Thesis Reference

Thesis

Mechanisms of tumour suppression and control of genomic integrity by BARD1

JEFFORD, Charles Edward

Abstract

BARD1 est un suppresseur de tumeur qui interagit avec BRCA1 dans le maintien de l'intégrité du génome. D'autre part, il peut agir, indépendamment de BRCA1, dans une signalisation apoptotique en cas de stress génotoxique. Dans un premier volet, les mécanismes de suppression tumorale contrôlée par BARD1 ont été étudiés. Les régions de BARD1 nécessaires à l'induction de l'apoptose ont été identifiées ainsi que la nécessité d'une interaction entre BARD1 et p53. BARD1 est localisé dans le noyau où il forme des agrégats moléculaires avec BRCA1 et Rad51 pendant la réparation de l'ADN. En revanche, pendant l'apoptose, une translocation de BARD1 dans le cytoplasme a été observée. Dans un deuxième volet, certains facteurs déterminants de la stabilité chromosomique lors de la mitose ont été identifiés. En effet, lors de l'anaphase, BARD1 est localisé sur les microtubules, puis, lors de la cytokinèse, il interagit avec BRCA2, AuroraB et TACC1. Ces observations suggèrent un rôle supplémentaire de BARD1 dans la ségrégation des chromosomes pendant la mitose.

Reference

JEFFORD, Charles Edward. Mechanisms of tumour suppression and control of genomic integrity by BARD1. Thèse de doctorat : Univ. Genève, 2005, no. Sc. 3651

URN : urn:nbn:ch:unige-3490 DOI : 10.13097/archive-ouverte/unige:349

Available at: http://archive-ouverte.unige.ch/unige:349

Disclaimer: layout of this document may differ from the published version.

1 / 1 UNIVERSITÉ DE GENÈVE Département de biologie moléculaire FACULTÉ DES SCIENCES Professeur U. Schibler

Département de réhabilitation et gériatrie FACULTÉ DE MÉDECINE Professeur K.-H. Krause Docteur I. Irminger-Finger

Mechanisms of Tumour Suppression and Control of Genomic Integrity by BARD1

THÈSE Présenté à la faculté des sciences de l’Université de Genève pour obtenir le grade de Docteur ès sciences, mention biologique

par

Charles Edward Jefford

Troinex (GE)

Thèse N° 3651

Genève, 2005

UNIVERSITÉ DE GENÈVE Département de biologie moléculaire FACULTÉ DES SCIENCES Professeur U. Schibler

Département de réhabilitation et gériatrie FACULTÉ DE MÉDECINE Professeur K.-H. Krause Docteur I. Irminger-Finger

Mechanisms of Tumour Suppression and Control of Genomic Integrity by BARD1

THÈSE Présenté à la faculté des sciences de l’Université de Genève pour obtenir le grade de Docteur ès sciences, mention biologique

par

Charles Edward Jefford

Troinex (GE)

Thèse N° 3651

Genève, 2005

FACULTÉDESSCIENCES

.. DE GENEVE

Doctorat ès sciences mention biologique

Thèse de Monsieur Charles Edward JEFFORD intitulée:

"Mechanisms of Tumour Suppression and Control of

Genomic Integrity by BARD1 Il

La Faculté des sciences, sur le préavis de Monsieur K.-H. KRAUSE,professeur ordinaire et directeur de thèse (Département de gériatrie - laboratoire de biologie du vieillissement), de Madame 1.IRMINGER-FINGER,docteur (Département de gériatrie - laboratoire de biologie du vieillissement), et U. SCHIBLER,professeur ordinaire (Département de biologie moléculaire) co-directeurs de thèse, et M. AGUET, professeur (Institut Suissede recherche expérimentale surle cancer - Epalinges,Suisse),autorisel'impressionde la présente thèse, sans exprimer d'opinion sur les propositions qui y sont énoncées.

Genève, le 18 août 2005

(1 ~ Y'" \Vl V' Thèse - 3651 - Le Doyen, Pierre SPIERER

N.B.- La thèse doit porter la déclaration précédente et remplir les conditions énumérées dans les "Informations relatives aux thèses de doctorat à l'Université de Genève".

Nombre d'exemplaires à livrer par colis séparé à la Faculté: - 7 -

This thesis is dedicated to the ones I love: to my family and especially to my parents who unstintingly supported me throughout my university years.

