thiocyanate, 25 mM sodium citrate, 0.5 % sarcosyl, 0.1 M 2-mercaptoethanol pH 7.0 (Solution D). Cells were ruptured by the addition of 200111 glass beads and vigorous shaking for 5 min at 4°C, and cellular debris removed by centrifugation. Supernatants were transferred to 4 ml polypropylene tubes Chapter 3 67 and 0.13 ml 1.5 M Na-acetate pH 4, Iml Tris-saturated phenol pH 4.0 and 0.2ml chloroform-isoamyl alcohol (49: 1) added sequentially. Tubes were vortexed for 10 seconds and incubated on ice for 15 min. Phenol and aqueous phases were separated by centrifugation at 10000 x g for 20 min at 4°C and the aqueous, top layer containing RNA transferred to a clean 2 ml Eppendorf tube. A 1 ml aliquot of isopropanol was added and the mixture incubated at -20°C for 2 h. RNA pellets were collected by centrifugation as before and dissolved in 300 f..ll Solution D. One volume of isopropanol was added and tubes again incubated at -20°C for 2 h. RNA pellets were collected as before, washed once in 75 % ethanol and vacuum dried. Finally, the washed RNA pellet was resuspended in 40 f..ll RNAse-free water, treated with 0.1 % (v/v) diethylpyrocarbonate (DEPC). The quality and purity (no genomic DNA contamination) of RNA was verified by agarose gel electrophoresis. Town Complementary DNA (cDNA) was prepared by reverse transcription as follows: RNA from each of the eight samples (2X WT stressed, 2X WT unstressed, 2X KO stressed and 2X KO unstressed) was adjusted to a concentrationCape of 5 f..lg/f..ll, combined with 250 pmol oligo-dT primer and water to a final volume of 25 f..ll and transferred to a sterile 0.5 ml thin-walled PCR tube. Tubes were brieflyof spun in a microcentrifuge and incubated at noc for 2 min, followed by incubation for 2 min on ice. A mixture of 5 f..ll lOX M­ MuLV RT Buffer (obtained with the enzyme), 50 nmol dNTPs, 250 U M-MuLV Reverse Transcriptase (M-0253S, New England Biolabs, USA) and water up to 25 f..ll was added to these tubes and incubated at 42°C for 1 h, where after 20 U RNase H (M-0297S, New England Biolabs, USA)University was added to remove RNA from the RNA/cDNA complexes. Incubation was for a further 15 min at 37°C followed by storage at -20°e.

Synthesized cDNA was quantified by spectrophotometry on a Nanodrop ND-IOOO spectrophotometer (NanoDrop Technologies, USA) at 260nm. Prior to realtime PCR, the qPCR primers and cDNA were tested by PCR as follows: 25 pmol forward primer, 25 pmol reverse primer, I f..ll 6.25 mM dNTPs, 2.5 f..ll lOX Taq Buffer, 2 U Taq polymerase, 2.5 f..ll 25 mM MgCh, 0.5 f..ll cDNA and Milli-Q water up to 25 f..ll. The PCR program comprised: 94°C, 5 min followed by 30 cycles of 94°C, 30 seconds, 58°C, 30 seconds, Chapter 3 68 noc, 30 seconds followed by noc, 10 min and finally 4°C, 10 min. Products were visualized on a 1.5 % (w/v) agarose gel using a Hpall digest of pBR322 as a DNA standard to allow size determination of small (ca. 150 bp) PCR products.

3.2.2.5.4. Realtime quantitative PCR (qPCR) qPCR was performed using the Sensimix Kit (Quantace Ltd, UK) which contained 50X SYBR Green and Sensimix Solution (Heat-activated Taq DNA Polymerase, an internal reference, dNTPs and 25mM MgCI2). Each qPCR reaction comprised 12.5 III Sensimix Solution, 50 pmol forward primer, 50 pmol reverse primer, 0.5 III 50X SYBR, ca. 100 ng cDNA and water to a final volume of 25 Ill. The reactions were performed in a Corbett Rotor Gene RG-3000A qPCR instrument (Corbett Research, Australia) using Rotorgene 6.0 software in the F AMlSYBR acquisition mode using a holdTown step of 95°C for 10 min, cycling at 95°C for 5 seconds, 58°C for 8 seconds and noc for 10 seconds, a melt step comprising a ramp from n to 95°C, rising in 1°C increments with a wait of 45 seconds for the first and 5 seconds for each subsequent increment.Cape of

University J. Ll. Rt:SU .. TS

.1.2 ..'. L. Hr~~" "r ("It

Smal di lutions o(WT ~ Il d KO )'t'~SI ed ls were Spolk{[ onto YlorD a:;ar r late, <;onla,m nJ,l

,ariuus concenUaUnn; nf (:1< unJ gro\\ n 1m- '-8 It al JO"c. Whe~ ".'wwtl1 of lh" W'T

t CK. thc ([isn'ptlol) mu\anl (KO) .... :l.!l fowld 1101 to ~w at COllccn l,-al;oll' of e R abo,'c 0.03 mg ml (Figure

J .2. I), These fe'IlII" indk ~lC

ill 1he prc<~l) ce r>f CR. Town

KO Cape of 'NT KO

wr

KO University wr

KO

WT

F.g= 3.2, 1 Uk.1 «ITIt on II", ~'fQ"lh "j \\."j' and KO yeas<. Cdb '''Te MTIJlly lO - t~l<1 ,blttt~,1 1',"11 rn,J-log;1f!lhm><.: c~ II \I ' ''' ;.nJ 1 (I I' I " \lIIt,,~· ".." JPpbed tu Y JoPLl piJl.<;, e,",1 ;~"I"A 0, (1 ,111 _ 11.02 ",oil (I O~ ," ~"' l CR ''''llCel ,,'ely . 1k pial{" ,Iou" n repre",nl f-.""",IJl • ~C! -IR 11m".,;. Chapter 3 70

3.2.3.1.2 Morpholoi{)' andjloallfallOn

The WT and KO strains were next examined by light microsc<.>py aller growth in VErD liquid media alone or contaming varIOus concentrations of CR (Figure 32.2) In the presence of CR, both yeast strains <.Iisplaye<.l aberrant cell growth These effects were more pronounced in the KO strain, and at a concentration of O. I mg/ml CR and above. this strain fomled large. dense groups of cell>. These clumps of cells c<.>uld not be separated by detergents (5 % (w/v) SDS, 5 % (v/v) Triton X-loo) or vigorous shaking (data not shown), thu> the cells did not aggregate as a result of weak interaction forces It was thus propo>ed that the dumps were due to improper cell separalion (Figure 3.2.3), where daughter cells remamed attached to the mother cell

Town

Cape of

University FIgure 3.2. 2. (,R altered the morphology of the KO slram after 20 hours A YEPI); H 0.02 mglml: C 0.05 rng/rnL DOl rng/ml: E: 0.2 rngiml; F 0.3 rngiml CR. Dead cdl, app"ar dark due 10 :l.lacl of acll~C transport ofCR oot ofthcsc cells, n..: bar rcprei>Cots 10 ~UT\

Indeed. upon closer investigation, the KO strain displayed up 10 5 buds per cell and cellular distortion in the presence of CR_ whercas the WT displayed a maximum of 2 buds per cell (Fib'Ure 3.2,3). These results suggestcd thatllsp12p partially prevented the eflecl> ofCR un chitin and hence cell separation Ch~pte r 3 71

YEPO YEPD + CR , " 1\ 7' ~ \. \ "-•' \ KO '.:, • •

Town WT

Cape of FIgure 3_2,,<. Closer examlllalion ofKO cell$ in '"')l0",e I" 0_02 mg"- ml rR ,,,-ealed thaI cellub.. a&,"'~gal", n wa' due I" ln1'r<'per seplal ion (S) "hich resulled III ce llular dumpin g (C) . ]lar: 5

~1Jl.

Cellular aggregation was qllamitieu and com p ~red by measuring the decrease in solution turbidity in spectrophotome1ric Cll'eUes owr 1ime at 600 nrn.ln eontrastlO WT cells. the KG ,train displayedUniversity " mmk~d increase ill 'edimentalion (Figure 3_2.4), indi~ali n g in~re~5ed ~ e ll - cell imeradion due 10 mul lipl e daughter cells on e~ch nl(llher cell. Chapter 3 72

1.1

_ 0.9 Iii; ;:l-- ~ 0.8 ...... o ....~ :sI 0.7 'S !-o 0.6

0.5

0.4 +-----,.-----r-----,------r----...------, o 100 :1l0 300 400 500 600 Time (5) Town

Figure 3.2.4. The flocculation of KO cells stressed with 0.05 mg/ml CR was markedly more pronounced than WT cells or unstressed cells, due to greater cell-cell interactions and cell size. +: KO stressed, .: KO unstressed, 0: WT stressed and .:Cape WT unstressed. Values expressed are the means from three separate experiments. of This aggregation was also noticed to a lesser extent in KO cells not exposed to CR (Figure 3.2.2 A), which prompted investigation into CR-independent flocculation. In a settling experiment, where cells were transferred to a glass test tube, vortexed and allowed to settle, the KO strain displayed a markedly faster rate of settling (Figure 3.2.5 A), due to the cell aggregation previously observed. This behaviour was quantified by measuring the clearedUniversity zone over time and indeed the KO strain sedimented approximately twice as fast as the wildtype (Figure 3.2.5 B). The contribution of hydrophobic effects to this phenomenon was determined by comparing the hydrophobicity of the WT and KO strains by partitioning into an organic layer (octane). Cells were dispersed throughout the organic and aqueous layers, the layers allowed to separate and the loss of cells from the aqueous layer quantified by spectrophotometry. The results indicated that ca. 14± 1 % of KO cells entered the organic phase compared to ca. lO±l % WT cells. The KO strain was therefore only slightly more hydrophobic than [he WT strain and hydrophobicity was pus~bly only a contributing factor fur the flocculation observed.

A B

Town

Figure 3.2.5 . A KO cdls dISplayed aggregation aOO rrnpropcr cell separation unde, noll-stre'SS condit"'"" Th" re,ulled m a marked incrr.osc in the rille of 'Lithng. iruilca.!cd by an lIlCrca," In the transparcnc~ of the YEPD mcd'3. Time IS mdicaloo III milllltcs aJong the bottom. B. \\T (_) cells sedimented oul of SllSPCll.'101l slower than KOCape (0) cell, ove r time Data was ohtalllcd by mca.,ul1.>Jl1l'lll of the cleared ZO£\C, In A. of 3. 2. 3.1.3, lnvasiotl

Oth er authors have shown that CR stimulates m,aSlve growth in strains not normally

a,>ocialed with Ihis form of gJowth, including the W303 strain used In these studies (Zaragoza and Gancedo, 20(0). Th e mechanism of this action is unknown, bot may involve alteration ofUniversity floccutin expressioo or of cell wall charge, hydrophobicity or surface texture. The contlibution of Hsp l1p to invasive gro",,1h was investigated by exposing W1 and KO strains to 0 ,01 mglml CR (a sublethal dose) on agar plates for an extended period of up to six days and washing ofT ,isible colonies, The WT and KO strains did not invade yt-:f>l) agar but in the presence ofeR, the WT strain displayed invasive growth whereas

the KO strain did nOL This process appeared time-dependent, since WT cells only markedly invaded the agar growth medium after 3 days (Figure 3,1 ti) Chapter 3

YEI'D • WT

YEPD + l'R

hgllIc 3,2,6. 0.02 mgiml CR e nh, nc~J the in\'aSlwn~" ufWT yeast III an Ilsr12r ,nd time­ Jepenocnl Tllall '-"" a It., extended ~'T()wth at 30'C. I:! , BetUre wa,hmg. A A Iter wa:;;hmg_ Town TtJe eXlent and nature of inVaSl\-euc>s ,,1' V/T ycasl growmg in the prescnce of CR was asccrtained hy m'CHlf,C0py_ SlI1T'rismgly. an altered nXlrphology I'esemhhng prol ate spheroids as well as IJrge cll.lmp, ",as obscncd Cape(Flgmc 3.1.7 A), Fll rthcllllore. inva,ion appeared to Cllineid e with the fo[]mlion or chains or cells, "hith may h~ve faci liMed pcnetmtion into the agJ' (hgure 3 2.7 FlJ_ of

University

F1gur~ 3,2,7, A In,.,,:;] \'e cdb CXOITlHlCd by phase eOnlr"si JTlKTl'SCOPY ,llSplaYc<1 ,pherold (S) and cilllTl.,.,u (C) , truetu,"" 'lhe,e ,tTlIctlires "~'fe e:<~mlLlc<1 In l"ealer dClail ,"mg cOl1f""al rmeTUscupy (FJgurc 3_2.8); 1:1; InvaslOll "as JXl'Sibly due 10 penetr,,,,,n oftllC agal by chams of cell" Bar: 51)() ~HTl. Chapter 3 75

Spheroid, were examined in greater detail by repeating the expeIiment with a /1uoresC~nt strain of yeast. containing the pYH 12G2 plasmid expressing Hsp12-Gfp2p, and vie\.\'ing the in;a~ive cells by confocal microscopy_ The average spheroid was 600 lIm m length and appro"imalely 200 J-lm wide (Figure 32& A) Further investigation of these structures bj excision, immer~ion in gl ycerol and phase contrast microscopy (Figure ),2,8 13) or confocal microscopy of whole $pheroids (Figure 3,2 & C) revealed that the structures were composed of dense accumulations of cells These ,tructures were unstable and ti-agmented in the presence of water or when removed from the agar environment

Town

B Cape of

University

Figure 3, 2, 8_ InvestigallOn of the morphology of mvas1\'C yeast ecHs by crnlix;;ll (A C) and phase contrast (0) microscopy , A - Q,'etvlew of a sphe[Old (arrow) to dePIct size. bar ~ 500 ~UlL B. phase DOntrast nllcroscopy of a srhcroid struclure after cxeislOll from agar and IInmersion il\ glycerol Note the fragment:lt KJII to the left of the spheroid, bar - 100 I'm. C: A rotatlOil throogh a fluorescent 'phewl

3.2.3.1.4. Chitin interaction

Previous studies have shown that CR bound to chitin as it was synthesized. This prevented chitin fibre fonnation, which resulted in the disruption of the septum and consequently the budding process (Pancaldi et aI., 1985; Bartnicki-Garcia et ai., 1994; Raclavsky et ai., 1999). WT cells were viable in the presence of CR, whereas KO cells displayed sensitivity to low concentrations of CR. This prompted the investigation of whether Hsp 12p played a protective role in the cell wall by binding to chitin to facilitate budding in the presence of CR. Chitin was incubated with increasing concentrations of Hsp12p before exposing this treated chitin to CR. Hsp12p appeared to block CR binding to chitin in a concentration-dependent manner (Figure 3.2.9). Town SO

40 CY: U -0 c 30 Cape :::l 0 .J:) c 20 of ::J ~ 10

0 0 O.s I.S 2 2.S

Hsp 12p concentration (mg/ml) University Figure 3.2.9. Hsp12p binds chitin in vitro and prevents CR binding. 15 mg of chitin was exposed to increasing concentrations of Hsp12p for 10 minutes at 25°C before CR was added to a final concentration of O.OOSmg/ml. The total sample volume was lml. The % unbound CR was detem1ined by measuring the absorbance at 500nl11.

3.2.3.2. PIR proteins

Biotin is a small vitamin (244 Da) that efficiently binds avidin and streptavidin (Green, 1963; Tausig and Wolf, 1964). Esters of biotin, including sulfo-N-hydroxysuccinimide (Sulfo-NHS) are water soluble and in addition to avidin, bind primary amine groups in Ch~ptcr 3

other proleins to fo rm amid~s . T b~ plasma mcmhrune 01' ye~sl is impcrm~~blG to this compoun.l thus only cdl wa ll proleins arc houlld ill (hi, nWnner, \\iT and KO yeast cells

"ere subjectc<.l to Ihis tr~allncnl ami Ihe r~sullal11 albli-e~(racl~d biolinyiatcd proteins

"er~ \'j,ualisoo u,ing strcpla1-idi n conjtlgat~d to alkaline rhosphata,e an<.l a modi lied rOml or W~'l~m Blotting, Th~ bioI showed no diff~rcncc iu th~ ~'prcs,iOI1 of PlR proteins (Figw'c 3,2.10), implyil1 g lhal Hsr12p mediales ilS effects through another mCl'hu!1l,m.

