DOCSLIB.ORG

Characterization of Maternal Antigen That Embryos Require (MATER

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Characterization of Maternal Antigen That Embryos Require (MATER Journal of Reproduction and Development, Vol. 56, No. 1, 2010, 09-098A —Full Paper— Characterization of Maternal Antigen That Embryos Require (MATER/ NLRP5) Gene and Protein in Pig Somatic Tissues and Germ Cells Laura Francesca PISANI1,3), Paola RAMELLI1), Barbara LAZZARI2), Silvia BRAGLIA1)#, Fabrizio CECILIANI3) and Paola MARIANI1) 1)Livestock Genomics 2 Unit, Parco Tecnologico Padano, Lodi 26900, 2)Statistical Genomics and Bioinformatics Unit, Parco Tecnologico Padano, Lodi 26900 and 3)Department of Animal Pathology, Hygiene and Veterinary Public Health, Università degli Studi di Milano, Milano 20133, Italy #Present: DIPROVAL, Sezione di Allevamenti Zootecnici, University of Bologna, Reggio Emilia 42100, Italy Abstract. Maternal effect genes produce mRNA or proteins that accumulate in the egg during oogenesis and control the developmental program until embryonic genome activation takes place. NLRP5 (NLR family, Pyrin domain containing 5), also called MATER (Maternal Antigen That Embryos Require) is one of the genes required for normal early embryonic development, although its precise function remains to be elucidated. The aim of the present study was to analyze the NLRP5 gene expression pattern and protein distribution in somatic tissues and germ cells in the pig. Reverse transcription was performed on mRNA from germinal vescicle (GV) oocytes and total RNA from spermatozoa and tissues from different organs. The transcript for NLRP5 gene was identified only in ovaries and oocytes. The presence of NLRP5 protein was detected only in ovaries by western blot analysis and immunohistochemistry. Key words: Maternal effect genes, NLR family, Pyrin domain containing 5 (NLRP5), Oocytes, Pig (J. Reprod. Dev. 56: 41–48, 2010) ver the past few years, a number of mammalian genes predom- differentiation and maturation [17–19]. Maternally expressed inantly or exclusively expressed in germ cells have been genes are implicated in this process, and some of them are associ- discovered. Functional studies have reported the essential role of ated with developmental competence [20, 21]. In domestic species, these genes during gametogenesis, folliculogenesis and early MET occurs at the 4–16-cell stage [22], a stage in which enough embryonic development [1–7]. NLRP5 (NLR, pyrin domain biological material is available to study the fate of maternal containing5), also called MATER (Maternal Antigen That mRNAs and their action in regulating embryo cleavages. Studying Embryos Require), is one of these genes. However, its precise these genes in farm animals provides a model for understanding the function remains to be elucidated, although the transcription pat- mechanisms that affect oocyte quality and their implication in the terns may suggest a role in embryonic genome activation. success of embryo development and survival. Maternal mRNAs accumulated in the oocyte have a crucial role NLRP5 is an oocyte-specific maternal effect gene first identified for successful embryo development before activation of the embry- in the mouse, an animal in which it affects development beyond the onic genome (EGA) [3], and some of them are also required for 2-cell stage [15, 23]. More recently, the RNA and protein were embryo development after EGA and implantation. These genes, observed up to the 16-cell stage in bovine embryos [24, 25], the 8- which are called maternal effect genes and which include NLRP5, cell stage in a non-human primate [26] and in germinal vesicles in Zygotic Arrest 1 (Zar1) [8, 9], Stella [10, 11] and Nucleoplasmin 2 humans [27]. The transcript can be detected during oocyte growth (Npm2) [12], are all required for normal embryonic development from primary follicles, accumulates during oocyte development beyond the 1- and 2-cell stage in mice [13, 14]. Knock-out of these and decreases