Acknowledgements

I would like to thank my thesis supervisor and director, Dr Irmgard Irminger-Finger, for being such an excellent guide through this thesis and for her continuous enthusiasm; Professor Karl-Heinz Krause for being my thesis director and for welcoming me in the Laboratory of Aging Biology. I would like to thank Professors Ueli Schibler and Michel Aguet for accepting to be my thesis jury; Dr Pedro Herrera and Dr Michael Pepper for accepting to be my “parrains de thèse”.

I would like to address my appreciation to Dr Anis Feki, Dr Esther Bettiol, Dr Laetitia Cartier-Fioraso and Dr Stephan Ryser for their friendship, advice and support; to Aurélie Caillon, Laura Ortolan-Trigui, Chantal Genet, Terese Laforge and Olivier Plastre for their kindness, support and excellent technical assistance; Dr Jacques Proust and Dr Sophie Clement-Leboube for helpful comments on the manuscript; and Hélène Gfeller-Tillmann for administrative help. I would like to thank Dr Sarantis Gagos for providing his expertise on cytogenetic analysis, Dr Jean Harb on electronic microscopy, Dr Serge Arnaudeau on confocal microscopy, Dr Bénédicte Delaval and Dr Daniel Birnbaum for their precious collaboration.

I would like to give credit to all previous and present members of the Laboratory of Aging Biology and collaborators who helped me in various ways: Dr Marisa Jaconi, Dr Michel Dubois-Dauphin, Dr Lena Serrander, Dr Igor Bondarev, Dr Gaetan Gavazzi, Dr Philippe Berardi, Dr Jian Li, Dr Botond Banfi, Dr Mathieu Hauwel, Dr Michela Schaeppi, Dr Karen Bedard, Dr Anne-Thérèse Vlastos, Nicolas Molnarfi, Stéphanie Julien, Dr David Suter, Michael Stouffs, Fabrice Calabria, Mamadou Hadi-Sow, Dr Jian Yu Wu, Christine Deffert, Diderik Tirefort, Paula Borel, Françoise Piotton and Silvia Sorce.

iii Furthermore, I would like to acknowledge my former mentors Dr Richard Isbrucker, Dr Ross Longley and Dr Shirley Pomponi at the Harbor Branch Oceanographic Institution in Florida who were instrumental in rekindling my interest in biological sciences during a fulfilling internship, as well as Mr J. S. Johnson who provided the opportunity to work at HBOI.

Finally, I would like to express my gratitude to my father, Professor Charles William Jefford, for his unstinting support and encouragement, and for kindly reading the manuscript. I would also like to acknowledge my mother, sisters, nieces and brothers- in-law for their constant support: Susan, Sarah, Alex, Kasmira, Nina, Nieve, Mikael and Hossein without whom this doctorate would certainly not have been possible.

iv TABLE OF CONTENTS page Avant propos...... 1 Organisation de la thèse...... 1 Résumé de la thèse ...... 2 Introduction sur BARD1 ...... 2 Structure de BARD1...... 2 Les modèles génétiques ...... 3 L’activité ubiquitine ligase de BARD1...... 3 Les fonctions de BARD1 dépendantes de BRCA1...... 4 Les fonctions de BARD1 indépendantes de BRCA1...... 5 Les objectifs de la thèse...... 5 Résultats et discussion...... 6 Conclusion...... 13 Preface...... 14 The purpose of cancer...... 14 Review on BARD1 and its diverse functions...... 16 I) Breast cancer and the BRCA tumour suppressors...... 16 BRCA1 and BRCA2 mutations in cancer...... 16 Genetic models for BRCA1 and BRCA2...... 18 Overview BRCA1 and BRCA2 functions...... 18 II) BARD1 protein structure ...... 19 BARD1 discovery and phylogenetic analysis...... 19 BARD1 orthologues...... 21 RING finger domain...... 23 Ankyrin repeats...... 25 BRCT domains...... 25 III) Ubiquitin ligase functions of BRCA1/BARD1...... 26 RING finger domain proteins are ubiquitin ligases...... 26 Ubiquitination and de-ubiquitination...... 26 BARD1/BRCA1 heterodimer is an E3 ubiquitin ligase...... 27 Ubiquitin targets of the BARD1/BRCA1 heterodimer...... 28 IV) BARD1 functions and its associated proteins...... 31