CCVI'6

CCW7

ccw~ conTown '"liS

m H2(J/A Cape " of

Flgure 3,~,1O, FIR pr()(ctn exprcs>;oo w~s not ~ffectcd by 10» of Ihpl2p. 1'IR prolelll' were extracted from b,()( ,nylatcd cell wulls by rnlid "Ibh extractlO'\. subJccted to SDS-FA(iE, l,"n,felTCd to nltrocellulosc and \%uali""d using ,trel',tav,dll1 (conjugated lo "lleJline pilO'il'hata,c). fin? a,~1 NflT PlR IJrolclll ""-niCS arc dcp lctcd On the ri gh t.~, shown In M,-;a and T~nncr. 19<19. Lanc S " an cxtract of 101"1 chICken Imtoncs for SIze contparison. Il l: 22,5: 1l5' :0.6: H3: 15.4: H213: 13.7: H2A: 1-'-0 and H4: 11.1 kD ~. University J.LLt Floeell lin ,

The malll proteins invol\'cd in iln'asH C grow th and tloccul~tion bdong 10 the tlocculin family. · Ib~ most ;mpOl1ant l>rowin . Flollp. is essential for tlocculation (Lo an<.l

Dr~nginis 19%). in,~sl'~ growlh, pseudoh>11hal d e \' e l opm~nt (Lambrcchts el ai, 1')%:

Lo an<.l Drangillis 1~ l)8) und h10lilm lonnulJOn (Reynold., ami Fink, 20() I ). Chapler J

I 'o,:;ib l ~ re,toratlon of Ilocmhn c>.pl'e"ion by th~ action of CR. pl'~ 5C nC~ of II,p12p 01

lack of II sp I2p wo, in,e,tig"ted ,ince i.i) the inva,,\'C b "~,,

r~stol'ed by CR III an lls pllp-d"f'Cndcnt manner, (1 i) KO ,-",11, displayed enhanced

fl occlllation and (iii) pre_ ious stlluie, lon plic~tcd II spllp in biofilm fonnation {7ard ('/ at. _2(02) . WT and KO celis w~j'c strcssed with C R. Th~jr 1111{ K A ~xtraded ~nd

bj realtime

induCC

(daTa no! shown), ' Ih ~ realT imc PCll grJph' o btajn ~"

J,~ II). sinL~ HSP12 w~" found to bc mUlIccd in j'~s pon sc to ell (ca, 1 till d), in

OlTTclatioIl "ilh prcvious find ings (Garcia eI al,. 2004) Th~ invasi,c bch~ vio ur of the

WT >train and tl occulation of th~ KO stmm v.a, lhu, nm a, a I,-,,"h of rc,tomtion of

tlocclIlin ~xprcssiOl1 , Town

'))-, / '/

55-[

~l : Cape 45 ~, of /l ~ 4(1 ~ . ' ~ 35~ ~ -'-I~ , e ~ , !! " University / /!/ / ", - .-:;,::::J~ .

, - , ----~~ " ~ ~ cO Cycles

F igur~ 3.2. j I R ~" Il,me PCR "n"l~'" of IfSI'I], HSI'12 1e,'.I, mcrca,cd ca, 2-folJ ill rc'ron", w CR str~". as ind i",,, ted b~ hl gh~r jhLOfo,,__ ellc~ "n~r w. 2 .. cyc le" m"ck' ACT/. lIm lrc,,;;cJ "ells. Bluc: IISPI2, ull

3.2.4. DISCUSSION

In this section, the inter-relationship between Hsp12p, CR, flocculins, flocculation and yeast morphology was investigated.

Maintenance of cell wall integrity through the action of the stress-responsive protein, Hsp12p, appeared essential for the survival of yeast grown in the presence of CR. Furthermore, CR altered the morphology of yeast cells, with the greatest effects observed on KO cells. These cells displayed enhanced cellular aggregation and improper septation which resulted in flocculation. The maintenance of cell morphology and survival of WT cells was possibly achieved by the interaction of Hsp12p with chitin, where it prevented CR binding to chitin. Town Flocculation was also observed in KO cells not exposed to CR. Investigation of the effects of hydrophobicity and flocculin expression in WT and KO strains revealed only a minor difference. Furthermore, cell aggregationCape was not abolished by detergents or mechanical force. This implicated other parameters, such as defective cell separation, as the main factor governing flocculation in theof W303 genetic background.

A possible explanation for the effects of CR on KO cells is that these cells possessed higher chitin content than WT cells. Previous studies have shown that cells with lowered glucan content display enhanced cell wall chitin levels. Elevated chitin content would render the yeast cellsUniversity more vulnerable to CR, which binds to chitin and disrupts budding. Furthermore, an increase in cell wall chitin would result in a less flexible cell wall. Finally, an excess of chitin would cause a thicker primary septum to form, which would possibly hamper cell separation, resulting in clumps of cells and flocculation. These hypotheses were investigated in section 3.4.

Yeast cells grown for prolonged periods on agar plates containing CR exhibited invasive growth. The dependence on Hsp12p for invasive growth was initially suspected to involve alteration of flocculin proteins, which are known mediators of invasive growth Chapter 3 80

(Lo and Dranginis, 1996). However, flocculin levels were not raised or different in the WT and KO strains. The dependence on CR for invasion by normally non-invasive W303 yeast cells was possibly mediated by direct effects on cell division due to CR complexing with chitin, as has been previously demonstrated in liquid cultures (Pancaldi et at., 1985; Vannini et at., 1985; Kopecka and Gabriel, 1992). This led to cellular chain formation, which enabled penetration of the agar surface resulting in pseudo-invasive growth. In the KO strain, cell separation was inhibited to such an extent that even chains were not formed, resulting in the abolishment of pseudo-invasive growth. Furthermore, mother cells with up to 5 daughter cells attached were observed in the KO strain in response to CR. In contrast, the WT strain only had a maximum of 2 daughter cells per mother cell, suggesting that the likelihood of chain formation due to unidirectional growth was greater in the WT strain.

An intriguing form of growth was observed when invasive WT cells growing in the presence of CR were investigated microscopically, namely the formation of prolate spheroids. These structures were postulated to be formed when yeast cells penetrated the agar surface and divided beneath it, exhausting water, causing crack formation in the agar which then led to spheroid formation asy cells of continually Cape divided Town outwards.

In summary, Hsp 12p is required for viability and proper cell separation of yeast cells in the presence of CR possibly by protecting chitin or by ensuring proper levels of polysaccharides in the cell wall. Universit Chapter 3 81

3.3. HSP12P INCREASES THE FLEXIBILITY OF THE YEAST CELL WALL IN RESPONSE TO STRESS: AN AGAROSE MODEL-BASED APPROACH

3.3.1. INTRODUCTION

The cell wall of the yeast S. cerevisiae is composed of an outer mannoprotein layer involved in cell-cell recognition and an inner carbohydrate layer that provides much of its physical strength (Klis, 1994; Lipke and Ovalle, 1998). The glucans are the major components of this inner layer, which can be divided into inner and outer components.

The outer amorphous component is enriched in ~-1,6 glucans whereas the fibrillar inner component comprises mainly ~-1,3 glucans. The ~-1,3 glucan layer is an insoluble triple helical arrangement of ~-1,3 linked polymers of D-glucose. This layer is thought to provide the yeast cell with its mechanical stability, since removal of the mannoprotein

layer and the ~-1,6 glucan layer with pronase and ~-1,6 glucanase respectively, has no effect on cell shape (for a review, see Klis et al., 2002).

Inununocytochemical analysis and alkaline extraction of Hsp12p has demonstrated that this protein is primarily located in the cell wall (Motshwene et al., 2004) although a small quantity is found surrounding the plasmay membrane of Cape (Sales et al.,Town 2000). Since KO yeast cells displayed markedly less cell volume change upon osmotic shock, Hsp12p was proposed to playa role in theersit enhancement of cell wall flexibility (Motshwene et aI., 2004). Indirect evidence in support of such a function is that trehalose deficient (tpsLJ) yeast are sensitiveUniv to hydrostatic pressure (Iwahashi et aI., 1997), displaying an altered morphology with cytoskeletal deformation after the application of pressure. This altered morphology, ascribed to resultant changes in the cell wall, was not observed when the yeast cells were heat shocked prior to the application of pressure (Fernandes et aI., 2001). Rescue of the barosensitive tpsLJ phenotype by heat shock thus supports the hypothesis that Hsp 12p influences cell wall flexibility.

Hsp 12p is postulated to act by interrupting the normal hydrogen bonding pattern of the glucan polymers in a manner analogous to plasticizers in plastic polymers. In order to test Chapter 3 82

this hypothesis, Hsp12p would have to be incorporated with ~-1,3 glucan extracted from yeast cell walls and the elasticity determined. The ~-1,3 glucan matrix can, however, only be solubilised after partial phosphorylation (Williams et al., 1991), which would introduce anionic groups and alter the nature of the inter-chain interactions. Hsp12p was thus incorporated into the polysaccharide agarose, which has a number of similarities to

~-1,3 glucan, and the resultant effects on gel strength and gelling kinetics quantified.

Agarose is also a neutral copolymer but composed of alternating 1,3-linked ~-D­ galactopyranose and 1A-linked 3,6-anhydro-a-L-galactopyranose residues (Amott et ai., 1974). X-ray diffraction and optical rotation studies have elucidated the structure of agarose to be a parallel double helix, which adopts a left-handed three-fold symmetry

(Amott et aI., 1974). Unlike ~-1,3 glucan, agarose readily dissolves in water at 80°C. On cooling, it remains in a sol state to the gelation temperature, whereupon gelling begins. The mechanism for the gelation process is believed to involveTown the assembly of random coils in solution to more ordered double helices by hydrogen bonding and, finally, aggregation of these helices to form a porous matrix (Griess et al., 1989). This process is accompanied by an increase in the viscosity and lightCape scattering properties of the solution (Amott et aI., 1974). Proteins can be readily incorporated into the agarose matrix, for example the incorporation of specific antibodiesof for antigen quantification via "rocket" electrophoresis (Laurell, 1966).

University Chapter 3 83

3.3.2. MATERIALS AND METHODS

3.3.2.1. Materials

All chemicals used were of high purity. Double distilled water was used for all experiments.

3.3.2.2. Gelation temperature and gel strength assays

The gelation temperature was investigated usmg a Shimadzu UV 2201 recording spectrophotometer (Shimadzu Corporation, Japan) with a temperature controlled cuvette holder. The wavelength for analysis (500 nm) was chosen by determining the lowest wavelength exhibiting zero absorption for an agarose solution.Town A typical analysis involved placing 1 % (w/v) liquid Molecular Grade agarose (Whitehead Scientific, RSA) at 70°C in a plastic cuvette in the spectrophotometer with the cuvette holder maintained at O°C, and allowing cooling to occur to 50°e. TheCape absorption and sample temperature, monitored using a Fluke Multimeter (Fluke, USA) equipped with a thermocouple, was then determined over the next 300 seconds.of Turbidity was defined as the absorption at

500 nm at 11°e. The gelation temperature, T g, was defined as the temperature at which the maximum rate of change of absorption occurred.

For gel strength studies, agarose was dissolved at the stated concentration in water or the solution of choice Universityat 80°C and the solution poured into cylindrical nylon moulds (10 mm diameter by 10 mm height). Propanol (I-propyl alcohol) was used instead of ethanol since the boiling point of 97°C is greater than the temperature used to dissolve the agarose. Each mould was covered with a glass plate and allowed to cool to RT at 100% humidity to minimise loss of liquid from the gel. Gels were removed from the moulds inm1ediately prior to use. Compression was applied to the agarose cylinder using an Instron 5567 Universal Tester (Instron Corporation, MS. USA) using a cylindrical nylon probe with flat face geometry at a crosshead speed of 60 mmlmin. This crosshead speed was used to minimise loss of water due to the porous nature of the agarose, so that the Chapter 3 84 cylinders essentially represented solid structures. The force exerted on the probe (stress) was determined as a function of probe extension (strain). Gel strength was defined as the maximum force that the sample could withstand before permanent deformation and was characterised by a sharp decline in the force exerted on the probe by the agarose at a certain critical extension.

Town

Cape of

University Chapter 3 85

3.3.3. RESULTS

A variety of salts have been characterised into lyotropic, neutral and chaotropic solutes on the basis of their effects on ribonuclease stability (Von Hippel and Wong, 1965). Incorporation of the lyotropic solute ammonium sUlphate «NH4)2S04) into the agarose matrix showed a large increase in the turbidity as well as the gelation temperature. The magnitude of these increases was linearly dependent on the (NH4)2S04 concentration (Figure 3.3.1). In contrast, incorporation of the chaotropic agent, urea, into the agarose matrix had the opposite effect, with a concentration dependent decrease in both the turbidity and the gelation temperature observed (Figure 3.3.1).

A 0.5 B 40 Town 0.4 E 30 .~ ci. "0 0.3 E :e 2 20 .3 c ill 0.2 0 (;) ~ Cape Q) 10 0.1 of(;) 0 0 0 0.5 0 0.5 [Solute added] M [Solute added] M

Figure 3.3.1. The effects of included solutes on (A) the gel turbidity (Asoo at 11 DC) and (B) gelation temperature (Tg) of 1 % (w/v) agarose. The included solutes used were (NH4)2S04 (--), urea (+-+) and propanol ( ... - ... ). The data shown are the means ± the standard deviation of three separateUniversity experiments.

Agarose gelation has been postulated to be brought about by hydrogen bonding between agarose chains. To investigate whether there was any hydrophobic contribution to this process, propanol was incorporated into the agarose matrix and the change in the turbidity on cooling investigated. Propanol behaved in a similar manner to urea (Figure 3.3.1) with regard to alteration of the gelation temperature, where a concentration dependent decrease of a similar magnitude was observed. Little change in the turbidity of Chapter 3 86 the agarose was observed, however, suggesting that the interaction of individual agarose chains was largely unaltered by propanol.

A 9 B 180 160 z ~ 140 ::f2. ~6 "'--- 120 0, ..c c ~ ~ 100 (j) 3 ~ 80 Qj U5 l? Qj 60 l? 40 0 20 0 0.5 0 ~ [Solute added] M A B C 0 E F

Figure 3.3.2. (A) The effects of included solutes on the gel strength of 1 % (w/v) agarose. The included solutes used were (NH4hS04 (-) or urea ( +-+). (B) Comparison of the effects of inclusion of 1 molar concentrations of various solutes on the relative gel strengths of 1 % (w/v) agarose. A: no addition, B: (NH4)2S04, C: KCl, D: urea, E: n-propanol, F: sucrose. The results shown are the means ± the standard deviation of three separate experiments.

The changes observed in the turbidity after incorporation of various solutes suggested an alteration in the strength of the agarose matrix. The gel strength, the maximum force that the sample could withstand before permanent deformation, was therefore determined for agarose incorporating a variety of solutes at different concentrations. Solutes were found to affect gel strength in a concentration-dependent manner with lyotropic solutes such as (NH.:lhS04 increasing the gel strength and the chaotropic solute urea decreasing the gel strength (Figure 3.3.2University A). Comparison of theof effects Cape of the incorporation Town of the lyotropic solutes (NH4)2S04 and KCI showed that the presence of 1 M (NH4)2S04 increased the gel strength by 30 % whereas the presence of 1 M KCI increased the gel strength by 50 %. In contrast, the presence of 1 M urea was found to decrease the gel strength by 40 % (Figure 3.3.2 B). The stress response protein Hsp 12p has been shown to be expressed when yeast are exposed to hyper-osmotic conditions due to the presence of a variety of different solutes including salts, ethanol and sugars in the medium. Thus the effect of incorporation of propanol or sucrose on gel strength was investigated. Both sucrose and propanol increased gel strength in a concentration dependent manner (data not shown) with Chapter 3 87 incorporation of 1 M sucrose or 1 M propanol resulting in an identical increase of 25% in the gel strength (Figure 3.3.2 B).

A 0.4 B 30

~ 0.3 ci. 25 -a E ~ 0.2 2 .2 c (jj o 20 <..') 0.1 ~ (jj <..') 0 15 0 2 o 2 [Urea added] M [Urea added] M

C 9 Town

£: 6 OJ c ~ til 3 Cll <..') Cape o o of0.5 [Urea added] M

Figure 3.3.3. Effect of the incorporation of increasing concentrations of urea on the turbidity (A), gelation temperature (B) and gel strength (C) of 1 % (w/v) agarose incorporating 0.5 M

(NH.jhSO.j. The arrow (t) on the ordinate shows the effect of the addition of 0.5 M (NH 4hS04. The results shown are the means ± the standard deviation of three separate experiments. A least squares regression line was fitted to the data and extrapolated to cross the dashed line (- - -) representing the turbidity,University gelation temperature or gel strength of 1 % (w/v) agarose prior to the addition of 0.5 M (NH4hS04.

Competition between the vanous factors affecting agarose were investigated by simultaneous incorporation of a chaotropic and a lyotropic solute into the gel matrix, which was expected to result in intermediate values of the turbidity, gelation temperature and gel strength dependent on the relative concentration of the chaotropic and the lyotropic solutes used. Agarose incorporating 0.5 M (NH4hS04 together with various concentrations of urea up to 0.75 M was prepared and the effect of the urea concentration Chapter 3 88 on the above parameters investigated. Increasing the urea concentration resulted in a concentration-dependent reduction in the increased turbidity (Figure 3.3.3 A), gelation temperature (Figure 3.3.3 B) and gel strength (Figure 3.3.3 C) brought about by the incorporation of 0.5 M (NH4)2S04. The effect was most marked on the gel strength, where extrapolation of the data showed that the theoretical incorporation of approximately 0.9 M urea would have restored the gel strength to that prior to incorporation of the 0.5 M (NH4hS04' The effect of the urea on the gelation temperature and the turbidity was less marked. Extrapolation of the data showed that restoration of these parameters to their original value required a higher concentration of urea, approximately 1.7 M urea in both cases.

A 7 B 8 Z Town :5 7 OJ c ~ en 6 Qi CapeC) 5 of o 2 4 [Protein added] mg/ml [Hsp12p added] mg/ml

Figure 3.3.4. (A) Effect of the incorporation of increasing concentrations of the proteins Hsp 12p (+-+) or lysozyme (-) on the gel strength of 1 % (w/v) agarose. (B) Effect of the incorporation of increasing concentrations of Hsp 12p on the gel strength of 1 % (w/v) agarose incorporating 0.25 M (NH4hS04' The arrow (I) on the ordinate shows the effect of the addition of 0.25 M (NH4hSO.j. A least squares regression line was fitted to the data and extrapolated to cross the dashed lineUniversity (- - -) representing the turbidity, gelation temperature or gel strength of 1 % (w/v) agarose prior to the addition of 0.25 M (NH 4hSO.j. All results shown are the means ± the standard deviation of three separate experiments.