after fertilization [28, 29]. NLRP5-null female mice genes leads to incapacity of the embryo to develop beyond the 2- present a normal phenotype regarding folliculogenesis, ovulation cell stage [15]. and fertilization; however, their embryos do not develop beyond Developmental block in embryos produced in vitro remains the the 2-cell stage coincident with maternal-to-embryo transition [15]. main problem in assisted reproduction of farm animals, particularly The NLRP family is a subfamily of the newly described CATER- in cattle and pigs. An increasing amount of data indicates that the PILLER (CAspase-recruiment domain (CARD) Transcription embryonic genome activation is crucial for the success of preim- Enhancer, R (purine)-binding, Pyrin, Lots of LEucine Repeats) plantation embryo development [16]. To ensure maternal-embryo family, which comprises proteins with a nucleotide-binding transition (MET) of gene expression, oocytes have to reach a suffi- domain and a leucine-rich domain [30]. In humans, the NLRP gene ciently advanced level of developmental competence during family is constituted of 14 members [31]. As these genes have only been discovered recently, information about their expression and Received: June 9, 2009 functions in farm animals is still very limited. Accepted: September 1, 2009 Published online in J-STAGE: October 8, 2009 The aim of this study was the identification and characterization ©2010 by the Society for Reproduction and Development in a second farm species, swine, of one of these genes, NLRP5, an Correspondence: LF Pisani (e-mail: [email protected]) oocyte-selective factor that may play an important role in oogenesis 42 PISANI et al. Table 1. Primer pairs used for correct mRNA retro-transcription and cDNA amplification Forward 5’–3’ Reverse 5’–3’ Amplicon size Annealing temperature Beta actin aatcctgcggcatccacgaaacta agaagcatttgcggtggacgat 318 bp 60 C Histone H2AFZ aggacgactagccatggacgtgtg ccaccaccagcaattgtagccttg 208 bp 60 C cds1 tccaattacggactgcagtggt gctcttcgagtccatctaccacaa 772 bp 59 C cds2 ggctcttgattgtggtagatggac cgtagaacaaggccgcaaagaa 726 bp 60 C cds3 aggagttctttgcggccttgtt acccgggcccctttaaatatcaga 697 bp 59 C cds4 ggcagccagcctgtaaaatacaga tcgtgatcacgttggacagact 771 bp 59 C cds5 agagtctgtccaacgtgatcacga taggacagcgcttcacagagaac 637 bp 60 C and preimplantation embryo development, thus confirming the data Italy) according to the manufacturer’s instructions. RNA from produced so far only in bovine. each sample was quantified using a NanoDrop Spectrophotome- ter (NanoDrop Technologies, Wilmington, DE, USA) and stored Materials and Methods at –80 C until use. Oocyte collection Reverse transcription polymerase chain reaction and cDNA Ovaries from puberal gilts were collected from a local abattoir amplification and transported to the laboratory at 25–30 C in 0.9% saline. Cumu- Reverse transcription polymerase chain reaction (RT-PCR) was lus oocyte complexes (COCs) were isolated under a carried out in a total volume of 20 μl of reaction mixture containing stereomicroscope, recovered from each dish and transferred to a mRNA from pooled oocytes and total RNA from tissues and sper- Petri dish containing Tissue Culture Medium 199 (TCM 199). matozoa (1 μg total RNA), 1 μl of oligo(dT)18 (0.5 μg/μl) and Cumulus cells were removed using 3 mg/ml hyaluronidase in saline DEPC-treated water up to the final volume. RNA was denatured at and repeated pipetting. Oocytes were collected in pools of 10 in 3 70 C for 5 min. Four μl of 5× reaction buffer, 1 μl of 10 mM μl of washing medium, TCM 199, and stored at –80 C until use. dNTPs and 1 μl of RiboLock Ribonuclease inhibitor (20 U/ml) were added and the mixture was incubated at 37 C for 5 min. RT RNA isolation from oocytes was performed with 1 μl (200 U) RevertAid H Minus M-MuLV RT Extraction of mRNA from oocytes was performed using a Dyna- for 1 hour at 42 C. Enzymes were inactivated at 70 C for 10 min. beads mRNA DIRECT Micro-Kit (Invitrogen, Italy) according to All reagents were purchased from