v Knockout experiments and genomic instability phenotype. . . . . 32 BARD1 in DNA-damage repair...... 33 Cellular localisation of BARD1 and BRCA1 during DNA repair. . 33 BARD1 in transcriptional regulation and chromatin remodelling. . 34 BARD1 in mRNA processing...... 36 BRCA1-independent pro-apoptotic functions of BARD1 ...... 37 Mapping of pro-apoptotic domain of BARD1...... 39 BRCA1 and BARD1 functions in cell cycle...... 40 V) BARD1 mutations and expression in cancer...... 41 BARD1 tumour suppressor mutations in breast and ovarian cancers 41 BARD1 expression in normal and tumour tissues...... 43 VI) Conclusion...... 45 Results...... 47 Published results (1 to 4) and paper submitted for publication (5) are preceded by a one page summary and explain my contribution in each project. Supplemental results (6 and 7) are summarized and accompanied by figures.

Publications:

1. Irminger-Finger I, Leung WC, Li J, Dubois-Dauphin M,Harb J, Feki A, Jefford CE, Soriano JV, Jaconi M, Montessano R, Krause KH. Identification of BARD1 as mediator between proapoptotic stress and p53-dependent apoptosis. Mol Cell. 2001 Dec;8(6):1255-66...... 48

2. Jefford CE, Feki A, Harb J, Krause KH, Irminger-Finger I. Nuclear- cytoplasmic translocation of BARD1 is linked to its apoptotic activity. Oncogene. 2004 Apr 29;23(20):3509-20...... 60

3. Feki A, Jefford CE, Durand P, Harb J, Lucas H, Krause KH, Irminger-Finger I. BARD1 expression during spermatogenesis is associated with apoptosis and hormonally regulated. Biol Reprod. 2004 Nov;71(5):1614-24...... 73

4. Feki A, Jefford CE, Berardi P, Wu JY, Cartier L, Krause KH, Irminger- Finger I. BARD1 induces apoptosis by catalyzing phosphorylation of p53 by DNA-damage response kinase. Oncogene. 2005 Mar 14 (in press)...... 85

Submitted for publication: 5. Jefford CE, Delaval B, Ryser S, Birnbaum D, Irminger-Finger I. BARD1 interacts with BRCA2 to regulate cytokinesis and maintain genomic stability...... 97 Supplemental results and ongoing projects: 6. Role of BARD1 in telomere maintenance and crisis...... 124 7. BARD1 promoter analysis...... 130 Conclusion...... 136 References...... 137

vii

Avant propos Organisation de la thèse Quelques mots sont nécessaires pour décrire le plan de la thèse. La thèse est divisée en plusieurs parties. Le premier chapitre est en français, résume toute la thèse et constitue aussi l’introduction de thèse. Il contient un résumé de la revue sur BARD1, les objectifs et le plan de la thèse, un résumé précis des résultats et discussions, divisés en 7 sous-chapitres, ainsi qu’une petite conclusion. Le reste de la thèse est en anglais à cause des publications. Le deuxième chapitre est une préface philosophique sur le rôle des tumeurs dans la population. Le troisième chapitre est une revue complète sur BARD1 qui sera prochainement soumis pour une publication dans un journal et qui a déjà servi en partie comme chapitre pour un livre. Le quatrième chapitre regroupe tous les résultats et est divisé en 7 parties distinctes. Ces parties sont reliées entre elles par la même thématique. Vu que tous les résultats sont publiés avec des collaborateurs, les sous-chapitres sont introduits par un petit résumé où je décris aussi ma contribution. Les sous-chapitres résultats (1 à 4) sont des publications. Le sous-chapitre (5) a été soumis pour publication et les deux derniers sous-chapitres (6 et 7) sont présentés, par soucis de concision, très succinctement avec quelques figures. Ces deux derniers chapitres représentent beaucoup de travail et sont en cours d’étude. La thèse se termine par une petite conclusion et les références. Bonne lecture !