Studies on whole yeast (Motshwene et al., 2004) showed that the presence of Hsp 12p markedly affected the ability of the yeast to withstand sudden pressure changes. This was ascribed to an alteration in the elasticity of the cell wall brought about by Hsp 12p interacting with the ~-glucan matrix. Hsp12p was therefore incorporated into the agarose matrix at concentrations of up to 4 mg/ml and the effect on the turbidity, gelation temperature and gel strength investigated. Incorporation of Hsp12p had no etTect on Chapter 3 89

either the gelation temperature or the turbidity of the agarose matrix (data not shown) but the protein appeared to act as a chaotrope, reducing the gel strength in a concentration­ dependent manner (Figure 3.3.4 A). The gel strength was found to diminish by just over 20 % when Hsp12p was present at a concentration of 4 mg/ml (0.25 mM). In contrast, incorporation of the 14.3 kDa protein lysozyme (C-62971, Sigma-Aldrich, USA) as a control at the same concentration failed to elicit any response (Figure 3.3.4 A). Since changes in the gel strength of the agarose on incorporation of Hsp 12p might have been due to homogeneous separation of the protein and agarose on cooling, resulting in the formation of agarose "islands", the distribution of Hsp 12p in the agarose matrix was determined by microscopy after staining with the protein dye Coomassie Brilliant blue. A uniform distribution of stain throughout the agarose matrix was observed (data not shown), suggesting that incorporation of Hspl2p into the agarose matrix had occurred during cooling. Since Hsp12p acted in a manner analogous to ureaTown in that the agarose gel strength decreased upon its incorporation, competition studies were conducted to ascertain if Hsp 12p would restore the gel strength of agarose incorporating a lyotropic solute to that of the agarose alone. Indeed, extrapolationCape of the data presented in Figure 3.3.4 B showed that Hsp12p at 3.4 mg/ml would have restored the gel strength of agarose incorporating 0.25 M (NH4)2S04 to that foundof for agarose alone. A similar result was found using 0.75 M sucrose as the lyotropic solute (data not shown).

University Chapter 3 90

3.3.4. DISCUSSION

The results reported here show an intriguing correlation between the gel strength of the agarose matrix and factors known to stimulate Hsp12p synthesis, such as salt, alcohols and sugars. Incorporation of lyotropic solutes into the agarose matrix resulted m increased gel strength whereas incorporation of the chaotropic solutes resulted In decreased gel strength. Since gel strength measurements were all performed on agarose discs of identical dimensions, these results suggested an increased value of the Young's modulus on incorporation of lyotropic solutes and a decreased Young's modulus on incorporation of chaotropic solutes. Young's moduli were not determined as the methodology used would not produce reliable values for these parameters due to a number of factors including friction between the agarose disc and the compression platforms, non-elastic compression and non-uniaxial compression.Town The increased gel strength observed on incorporation of lyotropic solutes could be restored to its original value by the simultaneous incorporation of Hspl2p. This is analogous to the situation in yeast, where growth in hyper-osmotic media orCape growth in media containing ethanol results in an increased Hsp12p content (Mtwisha et aI., 1998; Sales et aI., 2000). Thus it appears that yeast senses the increased cellof wall rigidity, possibly via the cell wall integrity pathway (Hohmann, 2002; Garcia et aI., 2004) or through plasma membrane stretch (Kamada et al., 1995; de Nobel et aI., 2000; Harrison et al., 2001; Torres et aI., 2002) and responds by increasing the Hsp 12p content in the cell wall to restore flexibility. Recently the pressure needed to break a yeast cell has been determined (Smith et aI., 2000). This pressure,University ca.4810 kN/m2, is equivalent to an agarose concentration of approximately 0.25 % (w/v).

The gelation of agarose has been proposed to be a two-step process, with random coils in solution initially assuming double helical conformations. Upon further cooling, bundles of helices form (Amott et al., 1974). It has been suggested that these bundles can be described as long rods, which affect the turbidity and gel filtration characteristics of the matrix (Obrink, 1968). The results reported here suggest that the size of these rods is affected by the presence of solutes during the cooling process that results in the formation Chapter 3 91 of the agar matrix which in tum alters the physical properties of the matrix. Since both helix and rod formation are brought about by hydrogen bonding between agarose molecules, factors that affect hydrogen bonding would be expected to alter this process. Thus the presence of chaotropic solutes, which are known to disrupt hydrogen bonding, would result in a reduced helix formation and therefore smaller rods. These rods would in tum reduce the turbidity due to their smaller size and the gelation temperature and gel strength due to reduced hydrogen bonding. Lyotropic solutes, by increasing the bound water content of the solution, would have the opposite effect. The reduced free water content would favour the hydrogen bonding of agarose monomers to other monomers rather than to free water thereby promoting the formation of longer helical segments and therefore larger rods. Larger rods more strongly hydrogen bonded to one another would account for the increased gel strength observed. This explanation might well be an over­ simplification of a complex phenomenon since the turbidity is Towndependent not only on the size of the particles but also on the relative refractive indices of particles and solvent.

The absence of effect of the incorporation of HspCape 12p into the agarose matrix on the turbidity and the gelation temperature is perhaps not surprising. The concentration of Hsp12p used was extremely low, less than of1 mM, in contrast to the molar concentrations of solutes required to elicit a response. These data suggest that Hsp12p does not affect either the sizes of the rods formed on cooling the agar or the overall interactions between them that occur during the cooling process. The effect of Hsp12p on the gel strength is presumably brought about by Hsp 12p interchelating between the agarose rods. It has been shown that LEA proteinsUniversity have little structure in solution (Russouw et al., 1995; Lisse et aI., 1996), a property that would enable such proteins to form hydrogen bonds to agarose rods at different positions along the primary sequence. This presumably allows the agarose rods greater movement with respect to one another without breaking hydrogen bonds, a property similar to that of plasticizers. In contrast, lysozyme failed to alter the gel strength of the agarose matrix. This is presumably because lysozyme is a globular protein (Phillips, 1966) with a defined structure. This defined structure would prevent agarose rod movement without breaking hydrogen bonds, which would account for the observed lack of effect on the agarose gel strength. Thus Hsp 12p appears, as least in this Chapter 3 92 model system for the yeast cell wall, to act as a chaotropic agent and plasticizer to increase flexibility of gel matrices.

Town

Cape of

University Chapter 3 93

3.4. INVESTIGATION INTO THE EFFECTS OF HSP12P ON CELL WALL PARAMETERS BY DIRECT MEASUREMENTS ON LIVE YEAST CELLS

3.4.1. INTRODUCTION

Previous studies using agarose as a model system indicated that Hsp12p may act as a plasticizer in the yeast cell wall. It was, however, desirable to investigate whether these effects occurred in live yeast cells. Atomic Force microscopy (AFM) is a relatively new method that allows one not only to scan the surface of biological samples but also to determine the force required to cause deformation. One major problem with AFM is the attachment of the biological sample to the solid support in a manner which immobilises it yet affects neither the biological activity nor the surface properties of the sample. Previous methods used to immobilise yeast cells for AFM haveTown included trapping the cells within polycarbonate pores (Dufrene et al., 2001) and drying yeast cells onto glass slides (Adya et aI., 2006). However, dried yeast cells poorly represent cells in an aqueous environment as such cells would most likely haveCape very different surface properties as a result of the drying process. These would include an increased cell wall rigidity brought about by the increased osmolarity of the ofsample as well as the presence of cell wall proteins which are known to be expressed during desiccation. Although trapping yeast cells within polycarbonate pores retains the cells in an aqueous environment, the yeast cells may not be completely immobile within the pore, giving rise to the possibility of anomalous data when determining the force curves. University Physical adsorption of yeast cells onto polyethyleneimine (PEl) coated glass plates (Burks et aI., 2003; Camesano and Logan, 2000; Rodriguez et al., 2002; Vadillo­ Rodriguez et al. 2004) to immobilise W303 WT and KO yeast cells was thus considered the least invasive and was used in these studies. In addition, this method allowed the determination of the spring constant of the stiff PEl-coated glass surface and the yeast cell from the same plate. Chapter 3 94

Further assays to detennine the flexibility of the yeast cell wall included electrophoretic mobility assays. The stiffness of the cell wall could be calculated using the data from these assays (Dague ct aI., 2006). Finally, the yeast cell wall was investigated using infrared (IR) spectroscopy, to establish whether the chemical composition of the cell wall was altered in KO cells.

Town

Cape of

University Chapter 3 95

3.4.2. MATERIALS AND METHODS

3.4.2.1. Materials

All chemicals used were of high purity. Double distilled water was used for all experiments.

3.4.2.2. Organisms and culture conditions

Yeast strains and growth conditions were as previously described (this chapter, section 3.2).

3.4.2.3. Atomic Force Microscopy (AFM) Town

Polyethylimine (PEl, P-3143, Sigma-Aldrich, USA) covered glass slides were prepared by flooding one side of a nitric acid washed glassCape slide with 0.2 % (w/v) PEl after which it was allowed to stand at RT for 1 h. Slides were thoroughly washed with deionised water, allowed to dry and used immediately.of An overnight culture of WT or KO yeast

0 cells was washed twice with 1 mM KN03 pH 6.5 at 3000 x g for 10 min at 10 e and resuspended to a concentration of ca. 0.2 ODU/ml in the same buffer. This concentration of cells represented the optimum coverage of the glass slide as determined microscopically (Figure 3.4.1). The PEl-coated side of each slide was covered with washed yeast cells Universityin 1 mM KN03 pH 6.5 and incubated at RT for 1 h. Slides were gently rinsed three times with deionised water and rapidly immersed in 1 mM KN03 pH 6.5.

Inunediately prior to analysis, slides were removed from the 1 mM KN03 pH 6.5 solution, fixed onto the AFM sample holder and covered by a drop of 1 mM KN03 pH 6.5. All AFM measurements were performed in this solution using a commercial microscope (Thern10microscope Explorer Ecu+, Veeco Instruments, USA). Samples were initially imaged at low resolution to identify individual cells on the PEl-coated glass plate. Interaction forces were measured between a single silicon nitride tip (ke = 0.03 Chapter 3

\lim, \ILCT-EXMT-BF, \'eeco Instrulllents, LSA) and the cell sut'hce, A single forc e me~surement wa, performed on an indi, idual cell to avoid potential hysteresis,

Town hglLfC 3,4.1, (jl~sl ,hues Were e ,a",i nect p!'1Qr to AN 10 cterermrne the orti mum ()]l1tc~1

A mimmum 01 [0 indi\'idllCl [ cells froLn ("0 separa(eCape yeast cul1urer. were used (ur such meQsuremcnts, 111C X, Y and 7. axis piczo-electricof alms were used to positIon thc lip These piew-cle<'tnc anTIS could move minute distances in response (0 an applied electric currem, allowing preclse pOSltiomng or thc IIp_ Raw dellecllon-piezo di ,placement curv~s Were convcr(ed mto lorce ClinCs us ing the sell." li vit)' of' the photodetector and thc 'pring conslam or the cantiie\'cL Force cul'\e, and standard ,k'viatlOn, were calculated [or ~ach

,ample in - 10)_ The first noticeable i ncr e~", O['lorce as the tip approached Ihe sample wa' used a' a referenceUniversity lor /ero piezo dispiQcemcnt. Alkr Al:M meQ'llrements. slides were inmlersed in YEPD and incubated overnight to confirm the riability oj' the yeast cells used,

J.4.2A. Electrophoretic Mobility Assays

ElectrophoretIc mobility m e~su remenlS were perlonned 011 a letQphorellleter IV ISEPHY-CAD TnstnlItlClllatlOll, france) e(luipped wllh la",r ilhnninQtion and Q v,deo interJace. Al least 50 measurements of' cell nYlhi l ity (or each condition Were per formed in Chapter 3 97 a Suprasil quartz cell (Perkin-Elmer, USA) at RT. Yeast cells were prepared as for AFM and mobilities recorded at various ionic strengths ranging between 1 ruM and 30 mM

KN03 pH 6.5. The relationship between electrophoretic mobility and ionic strength was analysed using soft particle analysis (Duval and Van Leeuwen, 2004; Yezek et aI., 2005). Briefly, the electrokinetic (electrostatic and hydrodynamic) response of a soft particle (defined as an impermeable hard-core component covered with a permeable polyelectrolyte layer) can be described quantitatively using ngorous numerical evaluations without any restriction of size, charge and Debye thickness. The spherical yeast cells used were assumed to be soft particles with a core diameter a close to 3 )lm and with a cell wall thickness (5 of 100 nm as identified from electronic images (Sales et aI., 2002). The experimental data were fitted using the method of least mean squares to determine the permeability parameter (leo) and the volumic charge density of the polyelectrolyte layer (Po) of each cell.

3.4.2.5. Infrared Spectroscopy

Attenuated Total Reflectance Fourier Transform infrared (ATR-FTIR) spectra of yeast l suspensions in Milli-Q water were measured between 4000 and 600 cm· on a Perkin­ Elmer 2000 spectrometer (Perkin-Elmer,ty USA) of equippedCape with Towna KBr beam splitter and a DTGS (deuteriated triglycine sulphate) thermal detector. In a typical experiment, 100 )ll of an overnight culture ofWTersi or KO yeast cells was applied to the ATR accessory, which comprised a horizontal Diamond crystal prism (AST Applied Systems, USA) with 9 internal reflectionsUniv on the upper surface, an angle of incidence of 45° and a penetration l depth at 1500 cm· of 1 )lm. The sample was covered with water and analysed at a spectral resolution of 4 cm- l for 4 min. Trradiance throughout an empty cell (without the A TR accessory) was about 20 % of full signal. ATR spectra of the sample were plotted using the absorbance of the sample together with the internal reflectances (R) of the device as log (Rreference/Rsamplc) versus wavenumber. The spectrum of water was used as an absorbance reference. The A TR spectra are not strictly proportional to the absorption coefficients at each wavenumber since no further correction has been applied (Mirabella and Harrick, 1985), but the results can still be compared relative to one another at each Chapter 3 98 wavenumber. The contribution of water vapour and carbon dioxide signals to the spectra was minimised using the H20/C02 procedure of the Spectrum 5.0.1 software.

Town

Cape of

University Chapter 3 99

3.4.3. RESULTS

3.4.3.1. Atomic Force Microscopy

PEl-coated glass slides with adhered yeast cells were incubated in YEPD after AFM analysis. Yeast cells remained viable after AFM determinations, indicating the non­ invasiveness of this methodology (data not shown). A typical AFM image (Figure 3.4.2) of yeast cells physically adsorbed onto PEl-coated glass slides revealed spherical shapes with diameters ranging from 2.5 to 6 /lm. These initial scans allowed the selection of individual cells for AFM force measurements of the cell wall. Regions of the cell wall with bud scars were not selected, since these regions exhibit increased rigidity due to the presence of chitin (Touhami et aI., 2003). All curves recorded displayed non-linear behaviour at low loading forces and a near-linear domain at highTown loading forces (Figure 3.4.3). Preliminary attempts to physically adsorb yeast to the slides and then perform AFM analysis in the presence of 100 mM salt were unsuccessful. This salt level prevented electrostatic interactions by shieldingCape cell surface charge, lowering the adhesion of cells to the slide. Measurements were thus performed in 1 mM KN03, but this hampered nanomechanical interpretationof of low loading force-dependent non-linear behaviour due to increased electrostatic interactions (Gaboriaud et aI., 2005; Dufrene et al.. 2001). Fortunately, the high-loading force-dependent linear behaviour corresponded to the mechanical deformation of the cell wall and the spring constant kcw could be calculated using the following equation: University k -- . CH - kc S +S k . J ( c where kc represents the spring constant of the cantilever and S is the slope in the linear domain of the force curves.

In contrast with the stiff behaviour displayed by the glass surface, the force curves recorded for the two yeast strains exhibited soft behaviour with a non linear component at low loading forces and an almost linear domain at high loading forces (Figure 3.4.3). The Chapter} 100 nanomechanical properties of2.5 flm diameter cells of the two strains were different with

L the KO strain appearing stiffer (k,,~ = 72 1- 3 mN.nf ) than the WT str.. in (Ic..,., = 17 10 5 m\l.m·I).lntere,tingly. the si,e of' the ce ll afl"ected the nanomechanical propcrtic,> orthe cell. as the spring eon,tallt of the cell walls of 4.5 J.un diameter KO cells was low~r (k,~ = 19 ± 2 m\l.m-l). This phenomenon wa'> possibly dlle to larger cells presenting a flatter surface to the tip. allowing lllcrcw,ed lateral force distribution.

Tm, flexlbility ol'agaro'>e, usecl as a model system for the yea,t cell wall, decreased upon incorporation of osmolyte, . The effect of mallllitoi on the spring constant of the cell wall, k.,~, 01' \\'1' yea,t was thus investigatcd by incubating a PEl-coated glass slide containing this yeast str.. in ill 0.8 M manmtol for 10 min before tkkmlining the foree curves. The l spring con8tant ill tbe pres~nce or mannitol increased 8-fold to 141 ± 1 mN.nf , m agreement with the previous data obtained using agarose. Town

Cape of

University

Figure 3.4.2: A l]'picat AFM height image (12 x 12 ~m; L-Ran.,>e; 3 )lm) of S. c<'Ini-l'iu,' WT cell. recorded in aqueous soIu(ion (J mM ](NOs pH 6.5). Chapter 3 101

3,0~------~~------~

K 2,5

2,0 z c w -II) 1 ,5 ....u o LL

1,0

0,5

o,0 L-..,...... -..,....--....------,r------r---r--.::;~.m..-.I -200 - 15 0 -1 00 -50 o Relative piezo displacement (nm)

Figure 3.4.3: Mean and respective standard deviations (n = 10) of force curves measured on WT (W) and KO (K) yeast strains in aqueousy electrolyte of Cape solution (1 TownmM KNO}, pH 6). Typical experimental data obtained on a stiff glass surface (G) is plotted to illustrate the defom1ation of yeast. The size of all cells investigated was ca. 2.5 11m.