M-Medical, Italy. the manufacturer’s instructions. Briefly, samples were lysed in 100 The correct mRNA retrotranscription was assessed by PCR. μl of Lysis Buffer for 10 min at room temperature. Each sample Primers for beta actin (EMBL DQ845171) and H2A histone family was transferred into a clean tube with 2μl of Dynabeads member Z (EMBL NM_174809) were designed based on the swine Oligo(dT)25 and gently mixed for 5 min. After two washes in and bovine sequence respectively (Table 1), and the amplicons Washing Solution A (10 mmol Tris-HCl, pH 8.0, 0.15 mmol LiCl, were used as positive controls in the following cDNA 1 mmol EDTA, 0.1% (w/v) SDS) and three washes in Washing amplification. Solution B (10 mmol Tris-HCl, pH 8.0, 0.15 mmol LiCl, 1 mmol Five primer pairs were designed based on the complete NLRP5 EDTA), Poly(A)+RNAs were eluted from the beads by incubation coding sequence (EMBL NM_001007814) and are reported in in 8.5 μl Diethylpyrocarbonate (DEPC)-treated water at 65 C for 2 Table 1. All primer pairs were designed using the prediction pro- min. Aliquots were immediately used for reverse transcription. gram AmplifX 1.37. A negative control was also included in the analysis. Tissue and spermatozoa collection and RNA extraction Polymerase chain reaction (PCR) was performed in a total vol- Porcine tissues, which for these experiments included sample ume of 15 μl of the following reaction mix: 0.6 μl 50 mM MgCl2, of the heart, liver, ovary, lung, spleen, medulla oblongata, tongue, 0.3 μl Taq DNA polymerase (5 U/μl), 1.5 μl 10 × PCR buffer (200 muscle, subcutaneous adipose tissue and aorta, were collected at a mM Tris-HCl, pH 8.4, 500 mM KCl), 1 μl 10 mM dNTPs and 6.25 local abattoir and transported to the laboratory in phosphate buff- pmol of each sequence-specific primer (Invitrogen, Italy). It was ered saline (PBS), washed in fresh PBS and stored at –80 C. carried out in an Eppendorf thermal cycler (Eppendorf, Italy), using Porcine sperm samples were purified by centrifugation through a the following cycle: 94 C for 3 min, followed by 25 cycles of 94 C discontinuous Percoll density gradient (95:45, v/v) and swim-up for 30 sec, 59–60 C for 30 sec and 72 C for 45 sec, with a final technique.
Load more

Recommended publications
  • NOD-Like Receptors in the Eye: Uncovering Its Role in Diabetic Retinopathy
    International Journal of Molecular Sciences Review NOD-like Receptors in the Eye: Uncovering Its Role in Diabetic Retinopathy Rayne R. Lim 1,2,3, Margaret E. Wieser 1, Rama R. Ganga 4, Veluchamy A. Barathi 5, Rajamani Lakshminarayanan 5 , Rajiv R. Mohan 1,2,3,6, Dean P. Hainsworth 6 and Shyam S. Chaurasia 1,2,3,* 1 Ocular Immunology and Angiogenesis Lab, University of Missouri, Columbia, MO 652011, USA; [email protected] (R.R.L.); [email protected] (M.E.W.); [email protected] (R.R.M.) 2 Department of Biomedical Sciences, University of Missouri, Columbia, MO 652011, USA 3 Ophthalmology, Harry S. Truman Memorial Veterans’ Hospital, Columbia, MO 652011, USA 4 Surgery, University of Missouri, Columbia, MO 652011, USA; [email protected] 5 Singapore Eye Research Institute, Singapore 169856, Singapore; [email protected] (V.A.B.); [email protected] (R.L.) 6 Mason Eye Institute, School of Medicine, University of Missouri, Columbia, MO 652011, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-573-882-3207 Received: 9 December 2019; Accepted: 27 January 2020; Published: 30 January 2020 Abstract: Diabetic retinopathy (DR) is an ocular complication of diabetes mellitus (DM). International Diabetic Federations (IDF) estimates up to 629 million people with DM by the year 2045 worldwide. Nearly 50% of DM patients will show evidence of diabetic-related eye problems. Therapeutic interventions for DR are limited and mostly involve surgical intervention at the late-stages of the disease. The lack of early-stage diagnostic tools and therapies, especially in DR, demands a better understanding of the biological processes involved in the etiology of disease progression.
