DOCSLIB.ORG

Population Genetic Structure and Genetic Diversity in Twisted-Jaw Fish, Belodontichthys Truncatus Kottelat & Ng, 1999 (Siluriformes: Siluridae), from Mekong Basin

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Population Genetic Structure and Genetic Diversity in Twisted-Jaw Fish, Belodontichthys Truncatus Kottelat & Ng, 1999 (Siluriformes: Siluridae), from Mekong Basin Hindawi International Journal of Zoology Volume 2017, Article ID 5976421, 7 pages https://doi.org/10.1155/2017/5976421 Research Article Population Genetic Structure and Genetic Diversity in Twisted-Jaw Fish, Belodontichthys truncatus Kottelat & Ng, 1999 (Siluriformes: Siluridae), from Mekong Basin Surapon Yodsiri,1,2 Komgrit Wongpakam,1,2 Adisak Ardharn,1,2 Chadaporn Senakun,1,2 and Sutthira Khumkratok1,2 1 Walai Rukhavej Botanical Research Institute, Mahasarakham University, Kantharawichai District, Maha Sarakham 44150, Thailand 2Biodiversity and Conservation Research Unit, Walai Rukhavej Botanical Research Institute, Mahasarakham University, Kantharawichai District, Maha Sarakham 44150, Thailand Correspondence should be addressed to Komgrit Wongpakam; komgrit [email protected] Received 15 February 2017; Accepted 11 July 2017; Published 16 August 2017 Academic Editor: Marco Cucco Copyright © 2017 Surapon Yodsiri et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The Mekong River and its tributaries possess the second highest diversityinfishspeciesintheworld.However,thefishbiodiversity in this river is threatened by several human activities, such as hydropower plant construction. Understanding the genetic diversity and genetic structure of the species is important for natural resource management. Belodontichthys truncatus Kottelat & Ng is endemic to the Mekong River basin and is an important food source for people in this area. In this study, the genetic diversity, genetic structure, and demographic history of the twisted-jaw fish, B. truncatus, were investigated using mitochondrial cytochrome b gene sequences. A total of 124 fish specimens were collected from 10 locations in the Mekong and its tributaries. Relatively high genetic diversity was found in populations of B. truncatus compared to other catfish species in the Mekong River. The genetic structure analysis revealed that a population from the Chi River in Thailand was genetically significantly different from other populations, which is possibly due to the effect of genetic drift. Demographic history analysis indicated that B. truncatus has undergone recent demographic expansion dating back to the end of the Pleistocene glaciation. 1. Introduction fish is caught and exported to Thailand [4]. However, there is no information on the genetic diversity and genetic structure The Mekong is the second most biodiverse river for fish of this important fish, despite being important for natural species. It has been estimated that more than 877 fish resource management [5]. species can be recorded in the Mekong and its tributaries [1]. However, many species are under threat due to human- In this study, we used the mitochondrial cytochrome b mediated environmental change, such as hydropower dam (cyt b) sequences to examine the genetic diversity, genetic construction [1, 2]. structure, and demographic history of B. truncatus in the The twisted-jaw catfish (Belodontichthys truncatus Kotte- Mekong and two of its tributaries, the Chi and Mun Rivers lat & Ng) is endemic to the Mekong basin [3]. Two species in northeastern Thailand. Previous studies indicated that of the genus Belodontichthys are found in the Mekong and cyt b sequences can be successfully used to infer genetic its tributaries, including B. dinema Bleeker, 1851, and B. structure and demographic history of freshwater fishes [6– truncatus. The former species occur in central and southern 8]. The information presented in this study will be useful for Thailand,Malaysia,Sumatra,andBorneo,whilethelatter the management of B. truncatus. In addition, because this species is found in northeast Thailand, Lao PDR, Cambodia, species is widely distributed in the Mekong and its tributaries, and Vietnam [3]. Belodontichthys truncatus is a very impor- understanding its genetic structure and demographic history tant species for fisheries in Lao PDR and Cambodia where the would shed some light on the effect of historical change 2 International Journal of Zoology ∘ ∘ ∘ ∘ ∘ ∘ 101 0 0 E 102 0 0 E 103 0 0 E 104 0 0 E 105 0 0 E 106 0 0 E ∘ ∘ 19 0 0 N 19 0 0 N N ∘ ∘ 18 0 0 N 18 0 0 N ∘ ∘ 17 0 0 N 17 0 0 N ∘ ∘ 16 0 0 N 16 0 0 N ∘ ∘ 15 0 0 N 15 0 0 N ∘ ∘ 14 0 0 N 14 0 0 N ∘ ∘ 13 0 0 N 13 0 0 N ∘ ∘ 12 0 0 N 12 0 0 N ∘ ∘ 11 0 0 N 11 0 0 N (km) 025 50 100 150 200 ∘ ∘ 10 0 0 N 10 0 0 N ∘ ∘ ∘ ∘ ∘ ∘ 101 0 0 E 102 0 0 E 103 0 0 E 104 0 0 E 105 0 0 E 106 0 0 E Dam Tributary Location Country boundary Mekong River Figure 1: Sampling locations for twisted-jaw fish, Belodontichthys truncatus, are used in this study. Details of sampling sites are provided in Table 1. (e.g., Pleistocene climatic and environmental change) on fish Lake in Cambodia. Specimens were identified following the biodiversity. description of Belodontichthys truncatus by Kottelat & Ng [3]. 2. Materials and Methods 2.2. DNA Extraction, Polymerase Chain Reaction, and 2.1. Specimen Collection and Identification. Atotalof124fish Sequencing. Genomic DNA was extracted from the tissue specimens were collected from seven locations in Thailand using the Genomic DNA Extraction mini kit (RBC Bio- Science, Xindian City, Taiwan). A fragment of the cytochrome and Cambodia (Table 1 and Figure 1). Among these locations, b(cytb)gene was amplified using the primers Glu31 (5 GTG- onewasfromtheChiRiverandonefromtheMunRiver;both of these are in northeastern Thailand. Three sites were from ACTTGAAAAACCACCGTT3 )andCat.Thr29(5ACC- the Mekong River along the Thailand-Lao PDR border, one TTCGATCTCCTGATTACAAGAC3 ) [9]. The amplifi- from the Mekong River in Cambodia and one from Tonle Sap cation reaction with a total volume of 50 lcontained International Journal of Zoology Table 1: Details of sampling locations for Belodontichthys truncatus used in this study and haplotype and nucleotide diversity. Geographic Collection Haplotype Location (code) River Nucleotide diversity region date diversity ∘ 15 47 24.82 N Yasothon Province, Thailand (CHYT) Chi ∘ 2 10/11/2014 0 0 104 08 34.04 E ∘ Mueang District, Maha Sarakham Province 16 13 18.29 N Chi ∘ 214/08/20140 0 (CHMK) 103 20 3.13 E ∘ 15 40 38.17 N At Samat District, Roi Et Province (CHRO1) Chi ∘ 4 6/11/2014 0.8333 ± 0.2224 0.001958 ± 0.001641 104 06 48.87 E ∘ 15 41 41.50 N Phanom Phrai District, Roi Et Province (CHRO2) Chi ∘ 14 10/11/2014 0.5055 ± 0.1581 0.003413 ± 0.002077 103 07 38.64 E ∘ 15 14 29.71 N Ubon Ratchathani Province, Thailand (MUUB) Mun ∘ 10 11/11/2014 0.8667 ± 0.0850 0.00205 ± 0.00141 104 57 20.64 E ∘ 18 01 28.29 N Nong Khai Province Thailand (MKNK) Mekong ∘ 13 8/11/2014 0.9487 ± 0.0506 0.00405 ± 0.00242 101 52 54.34 E ∘ Khong Chiam District, Ubon Ratchathani 15 23 26.82 N Mekong ∘ 13 17/10/2014 0.9359 ± 0.0507 0.00401 ± 0.00240 Province, Thailand (MKUB) 105 29 39.14 E ∘ Khemarat District, Ubon Ratchathani Province, 16 02 32.16 N Mekong ∘ 28 14/10/2014 0.8810 ± 0.0367 0.00271 ± 0.00165 Thailand (MKKR) 105 13 32.39 E ∘ 11 33 28.18 N Phnom Penh Province, Cambodia (MKCDPP) Mekong ∘ 12 18/11/2014 0.8788 ± 0.0751 0.00242 ± 0.00158 104 56 14.13 E ∘ Tonle Sap Lake, Pursat Province, Cambodia Tonle Sap 12 02 19.24 N ∘ 26 15/11/2014 0.8062 ± 0.0594 0.00365 ± 0.00212 (MKCDPO) Lake 104 43 43.54 E