3.4.3.2. Electrophoretic Mobility Assays

The ionic strengthUniversit dependence of the electrophoretic mobility of a particle relies on the softness of the particle. In the case of a rigid particle, the mobility tends to zero at high ionic strength, and the zeta potential at the slip plane of the particle can be calculated from the classical theoretical concepts of the Smoluchowski-Henry equations.

In contrast, soft particles such as biological cells possess non-zero asymptotic electrophoretic mobilities at high ionic strengths due to non-negligible contributions of the hydrodynamic properties. This behaviour is characteristic of particles with a soft, hydrodynamically permeable layer surrounding the particle. Chapter 3 102

The experimentally determined electrophoretic mobilities of WT and KO yeast cells at different ionic strengths and at neutral pH value are shown in Figure 3.4.4. The electrophoretic mobilities of both strains reached a non-zero constant value upon increasing the ionic strength, as expected from the theoretical considerations of soft particle behaviour.

Yeast cells were modelled as a particle with a hard core of diameter 3 ~m coated with a polyelectrolyte permeable layer 100 nm thick. By fitting the experimental data, the permeability parameter (Ao) and the volumic charge density (Po) of the soft layer were determined for the two strains using methodology described for bacterial systems and humic substances (Duval et ai., 2005). The resulting best fits are shown in Figure 3.4.4 as plain lines. While the volumic charge densities were similar for the two strains, the softness parameter was higher for WT yeast (3 nm) comparedTown with the KO strain (2.3 nm). This result indicated that the external layer of the KO cells was stiffer than the corresponding layer of WT cells. Cape of

University Chapter 3 103

-0.8 - -.... \VI P. ::::·6 mM u 1/\ =3 nm c -1.6 '-L-______-'-- ______---' 1 10 Town100 0.4 B o Cape I- .x~ -0.4 of w o w -~ -0.8 -.,; KO p ::::·7 mM Q 11A = 2.3 nm University-1.6 (I 10 100 Ionic strength in KNO / ruM 3

Figure 3.4.4. Electrophoretic mobilities as a function of ionic strength (KN03 • pH 6.5) for the two types of S cerevisiae strains. Experimental data (filled circles) were fitted by using the rigorous numerical evaluations (plain lines) with free parameters, 11 A.,-) characterising the typical flow penetration length within the soft polymeric layer and po the volumic charge density of that layer. The thickness of the pem1eable polyelectrolyte layer (5) has been considered to be 100 lID1 with a core radius close to l.5 11m. Chapter 3 104

3.4.3.3. Infrared Spectroscopy

Yeast cells were 2.5 to 6 ).tm in diameter as demonstrated by AFM and optical images. The vertical thickness of A TR analysis from the crystal to the top vertical dimension in the solution was approximately 1 ).tm. Thus ATR spectra were related only to the spectral features of the periphery of the cells in contact with the diamond crystal. Figure 3.4.5 depicts the 1800 - 800 cm"! region of the ATR-FTIR spectra obtained for the WT and KO strains of yeast. The assignments of the spectra are summarised in Table 3.4.l. Bands near 1104 and 1075 cm"! were assigned to 13-(l-3)-glucans, and bands at 977, 1050 and 1128 cm"! were assigned to mannans based on the known composition of the yeast cell wall (Klis et ai., 2002).

Table 3.4.1. Assignment of infrared vibrational bands in the region 1800-900 cm-I of the ATR­ FTIR spectra of S. cerevisiae yeast cells in water suspension.

Wavenumberls (em"') Assignment* 1644 Amide I band (vC=O, oN-H, vC-N); oH20 (possible residual band arising from non-perfect compensation of water) 1540 Amide II band (vC-N, CNH)

1448 CH1 bending 1407 CH bending 1244 Amide band III (vC=O, CN-H, vC-N); ~-glucans 1218 (sh) P=O stretching in phosphate esters 1200-950 C-O-C, C-O, C-C stretchings and CH2 (sugars); POl, C-O-P and P-O-P stretchings (weak intensity) 1128.1051. 977 Mannans 1104,1075,1071 University~-1-3-glucans of Cape Town *: Michell and Scurfield. 1970; Galichet et al., 2001; Machova et al., 1999 v: stretching, 8: bending. sh: shoulder

The spectra of WT and KO strains were normalised with respect to the amide II (protein) band at 1540 cm"! and the difference spectrum between the two strains calculated (Figure 3.4.5, inset). The KO strain displayed a markedly lowered 13-1-3-glucan and mannan (l150, 1240 and 950 cm"!) content. In addition, the band at 1218 cm"! indicated lower phosphate group content in the KO strain, possibly due to lowered levels of phosphopeptidomannans. Chapter 3 105

0.030 I I o 010 ~ 0.025 ..,c,

0.020 'r. ~J :". :=: Co ~ 0::: ----..... 0.015 Town 0:::-" '--' CD 0 ...... l 0.010

0.005 Cape of 0.000 _ ..'-1"""""

1800 1700 1600 1500 1400 1300 1200 1100 1000 900 800

Wavenumber (em-I)

Figure 3.4.5: ATR-FTIR spectra (1800 to 800 cm- I) ofWT and KO cells in water. Solid line: WT; broken line: KO. SpectraUniversity are nomlalised with respect to the amide II band. Inset: The 1300 to 900 cm l region of the difference spectrum (spectrum of the WT - spectrum of the KO), depicting differences in cell wall chemistry between the two strains. Chapter 3 106

3.4.4. DISCUSSION

These studies have shown that Hsp 12p affects the flexibility, texture and chemistry of the yeast cell wall. Cells lacking Hsp12p were markedly stiffer and consequently did not deform easily. Furthermore, yeast cell walls were hardened by osmolytes (mannitol), as previously suggested by incorporation of osmolytes into agarose. Electrophoretic mobility of KO cells was markedly reduced due to a stiffer cell wall. Finally, the cell wall chemistry of cells lacking Hsp 12p was altered and displayed a lower amount of glucans, mannans and phosphopeptidomannans. This may have been due to the following: (i) Cells lacking Hsp 12p would have less flexible cell walls and would thus have hampered insertion of these residues into the stiff cell surface, (ii) Hsp l2p may have acted through MidI P to alter levels of intracellular calcium and consequently the function of Pmr1p and Fks2p, which processTown peptidomannans and synthesize glucans respectively (Section 3.5), (iii) Yeast cells compensate for lack of certain cell wall components. Thus KO cells may have synthesised less glucans, which would decreaseCape cell wall flexibility, to compensate for increased cell wall rigidity. of

The lowered amount of glucan in the cell wall of KO cells might possibly result in a compensatory increase in chitin content, as has been observed in other cell wall mutants lacking glucan synthase activity (Ram et aI., 1998). Consequently, KO cells would have stiffer cell walls since previous studies have shown that the bud scar, mostly comprised of chitin, is stiffer thanUniversity the surrounding cell wall (Touhami et aI., 2003). Furthermore, cells with elevated chitin levels in the cell wall would be vulnerable to agents such as CR, which bind chitin. In addition, the primary septum between mother and daughter cells, which comprises mostly chitin, would be altered, leading to impaired cell separation. This would explain our previous findings where KO cells were more vulnerable to CR and displayed cellular aggregation due to impaired cell separation. Chapter 3 107

3.5. GENERAL DISCUSSION

The data presented in this thesis suggest that Hsp 12p plays multiple related roles in the cell wall. These roles are mediated independently of flocculin or PIR protein regulation. One such role is an interaction with chitin, since cells lacking Hsp12p were markedly more sensitive to CR, which binds chitin and disrupts cellular morphology. Interestingly, chitin is, like Hsp 12p, synthesised in response to all forms of stress affecting cell integrity (Dallies et al., 1998; Kapteyn et aI., 1999).

Studies employing agarose as a model system for the cell wall indicated that Hsp 12p enhances cell wall flexibility, possibly to alleviate the effect of various stresses on the cell wall. This increased flexibility was postulated to involve interchelation of Hsp 12p between agarose helices, facilitating their movement. This Townincrease in elasticity was confirmed by atomic force microscopy, which allowed measurements of cell wall flexibility on live yeast cells. The effects of Hsp 12p on cell wall chemistry included marginal enhancement of cell electrophoretic mobility,Cape possibly by increased cell wall rigidity. Furthermore, KO cells displayed lowerof levels of phosphorylated peptidomannans and ~-1 ,3-glucans. The decrease in glucan content may have led to an increased amount of chitin, due to the compensatory response exhibited by cell wall mutants. This would have led to a further increase in cell wall rigidity and impaired cell division.

These multiple roles can be presented as a model (Figure 3.5.1), where the binding target for Hsp 12p is chitin.University In this locus Hsp 12p prevents Congo Red binding and interchelates between adjacent glucan chains, allowing them to move relative to one another, enhancing cell wall flexibility. Chapler 3 108

"'Sensing H,,12, Cell integrity pathway HOG pathway T ranscriplion "-,... ! TranslationTown HSP12 Promoter HSP120RF Cape

M¥01opr0t~irl GP I aI):hor d-I ,3-JI IJo:a nof TrJ1snwmbrane B-1_o-gilican Chibn rrotein Figure 3.5 I , A simp llfLed model depICting the multiple roles ()f the STress-responSIve prfllein IIspl2p in the yeast cdl "all Hspl2p binds chilin and pre,ents CR bmding, cnhan<.:ing cell ""alllllly, r:"nhcrrnore. Hsp I 2p in(crchelatC5 octwccn ~-1.3-g l"can s, facihtalcs moWfllCtll aII

What is the rule ofUniversity Hsp 12p-mediated cell wall flexibi lity in yeast~ One possibili ty is the mrxiulation of calcium (Ca") llux_ Yeast cel l ~ require cyto~olic calcium ti.lf the activity of a variety of enzymes responsible lor cell wall synthe~is and ~ecretory prolein proces~ing, sorting and modification (Mazur el at., 1995, Stathopoulos and Cyen, 1997;

Dlirr el at. , 1998, Zhao d al. , 1998) In addition, ~alcillm is re qU1r~d fur the unfolded protein responsc, which is activated upon stresses which re~ult in an increa~ed wn~entration uf mistulded or unfolded protcins in the endoplasmic reticulum (ER)

(Bonilla el al., 2002) Rapid o~ci ll a ti on~ of calcium level, have also been shuwn to be Chapter 3 109 important for optimum gene regulation (Dolmetsch et aI., 1998). Yeast cells accumulate 2 and store calcium in the ER through internal Ca + pumps, such as Pmrl p, where it is available for rapid responses (Bonilla et al., 2002). These stores are replenished by calcium uptake from the environment, through putative plasma membrane stretch­ activated ion channels such as Cch1p/Mid1p (Iida et aI., 1994; Batiza et aI., 1996; 2 Kanzaki et aI., 1999; Kanzaki et al., 2000; Yoshimura et al., 2004). Most Ca +-regulated pathways are initiated by the calcium and calmodulin-dependent serine/threonine-specific protein phosphatase, calcineurin (Rusnak and Mertz, 2000). This protein is responsible for the dephosphorylation of several targets such as the transcription factor, Crz1 p (Matheos et aI., 1997; Stathopoulos and Cyert, 1997), which in tum induces cell wall construction genes, such as FKS2 (Mazur et aI., 1995; Stathopoulos and Cyert, 1997; Zhao et aI., 1998). FKS2 encodes a subunit of glucan synthase which produces B-1,3- glucans to increase cell wall strength to withstand turgor Townpressure and mechanical damage during stressful conditions.

2 Upon exposure to a variety of stresses, the Ca + Capestorage system is rapidly depleted, since 2 large amounts of Ca + are required for secretion and activation of cell wall remodelling enzymes and for the UPR. Moreover, theseof stresses harden the yeast cell wall (as shown using AFM) or prevent its outward expansion (Kamada et aI., 1995; de Nobel et aI., 2000; Harrison et aI., 2001; Torres et aI., 2002), limiting plasma membrane stretch and

2 concomitantly Ca + replenishment. We have found that the small heat shock protein, Hsp 12p, increases the flexibility of the yeast cell wall and is expressed in response to a wide variety of stresses.University We propose that Hsp 12p may playa role in the replenishment of 2 internal Ca + stores by enhancing the activity of stretch-activated ion channels through enhancing cell wall flexibility. In this manner, Hsp12p would also enhance downstream cell wall remodelling events during continued stress, promoting cell viability.

Several threads of evidence support this model, depicted in Figure 3.5.2). Under

2 conditions of hypo-tonic shock, which inhibits outward membrane expansion, a Ca + pulse is rapidly observed within seconds, indicative of the release of internal stores of 2 Ca +. Thereafter, the yeast cell gradually takes up calcium (Batiza et aI., 1996). This time Chapter 3 110

lapse is indicative of a pause where proteins must be expressed before ion channels can be activated. Since Hsp12p is induced through multiple pathways and expression is only pronounced after 20 minutes (Varela et al., 1995), this time lapse may be explained by an increase in Hsp 12p-mediated cell wall flexibility. Furthermore, in cells pre-stressed by exposure to cold for 6 days, calcium uptake was markedly enhanced in response to hypo­ tonic shock, implying that an additional co-factor expressed in response to cold was necessary to ensure optimum Ca2+ uptake (Batiza et aI., 1996). Kandror et al. showed that besides trehalose synthesizing enzymes, a variety of heat shock proteins, including Hsp12p, were slowly induced in response to cold (Kandror et aI., 2004). Moreover, calcium uptake in cells exposed to glucose limiting conditions, where cAMP concentrations are low and PKA activity is diminished, showed high levels of Ca2+ influx. These levels were not restored to basal levels, implying continuous Ca2+ uptake and loss of Ca2+ flux control (Batiza et al., 1996). This may Townbe explained by a lack of PKA activity, which results in a strong induction of HSP 12 gene expression (Varela et al.. 1995). This would result in a much more flexible cell wall and subsequent continuous activation of stretch-activated channel proteins. Cape

Kamada et al. observed that yeast cells activateof the cell integrity protein kinase C (PKC) pathway in response to mild heat shock (Kamada et al., 1995). This response was abolished in cells where plasma membrane stretch was inhibited, prompting the postulation that downstream components of this pathway were activated by weakness of the cell wall. Subsequent plasma membrane stretch would result in calcium influx, and PKC 1 is activatedUniversity directly by this ion (Levin et aI., 1990). In addition, Kamada et al. found that expression of Mpk1 p, the MAP kinase mediating this pathway, was only observed after 20 minutes. Our model can possibly explain the nature of these findings, where expression of Hsp 12p, which initiates at 20 minutes and is maximal at 30 minutes, gradually weakens the cell wall, enhancing Ca2+ uptake and resulting in Mpk1 p activation. Mpklp and Ca2+-activated calcineurin then act synergistically to stimulate Fks2p to reinforce the yeast cell wall (Zhao et al., 1998). Furthermore, Mpk 1P has been shown to be directly involved in MidI p activation (Bonilla and Cunningham, 2003) and over-expression of Pkc 1p in S. pombe resulted in a high level of intracellular Ca2+ Chapter 3 III

(Arellano et al., 1999; Calonge et al., 2000) which was dependent on the presence of Ehs1p, a Mid1p homologue (lida et al., 1994; Camero et al., 2000). Over-expression of Pkc 1p in S. cerevisiae has been shown to result in HSP 12 induction, thus linking the two processes (Garcia et al., 2004).

The importance of regUlating HSP 12 in response to hyper-osmotic shock is two-fold. Firstly, in response to salts such as NaCI or LiCl, intracellular levels of Na+, Li+ or cr increase. Some authors have demonstrated that calcineurin is essential in high salt stress adaptation of yeast (Mendoza et al., 1994; Nakamura et al., 1993). Since cell wall flexibility and Ca2+ uptake are necessary for sustained calcineurin function, Hsp12p may be needed for the adaptation of yeast cells to salt stress. Secondly, Alonse-Monge et al. showed that cells lacking the general osmotic stress responsive factor, Hog1 p, were more susceptible to cell wall degrading enzymes, indicative of a commonTown function of these two independent pathways. Hog1p was believed to act by controlling vesicle transport of cell wall enzymes, enhancing cell wall integrity (Alonse-Monge et al., 2001). Furthermore, Hog1 p stimulates HSP 12 induction (Siderius et al.,Cape 1997). The cell integrity pathway and osmotic stress pathway thus share functional aspects and are both characterised by HSP 12 induction. of

Further evidence is provided by the fact that (i) chitin synthesis is activated in response to cell wall stress and this is the binding target for Hsp12p, (ii) stress in general has been postulated to be sensed by plasma membrane stretch (Kamada et al., 1995; de Nobel et al., 2000; HarrisonUniversity et aI., 2001; Torres et al., 2002) and (iii) Hspl2p may directly affect the mobility and hence function of Fks2p by promotion of actin patch mobility (Delley and Hall, 1999; Utsugi et al., 2002), since Jang et al. found that a mutant lacking proper cytokinesis could be rescued by Hsp9p over-expression, a protein in S. pombe extremely similar to Hsp 12p. (J ang et al., 1996).