    [Show full text]
  • ATP-Binding and Hydrolysis in Inflammasome Activation
    molecules Review ATP-Binding and Hydrolysis in Inflammasome Activation Christina F. Sandall, Bjoern K. Ziehr and Justin A. MacDonald * Department of Biochemistry & Molecular Biology, Cumming School of Medicine, University of Calgary, 3280 Hospital Drive NW, Calgary, AB T2N 4Z6, Canada; [email protected] (C.F.S.); [email protected] (B.K.Z.) * Correspondence: [email protected]; Tel.: +1-403-210-8433 Academic Editor: Massimo Bertinaria Received: 15 September 2020; Accepted: 3 October 2020; Published: 7 October 2020 Abstract: The prototypical model for NOD-like receptor (NLR) inflammasome assembly includes nucleotide-dependent activation of the NLR downstream of pathogen- or danger-associated molecular pattern (PAMP or DAMP) recognition, followed by nucleation of hetero-oligomeric platforms that lie upstream of inflammatory responses associated with innate immunity. As members of the STAND ATPases, the NLRs are generally thought to share a similar model of ATP-dependent activation and effect. However, recent observations have challenged this paradigm to reveal novel and complex biochemical processes to discern NLRs from other STAND proteins. In this review, we highlight past findings that identify the regulatory importance of conserved ATP-binding and hydrolysis motifs within the nucleotide-binding NACHT domain of NLRs and explore recent breakthroughs that generate connections between NLR protein structure and function. Indeed, newly deposited NLR structures for NLRC4 and NLRP3 have provided unique perspectives on the ATP-dependency of inflammasome activation. Novel molecular dynamic simulations of NLRP3 examined the active site of ADP- and ATP-bound models. The findings support distinctions in nucleotide-binding domain topology with occupancy of ATP or ADP that are in turn disseminated on to the global protein structure.
    [Show full text]
  • NLRP2 and FAF1 Deficiency Blocks Early Embryogenesis in the Mouse
    REPRODUCTIONRESEARCH NLRP2 and FAF1 deficiency blocks early embryogenesis in the mouse Hui Peng1,*, Haijun Liu2,*, Fang Liu1, Yuyun Gao1, Jing Chen1, Jianchao Huo1, Jinglin Han1, Tianfang Xiao1 and Wenchang Zhang1 1College of Animal Science, Fujian Agriculture and Forestry University, Fujian, Fuzhou, People’s Republic of China and 2Tianjin Institute of Animal Science and Veterinary Medicine, Tianjin, People’s Republic of China Correspondence should be addressed to W Zhang; Email: [email protected] *(H Peng and H Liu contributed equally to this work) Abstract Nlrp2 is a maternal effect gene specifically expressed by mouse ovaries; deletion of this gene from zygotes is known to result in early embryonic arrest. In the present study, we identified FAF1 protein as a specific binding partner of the NLRP2 protein in both mouse oocytes and preimplantation embryos. In addition to early embryos, both Faf1 mRNA and protein were detected in multiple tissues. NLRP2 and FAF1 proteins were co-localized to both the cytoplasm and nucleus during the development of oocytes and preimplantation embryos. Co-immunoprecipitation assays were used to confirm the specific interaction between NLRP2 and FAF1 proteins. Knockdown of the Nlrp2 or Faf1 gene in zygotes interfered with the formation of a NLRP2–FAF1 complex and led to developmental arrest during early embryogenesis. We therefore conclude that NLRP2 interacts with FAF1 under normal physiological conditions and that this interaction is probably essential for the successful development of cleavage-stage mouse embryos. Our data therefore indicated a potential role for NLRP2 in regulating early embryo development in the mouse. Reproduction (2017) 154 245–251 Introduction (Peng et al.
