Journal of Reproduction and Development, Vol. 56, No. 1, 2010, 09-098A —Full Paper— Characterization of Maternal Antigen That Embryos Require (MATER/ NLRP5) Gene and Protein in Pig Somatic Tissues and Germ Cells Laura Francesca PISANI1,3), Paola RAMELLI1), Barbara LAZZARI2), Silvia BRAGLIA1)#, Fabrizio CECILIANI3) and Paola MARIANI1) 1)Livestock Genomics 2 Unit, Parco Tecnologico Padano, Lodi 26900, 2)Statistical Genomics and Bioinformatics Unit, Parco Tecnologico Padano, Lodi 26900 and 3)Department of Animal Pathology, Hygiene and Veterinary Public Health, Università degli Studi di Milano, Milano 20133, Italy #Present: DIPROVAL, Sezione di Allevamenti Zootecnici, University of Bologna, Reggio Emilia 42100, Italy Abstract. Maternal effect genes produce mRNA or proteins that accumulate in the egg during oogenesis and control the developmental program until embryonic genome activation takes place. NLRP5 (NLR family, Pyrin domain containing 5), also called MATER (Maternal Antigen That Embryos Require) is one of the genes required for normal early embryonic development, although its precise function remains to be elucidated. The aim of the present study was to analyze the NLRP5 gene expression pattern and protein distribution in somatic tissues and germ cells in the pig. Reverse transcription was performed on mRNA from germinal vescicle (GV) oocytes and total RNA from spermatozoa and tissues from different organs. The transcript for NLRP5 gene was identified only in ovaries and oocytes. The presence of NLRP5 protein was detected only in ovaries by western blot analysis and immunohistochemistry. Key words: Maternal effect genes, NLR family, Pyrin domain containing 5 (NLRP5), Oocytes, Pig (J. Reprod. Dev. 56: 41–48, 2010) ver the past few years, a number of mammalian genes predom- differentiation and maturation [17–19]. Maternally expressed inantly or exclusively expressed in germ cells have been genes are implicated in this process, and some of them are associ- discovered. Functional studies have reported the essential role of ated with developmental competence [20, 21]. In domestic species, these genes during gametogenesis, folliculogenesis and early MET occurs at the 4–16-cell stage [22], a stage in which enough embryonic development [1–7]. NLRP5 (NLR, pyrin domain biological material is available to study the fate of maternal containing5), also called MATER (Maternal Antigen That mRNAs and their action in regulating embryo cleavages. Studying Embryos Require), is one of these genes. However, its precise these genes in farm animals provides a model for understanding the function remains to be elucidated, although the transcription pat- mechanisms that affect oocyte quality and their implication in the terns may suggest a role in embryonic genome activation. success of embryo development and survival. Maternal mRNAs accumulated in the oocyte have a crucial role NLRP5 is an oocyte-specific maternal effect gene first identified for successful embryo development before activation of the embry- in the mouse, an animal in which it affects development beyond the onic genome (EGA) [3], and some of them are also required for 2-cell stage [15, 23]. More recently, the RNA and protein were embryo development after EGA and implantation. These genes, observed up to the 16-cell stage in bovine embryos [24, 25], the 8- which are called maternal effect genes and which include NLRP5, cell stage in a non-human primate [26] and in germinal vesicles in Zygotic Arrest 1 (Zar1) [8, 9], Stella [10, 11] and Nucleoplasmin 2 humans [27]. The transcript can be detected during oocyte growth (Npm2) [12], are all required for normal embryonic development from primary follicles, accumulates during oocyte development beyond the 1- and 2-cell stage in mice [13, 14]. Knock-out of these and decreases after fertilization [28, 29]. NLRP5-null female mice genes leads to incapacity of the embryo to develop beyond the 2- present a normal phenotype regarding folliculogenesis, ovulation cell stage [15]. and fertilization; however, their embryos do not develop beyond Developmental block in embryos produced in vitro remains the the 2-cell stage coincident with maternal-to-embryo transition [15]. main problem in assisted reproduction of farm animals, particularly The NLRP family is a subfamily of the newly described CATER- in cattle and pigs. An increasing amount of data indicates that the PILLER (CAspase-recruiment domain (CARD) Transcription embryonic genome activation is crucial for the success of preim- Enhancer, R (purine)-binding, Pyrin, Lots of LEucine Repeats) plantation embryo development [16]. To ensure maternal-embryo family, which comprises proteins with a nucleotide-binding transition (MET) of gene expression, oocytes have to reach a suffi- domain and a leucine-rich domain [30]. In humans, the NLRP gene ciently advanced level of developmental competence during family is constituted of 14 members [31]. As these genes have only been discovered recently, information about their expression