Total 124 0.9765 ± 0.0051 0.003179 ± 0.001826 3 4 International Journal of Zoology 2 l MgCl2 (50 mM), 5 lof10xPCRbuffer,1.6lofmixed dNTPs (10 M), 2 lofeachprimer(10M), 0.4 lofTaq DNA polymerase (5 u/l), and 2 lDNAtemple.Thetem- ∘ perature profile was as follows: 94 Cfor3min,followedby ∘ ∘ ∘ 35 cycles of 94 C for 30 seconds, 48 Cfor1min,and72C ∘ for 1.30 min with a final extension at 72 C for 7 min [10]. The PCR products were checked by 1% agarose gel electrophoresis and purified using a High Yield Gel/PCR DNA fragment extraction kit (RBC BioScience, Taiwan). Sequencing was performed at the Macrogen DNA sequencing service (Seoul, Mekong River Korea) using the same primers as in the PCR. Chi River Mun River 2.3. Data Analysis. Afragmentof1,024bpofthecyt Figure 2: Median joining (MJ) network of 124 mitochondrial b gene was obtained from 124 specimens. Sequences cytochrome b (cyt b) sequences of Belodontichthys truncatus.Each were deposited in GenBank under the accession numbers haplotype is represented by a circle and sizes of circles are relative to KY607016–KY607139. Genealogical relationships between number of individuals sharing a specific haplotype. Haplotypes are haplotypes were estimated using a median joining (MJ) labelled according to the river. network (Bandelt et al., 1999) calculated using Network v 4.6.1.0 (http://www.fluxus-engineering.com). Haplotype 2500 diversity and nucleotide diversity were calculated using 2000 Arlequin ver. 3.5 [11]. The population pairwise ST calculated = 0.838 Tau ∗∗ in Arlequin was used to infer the genetic structure. The Fu’s F = −26.2649 1500 S ∗∗ significance test statistic was obtained from 1,023 permu- Tajima’s D = −2.5364 ∗∗ tations. To avoid bias, due to a small sample size, popu- 1000 P < 0.001 lations with less than five specimens were omitted from the genetic structure analysis. A Mantel test [12] was used 500 to determine the relationship between the genetic distance 0 (ST from Arlequin) and the geographical distance (km) for 0 5 10 15 20 25 30 an isolation-by-distance (IBD) model. The Mantel test was implemented in IBD ver. 1.52 [13] using 1,000 randomizations.
Load more

Recommended publications
  • Download Article (PDF)
    STUDIES ON THE CLASSIFICATION OF THE CATFISHES OF THE ORIENTAL AND PALAEARCTIC FAMILY SILURID AE. By JANET RAIG, NoJ,ural History Museum, Stanford University, U. S. A. CONTENTS. PAGE. Introduction 59 Acknowledgements 60 The Fa.mily Siluridae- A. History of the Family 60 B. Characterization of the Family .. 60 C. Distdbution 61 ~. Diagnostic Key to the Genera 61 A Tenta.tive Review of the Genera of Siluridae- 1. Hemisilurus 63 2. Oeratoglanis 65 3. Belodontichthys 65 4. Silurichthys 67 o. Silurus 71 6. Wallago 79 7. Hito 81 8.0mpok 83 9. Kryptopter'U8 92 A Checklist of the Genera and species 94 References 110 INTRODUCTION. The present study was undertaken in order to untangle some of the problems of classification which have beset this group. The genera have not been studied in toto since the days of Bleeker and Gunther. In this study I have made an attempt to clarify the relationships of the various genera, which in some cases has involved revision of generic limits. Lack of time and material has precluded a thorough analysis of the species within any genus; for the same reason no skeletal examinations were possible. It is hoped, however, that a clarification of generic limits through study of external characters will make it easier in the future for interested workers, with sufficient material at hand, to do further and much-needed work on both the genera and the species. [ 59 ] 60 Records of the Indian Muse'U1n. [VOL. XLVIII; ACKNOWLEDGEMENTS. For most valuable aid and guidance in this study, and the giving free~y of precious tin;te, I wish to thank Dr.