    [Show full text]
  • Greg's Awesome Thesis
    Analysis of alignment error and sitewise constraint in mammalian comparative genomics Gregory Jordan European Bioinformatics Institute University of Cambridge A dissertation submitted for the degree of Doctor of Philosophy November 30, 2011 To my parents, who kept us thinking and playing This dissertation is the result of my own work and includes nothing which is the out- come of work done in collaboration except where specifically indicated in the text and acknowledgements. This dissertation is not substantially the same as any I have submitted for a degree, diploma or other qualification at any other university, and no part has already been, or is currently being submitted for any degree, diploma or other qualification. This dissertation does not exceed the specified length limit of 60,000 words as defined by the Biology Degree Committee. November 30, 2011 Gregory Jordan ii Analysis of alignment error and sitewise constraint in mammalian comparative genomics Summary Gregory Jordan November 30, 2011 Darwin College Insight into the evolution of protein-coding genes can be gained from the use of phylogenetic codon models. Recently sequenced mammalian genomes and powerful analysis methods developed over the past decade provide the potential to globally measure the impact of natural selection on pro- tein sequences at a fine scale. The detection of positive selection in particular is of great interest, with relevance to the study of host-parasite conflicts, immune system evolution and adaptive dif- ferences between species. This thesis examines the performance of methods for detecting positive selection first with a series of simulation experiments, and then with two empirical studies in mammals and primates.
    [Show full text]
  • Alteration of Genomic Imprinting After Assisted Reproductive Technologies and Long-Term Health
    life Review Alteration of Genomic Imprinting after Assisted Reproductive Technologies and Long-Term Health Eguzkine Ochoa Department of Medical Genetics, University of Cambridge and NIHR Cambridge Biomedical Research Centre, Cambridge CB2 0QQ, UK; [email protected]; Tel.: +44-1233-746714 Abstract: Assisted reproductive technologies (ART) are the treatment of choice for some infertile couples and even though these procedures are generally considered safe, children conceived by ART have shown higher reported risks of some perinatal and postnatal complications such as low birth weight, preterm birth, and childhood cancer. In addition, the frequency of some congenital imprinting disorders, like Beckwith–Wiedemann Syndrome and Silver–Russell Syndrome, is higher than ex- pected in the general population after ART. Experimental evidence from animal studies suggests that ART can induce stress in the embryo and influence gene expression and DNA methylation. Human epigenome studies have generally revealed an enrichment of alterations in imprinted regions in chil- dren conceived by ART, but no global methylation alterations. ART procedures occur simultaneously with the establishment and maintenance of imprinting during embryonic development, so this may underlie the apparent sensitivity of imprinted regions to ART. The impact in adulthood of imprinting alterations that occurred during early embryonic development is still unclear, but some experimental evidence in mice showed higher risk to obesity and cardiovascular disease after the restriction of some imprinted genes in early embryonic development. This supports the hypothesis that imprinting alterations in early development might induce epigenetic programming of metabolism and affect long-term health. Given the growing use of ART, it is important to determine the impact of ART in genomic imprinting and long-term health.
    [Show full text]
  • NOD-Like Receptors (Nlrs) and Inflammasomes
    International Edition www.adipogen.com NOD-like Receptors (NLRs) and Inflammasomes In mammals, germ-line encoded pattern recognition receptors (PRRs) detect the presence of pathogens through recognition of pathogen-associated molecular patterns (PAMPs) or endogenous danger signals through the sensing of danger-associated molecular patterns (DAMPs). The innate immune system comprises several classes of PRRs that allow the early detection of pathogens at the site of infection. The membrane-bound toll-like receptors (TLRs) and C-type lectin receptors (CTRs) detect PAMPs in extracellular milieu and endo- somal compartments. TRLs and CTRs cooperate with PRRs sensing the presence of cytosolic nucleic acids, like RNA-sensing RIG-I (retinoic acid-inducible gene I)-like receptors (RLRs; RLHs) or DNA-sensing AIM2, among others. Another set of intracellular sensing PRRs are the NOD-like receptors (NLRs; nucleotide-binding domain leucine-rich repeat containing receptors), which not only recognize PAMPs but also DAMPs. PAMPs FUNGI/PROTOZOA BACTERIA VIRUSES MOLECULES C. albicans A. hydrophila Adenovirus Bacillus anthracis lethal Plasmodium B. brevis Encephalomyo- toxin (LeTx) S. cerevisiae E. coli carditis virus Bacterial pore-forming L. monocytogenes Herpes simplex virus toxins L. pneumophila Influenza virus Cytosolic dsDNA N. gonorrhoeae Sendai virus P. aeruginosa Cytosolic flagellin S. aureus MDP S. flexneri meso-DAP S. hygroscopicus S. typhimurium DAMPs MOLECULES PARTICLES OTHERS DNA Uric acid UVB Extracellular ATP CPPD Mutations R837 Asbestos Cytosolic dsDNA Irritants Silica Glucose Alum Hyaluronan Amyloid-b Hemozoin Nanoparticles FIGURE 1: Overview on PAMPs and DAMPs recognized by NLRs. NOD-like Receptors [NLRs] The intracellular NLRs organize signaling complexes such as inflammasomes and NOD signalosomes.