All these findings and evidence can be represented as a model for Hsp12p function (Figure 3.5.2). In this model, a role for Hsp12p's interaction with Cprlp (see chapter 1, section 1.2) is also tentatively proposed. This protein is the binding target for Cyclosporin Chapter 3 112

A (CsA), an inhibitor of ca1cineurin secreted by a variety of organisms as an antifungal agent. Thus by Hsp 12p competing with CsA for Cpr! p, ca1cineurin activity is prolonged, giving the cell time to fortify its cell wall. Our model also predicts that cells lacking Hsp 12p would have less post-translationally processed cell wall peptidomannans and lowered glucan content, which was indeed indicated by infrared spectroscopy. Stress ------. Xcs~ Ca 2+ transient I E Cell integrity +J F CP~1 P pathway Calcineurin \(' "'~ ~'-s +K D., ~A 8~ HSP12P Chs3p C rz 1 P/~ Town+C +L k~u Chitin Fks2p+M G P-1,3-glucans Cape ~. H '.... Cell ofwall

Figure 3.5.2. A model for Hsp l2p function in S. cerevisiae. References are mdicated by letters of the alphabet. Further details are provided in Table 3.5.l. Arrows: induction / stimulation, blunt­ ended lines: repression! inhibition and broken lines: interaction. Chapter 3 113

Table 3.5.1. A sunm1ary of the references and findings used to compile the model presented in Figure 3.5.1.

Name Reference/s Brief description HSP 12 is induced by the cell integrity pathway in A Garcia et aI., 2004. response to stress. Jung and Levin, 1999; B The cell integrity pathway induces chitin synthesis. Roberts et aI., 2000. Popolo et aI., 1997; C Chs3p synthesizes chitin in response to stress. Ram et aI., 1998. D Ho et aI., 2002. CsA binding protein Cprlp associates with Hsp12p. E Breuder et aI., 1994. CsA associates with Cprl p. F Breuder et aI., 1994. The Cprl p / CsA complex inhibits calcineurin. Motshwene et ai., 2004; G Hsp 12p is present in the yeast cell wall. This study. H Orlean, 1997. Chitin is a cell wall component. 2 Batiza et aI., 1996. Stress causes a Ca + transient. 2 J Rusnak and Mertz, 2000. Ca + activates calcineurin. K Matheos et aI., 1997. Calcineurin acts via Crz 1Townp to mediate transcription. Mazur et aI., 1995; L Stathopoulos and Cyert, 1997; Crz1 p induces FKS2. Zhao et aI., 1998. M Douglas et af., 1994. FKS2 encodes a subunit of glucan synthase. P-1 ,3-glucan is the main component responsible for N Smits et aI., 1999. Cape cell wall strength. 0 This study Hsp 12pof enhances cell wall flexibility. Kanzaki et af., 1999; P Kanzaki et af., 2000; Mid 1P is stretch-activated. Yoshimura et aI., 2004. Q Iida et aI., 1994. Mid1p is needed for calcium flux. 2 R Durr et af., 1998. Ca + is needed for Pmr1 p function. Pmr1p is required for protein glycosylation and S Durr et af., 1998. sorting. 2 T Dolmetsch et ai., 1998. Ca + oscillations optimise gene regulation. UniversityHsp 12p affects actin parameters since a mutant Jang et al., 1996; lacking proper cytokinesis could be rescued by U Delley and Hall, 1999; Hsp9p, an Hsp12p homologue in S. pombe; Utsugi et ai., 2002. Actin patch mobility is needed for Fks2p function. V This study. Agarose (model cell wall) is hardened by stress. Fks2p is activated directly by the cell integrity W Mazur and Baginsky, 1996. pathway factor, Rho 1p. Chapter 4 114

CHAPTER 4 GENERAL DISCUSSION AND FUTURE PROSPECTS

GENERAL DISCUSSION

These studies have shown that Hsp 12p resides in the yeast cell wall from where it can be extracted with alkali solutions.

What are the practical consequences of Hsp12p's presence in the cell wall on the yeast cell? One could envisage that yeast cells in the environment require a mechanism to alleviate stresses induced by, for example, the osmotic shock of sudden rainfall or the heat of the sun. These stresses require stress response proteins which require calcium signalling for optimum synthesis. Thus Townby increasing cell wall flexibility, optimum recovery and continued colonization of the nutrient-rich surface would be facilitated. In addition, Hsp12p would aid the yeast cell in invading the substrate and allow it to forage for nutrients. Hsp12pCape would also protect chitin from the cell wall degrading enzymes secretedof by many plants and insects. Indeed, studies on wild yeast may provide even more functions for this multi-stress responsive multi­ functional protein.

We have discovered that Hsp 12p mediates the flexibility of the cell wall in response to a variety of stresses. These stresses are viewed as affecting cell wall flexibility (salts, alcohol, osmoticUniversity shock, heat) or cell wall integrity (damaging enzymes and compounds), as well as resulting in increased membrane fluidity (heat) and an increase in unfolded proteins (all stresses). Furthermore, we have shown that Hsp12p does not mediate its effects through alteration of the expression levels of flocculins or cell wall localised PIR proteins. Instead, Hsp 12p appears to alter the levels of cell wall polysaccharides and protects cell wall chitin.

These studies have provided other yeast stress response researchers with a rapid method to quantify stress using a strain of yeast expressing fluorescent Hsp12p. This strain may also be employed in future in an industrial setting to monitor industrial Chapter 4 115 processes such as ethanol production, enzyme manufacture, etc. and the stresses encountered in these operations. In addition, the use of this strain of yeast as a biosensor to rapidly assess secondary effects of cleaning agents, herbicides, etc. in the environment and to identify new toxins is proposed.

FUTURE PROSPECTS

Further studies could involve: 1. The extraction of cell wall proteins in response to various stresses at various times and at different times in the yeast cell cycle, to determine the kinetics of translocation of Hsp 12p into the cell wall. 2. Investigations into the interaction of Hsp12p with Cyclosporin A binding proteins. 3. Northern blot analysis of HSP12 mRNA levels with simultaneous determination of chitin synthase expression to establish a stoichiometry between the effects of stress on the yeast cell wall and Hsp 12p expression and binding to chitin. 4. The chemistry of Hspl2p-chitin interactions. 5. Investigations into regulatory cross-talk between the cell integrity pathway and other stress response pathways in an rlm1L1 mutant. This mutant, in accordance with the model proposed in Chapter 1 (Figure 1.4), would possibly exhibit decreased expression in response to a variety of stresses. 6. Determination of the effects of oleic acid on HSP 12 induction by analysing the effect of oleicUniversity acid on protein kinase of C Capeactivity, since Town a human homologue of yeast PKC is activated by this fatty acid. 2 7. Measurements of intracellular Ca + and cell wall components in response to various stress conditions as well as at different points in the yeast cell cycle, to confirm the model of Hsp 12p function.

However, these studies may be hampered by the following: 1. Several authors have reported the plasticity of gene regulation in compensating for mutations affecting cell wall integrity, such as enhanced levels of chitin and cross-linking components (Hong et aI., 1994; Gentzsch and Tanner, 1996; Popolo et aI., 1997; Ram et aI., 1998). Chapter 4 116

2. Some cell wall proteins are not essential for viability but do result in decreased cell wall stability (Hagen et ai., 2004). 3. The genetic background of the yeast strain has in many cases been shown to affect phenotypes such as flocculation and invasion. Thus the necessity of 2 Hsp12p in response to stress and Ca + signalling may only be observed in actual "wild" yeast cells, which must be optimally adapted for stress in an unforgiving environment.

Town

Cape of

University 117

REFERENCES

Adya, A.K., Canetta, E., and Walker, G.M. 2006. Atomic force microscopic study of the influence of physical stresses on Saccharomyces cerevisiae and Schizosaccharomyces pombe. FEMS Yeast Res. 6:120-128.

Akhtar, N., Pahlman, A.K., Larsson, K., Corbett, A.H., and Adler, L. 2000. SGD/ encodes an essential nuclear protein of Saccharomyces cerevisiae that affects expression of the GPD / gene for glycerol 3-phosphate dehydrogenase. FEBS Lett. 483:87-92.

Alepuz, P.M., Jovanovic, A., Reiser, V., and Ammerer, G. 2001. Stress-induced MAP kinase Hogl is part of transcription activation complexes. Mol. Cell 7:767-777.

Alexandre, H., Ansanay-Galeote, V., Dequin, S, and Blodin, B. 2001. Global gene expression during short-term ethanol stress in Saccharomyces cerevisiae. FEBS Lett. 498:98-103.

Alonse-Monge, R., Real, E., Wojda, I., Bebelman, J-P., Mager, W.H., and Siderius, M. 2001. Hyperosmotic stress response and regulation of cell wall integrity in S. cerevisiae share common functional aspects. Mol. Microbial. 41:717-730.

Aranda, A., Querol, A., and del Olmo, M. 2002. Correlation between acetaldehyde and ethanol resistance and expression of HSP genes in yeast strains isolated during the biological aging of sherry wines. Arch. Microbial. 177:304-312.

Arellano, M., Valdivieso, M.H., Calonge, T.M., Coli, P.M., Duran, A., and Perez, P. 1999. Schizosaccharomyces pombe protein kinase C homologues, Pcklp and Pck2p, are targets ofRholp and Rh02p and differentially regulate cell integrity. 1. Cell Sci. 112:3569-3578.

Arnott, S., Fulmer, A., and Scott, W.E. 1974. The agarose double helix and its function in agarose gel stlllcture. 1. Mol. BioI. 90:269-284.

Barker, M.G., and Smart, K.A. 1996. Morphological changes associated with the cellular ageing ofa brewing yeast strain. 1. A m. Soc. Brew. Chem. 54: 121-126.

Bartnicki-Garcia, S., Persson, J., and Chanzy, H. 1994. An electron microscope and electron diffraction study of the effect of Calcofluor and Congo Red on the biosynthesis of chitin ill vitro. Arch. Biochem. Biophys. 310:6-15.

Batiza, A.F., Schulz, T., and Masson, P.H. 1996. Yeast respond to hypotonic shock with a calcium pulse. 1. BioI. Choll. 271 :23357-23362.

Beck, T., and Hall, M.N. 1999. The TOR signalling pathway controls nuclear localization of nutrient­ regulated transcriptionUniversity factors. Nature 402:689-692. of Cape Town

Bonner, J.J., Ballou, c., and Fackenthal, D.L. 1994. Interactions between DNA-bound trimers of the yeast heat shock factor. Mol. Cell. BioI. 14:501-508.

Bonilla, M., and Cunningham, K.W. 2003. Mitogen-activated protein kinase stimulation of Cal. signalling is required for survival of endoplasmic reticulum stress in yeast. Mol. BioI. Cell 14:4296- 4305.

Bonilla, M., Nastase, K.K., and Cunningham, K.W. 2002. Essential role of calcineurin in response to endoplasmic reticulum stress. EMB01. 21:2343-2353.

Bony, M., Thines-Sempoux, D., Barre, P., and Blondin, B. 1997. Localization and cell surface anchoring of the Saccharomvces cerevisiae flocculation protein Flo 1p. 1. Bacterial. 179:4929- 4936.

Boorsma, A., de Nobel, H., ter Riet, B., Bargmann, B., Brul, S., Hellingwerf, K.J., and Klis, F.M. 2004. Characterization of the transcriptional response to cell wall stress in Saccharomyces cerevisiae. Yeast 21:413-427. 118

Boorstein, W.R., and Craig, E.A. 1990. Regulation of a yeast HSP70 gene by a cAMP responsive transcriptional control element. EMBO 1. 9:2543-2553.

Bose, S., Weikl, T., Bugl, H., and Buchner, J. 1996. Chaperone function of Hsp90-associated proteins. Science 274: 1715-1717.

Boyd. A.R.. Gunasekera, T.S., Attfield, P.V., Simic, K., Vincent, S.F., and Veal, D.A. 2003. A f1o~v-cytometric method for determination of yeast viability and cell number in a brewery. FEMS Yeast Res. 3:11-16.

Breuder, T., Hemenwayt, C.S., Mowa, N.R., Cardenas, M.E., and Heitman, J. 1994. Calcineurin is essential in cyclosporin A- and FK506-sensitive yeast strains. PNAS 91:5372-5376.

Brewster, J.L., de Valoir, T., Dwyer, N.D., Winter, E., and Gustin, M.e. 1993. An osmosensing signal transduction pathway in yeast. Science 259: 1760-1763.

Bro, e., Regenberg, B., Lagniel, G., Labarre, J., Montero-Lomeli, M., and Nielsen, J. 2003. Transcriptional, proteomic, and metabolic responses to lithium in galactose-grown yeast cells. 1. BioI. Chem.278:32141-32149.

Brown, J.L., Bussey, H., and Stewart, R.e. 1994. Yeast Skn7p functions in a eukaryotic two­ component regulatory pathway. EMBO 1. 13:5186-5194.

Bulawa, e.E. 1993. Genetics and molecular biology of chitin synthesis in fungi. Anl1u. Rev. Microbiol. 47:505-534. Town Burks, G.A., Velegol, D., Paramonova, E., Lindenmuth, B.E., Feick, J.D., and Logan, B.E. 2003. Macroscopic and nanoscale measurements of the adhesion of bacteria with varying outer surface composition. Langmuir 19:2366-2371.

Caba, E .. Dickinson, D.A., Warnes, G.R., and Aubrecht,Cape J. 2005. Differentiating mechanisms of toxicity using global gene expression analysis in Saccharomyces cerevisiae. Mutat Res. 575:34-46.

Cabib. E. 1981. Chitin: structure, metabolism andof regulation of biosynthesis. In: Encyclopedia o/Plant Physiology Vo!. 13B (Tanner. W., and Loewus, F.A., eds), p. 395, Springer Verlag, Berlin, Germany.

Cabib. E.. Roh, D-H., Schmidt, M., Crotti, L.B., and Varma, A. 2001. The yeast cell wall and septum as paradigms of cell growth and morphogenesis. 1. Bio!. Chem. 276: 19679-19682.

Calonge, T.M., Nakano, K., Arellano, M., Arai, R., Katayama, S., Toda, T., Mabuchi, I., and Perez, P. 2000. Schizosaccharomyces pombe Rh02p GTPase regulates cell wall p-glucan biosynthesis through the protein kinase Pck2p. Mol. Bio!. Cell 11 :4393-440 1.

Camesano, T.A., andUniversity Logan, B.E. 2000. Probing bacterial electrosteric interactions using atomic force microscopy. Environ. Sci. Techno!. 34:3354-3362.

Carnero. E .. Ribas. J.C., Garcia, B., Duran, A., and Sanchez, Y. 2000. Schizosaccharomyces pombe Ehs 1p IS involved III maintaining cell wall integrity and in calcium uptake. Mo!. Gen. Genet. 264: 173- 183.

Carrasco, P., Querol. A., and del Olmo, M. 2001. Analysis of the stress resistance of commercial wine yeast strains. Arch. Microbiol. 175:450-457.

Chang, Z., Primm, T.P., Jakana, J., Lee, I.H., Serysheva, I., Chiu, W., Gilbert, H.F., and Quiocho. F.A. 1996. Mvcobacterium tuberculosis 16-kDa antigen (HspI6.3) functions as an oligomeric structure in vitro to suppress thermal aggregation. 1. Bio!. Chem. 271 :7218-7223.

Chi, Y., Huddleston, M.J., Zhang, X., Young, R.A., Annan, R.S., Carr, S.A., and Deshaies, R.J. 2001. Negative regulation of Gcn4 and Msn2 transcription factors by Srb 10 eye lin-dependent kinase. Gelles Del'. 15:1078-1092. 119

Chomczynski, P., and Sacchi, N. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-159.

Cleves, A.E., Cooper, D.N., Barondes, S.H., and Kelly, R.B. 1996. A new pathway for protein export in Saccharomyces cerevisiae. 1. Cell. BioI. 133:1017-1026.

Cormack, B.P., Valdivia, R.H., and Falkow, S. 1996. FACS-optimized mutants of green fluorescent protein (GFP). Gene 173:33-38.

Cowart, L.A., Okamoto, Y., Lu, X., and Hannun, Y.A. 2006. Distinct roles for de novo versus hydrolytic pathways of sphingolipid biosynthesis in Saccharomyces cerel'isiae. Biochem 1. 393:733- 740.

Craig, E.A., Gambill, B.D., and Nelson, R.J. 1993. Heat shock proteins: molecular chaperones of protein biogenesis. Microbiol. Rev. 57:402-414.

Craig, E.A., and Jacobsen, K. 1984. Mutations of the heat inducible 70 kilodalton genes of yeast confer temperature sensitive growth. Cell 38:841-849.

Cunningham, K.W., and Fink, G.R. 1994. Calcineurin-dependent growth control in Saccharomyces 2 ccrcl'isiae mutants lacking PMC}, a homolog of plasma membrane Ca - ATPases. 1. Cell BioI. 124:351-363.

Cyert, M.S. 2003. Calcineurin signaling in Saccharomyces cerevisiac: how yeast go crazy in response to stress. Biochem. Biophy. Res. Commull. 31: 1143-1150. Town Dague, E., Duval, J., Jorand, F., Thomas, F., and Gaboriaud, F. 2006. Probing surface structures of Shewanella spp. by microelectrophoresis. Biophys. 1. In press.

Dallies, N., Francois, J., and Paquet, V. 1998. A new method for quantitative determination of polysaccharides in the yeast cell wall: Application to the Capecell wall defective mutants of Saccharomyces cerevisiac. Yeast 14:1297-1306. of Davenport, K.R., Sohaskey, M., Kamada, Y., Levin, D.E., and Gustin, M.C. 1995. A second osmosensing signal transduction pathway in yeast: hypotonic shock activates the PKCl protein kinase­ regulated cell integrity pathway. 1. BioI. Chem. 270:30157-30161. de Groot, E., Bebelman, J.P., Mager, W.H., and Planta, R.J. 2000. Very low amounts of glucose cause repression of the stress-responsive gene HSP 12 in Saccharomyces cerevisiae. Microbiology 146:367-375.