Résumé de la thèse Introduction sur BARD1 Les cancers du sein et de l’ovaire sont prévalents dans les pays développés. En effet, le risque cumulé dans la vie d’une femme de développer un cancer du sein est de 11% aux Etats Unis. La plupart des cas sont sporadiques, et, seulement environ 10% sont d’origine héréditaire. Deux gènes principaux de susceptibilité aux cancers gynécologiques ont été identifiés : BRCA1 et BRCA2 (Breast Cancer susceptibility genes 1 and 2). Ces deux gènes sont responsables d’environ la moitié des cas de tumeurs héréditaires. Des mutations dans d’autres gènes tels que PTEN, TP53, ATM, FANCD2 peuvent aussi prédisposer au cancer du sein, mais avec un risque très faible. BRCA1 et BRCA2 sont décrits comme des suppresseurs de tumeurs ; en effet, des mutations dans ces gènes prédisposent à des tumeurs du sein et de l’ovaire et les cellules de ces tumeurs perdent leurs allèles de type sauvage, produisant une perte de fonction. La nécessité d’étudier les mécanismes de suppression de tumeurs contrôlés par BRCA1 et de découvrir d’autres facteurs génétiques prédisposant aux cancers gynécologiques, a mené à la découverte de BARD1 (BRCA1 Associated RING Domain 1). Un criblage deux-hybrides dans la levure, en utilisant le bout N-terminal de BRCA1 comme appât, a permis l’identification d’une protéine interagissant avec BRCA1. Cette protéine, BARD1, est aussi un suppresseur de tumeur, car des mutations dans son gène semblent prédisposer au cancer du sein et parce que son absence n’est pas viable à l’état embryonnaire.

La structure de BARD1 BARD1 est une protéine de 777 acides aminés chez l’homme et de 765 chez la souris. BARD1 est un homologue de BRCA1. Elle contient deux domaines homologues hautement conservés pendant l’évolution. Ces domaines sont le domaine RING finger en N-terminal et le domaine BRCT en C-terminal. De plus, BARD1 contient trois domaines ankyrines que l’on ne se retrouve pas chez BRCA1. BARD1 et BRCA1 interagissent à travers leurs domaines RING. Deux chaînes en hélice-α de part et d’autre de la séquence primaire du RING assurent les liaisons hydrophobes permettant l’assemblage des deux domaines RING entre eux. Le RING

2 a une structure conservée qui contient deux atomes de zinc, nécessaires à l’activité enzymatique de l’hétérodimère BRCA1/BARD1. BARD1 a plusieurs orthologues chez d’autres espèces comme chez le Xenopus laevis et le nématode Caenorhabditis elegans, avec une fonction conservée.

Les modèles génétiques Pour comprendre la fonction de BARD1, une analyse génétique a été effectuée dans des souris. Comme pour BRCA1 ou BRCA2, les souris knock-outs pour BARD1 ne sont pas viables et meurent toutes au stade embryonnaire. Les embryons meurent prématurément parce que les cellules ne prolifèrent plus normalement et pas à cause de la mort cellulaire par apoptose. En revanche, les souris possédant un knock-out inductible développent des tumeurs du sein au bout d’une année. De plus, les cellules avec une délétion du gène de BARD1 génèrent rapidement une instabilité chromosomique et une morphologie néoplasique. Ces résultats montrent l’importance de l’expression de BARD1 dans le maintien du génome et dans la suppression de cancers.

L’activité ubiquitine ligase de BARD1 La fonction biochimique principale de BARD1 réside dans sa capacité à ubiquitiner des protéines. Cette fonction E3 ubiquitine ligase est augmentée en présence de BRCA1. Bien que des homodimères de BARD1 et de BRCA1 aient été observés in vitro, seule la forme hétérodimèrique est fonctionnelle in vivo. La fonction ubiquitine ligase de l’hétérodimère est nécessaire dans la suppression tumorale. En effet, les mutations connues, telles que C61G et C64G, inhibant l’activité ubiquitine ligase du domaine RING prédisposent à des tumeurs gynécologiques. Ces mutations déstabilisent la structure tridimensionnelle contenant le zinc, mais ne détruisent pas les liaisons hydrophobes de l’hétérodimère. Le domaine RING est caractéristique des ubiquitine ligases. Ces ubiquitine ligases sont très utiles, voire indispensables, dans le métabolisme de protéines contrôlant la progression du cycle cellulaire, telles que des cyclines D1, E1, p27, etc., et de ce fait peuvent jouer un rôle important dans le cancer et sa suppression. Les cibles de l’ubiquitination de BARD1/BRCA1 sont peu connues, probablement importantes dans la régulation du cycle cellulaire, mais on sait que BARD1/BRCA1 peut s’auto-ubiquitiner. De plus, BARD1/BRCA1 peut ajouter une protéine d’ubiquitine sur les histones H2A et H2AX, et sur FANCD2. Une