    [Show full text]
  • A Nucleotide-Binding Oligomerization Domain for Innate Immunity and Reproduction
    Editorial Page 1 of 5 A nucleotide-binding oligomerization domain for innate immunity and reproduction Yike Yin, Ce Shan, Zhonghan Li Center for Growth, Metabolism & Aging Key Laboratory of Bio-Resource and Eco-Environment of Ministry of Education, College of Life Sciences, Sichuan University, Chengdu 610065, China Correspondence to: Zhonghan Li. College of Life Sciences, Sichuan University, Chengdu 610065, China. Email: [email protected]. Provenance: This is an invited Editorial commissioned by Section Editor Dr. Ziwei Li (Department of Surgery, First Affiliated Hospital of Kunming Medical School, Kunming, China). Comment on: Abe T, Lee A, Sitharam R, et al. Germ-Cell-Specific Inflammasome Component NLRP14 Negatively Regulates Cytosolic Nucleic Acid Sensing to Promote Fertilization. Immunity 2017;46:621-34. Received: 02 February 2018; Accepted: 27 February 2018; Published: 03 April 2018. doi: 10.21037/amj.2018.03.05 View this article at: http://dx.doi.org/10.21037/amj.2018.03.05 Exposure to the various environmental microbial pathogens still largely unknown. is a constant threat to mammals. As a rapid mobilized first NOD, LRR, and pyrin domain containing proteins line defense, innate immunity is of critical importance for (NLRPs) are members of NLRs protein family (4). Previous mammalian cells to maintain their normal activities. One of studies focused on their roles in apoptotic and inflammatory the key features of innate immune response is to distinguish signaling pathways via the formation of an inflammasome non-self from self cues and thus initiates downstream and activation of caspases in innate immunity (5-7). defense responses including releasing cytokines, activation However, more recent researches have revealed their roles and recruitment of immune cells, etc.
    [Show full text]
  • Unsolved Mysteries in NLR Biology
    REVIEW ARTICLE published: 17 September 2013 doi: 10.3389/fimmu.2013.00285 Unsolved mysteries in NLR biology Christopher Lupfer andThirumala-Devi Kanneganti* Department of Immunology, St. Jude Children’s Research Hospital, Memphis, TN, USA Edited by: NOD-like receptors (NLRs) are a class of cytoplasmic pattern-recognition receptors. Thomas A. Kufer, University of Although most NLRs play some role in immunity, their functions range from regulating anti- Cologne, Germany gen presentation (NLRC5, CIITA) to pathogen/damage sensing (NLRP1, NLRP3, NLRC1/2, Reviewed by: Martin Sheldon, Swansea University, NLRC4) to suppression or modulation of inflammation (NLRC3, NLRP6, NLRP12, NLRX1). UK However, NLRP2, NLRP5, and NLRP7 are also involved in non-immune pathways such as Mohammed N. Al-Ahdal, King Faisal embryonic development. In this review, we highlight some of the least well-understood Specialist Hospital and Research aspects of NLRs, including the mechanisms by which they sense pathogens or damage. Centre, Saudi Arabia NLRP3 recognizes a diverse range of stimuli and numerous publications have presented *Correspondence: Thirumala-Devi Kanneganti, potential unifying models for NLRP3 activation, but no single mechanism proposed thus Department of Immunology, MS far appears to account for all possible NLRP3 activators. Additionally, NLRC3, NLRP6, and #351, St. Jude Children’s Research NLRP12 inhibit NF-kB activation, but whether direct ligand sensing is a requirement for this Hospital, 262 Danny Thomas Place, function is not known. Herein, we review the various mechanisms of sensing and activa- Memphis, TN 38105-3678, USA e-mail: thirumala-devi.kanneganti@ tion proposed for NLRP3 and other inflammasome activators. We also discuss the role of stjude.org NLRC3, NLRP6, NLRP12, and NLRX1 as inhibitors and how they are activated and function in their roles to limit inflammation.