    [Show full text]
  • Respective Influence of Vertical Mountain Differentiation on Debris Flow Occurrence in the Upper Min River, China
    www.nature.com/scientificreports OPEN Respective infuence of vertical mountain diferentiation on debris fow occurrence in the Upper Min River, China Mingtao Ding*, Tao Huang , Hao Zheng & Guohui Yang The generation, formation, and development of debris fow are closely related to the vertical climate, vegetation, soil, lithology and topography of the mountain area. Taking in the upper reaches of Min River (the Upper Min River) as the study area, combined with GIS and RS technology, the Geo-detector (GEO) method was used to quantitatively analyze the respective infuence of 9 factors on debris fow occurrence. We identify from a list of 5 variables that explain 53.92%% of the total variance. Maximum daily rainfall and slope are recognized as the primary driver (39.56%) of the spatiotemporal variability of debris fow activity. Interaction detector indicates that the interaction between the vertical diferentiation factors of the mountainous areas in the study area is nonlinear enhancement. Risk detector shows that the debris fow accumulation area and propagation area in the Upper Min River are mainly distributed in the arid valleys of subtropical and warm temperate zones. The study results of this paper will enrich the scientifc basis of prevention and reduction of debris fow hazards. Debris fows are a common type of geological disaster in mountainous areas1,2, which ofen causes huge casual- ties and property losses3,4. To scientifcally deal with debris fow disasters, a lot of research has been carried out from the aspects of debris fow physics5–9, risk assessment10–12, social vulnerability/resilience13–15, etc. Jointly infuenced by unfavorable conditions and factors for social and economic development, the Upper Min River is a geographically uplifed but economically depressed region in Southwest Sichuan.
    [Show full text]
  • Minshan Draft Factsheet 13Oct06.Indd
    Gift to the Earth 103, 25 October 2006 Gift to the Earth China: Sichuan and Gansu Provinces join efforts to preserve the giant panda and its habitat in the Minshan Landscape SUMMARY The 2004 Panda Survey concluded that 1,600 giant pandas survive in the wild. The pandas are scattered in 20 isolated populations in six major landscapes in southwestern China in the upper Yangtze River basin. Almost half these pandas are found in the Minshan landscape, shared by Sichuan and Gansu provinces. In a major development, the provincial governments of Sichuan and Gansu have each committed to establish new protected areas (PAs), linking corridors and co-managed areas to ensure all the pandas in Minshan are both protected and reconnected to ensure their long term health and survival. This represents the designation of almost 1,6 million hectares of panda habitat. Both provincial governments have also committed to establish PAs for other wildlife totaling an additional 900,000 hectares by 2010. WWF considers the giant panda as a ‘flagship’ species – a charismatic animal representative of the biologically rich temperate forest it WWF, the global conservation organization, recognizes these inhabits which also mobilizes support for conservation of the commitments by the two provincial governments as a Gift to larger landscape and its inhabitants. By conserving the giant panda the Earth – symbolizing a globally significant conservation and its habitat, many other species will also be conserved – including achievement and inspiring environmental leadership.
    [Show full text]
  • NHBSS 051 1G Baird Rhythm
    NAT. NAT. HIST. BULL. SIAM Soc. 51 (1): 5-36 ，2003 RHYTHMS OF THE RIVER: LUNAR PHASES AND MIGRATIONS OF SMALL CARPS (CYPRINIDAE) IN THE MEKONG RIVER Ian ιBa かI1 'd 1ヘMark S. Flahe 同'1， and Bounpheng Phylavanh 1 ABSTRA Cf τ'hro ughout history ，many differ 耳目 tcultures have associa 胞d lunar cycles with changes in variety a variety of human and animal behaviors. In the southem-most part of La os ，血血 .e area known 鼠“Siphandone" or 血.e 4，0∞islands ，rur 百 1 fishers living on islands 泊 the middle of the mains 悦 am Mekong River are especially conscious of the influence of lunar cycles on aquatic life. life. They associate upriver migrations of large quantities of small cyprinid fishes from Cambodia Cambodia to La os at the beginning of each year with lunar ph 舗 es. 百 is article examines the fishery fishery for small cyprinids in 血e Kh one Falls area ，Kh ong District ， Champasak Pr ovince ， southem southem La o PDR ，飢da five-year time series of catch -e ffort fisheries da 旬 for a single fence- fJl ter 釘ap are presented. 百lese da 筒 are then compared with catch da 組合om the bag-net fishery fishery in the Tonle Sap River 泊 C 釘 nbodia. It is shown 白紙 the migrations of small cyprinids ， particul 釘'i y Henicorhynchus lobatus and Paralaubuca 砂'P us ，眠 highly correlated with new moon periods at 血e Kh one Falls. Many small cyprinids migrate hundr 哲也 of km up the Mekong River River to Kh one Falls 台。 m 血eTo 叫巴 Sap River and probably 血.e Great Lak e in Cam bodia.