3 autre cible de l’ubiquitination de BRCA1/BARD1 est la γ-tubuline ce qui est important dans la régulation de la duplication des centrosomes. En outre, la nucleophosmine/B23 est aussi une cible candidate pour une ubiquitination par BRCA1/BARD1, confirmant un rôle pour BARD1 dans la régulation des centrosomes. Finalement, l’hétérodimère BRCA1/BARD1 peut se lier la RNA polymérase II (RNAPII) et peut ubiquitiner la sous-unité Rbp1 de RNAPII.

Les fonctions de BARD1 dépendantes de BRCA1 BARD1 a plusieurs fonctions. BARD1 se lie à BRCA1, et semble partager beaucoup de fonctions qui sont attribuées à BRCA1. Cependant, BARD1 possède des fonctions indépendantes de BRCA1. Sa fonction la plus importante est partagée avec BRCA1 dans la réparation de l’ADN. BARD1 interagit avec BRCA1 dans la réparation de l’ADN cassé en doubles brins (DSB, double strand breaks) et est activée par ATM, ATR et en se liant au DNA-PKs et aux protéines Ku70 et 80. La réparation peut se faire par HR (homology directed repair), par NHEJ (Non- homologous end joining), ou par MMR (mismatch repair) en interagissant avec hMSH2, hMSH3, hMSH6. L’expression de BARD1 peut être régulé pendant le cycle cellulaire, mais pour la réparation de l’ADN, BARD1 est localisé dans des complexes nucléaires pendant la phase S avec BRCA1 et Rad51 au niveau des sites de fourches de réplication et peut se re-agréger dans des complexes de réparation d’ADN avec PCNA et Rad51 après traitement hydroxyurée. La localisation nucléaire n’est pas exclusive et le déplacement de BARD1 dans le cytoplasme sera discuté dans la partie résultats.

BARD1 et BRCA1 jouent un rôle dans la régulation de la transcription car elles peuvent se lier au complexe RNA polymerase II holoenzyme (holo-pol). En outre, holo-pol est dégradée par ubiquitination après dommage de l’ADN. L’arrêt de la transcription à des sites de dommages d’ADN est associé à la dégradation de holo- pol suggérant un rôle pour BRCA1/BARD1 ubiquitine ligase dans la régulation de la transcription. De plus, il semblerait que le domaine BRCT de BARD1 comme celui de BRCA1 peut activer la transcription in vitro. BRCA1 peut se lier directement à l’ADN, sans doute à des sites de fourches de réplication. BARD1, en outre, peut se lier avec le facteur CstF-50 dans le but d’inhiber la polyadenylation et la maturation des ARN messagers in vitro, indiquant que BARD1 a effectivement un rôle dans la régulation

4 de l’expression de gènes. La sous-unité p50 de NF-kB peut se lier indirectement à BARD1 par l’intermédiaire de Bcl-3. L’interaction Bcl-3-BARD1 pourrait avoir lieu au niveau de leurs domaines ankyrines. Cette interaction est une indication supplémentaire quant au rôle de BARD1 dans la régulation de la transcription de certains gènes.

Les fonctions de BARD1 indépendantes de BRCA1 En plus des fonctions de BARD1 dépendantes de BRCA1, BARD1 a aussi une fonction indépendante de BRCA1, car sa surexpression dans des cellules en cultures est suffisante pour induire l’apoptose. Cette fonction est importante mais sera donc discutée plus en détails dans la thèse.