De Micheli, M., Bille, J., Schueller, c., and Sanglard, D. 2002. A common drug-responsive element mediates the upregulationUniversity of the Candida albicans ABC transporters CDR} and CDR2, two genes involved in antifungal drug resistance. Mol. Microbial. 43: 1197-1214. de Nobel, J.G., Klis, F.M., Priem, J., Munnik, T., and van den Ende, H. 1990. The glucanase­ soluble mannoproteins limit cell wall porosity in Saccharomyces cerevisiae. Yeast 6:491--499. de Nobel, H., Ruiz, c., Martin, H., Morris, W., Brul, S., Molina, M., and Klis, F.M. 2000. Cell wall perturbation results in dual phosphorylation of the Slt2/Mpki MAP kinase and in an Slt2-mediated increase in FKS2-lacZ expression, glucanase resistance and thermotolerance. Microbiology 146:2121- 2132.

De Nadal, E., Zapater, M., Alepuz, P.M., Sumoy, L., Mas, G., and Posas, F. 2004. The MAPK Hogl recruits Rpd3 histone deacetylase to activate osmoresponsive genes. Nature 427:370-374.

DeJong, W.W., Leunissan, J.A.M., and Voorter, C.E.M. 1993. Evolution of the a-crystallin/small heat shock protein family. Mol. Bio!. Eva!. 10:103-126. 120

Delley, P-A., and Hall, M.N. 1999. Cell wall stress depolarizes cell growth via hyperactivation of RHOI. J Cell BioI. 147:163-174.

Delorme, E. 1989. Transfonnation of Saccharomyces cere\'isiae by electroporation. Appl. Environ. Microbial. 55:2242-2246.

Dennis, P.B., Fumagalli, S., and Thomas, G. 1999. Target of rapamycin (TOR): balancing the opposing forces of protein synthesis and degradation. Curro Opil1. Gellet. Dev. 9:49-54.

Dodou, E., and Treisman, R. 1997. The Saccharomyces cerevisiae MADS-box transcription factor Rlml is a target for the Mpkl mitogen-activated protein kinase pathway. Mol. Cell. BioI. 17:1848- 1859.

Dolmetsch, RE., Xu, K., and Lewis, RS. 1998. Calcium oscillations increase the efficiency and specificity of gene expression. Nature 392:933-936.

Donalies, U.E., and Stahl, U. 2001. Phase-specific gene expression in Saccharomyces cerevisiae, using maltose as carbon source under oxygen-limiting conditions. Curro Genet. 39: 150-155.

Doszhinyi, Z., Csizm6k, V., Tompa, P., and Simon, I. 2005. The pairwise energy content estimated from amino acid composition discriminates between folded and intrinsically unstructured proteins. J Mol. BioI. 347:827-839.

Douglas, C.M., Foor, F., Marrinan, J.A., Morin, N., Nielsen, J.B., Dahl, A.M., Mazur, P., Baginsky, W., Li, W., el-Sherbeini, M., Clemas, J.A., Mandala, S.M., TownFrommer, B.R., and Kurtz, M.B. 1994. The Saccharomyces cerevisiae FKSI (ETGI) gene encodes an integral membrane protein which is a subunit of 1,3-~-D-glucan synthase. PNAS 91:12907-12911.

Dufrene, Y.F., Boonaert, c.J.P., van der Mei, H.c., Busscher, H.J., and Rouxhet, P.G. 2001. Probing molecular interactions and mechanical properties of microbial cell surfaces by atomic force microscopy. Ultramicroscopy 86: 113-120. Cape Durr, G., Strayle, J., Plemper, R, Elbs, S., Klee,of S.K., Catty, P., Wolf, D.H., and Rudolph, H.K. 1998. The medial-Golgi ion pump Pmrl supplies the yeast secretory pathway with cit and Mn2+ required for glycosylation, sorting and endoplasmic reticulum-associated protein degradation. Mol. BioI. Cell 9: 1149-1162.

Dutton, J.R., Johns, S., and Miller, B.L. 1997. StuAp is a sequence-specific transcription factor that regulates developmental complexity in Aspergillus nidulalls. EMBO J 16:5710-5721.

Duval, J.F., and van Leeuwen, H.P. 2004. Electrokinetics of diffuse soft interfaces. 1. limit of low donnan potentials. Lallgmuir 20: 10324-1 0336.

DuYal, J.F.L., Busscher,University H.J., van de Belt-Gritter, B., van der Mei, H.C., and Norde, W. 2005. Analysis of the mterfacial properties of fibrillated and nonfibrillated oral Streptococcal strains from electrophoretic mobility and titration measurements: evidence for the shortcomings of the 'classical soft-particle approach'. Langmuir 21: 11268-11282.

Eriksson, P., Alipour, H., Adler, L., and Blomberg, A. 2000. Rap 1p-binding sites in the Saccharomyces cerevisiae GPD I promoter are involved in its response to NaCl. J BioI. Chem. 275:29368-29376.

Ferguson, S.B., Anderson, E.S., Harshaw, R.B., Thate, T., Craig, N.L., and Nelson, H.C. 2005. Protein kinase A regulates constitutive expression of small heat-shock genes in an Msn2/4p­ independent and Hsfl p-dependent manner in Saccharomyces cerevisiae. Genetics 169: 1203-1214.

Fernandes, P.M., Domitrovic, T., Kao, C.M., and Kurtenbach, E. 2004. Genome expression pattern in Saccharom\'ces cerevisiae cells in response to high hydrostatic pressure. FEBS Lett. 556: 153-160. 121

Fernandes, P.M.B., Farina, M., and Kurtenbach, E. 2001. Effect of hydrostatic pressure on the morphology and ultrastructure of wild-type and trehalose synthase mutant cells of Saccharomyces cerevisiae. Appl. Microbiol. Lett. 32:42-46.

Ferrell, J.E. 1996. Tripping the switch fantastic: how a protein kinase cascade can convert graded inputs into switch-like outputs. Trends Biochem. Sci. 21:460-466.

Ferrigno, P., Posas, F., Koepp, D., Saito, H., and Silver, P.A. 1998. Regulated nucleo/cytoplasmic exchange of HOGI MAP kinase requires the importin beta homologs NMD5 and XP01. EMBO 1. 17:5606-5614.

Firon, A., Lesage, G., and Bussey, H. 2004. Integrative studies put cell wall synthesis on the yeast functional map. Curl'. Opil1. Microbiol. 7:617-623.

FraDl;ois, J., B1azquez, M.A., Arino, J., and Gancedo, C. 1997. Storage carbohydrates in the yeast Saccharomyces cerevisiae. In: Yeast Sugar Metaholism (Zimmermann, F. K., Entian, K.D., eds), pp. 285-311, Technomics Publishing Co. Inc., Lancaster, PA, USA.

Freeman, B.c., and Morimoto, R.I. 1996. The human cytosolic molecular chaperones hsp90, hsp70 (hsc70) and hdj-l have distinct roles in recognition of a non-native protein and protein refolding. EMBO 1. 15:2969-2979.

Gaboriaud, F., Bailet, S., Dague, E., and Jorand, F. 2005. Surface structure and nanomechanical properties of Shewanella putrefaciens bacteria at two pH values (4 and 10) determined by atomic force microscopy. 1. Bacteriol. 187:3864-3868. Town Galichet, A., Sockalingum, G.D., Belarbi, A., and Manfait, M. 2001. FTIR spectroscopic analysis of Saccharomyces cerevisiae cell walls: study of an anomalous strain exhibiting a pink-coloured cell phenotype. FEMS Microbiol. Lett. 197: 179-186.

Gancedo, J.M. 2001. Control of pseudohyphae formationCape III Saccharomyces cerevisiae. FEMS Microbiol Rev. 25:107-123. of Garcia, R., Bermejo, c., Grau, c., Perez, R., Rodriguez-Pen, J.M., Francois, J., Nombela, c., and Arroyo, J. 2004. The global transcriptional response to transient cell wall damage in Saccharomyces cerevisiae and its regulation by the cell integrity signaling pathway. 1. BioI. Chem. 279: 15183-15195.

Gentzsch. M., and Tanner, W. 1996. The PMT gene family: protein O-glycosylation in Saccharomyces cerevisiae is vital. EMB01. 15:5752-5759.

Gimeno, c.J., Ljungdahl, P.O., Styles, C.A., and Fink, G.R. 1992. Unipolar cell divisions in the yeast Saccharomyces cerevisiae lead to filamentous growth: regulation by starvation and RAS. Cell 68: 1077-1090. University Gorner, W., Durchschlag, E., Martinez-Pastor, M.T., Estruch, F., Ammerer, G., Hamilton, B., Ruis, H., and Schuller, C. 1998. Nuclear localization of the C2H2 zinc finger protein Msn2p is regulated by stress and protein kinase A activity. Genes Dev. 12:586-597.

Gounalaki, N, and Thireos, G. 1994. Yaplp, a yeast transcriptional activator that mediates multidrug resistance, regulates the metabolic stress response. EMBO 1. 13:4036 - 4041.

Gray, J.V., Ogas, J.P., Kamada, Y., Stone, M., Levin, D.E., and Herskowitz, I. 1997. A role for the Pkc 1 Map kinase pathway of Saccharomyces cerevisiae in bud emergence and identification of a putative upstream regulator. EMBO 1. 16:4924-4937.

Green, N.M. 1963. Avidin. 3. The nature of the biotin-binding site. Biochem. 1. 89:599-609.

Griess, G.A., Moreno, E.T., Easom, R.A., and Serwer, P. 1989. The sieving of spheres during agarose gel electrophoresis: quantitation and modelling. Biopolym. 28: 1475-1484. 122

Guo, B., Styles, C.A., Feng, Q., and Fink, G.R. 2000. A Saccharomyces gene family involved in invasive growth, cell- cell adhesion, and mating. PNAS 97: 12158-12163.

Gupta, S., Sharma, S.c., and Singh, B. 1994. Changes in the composition and peroxidation of yeast membrane lipids during ethanol stress. Acta Microhiol. !lIlmunol. Hung. 41: 197-204.

Gygi, S.P., Rochon, Y., Franza, B.R., and Aebersold, R. 1999. Correlation between protein and mRNA abundance in yeast. Mol. Cell. BioI. 19: 1720-1730.

Hagen, I., Ecker, M., Lagorce, A., Francois, J.M., Sestak, S., Rachel, R., Grossmann, G., Hauser, N.C., Hoheisel, J.D., Tanner, W., and Strahl, S. 2004. Sedlp and Srllp are required to compensate for cell wall instability in Saccharomyces cerevisiae mutants defective in multiple GPI-anchored mannoproteins. Mol. Microbial. 52: 1413-25.

Harrison, c.J., Bohm, A.A., and Nelson, H.C. 1994. Crystal structure of the DNA binding domain of the heat shock transcription factor. Science 263:224-227.

Harrison, J.c., Bardes, E.S., Ohya, Y., and Lew, D.J. 2001. A role for the Pkc1p/Mpklp kinase cascade in the morphogenesis checkpoint. Nat. Cell BioI. 3:417-420.

Higgins, V.J., Rogers, P.J., and Dawes, I.W. 2003. Application of genome-wide expression analysis to identify molecular markers useful in monitoring industrial fermentations. Appl. Environ. Microbial. 69:7535-7540. Hirata, D., Harada, S., Namba, H., and Miyakawa, T. 1995. AdaptationTown to high-salt stress in Saccharomyces cerevisiae is regulated by Ca2+/calmodulin-dependent phosphoprotein phosphatase (calcineurin) and cAMP-dependent protein kinase. Mol. Gen. Genet. 249:257-264.

Hirata, Y., Andoh, T., Asahara, T., and Kikuchi, A. 2003. Yeast glycogen synthase kinase-3 activates Msn2p-dependent transcription of stress responsiveCape genes. Mol. BioI. Cell 14:302-312. Ho, Y., Gruhler, A., Heilbut, A., Bader, G.D., Moore, L., Adams, S.L., Millar, A., Taylor, P., Bennett, K., Boutilier, K., Yang, L., Wolting, c.,of Donaldson, I., Schandorff, S., Shewnarane, J., Yo, M., Taggart, J., Goudreault, M., Muskat, B., Alfarano, c., Dewar, D., Lin, Z., Michalickova, K., Willems, A.R., Sassi, H., Nielsen, P.A., Rasmussen, K.J., Andersen, J.R., Johansen, L.E., Hansen, L.H., Jespersen, H., Podtelejnikov, A., Nielsen, E., Crawford, J., Poulsen, V., Sorensen, B.D., Matthiesen, J., Hendrickson, R.C., Gleeson, F., Pawson, T., Moran, M.F., Durocher, D., Mann, M., Hogue, C.W., Figeys, D., and Tyers, M. 2002. Systematic identification of protein complexes in Saccharomyces cerevisiae by mass spectrometry. Nature 415: 180-183.

Hochachka, P .. and Somero, G. 2002. Biochemical Adaptations: Mechanisms and Processes in Physiological Emlution,University Oxford University Press, NY, USA. Hohmann, S. 2002. Osmotic stress signaling and osmoadaptation in yeasts. Microbial. Mol. BioI. Rev. 66:300-372.

Hong, Z., Mann, P., Shaw, K. J., and DiDomenico, B. 1994. Analysis of ~-glucans and chitin in a Saccharoll1\'ces cerel'isiae cell wall mutant using high-performance liquid chromatography. Yeast 10: 1083-1092.

Horwitz, J. 1992. a-Crystallin can function as a molecular chaperone. PNAS 89: 10449-10453.

Huang, D., Wilson, W.A., and Roach, P.J. 1997. Glucose-6-P control of glycogen synthase phosphorylation in yeast. 1. BioI. Chem. 272:22495-22501.

Huang, C-Y, and Ferrell, J.E. 1996. Ultrasensitivity in the mitogen-activated protein kinase cascade. PNAS 93:10078-10083.

Huh, W-K., Falvo, J.V., Gerke, L.C., Carroll, A.S., Howson, R.W., Weissman, J.S., and O'Shea, E.K. 2003. Global analysis of protein localization in budding yeast. Nature 425:686-691. 123

Igual, J.c., Johnson, A.L., and Johnston, L.H. 1996. Coordinated regulation of gene expression by the cell cycle transcription factor SWI4 and the protein kinase C MAP kinase pathway for yeast cell integrity. EMB01. 15:5001-5013.

Igual, J.c., and Estruch, F. 2000. Signalling stress in yeast. Food tecllllo!. biotecllllol. 38:263-276.

Iida, H., Nakamura, H., Ono, T., Okumura, M. S., and Anraku, Y. 1994. MIDI, a novel Saccharomyces cerel'isiae gene encoding a plasma membrane protein, is required for Cal' influx and mating. Mol. Cell. Biol. 14:8259-8271.

Ivorra, C., Perez-Ortin, J.E., and del Olmo, M. 1999. An inverse correlation between stress resistance and stuck fermentations in wine yeasts. A molecular study. Biotechnol. Bioeng. 64:698-708.

Iwahashi, H., Kaul, S. c., Obuchi, K. and Komatsu, Y. 1991. Induction of barotolerance by heat shock treatment in yeast. FEMS Microbial. Lett. 80:325-328.

Iwahashi, H., Obuchi, K., Fujii, S., and Komatsu, Y. 1997. Barotolerance is dependent on both trehalose and heat shock protein 104 but is essentially different from thermotolerance in Saccharomyces cerevisiae. Appl. Microbial. Lett. 25:43--47.

Iwahashi, H., Obuchi, K., Fujii, S., and Komatsu, Y. 1995. The correlative evidence suggesting that trehalose stabilizes membrane structure in the yeast Saccharomyces cerel'isiae. Cell. Mol. BioI. 41:763-769. Jacoby, J.J., Schmitz, H.P., and Heinisch, J.J. 1997. Mutants affected Townin the putative diacylglycerol binding site of yeast protein kinase C. FEBS Lett. 417:219-222.

James, P., Pfund, C., and Craig, E.A. 1997. Functional specificity among Hsp70 molecular chaperones. Science 275:387-389.

Jamieson, D.J. 1992. Saccharomyces cerevIszae has distinctCape adaptive responses to both hydrogen peroxide and menadione. 1. Bacterial. 174:6678-6681.of Jang, Y-J., Park, S-K., and Yoo, H-S. 1996. Isolation of an HSPl2-homologous gene of Schi:::asaccharomyces pombe suppressing a temperature-sensitive mutant allele of cdc4. Gene 172: 125- 129.

Jin Y-L., Ritcey, L.L., Speers, R.A.R., and Dolphin, P.J. 2001. Effect of cell surface hydrophobicity, charge and zymolectin density on the flocculation of Saccharomyces cerevisiae. 1. Am. Soc. Brew. Chem.59:1-9.

Jin, Y-L., and Speers, A. 2000. Effect of environmental conditions on the flocculation of Saccharomyces cerel'isiae.University 1. Am. Soc. Brew. Chon. 58:108-116. Jung, U.S., and Levin, D.E. 1999. Genome-wide analysis of gene expression regulated by the yeast cell wall integrity signaling pathway. Mol. Microbial. 34: 1049-1057.

Kamada, Y., Jung, U.S., Piotrowski, R., and Levin, D.E. 1995. The protein kinase C-activated MAP kinase pathway of Saccharomyces cerevisiae mediates a novel aspect of the heat shock rcsponse. Genes Del'. 9:1559-1571.

Kandror, 0., Bretschneider, N., Kreydin, E., Cavalieri, D., and Goldberg, A.L. 2004. Yeast adapt to near-freezing temperatures by STRE/Msn2,4-dependent induction of trehalose synthesis and certain molecular chaperones. Mol. Cell. 13:771-781.