    [Show full text]
  • Employing Geographical Information Systems in Fisheries Management in the Mekong River: a Case Study of Lao PDR
    Employing Geographical Information Systems in Fisheries Management in the Mekong River: a case study of Lao PDR Kaviphone Phouthavongs A thesis submitted in partial fulfilment of the requirement for the Degree of Master of Science School of Geosciences University of Sydney June 2006 ABSTRACT The objective of this research is to employ Geographical Information Systems to fisheries management in the Mekong River Basin. The study uses artisanal fisheries practices in Khong district, Champasack province Lao PDR as a case study. The research focuses on integrating indigenous and scientific knowledge in fisheries management; how local communities use indigenous knowledge to access and manage their fish conservation zones; and the contribution of scientific knowledge to fishery co-management practices at village level. Specific attention is paid to how GIS can aid the integration of these two knowledge systems into a sustainable management system for fisheries resources. Fieldwork was conducted in three villages in the Khong district, Champasack province and Catch per Unit of Effort / hydro-acoustic data collected by the Living Aquatic Resources Research Centre was used to analyse and look at the differences and/or similarities between indigenous and scientific knowledge which can supplement each other and be used for small scale fisheries management. The results show that GIS has the potential not only for data storage and visualisation, but also as a tool to combine scientific and indigenous knowledge in digital maps. Integrating indigenous knowledge into a GIS framework can strengthen indigenous knowledge, from un processed data to information that scientists and decision-makers can easily access and use as a supplement to scientific knowledge in aquatic resource decision-making and planning across different levels.
    [Show full text]
  • On China's Rivers
    102 A The “Last Report” On China’s Rivers Executive Summary By Bo Li, Songqiao Yao, Yin Yu and Qiaoyu Guo English Translation released in March 2014 This report is issued jointly by the following initiating and supporting organizations: Initiating organizations: Friends of Nature Institute of Public & Environmental Affairs Green Watershed SHAN SHUI Chengdu Urban Rivers Association Supported by: Nature University Xiamen Green Cross Association Huaihe River Eco-Environmental Science Research Center Green Zhejiang Saunders’ Gull Conservation Society of Panjin City Green Panjin Eco Canton EnviroFriends Institute of Environmental Science and Technology Dalian Environmental Protection Volunteers Association Green Stone Environmental Action Network Greenovation Hub Wild China Film English translation support from: China Environment Forum, Woodrow Wilson Center 1 1 First Bend of the Yangtze River FOREWORD In January 2013, the third year of China’s Twelfth • Reduce coal consumption as a percentage of prima- Five-Year Plan, the State Council released its 12th ry energy to below 65% by 2017; and, Five-Year Plan for Energy Development1, which • Construct 160 GW of hydropower capacity and to included targets that aim to shift China’s energy mix raise nationwide hydropower capacity to 290 GW. to one that pollutes less yet still fuels the country’s growing energy needs. Specifically, by 2015 the Plan If the Plan’s hydropower targets are to be met, by proposes to: 2015, nationwide conventional hydropower installed capacity will reach 48% of the technically exploitable • Increase the proportion of non-fossil fuels in overall hydropower potential, and 72% of the economically primary energy use to 11.4 percent; recoverable potential.
    [Show full text]
  • Earthquake Hazards and Large Dams in Western China
    Earthquake Hazards and Large Dams in Western China A Probe International Study By JOHN JACKSON April 2012 PROBE INTERNATIONAL EDITOR: PATRICIA ADAMS John Jackson is a pseudonym for a geologist with detailed knowledge of western China who wishes to remain anonymous to protect his sources. TABLE OF CONTENTS EXECUTIVE SUMMARY Page 1 INTRODUCTION Page 2 ANALYSIS Page 3 DISCUSSION Page 4 CONCLUSION Page 10 ENDNOTES Page 11 RESOURCES Page 14 APPENDIX A Page 16 − TABLE 1: Summary of ziyuan_b dam database for Page 16 selected rivers in western China − TABLE 2: Summary of U.S. Geological Survey Page 17 (USGS) earthquake database, 1973 – 2011 − TABLE 3: Percentage of total dams in each seismic Page 18 hazard zone for selected rivers in western China − TABLE 4: Percentage of total megawatt (MW) Page 19 capacity in each seismic hazard zone for each river − TABLE 5: Estimated number of dams completed and under construction before 2004, as of 2011, and the Page 20 percentage increase − TABLE 6: Incidences of RIS resulting in damage to dams and other structures, 1937 – 1981 Page 21 APPENDIX B Page 22 − FIGURE 1: Seismic hazard map showing dams Page 22 and major earthquake epicenters in western China Page 23 − FIGURE 2: Map of major dams in China (map "ziyuan_b") Page 24 − FIGURE 3: Geological Map of Nujiang, Lancang, and Jinsha River area Page 25 − FIGURE 4: Present-day crustal motion within the Tibetan Plateau inferred from GPS measurements Page 26 − FIGURE 5: Proximity of large dams to seismic hazard zones and shallow (< 10 km) earthquakes in western China 0 Executive Summary By constructing more than 130 large dams in a region of known high seismicity, China is embarking on a major experiment with potentially disastrous consequences for its economy and its citizens.