    [Show full text]
  • Human Parvovirus B19 Nonstructural Protein NS1 Activates NLRP3 Inflammasome Signaling in Adult‑Onset Still's Disease
    3364 MOLECULAR MEDICINE REPORTS 17: 3364-3371, 2018 Human parvovirus B19 nonstructural protein NS1 activates NLRP3 inflammasome signaling in adult‑onset Still's disease DER-YUAN CHEN1-4, YI-MING CHEN1-3*, HSIN-HUA CHEN1-3*, CHIA-WEI HSIEH1-3, NING-RONG GUNG1, WEI-TING HUNG1,2, BOR-SHOW TZANG4-7 and TSAI-CHING HSU4,5,7 1Department of Medical Education and Research, Taichung Veterans General Hospital, Taichung 40705; 2Faculty of Medicine, National Yang Ming University, Taipei 11221; 3Institute of Biomedical Science and Rong Hsing Research Center for Translational Medicine, National Chung Hsing University, Taichung 40227; 4Institute of Biochemistry, Microbiology and Immunology; 5Immunology Research Center; 6Department of Biochemistry, School of Medicine; 7Clinical Laboratory, Chung Shan Medical University, Taichung 40201, Taiwan, R.O.C. Received January 18, 2017; Accepted November 13, 2017 DOI: 10.3892/mmr.2017.8275 Abstract. Dysregulation of inflammasomes serves a induced significant upregulation of transcript levels of NLRP3, pathogenic role in autoinflammatory diseases (AIDs) and caspase-1 and interleukin (IL)-1β compared with PBMCs from adult-onset Still's disease (AOSD) has been categorized as healthy controls. B19-NS1 stimulation of PBMCs from patients an AID. The present study investigated the expression of with AOSD induced significant increase in supernatant levels NLR family pyrin domain containing proteins (NLRPs) of IL-1β and protein expression of NLRP3, caspase-1, IL-1β, inflammasome in patients with AOSD, the effect of inflam- and IL‑18 compared with healthy controls. Elevated expres- masome inhibitors on NLRP3 signaling and whether human sion of NLRP3 and its downstream inflammasome signaling parvovirus B19-associated antigens can activate NLRP3 in components in patients with AOSD indicated a potential patho- patients with AOSD.
    [Show full text]
  • Unleashing the Therapeutic Potential of NOD-Like Receptors
    REVIEWS Unleashing the therapeutic potential of NOD-like receptors Kaoru Geddes*, João G. Magalhães* and Stephen E. Girardin‡ Abstract | Nucleotide-binding and oligomerization domain (NOD)-like receptors (NLRs) are a family of intracellular sensors that have key roles in innate immunity and inflammation. Whereas some NLRs — including NOD1, NOD2, NAIP (NLR family, apoptosis inhibitory protein) and NLRC4 — detect conserved bacterial molecular signatures within the host cytosol, other members of this family sense ‘danger signals’, that is, xenocompounds or molecules that when recognized alert the immune system of hazardous environments, perhaps independently of a microbial trigger. In the past few years, remarkable progress has been made towards deciphering the role and the biology of NLRs, which has shown that these innate immune sensors have pivotal roles in providing immunity to infection, adjuvanticity and inflammation. Furthermore, several inflammatory disorders have been associated with mutations in human NLR genes. Here, we discuss the effect that research on NLRs will have on vaccination, treatment of chronic inflammatory disorders and acute bacterial infections. Nuclear factor-κβ Innate immunity to microbial pathogens relies on the current research suggests that they are essential for the A transcription factor activated specific host-receptor detection of pathogen- and danger- induction and regulation of the caspase 1 inflammasome by NLR or TLR signalling derived molecular signatures (collectively referred to as through their N-terminal pyrin domain7. Another that mediates expression of pathogen-associated molecular patterns (PAMPs) and important aspect of NLR biology is that a number of the cytokines and chemokines. danger-associated molecular patterns (DAMPs), respec- genes that encode these proteins are mutated in human Inflammasome tively).