Kanzaki. M., Nagasawa, M .. Kojima, I., Sato, c., Naruse, K., Sokabe, M., and Iida, H. 1999. Molecular identification of a eukaryotic, stretch-activated nonselective cation channel. Science 285:882-886. 124

Kanzaki, M., Nagasawa, M., Kojima, I., Sato, e., Naruse, K., Sokabe, M., and Iida, H. 2000. Report clarification. Science 288: 1347.

Kapteyn, J.e., Van Egmond, P., Sievi, E., Van Den Ende, H., Makarow, M., and Klis, F.M. 1999. The contribution of the O-glycosylated protein Pir2p/Hsp 150 to the construction of the yeast cell wall in wild-type cells and beta 1,6-glucan-deficient mutants. Mol. Microbial. 31: 1835-1844.

Ketela, T., Green, R., and Bussey, H. 1999. Saccharomyces cerevisiae Mid2p is a potential cell wall stress sensor and upstream activator of the PKCI-MPKI cell integrity pathway. 1. Bacterial. 181 :3330-3340.

Khan, W.A., Blobe, G.e., and Hannunt, Y.A. 1992. Activation of Protein Kinase C by Oleic Acid; determination and analysis of inhibition by detergent micelles and physiologic membranes: requirement for free oleate. 1. BioI. Chem. 267:3605-3612.

Klis, F.M. 1994. Cell wall assembly in yeast. Yeast 10:851-869.

Klis, F.M., Mol, P., Hellingwerf, K., and Brul, S. 2002. Dynamics of cell wall structure in Saccharomyces cerevisiae. FEMS Microbial. Rev. 26: 1-8.

Kobayashi, N., and McEntee, K. 1993. Identification of cis and trans components of a novel heat shock stress regulatory pathway in Saccharomyces cerevisiae. Mol. Cell. BioI. 13:248-256.

Kopecka, M., and Gabriel, M. 1992. The influence of Congo Red on the cell wall and (1-+3)-~-D­ glucan microfibril biogenesis in Saccharomyces cerevisiae. Arch. Microbial.Town 158: 115-126.

Kron, S.J. 1997. Filamentous growth in budding yeast. Trends Microbial. 5:450-454.

Kuge, S., Jones, N., and Nomoto, A. 1997. Regulation of yAP-l nuclear localization in response to oxidative stress. EMB01. 16:1710-1720. Cape Kyte J., and Doolittle, R.F. 1982. A simple method for displaying the hydropathic character of a protein. 1. Mol. BioI. 157:105-132. of Laemmli, U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.

Lagorce, A., Hauser, N.e., Labourdette, D., Rodriguez, e., Martin-Yken, H., Arroyo, J., Hoheisel, J.D., and Francois, J. 2003. Genome-wide analysis of the response to cell wall mutations in the yeast Saccharomyces cerevisiae. 1. BioI. Chem. 278:20345-20357.

Lambrechts, M.G., Bauer, F.F., Marmur, J., and Pretorius, I.S. 1996. Muc1, a mucin-like protein that is regulated by MssUniversity 10, is critical for pseudohyphal differentiation in yeast. PNAS 16:8419-8424. Laurell, e.B. 1966. Quantitative estimation of proteins by electrophoresis in agarose gel containing antibodies. Anal. Biochem. 15:45-52.

Lavoie, J.N .. Hickey, E., Weber, L.A., and Landry, J. 1993. Modulation of actin micro filament dynamics and fluid phase pinocytosis by phosphorylation of heat shock protein 27. J. Biol. Chem. 268:24210-24214.

Levin, D.E. 2005. Cell wall integrity signaling in Saccharomyces cerevisiae. Micro. Mol. BioI. Rev. 69:262-291.

Levin, D.E., Fields, F.O., Kunisawa, R., Bishop, J.M., and Thorner, J. 1990. A candidate protein kinase C gene. PKC I, is required for the S. cerevisiae cell cycle. Cell 62:213-224.

Li, J., Steen, H., and Gygi, S.P. 2003. Protein profiling with cleavable isotope-coded affinity tag (CICA T) reagents: the yeast salinity stress response. Mol. Cell. Proteom. 2: 1198-1204. 125

Lillie, S.H., and Pringle, J.R. 1980. Reserve carbohydrate metabolism in Saccharomyces cerevisiae: responses to nutrient limitation. J. Bacterial. 143: 1384-1394.

Lipke, P.N., and Ovalle, R. 1998. Cell wall architecture in yeast: new structure and new challenges. J. Bacterial. 180:3735-3740.

Lisse, T., Bartels, D., Kalbitzer, H.R., and Jaenicke, R. 1996. The recombinant dehydrin-like desiccation stress protein from the resurrection plant Craterostigma plantagineum displays no defined three-dimensional structure in its native state. Bio!. Chem. 377:555-651.

Liu, H., Styles, C.A., and Fink, G.R. 1996. Saccharomyces cerevisiae S288C has a mutation III FL08, a gene required for filamentous growth. Genetics 144:967-978.

Lo, W-S., and Dranginis, A.M. 1998. The cell-surface floc cui in Floll is required for pseudohyphae formation and invasion by Saccharomyces cerevisiae. Mol. BioI. Cell 9: 161-171.

Lo, W-S., and Dranginis, A.M. 1996. FLOil, a yeast gene related to the STA genes, encodes a novel ce 11 surface flocculin. J Bacterial. 178:7144--7151.

Lo, W-S., Raitses, E.I., and Dranginis, A.M. 1997. Development of pseudohyphae by embedded haploid and diploid yeast. Curro Genet. 32:197-202.

Locke, E.G., Bonilla, M., Liang, L., Takita, Y., and Cunningham, KW. 2000. A homolog of voltage-gated Ca"" channels stimulated by depletion of secretory Ca"' in yeast. Mol. Cell. Bio!. 20:6686-6694. Town Machova, E., Kvapilova, K., Kogan, G., and Sandula, J. 1999. Effect of ultrasonic treatment on the molecular weight of carboxymethylated chitin-glucan complex from Aspergillus niger. Ultrason. SOllochem. 5: 169-172.

Madhani, H.D., and Fink, G.R. 1997. Combinatorial Capecontrol required for the specificity of yeast MAPK signaling. Science 275:1314-1317. of Maeda, T., Takekawa, M., and Saito, H. 1995. Activation of yeast PBS2 MAPKK by MAPKKKs or by binding of an SH3-containing osmosensor. Science 269:554-558.

Maeda, T., Wurgler-Murphy, S., and Saito, H. 1994. A two-component system that regulates an osmosensing MAP kinase cascade in yeast. Nature 369:242-245.

Mager, W.H., and de Kruijff, A.J.J. 1995. Stress induced transcriptional activation. Microbial. Rev. 59:506-531. Marchler, G., Schiiller,University C., Adam, G., and Ruis, H. 1993. A Saccharomyces cerevisiae UAS element controlled by protein kinase A activates transcription in response to a variety of stress conditions. EMBOJ. 12:1997-2003.

Martin, H., Rodriguez-Pachon, J.M., Ruiz, C., Nombela, c., and Molina, M. 2000. Regulatory mechanisms for modulation of signaling through the cell integrity Slt2-mediated pathway in Saccharomyces cerevisiae. J Biol. Chem. 275: 1511-1519.

Martinez-Pastor, M.T., Marchler, G., Schiiller, c., Marchler-Bauer, A., Ruis, H., and Estruch, F. 1996. The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress-response element (STRE). EMBO J. 15:2227-2235.

Matheos, D.P., Kingsbury, T.J., Ahsan, U.S., and Cunningham, KW. 1997. Tcnlp/Crzlp, a calcineurin-dependent transcription factor that differentially regulates gene expreSSIon III Saccharomyces cerevisiae. Gelles Dev. 11:3445-3458.

Mazur, P .. and Baginsky, W. 1996. in vitro activity of 1,3-P-D-glucan synthase requires the GTP­ binding protein Rho 1. J BioI. Chem. 271:14604-14609. 126

Mazur, P., Morin, N., Baginsky, W., el-Sherbeini, M., Clemas, J.A., Nielsen, J.B., and Foor, F. 1995. Differential expression and function of two homologous subunits of yeast 1,3-P-D-glucan synthase. Mol. Cell. BioI. 15:5671-5681.

Measday, V., Moore, L., Retnakaran, R., Lee, J., Donoviel, M., Neiman, A.M., and Andrews, B. 1997. A family of cyclin-like proteins that interact with the Ph085 cyclin-dependent kinase. Mol. Cell. BioI. 17:1212-1223.

Mentre, P., Hamraoui, L., Hui Bon Hoa, G., and Debey, P. 1999. Pressure-sensitivity of endoplasmic reticulum membrane and nucleolus as revealed by electron microscopy. Cell. Mol. BioI. 45:353-362.

Michell, A.J., and Scurfield, G. 1970. An assessment of infrared spectra as indicators of fungal celJ walJ composition. Alist. 1. Bio!. Sci. 23:345-360.

Mirabella Jr, F.M., and Harrick, N.J. 1985. Internal reflection spectroscopy: review and sliPplement, Harrick Scientific Corporation, NY, USA.

Miyake, T., Reese, J., Loch, C.M., Auble, D.T., and Li, R. 2004. Genome-wide analysis of ARS (autonomously replicating sequence) binding factor 1 (Abfl P)-mediated transcriptional regulation in Saccharomyces c-erel·isiae. 1. BioI. Chem. 279:34865-34872.

Molano, J., Bowers, B., and Cabib, E. 1980. Distribution of chitin m the yeast cell wall. An ultrastructural and chemical study. 1. Cell BioI. 85: 199-212. Town Momose, Y., and Iwahashi, H. 2001. Bioassay of cadmium using a DNA microarray: genome-wide expression patterns of Saccharomyces cerevisiae response to cadmium. Em'iron. Toxico!. Chem. 20:2353-2360.

Morimoto, R.I. 1993. Cells in stress: transcriptional activation of heat shock genes. Science 259: 1409- 1410. Cape Motshwene, P., Brandt, W., and Lindsey, G. 2003.of Significant quantities of the glycolytic enzyme phosphoglycerate mutase are present in the cell walJ of yeast Saccharomyces cerevisiae. Biochem. 1. 369:357-362.

Motshwene, P .. Karreman, R., Kgari, G., Brandt, W., and Lindsey, G. 2004. LEA (late embryonic abundant)-like protein Hsp12p (heat-shock protein 12) is present in the cell walJ and enhances the barotolerance of the yeast Saccharomyces cerevisiae. Biochem. 1. 377:769-774.

Mrsa, V., Seidl, T., Gentzsch, M., and Tanner, W. 1997. Specific labelJing of celJ wall proteins by biotinylation. Identification of four covalently linked O-mannosylated proteins of Saccharomyces cerevisiae. Yeast 13:1145-1154.University Mrsa. V., and Tanner, W. 1999. Role of NaOH-extractable cell wall protems Ccw5p, Ccw6p, Ccw7p and Ccw8p (members of the PIR protein family) in stability of the Saccharomyces cerevisiae cell wall. Yeast 15:813-820.

Mtwisha, L., Brandt, W.F., McCready, S., and Lindsey, G.G. 1998. HSP 12 is a LEA-likc protcin in Saccharomyces cerevisiae. Plant Mol. BioI. 37:513-521.

2 Muller, E.M.. Locke, E.G., and Cunningham, K.W. 2001. Differential regulation of two Ca + influx systems by pheromone signalling in Saccharomyces cerevisiae. Genetics 159:1527-1538.

Nehlin. J.O .• Carlberg, M., and Ronne, H. 1991. Control of yeast GAL genes by MIG! repressor: a transcriptional cascade in the glucose response. EMB01. 10:3373-3377.

Nurrish. S.J.. and Treisman, R. 1995. DNA binding specificity determinants III MADS-box transcription factors. Mol. Cell. Bio!. 15:4076-4085. 127

Obrink, B. 1968. Characterization of fiber parameters in agarose gels by light scattering. J. Chroma!. 37:329~330.

Ogas, J., Andrews, B.J., and Herskowitz, I. 1991. Transcriptional activation of CLN1, CLN2 and a putative new G I cyclin (HCS26) by Swi4, a positive regulator of G I specific transcription. Cell 66:1015~1026.

Orlean, P. 1997. Biogenesis of yeast wall and surface components. In: The molecular biology o/the .l'east Saccharomyces, Volume 3, (Pringle, J.R., Broach, J.R., and Jones, E.W., eds.), pp. 229~362, Cold Spring Harbor, NY.

Palhano, F.L., Orlando, M.T.D., and Fernandes, P.M.B. 2004. Induction of baroresistance by hydrogen peroxide, ethanol and cold-shock in Saccharomyces cerevisiae. FEMS Microbiol. Lett. 233:139.

Pancaldi, S., Poli, F., Dall'olio, G., and Vannini, G.L. 1985. Anomalous morphogenetic events in yeasts exposed to the polysaccharide-binding dye Congo Red. Caryologia 38:247~256.

Pardo, M., Monteoliva, L., Pia, J., Sanchez, M., Gil, c., and Nombela, C. 1999. Two-dimensional analysis of proteins secreted by Saccharomyces cerevisiae regenerating protoplasts: a novel approach to study the cell wall. Yeast 15:459--472.

Pascual-Ahuir, A., Serrano, R., and Proft, M. 2001. The Skolp repressor and Gcn4p activator antagonistically modulate stress-regulated transcription in Saccharolllyces cerevisiae. Mol. Cell. Bial. 21:16~25. Town Pederson, B.A., Wilson, W.A., and Roach, P.J. 2004. Glycogen synthase sensitivity to glucose-6-P is important for controlling glycogen accumulation in Saccharomyces cerevisiae. J. Bial. Chem. 279: 13 764~ 13 768.

Pedruzzi, I., Burckert, N., Egger, P., and de Virgilio, C.Cape 2000. Saccharomyces cerevisiae Ras/cAMP pathway controls post-diauxic shift element-dependent transcription through the zinc finger protein Gis1. EMBO J. 19:2569~2579. of Pelham, H.R.B., and Bienz, M. 1982. A synthetic heat shock promoter element confers heat inducibility on the herpes-simplex virus thymidine kinase gene. EMBO J. 1: 1473~ 1477.

Perez-Torrado, R., Bruno-Barcena, J.M., and Matallana, E. 2005. Monitoring stress-related genes during the process of biomass propagation of Saccharomyces cerevisiae strains used for wine making. Appl. Ellviron. Microbiol. 71 :6831 ~6837.

Perez-Torrado, R., Carrasco, P., Aranda, A., Gimeno-Alcaniz, J., Perez-Ortin, J.E., Matallana, E., and del Olmo, M.L.University 2002. Study of the first hours of microvinification by the use of osmotic stress-response genes as probes. Syst. Appl. Microbiol. 25: 153~ 161.

Philip, B.. and Levin. D.E. 2001. Wsc1 and Mid2 are cell surface sensors for cell wall integrity signaling that act through Rom2, a guanine nucleotide exchange factor for Rho I. Mol. Cell. BioI. 21:271~280.

Phillips, D.C. 1966. The three-dimensional structure of an enzyme molecule. Sci. Amer. 215:75~80.

Piper. P .W. 1995. The heat shock and ethanol stress responses of yeast exhibit extensive similarity and functional overlap. FEMS Microbiol. Lett. 134:121~127.

Popolo, L., Gilardelli, D., Bonfante, P., and Vai, M. 1997. Increase in chitin as an essential response to defects in assembly of cell wall polymers in the ggp 1iJ mutant of Saccharomyces cerevisiae. J. Bactenol. 179:463--469.

Posas. F .• Takekawa. M., and Saito, H. 1998. Signal transduction by MAP kinase cascades in budding yeast. Curro Opin. Microbial. 1: 17 5~ 182. 128

Praekelt, U.M., and Meacock, P.A. 1990. HSP 12, a new small heat shock gene of Saccharomyces cerevisiae: Analysis of structure, regulation and function. Mol. Gell. Genet. 223:97-106.

Proft, M. and Serrano, R. 1999. Repressors and upstream repressing sequences of the stress-regulated ENA I gene in Saccharomyces cerevisiae: bZIP protein Sko 1p confers HOG-dependent osmotic regulation. Mol. Cell. BioI. 19:537-546.

Proft, M., Pascual-Ahuir, A., de Nadal, E., Arino, J., Serrano, R., and Posas, F. 2001. Regulation of the Sko 1 transcriptional repressor by the Hog 1 MAP kinase in response to osmotic stress. EMBO J. 20:1123-1133.

Raclavsky, V., Novotny, R., Smigova, J., and Vojkuvka, Z. 1999. Nikkomycin Z counteracts Rylux BSU and Congo Red inhibition of Saccharomyces cerevisiae growth but does not prevent formation of aberrant cell walls. Folia Microbial. (Praha) 44:663-668.

Rajavel, M., Philip, B., Bueher, B.M., Errede, B., and Levin, D.E. 1999. Mid2 is a putative sensor for cell integrity signaling in Saccharomyces cerevisiae. Mol. Cell. BioI. 19:3969-3976.

Ram, A. F. J., Wolters, A., ten Hoopen, R., and Klis, F. M. 1994. A new approach for isolating cell wall mutants in Saccharomyces cerevisiae by screening for hypersensitivity to Calcotluor White. Yeast 10:1019-1030.

Ram, A.F., Kapteyn, J.e., Montijn, R.e., Caro, L.H., Douwes, J.E., Baginsky, W., Mazur, P., van den Ende, H., and Klis, F.M. 1998. Loss of the plasma membrane-bound protein Gaslp in Saccharomyces cerevisiae results in the release of p-l,3-glucan into Townthe medium and induces a compensation mechanism to ensure cell wall integrity. 1. Bacterial. 180: 1418-1424.