    [Show full text]
  • The Water Balance of China and Its Large River Basins
    Hydrology for the Water Management of Large Riva- Basins (Proceedings of the Vienna Symposium, August 1991). IAHS Publ. no. 201, 1991. THE WATER BALANCE OF CHINA AND ITS LARGE RIVER BASINS LIU GUOWEI AND GUI YUENG Nanjing Institute of Hydrology and Water Resources China ABSTRACT The Yangtze River, Yellow River and other five large river basins are the largest ones in China, with a total area amount­ ing to about 4 333 687 km2 and covering both humid and arid/semi- arid regions. Based on the computation of atmospheric vapour transport, precipitation, évapotranspiration and runoff, water bal­ ance models for the whole country and its seven large river basins have already been developed. Through analyses with the models, some characteristics of hydrologie cycles in the river basins, includ­ ing the origins and routes of atmospheric moisture flux, the water circulation coefficients, etc., have been determined. The results provide a hydrologie basis for water resources assessment and management in China. INTRODUCTION China is located in the East Asian monsoon region, where the hydrologie cycle presents a monsoon climate regime. Every year in May, with the monsoon onset, the rainy season begins in the region south of 25 °N in China. During June to July, the rain band advances to the south of 35°N, and in the whole country the rainy season has developed by August. From November to March of the next year, it is a dry season, and there is a transient season from April to September. The whole country can be divided into three hydrologic-climatic zones: humid, semi-arid and arid zone.
    [Show full text]
  • Baird, Phd August, 2009 Author’S Contact Information
    The Don Sahong Dam: Potential Impacts on Regional Fish Migrations, Livelihoods and Human Health Ian G. Baird, PhD August, 2009 Author’s Contact Information: Ian G. Baird, PhD, Affiliate, POLIS Project on Ecological Governance, University of Victoria, P.O. Box 3060, University House 4, Victoria, B.C., Canada V8W 3R4 [email protected] www.polisproject.org Photo Credits: All photos were taken by Ian G. Baird 1 Table of Contents Acronyms 3 Executive Summary 4 1. Introduction 5 Figure 1. Proposed location of the Don Sahong Dam and study sites between Khone Falls and Vientiane Municipality 7 2. The Nature of the Mekong River Basin and Fish Migrations 8 3. The Khone Falls and the Hou Sahong Channel 9 Figure 2. Just below the Don Sahong Dam site 9 4. Fish Migrations in the Khone Falls Area 10 Table 1. Fish species that migrate up the Mekong River from the Tonle Sap River each dry season (adapted from Baird et al. 2003) 12 5. Methodology 13 6. Results 14 6.1 The Extent of Upstream Fish Migrations 14 Table 2. Fish species’ presence and absence along Mekong River between the Khone Falls and Vientiane Municipality 16 6.2 The Importance of Upstream Fish Migrations for Fisheries above Khone Falls 18 Figure 3. A fish trap on the Hou Xang Pheuak 19 6.3 Numbers of People Expected to be Impacted Upstream 19 6.4 The Importance of Upstream Fish Migrations for Fisheries below Khone Falls 20 6.5 The Impacts of the Don Sahong Dam to Downstream Fisheries 21 6.6 Numbers of People Expected to be Impacted Downstream 23 6.7 Gas Supersaturation below the Don Sahong Dam 24 6.8 Habitat Destruction below the Don Sahong Dam 24 6.9 Cumulative Impacts on Fish and Fisheries 24 7.