    [Show full text]
  • The Evolution of Reproduction-Related NLRP Genes
    J Mol Evol (2014) 78:194–201 DOI 10.1007/s00239-014-9614-3 REVIEW The Evolution of Reproduction-Related NLRP Genes Edgar A. Due´n˜ez-Guzma´n • David Haig Received: 17 January 2013 / Accepted: 19 February 2014 / Published online: 11 March 2014 Ó Springer Science+Business Media New York 2014 Abstract NLRP proteins are important components of Introduction inflammasomes with a major role in innate immunity. A subset of NLRP genes, with unknown functions, are NLRP proteins (Nod-like receptors with a pyrin domain) expressed in oocytes and early embryos. Mutations of have attracted recent attention because of their role in Nlrp5 in mice are associated with maternal-effect embry- innate immunity and inflammation (Kufer and Sansonetti onic lethality and mutations of NLRP7 in women are 2011; Strowig et al. 2012). A subset of NLRP genes are associated with conception of biparental complete hyda- expressed in mammalian oocytes (Hamatami et al. 2004; tidiform moles (biCHMs), suggesting perturbed processes Ponsuksili et al. 2006; Zhang et al. 2008) and maternal of genomic imprinting. Recessive mutations on NLRP2/7 deficiency of some of these ‘‘reproduction-related’’ NLRPs in humans are associated with reproductive disorders and (rNLRPs) have been shown to cause embryonic lethality in appear to be induced by a demethylation of the maternal mice (Hamatami et al. 2004; Tong et al. 2000; Peng et al. pronucleus. In this study, we find that radiation of NLRP 2012) and perturbations of genomic imprinting in human genes occurred before the common ancestor of Afrotheria oocytes (Murdoch et al. 2006; Kou et al. 2008; Parry et al.
    [Show full text]
  • Identification of Novel Regulatory Genes in Acetaminophen
    IDENTIFICATION OF NOVEL REGULATORY GENES IN ACETAMINOPHEN INDUCED HEPATOCYTE TOXICITY BY A GENOME-WIDE CRISPR/CAS9 SCREEN A THESIS IN Cell Biology and Biophysics and Bioinformatics Presented to the Faculty of the University of Missouri-Kansas City in partial fulfillment of the requirements for the degree DOCTOR OF PHILOSOPHY By KATHERINE ANNE SHORTT B.S, Indiana University, Bloomington, 2011 M.S, University of Missouri, Kansas City, 2014 Kansas City, Missouri 2018 © 2018 Katherine Shortt All Rights Reserved IDENTIFICATION OF NOVEL REGULATORY GENES IN ACETAMINOPHEN INDUCED HEPATOCYTE TOXICITY BY A GENOME-WIDE CRISPR/CAS9 SCREEN Katherine Anne Shortt, Candidate for the Doctor of Philosophy degree, University of Missouri-Kansas City, 2018 ABSTRACT Acetaminophen (APAP) is a commonly used analgesic responsible for over 56,000 overdose-related emergency room visits annually. A long asymptomatic period and limited treatment options result in a high rate of liver failure, generally resulting in either organ transplant or mortality. The underlying molecular mechanisms of injury are not well understood and effective therapy is limited. Identification of previously unknown genetic risk factors would provide new mechanistic insights and new therapeutic targets for APAP induced hepatocyte toxicity or liver injury. This study used a genome-wide CRISPR/Cas9 screen to evaluate genes that are protective against or cause susceptibility to APAP-induced liver injury. HuH7 human hepatocellular carcinoma cells containing CRISPR/Cas9 gene knockouts were treated with 15mM APAP for 30 minutes to 4 days. A gene expression profile was developed based on the 1) top screening hits, 2) overlap with gene expression data of APAP overdosed human patients, and 3) biological interpretation including assessment of known and suspected iii APAP-associated genes and their therapeutic potential, predicted affected biological pathways, and functionally validated candidate genes.
    [Show full text]