Reiser, V., Ruis, H., and Ammerer, G. 1999. Kinase activity-dependent nuclear export opposes stress-induced nuclear accumulation and retention of Hog 1 mitogen-activated protein kinase in the budding yeast Saccharomyces cerevisiae. Mol. Bioi. Cel/l0:Cape 1147-1161. Rep, M., Krantz, M., Thevelein, J.M., and Hohmann, S. 2000. The transcriptional response of Saccharomyces cerevisiae to osmotic shock: Hotl pof and Msn2p/Msn4p are required for the induction of subsets of high osmolarity glycerol pathway-dependent genes. 1. BioI. Chem. 275:8290-8300.

Rep, M., Reiser, V., Gartner, U., Thevelein, J.M., Hohmann, S., Ammerer, G., and Ruis, H. 1999. Osmotic stress-induced gene expression in Saccharomyces cerevisiae requires Msnlp and the novel nuclear factor Hotlp. Mol. Cell. BioI. 19:5474-5485.

Reynolds, T.B., and Fink, G.R. 2001. Bakers' yeast, a model for fungal biofilm fomution. Science 291 :878-881. Risse, G., Jooss, K., UniversityNeuberg, M., Bruller, H.J., and Muller, R. 1989. Asymmetrical recognition of the palindromic API binding site (TRE) by Fos protein complexes. EMBO 1. 8:3825-3832.

Roberts, e.J., Nelson, B., Marton, M.J., Stoughton, R., Meyer, M.R., Bennett, H.A., He, Y.D .• Dai, Hoo Walker. W.L., Hughes, T.R., Tyers. M., Boone, e., and Friend, S.H. 2000. Signaling and circuitry of multiple MAPK pathways revealed by a matrix of global gene expression profiles. Science 287:873-880.

Roberts, R.L.. and Fink, G.R. 1994. Elements of a single MAP kinase cascade in Saccharomyces cerevisiae mediate two developmental programs in the same cell type: mating and invasive growth. Genes Del'. 8:2974-2985.

Rodriguez. V.V., Busscher, H.J., Norde, W., and van der Mei, H.e. 2002. Softness of the bacterial cell wall of Streptococcus mitis as probed by microelectrophoresis. Electrophoresis 23:2007-2011.

Rodriguez-Pena, J.M., Perez-Diaz, R.M., Alvarez, S., Bermejo, e., Garcia, R., Santiago, e., Nombela, e., and Arroyo, J. 2005. The 'yeast cell wall chip' - a tool to analyse the regulation of cell wall biogenesis in Saccharomyces cerevisiae. Microbiology 151:2241-2249. 129

Rodriguez-Vargas, S., Estruch, F., and Randez-Gil, F. 2002. Gene expression analysis of cold and freeze stress in baker's yeast. Appl. Environ. Microbiol. 68:3024-3030.

Rondon, A.G., Garcia-Rubio, M., Gonzalez-Barrera, S., and Aguilera, A. 2003. Molecular evidence for a positive role of Spt4 in transcription elongation. EMBO 1. 22:612-620.

Ruis, H., and Schuller, C. 1995. Stress signalling in yeast. Bioessays 17:959-965.

Rusnak, F., and Mertz, P. 2000. Calcineurin: form and function. Physiol. Rev. 80:1483-1521.

Russell, M., Bradshaw-Rouse, J., Markwardt, D., and Heideman, W. 1993. Changes in gene expression in the Ras/adenylate cyclase system of S. cerevisiae: correlation with cAMP levels and growth. Mol. BioI. Cell 4:757-765.

Russouw, P.S., Farrant, J.M., Brandt, W.F., Maeder, D., and Lindsey, G.G. 1995. Isolation and characterisation of a heat soluble protein from pea (PisulI1 sativllll1) embryos. Seed Sci. Res. 5: l37-144.

Sahara, T., Goda, T., and Ohgiva, S. 2002. Comprehensive expression analysis of time-dependent genetic responses in yeast cells to low temperature. 1. BioI. Chem. 277:50015-5002l.

Sales, K., Brandt, W.F., Rumbak, E., and Lindsey, G.G. 2000. The LEA-like protein HSP 12 in Saccharomyces cerevisiae has a plasma membrane location and protects membranes against desiccation and ethanol-induced stress. Biochim. Biophys. Acta 1463:267-278. Sanchez, Y., and Lindquist, S.L. 1990. HSP 104 required for inducedTown thermotolerance. Science 248:1112-1115.

Santoro, N., and Thiele, D.J. 1997. Oxidative Stress Response in Yeast. In: Yeast Stress Responses (Hohmann, S., and Mager, W.H., eds.), pp. 171-211, Springer-Verlag, HeIdelberg, Germany.

Schade, B., Jansen, G., Whiteway, M., Entian, K.D., Capeand Thomas, D.Y. 2004. Cold adaptation in budding yeast. Mol. BioI. Cell 15:5492-5502. of Schaus, S.E., Cavalieri, D., and Myers, A.G. 200l. Gene transcription analysis of Saccharomyces cerevisiae exposed to neocarzinostatin protein-chromophore complex reveals evidence of DNA damage, a potential mechanism of resistance, and consequences of prolonged exposure. PNAS 98: 11 075-11 080.

Schmitt, A.P., and McEntee, K. 1996. Msn2p, a zinc finger DNA-binding protein, is the transcriptional activator of the multistress response in Saccharomyces cerevisiae. PNAS 93:5777-5782.

Schuller, C., Brewster J.L., Alexander M.R, Gustin M.C., and Ruis H. 1994. The HOG pathway controls osmotic regulation of transcription via the stress response element (STRE) of the Saccharomyces cerevisiaeUniversity CTTJ gene. EMBO 1. 13:4382--4389.

Seymour, I.J., and Piper, P.W. 1999. Stress induction of HSP30, the plasma membrane heat shock protein gene of Saccharomyces cerevisiae, appears not to use known stress-regulated transcription factors. Microhiology 145:231-239.

Shevchenko, A., Wilm, M., Vorm, 0., and Mann, M. 1996. Mass spectrometric sequencing of proteins from silver-stained polyacrylamide gels. Anal. Chem. 68:850-858.

Siderius, M., Rots, E., and Mager, W.H. 1997. High-osmolarity signalling in Saccharomyces cerevisiae is modulated in a carbon-source-dependent fashion. Microbiology 143:3241-3250.

Siderius, M., and Mager, W.H. 1997. General stress response: in search of a common denominator. In: Yeast Stress Responses (Hohmann, S., and Mager, W.H., eds.), pp. 2l3-230, R. G. Landes, Austin, Texas, USA. 130

Sieiro, e., Reboredo, N.M., and Villa, T.G. 1995. Flocculation of industrial and laboratory strains of Saccharomyces cerevisiae. 1. Ind. Microbiol. 14:461--466.

Silva, J.L., Foguel, D., and Royer, e.A. 200l. Pressure provides new insights into protein folding, dynamics and structure. Trends Biochem. Sci. 26:612-618.

Simoes, T., Teixeira, M.e., Fernandes, A.R., and Sa-Correia, I. 2003. Adaptation of Saccharomyces cerevisiae to the herbicide 2,4-dichlorophenoxyacetic acid, mediated by Msn2p- and Msn4p-regulated genes: important role of SPJ/. Appl. Environ. Microbiol. 69:4019--4028.

Smith, A., Ward, M.P., and Garrett, S. 1998. Yeast PKA represses Msn2p/Msn4p-dependent gene expression to regulate growth, stress response and glycogen accumulation. EMBO 1. 17:3556-3564.

Smith, A.E., Zhang, Z., Thomas, e.R., Moxham, K.E., and Middelburg, A.P.J. 2000. The mechanical properties of Saccharomyces cerevisiae. PNAS 97:9871-9874.

Smits, G.J., Kapteyn, J.e., van den Ende, H., and Klis, F.M. 1999. Cell wall dynamics in yeast. CUlT Opill. Microbiol. 2:348-352.

Sorger, P.K., and Pelham, H.R.B. 1988. Yeast heat shock factor is an essential DNA-binding protein that exhibits temperature-dependent phosphorylation. Cell 54:855-864.

Srikantha, T., Tsai, L.K., and Soli, D.R. 1997. The WHII gene of Candida albicans is regulated in two distinct developmental programs through the same transcription activation sequences. 1. Bacteriol. 179:3837-3844. Town Stathopoulos, A.M., and Cyert, M.S. 1997. Calcineurin acts through the CRZIITCN I-encoded transcription factor to regulate gene expression in yeast. Genes Dev. 11 :3432-3444.

Stone, R.L., Matarese, V., Magee, B.B., Magee, P.T., and Bernlohr, D.A. 1990. Cloning, sequencing and chromosomal assignment of a gene fromCape Saccharomyces cerevisiae which is regulated by glucose and positively by lipids. Gene 96: 171-176.of Stratford, M. 1992. Yeast flocculation: a new perspective. Adv. Microbiol. Physiol. 33:2-71.

Stratford, M., and Assinder, S. 1991. Yeast flocculation: Flol and New Flo phenotypes and receptor structure. Yeast 7:559-574.

Straver, M.H., Aar, P.e., van der Smit, G., and Kijne, J.W. 1993. Determinants of flocculence of brewer's yeast during fermentation in wort. Yeast 9:527-532.

Tausig, F., and Wolf, F.J. 1964. Streptavidin - a substance with avidin-like properties produced by microorganisms. Biochem.University Biophys. Res. Commun. 14:205-209. Teixeira, M.e., Santos, P.M., Fernandes, A.R., and Sa-Correia, I. 2005. A proteome analysis of the yeast response to the herbicide 2,4-dichlorophenoxyacetic acid. Proteomics 5: 1889-1901.

Thevelein, J.M., and de Winde, J.H. 1999. Novel sensing mechanisms and targets for the cAMP­ protein kinase A pathway in the yeast Saccharomyces cerevisiae. Mol. Microbial. 33:904-918.

Thomas, G., and Hall, M.N. 1997. TOR signalling and control of cell growth. Cll/T Opin. Cell BioI. 9:782-787.

Timblin, B.K., and Bergman, L.W. 1997. Elevated expression of stress response genes resulting from deletion of the PH085 gene. Mol. Microbial. 26:981-990.

Toh-E, A., Yasunaga, S., Nisogi, H., Tanaka, K., Oguchi, T., and Matsui, Y. 1993. Three yeast genes, PfR I, PfR2 and PfR3, containing internal tandem repeats, are related to each other, and PIR I and PfR2 are required for tolerance to heat shock. Yeast 9:481--494. 131

Toone, W.M., and Jones, N. 1998. Stress-activated signalling pathways in yeast. Genes Cells 3:485- 498.

Torres, J., di Como, e.J., Herrero, E., and de la Torre-Ruiz, M.A. 2002. Regulation of the cell integrity pathway by Rapamycin-sensitive TOR function in budding yeast. 1. BioI. Chem. 277:43495- 43504.

Touhami, A., Nysten, B., and Dufrene, Y.F. 2003. Nanoscale mapping of the elasticity of microbial cells by atomic force microscopy. Langmuir 19:4539--4543.

Trachtulcova, P., Frydlova, I., Janatova, I., and Hasek, J. 2004. The absence of the Isw2p-Itclp chromatin-remodelling complex induces mating type-specific and Flollp-independent invasive growth of Saccharomyces cerevisiae. Yeast 21:389--401.

Treger, J.M., Schmitt, A.P., Simon, J.R. and McEntee, K. 1998. Transcriptional factor mutations reveal regulatory complexities of heat shock and newly identified stress genes in Saccharomyces cerevisiae.1. Bio!. Chern. 273:26875-26879.

Utsugi, T., Minemura, M., Hirata, A., Abe, M., Watanabe, D., and Ohya, Y. 2002. Movement of yeast 1,3-p-glucan synthase is essential for uniform cell wall synthesis. Gelles Cells 7: 1-9.

Vadillo-Rodriguez, V., Busscher, H.J., Norde, W., de Vries J., Dijkstra, R.J.B., Stokroos, I., and van der Mei, H.e. 2004. Comparison of atomic force microscopy interaction forces between bacteria and silicon nitride substrata for the three commonly used immobilization methods. App!. Environ. Microbio!. 70:5441-5446. Town van Bakel, H., Strengman, E., Wijmenga, e., and Hoistege, F.e. 2005. Gene expression profiling and phenotype analyses of S. cerevisiae in response to changing copper reveals six genes with new roles in copper and iron metabolism. Physiol. Genomics 22:356-367.

Vannini, G.L., Poli, F., Donini A., and Pancaldi, S. 1983.Cape Effects of Congo Red on wall synthesis and morphogenesis in Saccharomyces cerevisiae. Plantof Sci. Lett. 31 :9-17. Varela, J.e.S., Praekelt, U.M., Meacock, P.A., Planta, R.J., and Mager, W.H. 1995. The Saccharomyces cerevisiae HSP 12 gene is activated by the high-osmolarity glycerol pathway and negatively regulated by protein kinase A. Mol. Cell BioI. 15:6232-6245.

Verna, J., Lodder, A., Lee, K., Vagts, A., and Ballester, R. 1997. A family of genes required for maintenance of cell wall integrity and for the stress response in Saccharomyces cerevisiae. Genetics 94: 13804-13809.

Verstrepen, K.J., Derdelinckx, G., Verachtert, H., and Delvaux, F.R. 2003. Yeast flocculation: what brewers should know.University Appl. Microbiol. Biotechnol. 61: 197-205. Vigh, L., Maresca, B., and Harwood, J.L. 1998. Does the membrane's physical state control the expression of heat shock and other genes? Trends Biochem. Sci. 23:369-374.

Viner, R.I., and Clegg, J.S. 2001. Influence of trehalose on the molecular chaperone activity ofp26, a small heat shock/alpha-crystallin protein. Cell Stress Chaperones 6:126-135.

Von Hippel, P.J., and Wong, K.Y. 1965. On the conformational stability of globular proteins. The effects of various electrolytes and nonelectrolytes on the thermal ribonuclease transition. 1. Bio!. Chern. 240:3913-3920.

\Vatanabe, Y., Takaesu, G., Hagiwara, M., Irie, K., and Matsumoto, K. 1997. Characterization ofa serum response factor-like protein in Saccharomyces cerevisiae, Rlml, which has transcriptional activity regulated by the Mpkl (Slt2) mitogen-activated protein kinase pathway. Mol. Cell. Bio!. 17:2615-2623. 132

Weisman, L.S., Bacallao, R., and Wickner, W. 1987. Multiple methods of visualizing the yeast vacuole permit evaluation of its morphology and inheritance during the cell cycle. 1. Cell. BioI. 105:1539-1547.

Werner-Washburne, M., Braun, E., Johnston, G.c', and Singer, R.A. 1993. Stationary phase in the yeast Saccharomyces cerevisiae. Microbiol. Rev. 57:383-401.

Wiech, H., Buchner, J., Zimmermann, M., Zimmermann, R., and Jakob, U. 1993. Hsc70, immunoglobulin heavy chain binding protein, and Hsp90 differ in their ability to stimulate transport of precursor proteins into mammalian microsomes. J. Bio!. Chem. 268:7414-7421.

Wieser, R., Adam, G., Wagner, A., Schiiller, C., Marchler, G., Ruis, H., Krawiec, Z., and Bilinski, T. 1991. Heat shock factor-independent heat control of transcription of the CTT! gene encoding the cytosolic catalase T of Saccharomyces cerevisiae. J. Biol. Chem. 266: 12406-1241l.

Williams, D.L., McNamee, R.B., Jones, E.L., Pretus, H.A., Bro, I.W., and di Luzio, N.R. 1991. A method for the solubilization of a (1-3)-P-D-glucan isolated from Saccharomyces cerevisiae. Carbo Res. 219:203-213.

Xiao, H., Perisic, 0., and Lis, J.T. 1991. Cooperative binding of Drosophila heat shock factor to arrays of a conserved 5 bp unit. Cell 64:585-593.

Yeh, K-W., Jinn, T-L., Yeh, C-H., Chen, Y-M., and Lin, C-Y. 1994. Plant low-molecular-mass heat-shock proteins: their relationship to acquisition of them10tolerance in plants. Biotechno!. App!. Biochem.19:41-49. Town Yezek, L.P., Duval, J.F., and van Leeuwen, H.P. 2005. Electrokinetics of diffuse soft interfaces. III. Interpretation of data on the polyacrylamide/water interface. Langmuir 21 :6220-6227.

Yoshimura, H., Tadaa, T., and Iidaa, H. 2004. Subcellular localization and oligomeric structure of the yeast putative stretch-activated Ca2+ channel componentCape Mid 1. Exp. Cell Res. 293: 185-195. Zara, S., Farris, G.A., Budroni, M., and Bakalinsky,of A.T. 2002. HSP12 is essential for biofilm formation by a Sardinian wine strain of S. cerevisiae. Yeast 19:269-276.

Zaragoza, 0., and Gancedo, J.M. 2000. Pseudohyphal growth is induced in Saccharomyces cerevisiae by a combination of stress and cAMP signaling. Antonie WIn Leeuwenhoek 78: 187-194.

Zhang, N., Gardner, D.c'J., Oliver, S.G., and Stateva, L.1. 1999. Down-regulation of the expression of PKC! and SRB 1/ PSA II VIG9, two genes involved in cell wall integrity in Saccharomyces cerevisiae, causes flocculation. Microbiology 145:309-316. Zhao, c" Jung, U.S ..University Garrett-Engele, P., Roe, T., Cyert, M.S., and Levin, D.E. 1998. Temperature­ induced expression of yeast FKS2 is under the dual control of protein kinase C and calcineurin. Mol. Cell. Bio!. 18:1013-1022.