    [Show full text]
  • 2009 Board of Governors Report
    American Society of Ichthyologists and Herpetologists Board of Governors Meeting Hilton Portland & Executive Tower Portland, Oregon 23 July 2009 Maureen A. Donnelly Secretary Florida International University College of Arts & Sciences 11200 SW 8th St. - ECS 450 Miami, FL 33199 [email protected] 305.348.1235 23 June 2009 The ASIH Board of Governor's is scheduled to meet on Wednesday, 22 July 2008 from 1700- 1900 h in Pavillion East in the Hilton Portland and Executive Tower. President Lundberg plans to move blanket acceptance of all reports included in this book which covers society business from 2008 and 2009. The book includes the ballot information for the 2009 elections (Board of Govenors and Annual Business Meeting). Governors can ask to have items exempted from blanket approval. These exempted items will will be acted upon individually. We will also act individually on items exempted by the Executive Committee. Please remember to bring this booklet with you to the meeting. I will bring a few extra copies to Portland. Please contact me directly (email is best - [email protected]) with any questions you may have. Please notify me if you will not be able to attend the meeting so I can share your regrets with the Governors. I will leave for Portland (via Davis, CA)on 18 July 2008 so try to contact me before that date if possible. I will arrive in Portland late on the afternoon of 20 July 2008. The Annual Business Meeting will be held on Sunday 26 July 2009 from 1800-2000 h in Galleria North.
    [Show full text]
  • Coal, Water, and Grasslands in the Three Norths
    Coal, Water, and Grasslands in the Three Norths August 2019 The Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH a non-profit, federally owned enterprise, implementing international cooperation projects and measures in the field of sustainable development on behalf of the German Government, as well as other national and international clients. The German Energy Transition Expertise for China Project, which is funded and commissioned by the German Federal Ministry for Economic Affairs and Energy (BMWi), supports the sustainable development of the Chinese energy sector by transferring knowledge and experiences of German energy transition (Energiewende) experts to its partner organisation in China: the China National Renewable Energy Centre (CNREC), a Chinese think tank for advising the National Energy Administration (NEA) on renewable energy policies and the general process of energy transition. CNREC is a part of Energy Research Institute (ERI) of National Development and Reform Commission (NDRC). Contact: Anders Hove Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH China Tayuan Diplomatic Office Building 1-15-1 No. 14, Liangmahe Nanlu, Chaoyang District Beijing 100600 PRC [email protected] www.giz.de/china Table of Contents Executive summary 1 1. The Three Norths region features high water-stress, high coal use, and abundant grasslands 3 1.1 The Three Norths is China’s main base for coal production, coal power and coal chemicals 3 1.2 The Three Norths faces high water stress 6 1.3 Water consumption of the coal industry and irrigation of grassland relatively low 7 1.4 Grassland area and productivity showed several trends during 1980-2015 9 2.
    [Show full text]
  • Assessment of Japanese and Chinese Flood Control Policies
    京都大学防災研究所年報 第 53 号 B 平成 22 年 6 月 Annuals of Disas. Prev. Res. Inst., Kyoto Univ., No. 53 B, 2010 Assessment of Japanese and Chinese Flood Control Policies Pingping LUO*, Yousuke YAMASHIKI, Kaoru TAKARA, Daniel NOVER**, and Bin HE * Graduate School of Engineering ,Kyoto University, Japan ** University of California, Davis, USA Synopsis The flood is one of the world’s most dangerous natural disasters that cause immense damage and accounts for a large number of deaths and damage world-wide. Good flood control policies play an extremely important role in preventing frequent floods. It is well known that China has more than 5000 years history and flood control policies and measure have been conducted since the time of Yu the great and his father’s reign. Japan’s culture is similar to China’s but took different approaches to flood control. Under the high speed development of civil engineering technology after 1660, flood control was achieved primarily through the construction of dams, dykes and other structures. However, these structures never fully stopped floods from occurring. In this research, we present an overview of flood control policies, assess the benefit of the different policies, and contribute to a better understanding of flood control. Keywords: Flood control, Dujiangyan, History, Irrigation, Land use 1. Introduction Warring States Period of China by the Kingdom of Qin. It is located in the Min River in Sichuan Floods are frequent and devastating events Province, China, near the capital Chengdu. It is still worldwide. The Asian continent is much affected in use today and still irrigates over 5,300 square by floods, particularly in China, India and kilometers of land in the region.
    [Show full text]