and Received: June 9, 2009 functions in farm animals is still very limited. Accepted: September 1, 2009 Published online in J-STAGE: October 8, 2009 The aim of this study was the identification and characterization ©2010 by the Society for Reproduction and Development in a second farm species, swine, of one of these genes, NLRP5, an Correspondence: LF Pisani (e-mail: [email protected]) oocyte-selective factor that may play an important role in oogenesis 42 PISANI et al. Table 1. Primer pairs used for correct mRNA retro-transcription and cDNA amplification Forward 5’–3’ Reverse 5’–3’ Amplicon size Annealing temperature Beta actin aatcctgcggcatccacgaaacta agaagcatttgcggtggacgat 318 bp 60 C Histone H2AFZ aggacgactagccatggacgtgtg ccaccaccagcaattgtagccttg 208 bp 60 C cds1 tccaattacggactgcagtggt gctcttcgagtccatctaccacaa 772 bp 59 C cds2 ggctcttgattgtggtagatggac cgtagaacaaggccgcaaagaa 726 bp 60 C cds3 aggagttctttgcggccttgtt acccgggcccctttaaatatcaga 697 bp 59 C cds4 ggcagccagcctgtaaaatacaga tcgtgatcacgttggacagact 771 bp 59 C cds5 agagtctgtccaacgtgatcacga taggacagcgcttcacagagaac 637 bp 60 C and preimplantation embryo development, thus confirming the data Italy) according to the manufacturer’s instructions. RNA from produced so far only in bovine. each sample was quantified using a NanoDrop Spectrophotome- ter (NanoDrop Technologies, Wilmington, DE, USA) and stored Materials and Methods at –80 C until use. Oocyte collection Reverse transcription polymerase chain reaction and cDNA Ovaries from puberal gilts were collected from a local abattoir amplification and transported to the laboratory at 25–30 C in 0.9% saline. Cumu- Reverse transcription polymerase chain reaction (RT-PCR) was lus oocyte complexes (COCs) were isolated under a carried out in a total volume of 20 μl of reaction mixture containing stereomicroscope, recovered from each dish and transferred to a mRNA from pooled oocytes and total RNA from tissues and sper- Petri dish containing Tissue Culture Medium 199 (TCM 199). matozoa (1 μg total RNA), 1 μl of oligo(dT)18 (0.5 μg/μl) and Cumulus cells were removed using 3 mg/ml hyaluronidase in saline DEPC-treated water up to the final volume. RNA was denatured at and repeated pipetting. Oocytes were collected in pools of 10 in 3 70 C for 5 min. Four μl of 5× reaction buffer, 1 μl of 10 mM μl of washing medium, TCM 199, and stored at –80 C until use. dNTPs and 1 μl of RiboLock Ribonuclease inhibitor (20 U/ml) were added and the mixture was incubated at 37 C for 5 min. RT RNA isolation from oocytes was performed with 1 μl (200 U) RevertAid H Minus M-MuLV RT Extraction of mRNA from oocytes was performed using a Dyna- for 1 hour at 42 C. Enzymes were inactivated at 70 C for 10 min. beads mRNA DIRECT Micro-Kit (Invitrogen, Italy) according to All reagents were purchased from M-Medical, Italy. the manufacturer’s instructions. Briefly, samples were lysed in 100 The correct mRNA retrotranscription was assessed by PCR. μl of Lysis Buffer for 10 min at room temperature. Each sample Primers for beta actin (EMBL DQ845171) and H2A histone family was transferred into a clean tube with 2μl of Dynabeads member Z (EMBL NM_174809) were designed based on the swine Oligo(dT)25 and gently mixed for 5 min. After two washes in and bovine sequence respectively (Table 1), and the amplicons Washing Solution A (10 mmol Tris-HCl, pH 8.0, 0.15 mmol LiCl, were used as positive controls in the following cDNA 1 mmol EDTA, 0.1% (w/v) SDS) and three washes in Washing amplification. Solution B (10 mmol Tris-HCl, pH 8.0, 0.15 mmol LiCl, 1 mmol Five primer pairs were designed based on the complete NLRP5 EDTA), Poly(A)+RNAs were eluted from the beads by incubation coding sequence (EMBL NM_001007814) and are reported in in 8.5 μl Diethylpyrocarbonate (DEPC)-treated water at 65 C for 2 Table 1. All primer pairs were designed using the prediction pro- min. Aliquots were immediately used for reverse transcription. gram AmplifX 1.37. A negative control was also included in the analysis. Tissue and spermatozoa collection and RNA extraction Polymerase chain reaction (PCR) was performed in a total vol- Porcine tissues, which for these experiments included sample ume of 15 μl of the following reaction mix: 0.6 μl 50 mM MgCl2, of the heart, liver, ovary, lung, spleen, medulla oblongata, tongue, 0.3 μl Taq DNA polymerase (5 U/μl), 1.5 μl 10 × PCR buffer (200 muscle, subcutaneous adipose tissue and aorta, were collected at a mM Tris-HCl, pH 8.4, 500 mM KCl), 1 μl 10 mM dNTPs and 6.25 local abattoir and transported to the laboratory in phosphate buff- pmol of each sequence-specific primer (Invitrogen, Italy). It was ered saline (PBS), washed in fresh PBS and stored at –80 C. carried out in an Eppendorf thermal cycler (Eppendorf, Italy), using Porcine sperm samples were purified by centrifugation through a the following cycle: 94 C for 3 min, followed by 25 cycles of 94 C discontinuous Percoll density gradient (95:45, v/v) and swim-up for 30 sec, 59–60 C for 30 sec and 72 C for 45 sec, with a final technique.