Objectifs de la thèse Le but de cette thèse est d’étudier les mécanismes de suppression tumorale contrôlée par BARD1 et de comprendre comment BARD1 maintient une stabilité génomique. La première partie de la thèse consiste à répondre aux questions suivantes : quelle est la partie de BARD1 qui est nécessaire à l’induction de l’apoptose ; quels sont les déterminants de cette voie apoptotique ; quels sont les protéines qui interagissent avec BARD1 dans la suppression tumorale ; est-ce que p53 interagit dans cette voie signalétique de l’apoptose? En outre, on a voulu montrer la dynamique de BARD1 et déterminer son expression et sa localisation pendant l’apoptose ainsi que pendant la mitose ; d’identifier les protéines qui interagissent avec BARD1 pendant la mitose et qui régulent son expression en caractérisant son promoteur. Dans un deuxième temps, nous avons étudié le phénomène de l’instabilité chromosomique dans les cellules cancéreuses et identifié certains déterminants de la stabilité génomique pendant la mitose, l’effet de BARD1 sur la régulation des télomères et sur la ségrégation des chromosomes.

Résultats et discussion 1. BARD1 : un médiateur de l’induction de l’apoptose en réponse à un stress génotoxique, dépendant de p53 BARD1 et BRCA1 ont des fonctions communes dans la réparation de l’ADN, dans la stabilité génomique, ainsi que dans des fonctions antitumorales. En effet, ces deux protéines homologues sont liées par leurs domaines RING respectifs. Dans une étude précédente, nous avons montré que la répression de BARD1 provoque des répercussions au niveau de la stabilité chromosomique ainsi que sur la morphologie et physiologie cellulaires, ce qui suggère une évolution vers un phénotype néoplasique. Dans cette première publication, nous montrons que BARD1 peut avoir des fonctions indépendantes de BRCA1 ainsi que l’importance de BARD1 face à un stress endommageant l’ADN. En cas de stress cellulaire et nucléaire, l’expression de BARD1 est augmentée à l’instar de celle de p53. Ces augmentations concomitantes de BARD1 et de p53 ont été observées in vitro en culture cellulaire, et in vivo dans des cas d’hypoxies induites par la formation d’une ischémie vasculaire cérébrale chez la souris. Nous avons démontré que cette augmentation se fait au niveau de la protéine et de son ARN messager. Il est intéressant de noter que les cellules qui sont réprimées pour BARD1 sont moins aptes à entrer en apoptose quand elles sont soumises à un stress. En effet, la fragmentation de l’ADN, normalement activée par des endonucléases spécifiques, de même que la présence de la caspase-3 activée sont réduites dans les cas où BARD1 est réprimée ou supprimée. La surexpression de BARD1 par transfection induit une mort cellulaire programmée. Les cellules produisent les mêmes signes qu’en cas de stress génotoxique, à savoir la fragmentation de l’ADN évaluée sur gel d’agarose, et mesurée quantitativement par cytométrie de flux (méthode TUNEL). Un mutant de BARD1 comprenant une mutation ponctuelle Q564H est incapable d’induire l’apoptose. De plus, l’induction de l’apoptose peut se faire même en l’absence de BRCA1. Les cellules souches de souris homozygotes BRCA1-/- peuvent être également induites en apoptose. Ceci démontre que BARD1 a une action cellulaire indépendante de BRCA1. Par contre, les effets pro-apoptotiques de BARD1 sont dépendants de p53 active et fonctionnelle. De plus, nous avons montré que BARD1 peut interagir avec p53 physiquement par des expériences de co-immunoprécipitations.

6 2. La translocation de BARD1 du noyau vers le cytoplasme est liée à son activité apoptotique BARD1 est un suppresseur de tumeur ainsi qu’une protéine pro-apoptotique. Puisqu’une augmentation de l’expression de BARD1 peut suffire à induire une réponse apoptotique dépendante de p53, nous avons cherché à identifier le domaine protéique de BARD1 responsable de la signalisation menant à l’apoptose. Pour cela, une série de mutants de délétion de BARD1 a été transfectée dans des cellules en culture et nous avons mesuré la capacité des protéines recombinantes à induire l’apoptose. Une région de la séquence de BARD1 comprenant les acides aminés de 510 à 604 est nécessaire à l’induction de l’apoptose. Cette partie de la séquence de BARD1 se trouve entre deux domaines fonctionnels : les répétitions d’ankyrines et le domaine BRCT en C-terminal. Ce domaine ne correspond pas à une structure conservée de la protéine. Ce domaine a la particularité de contenir les deux mutations répertoriées dans les tumeurs du sein C557S et Q564H. La partie proapoptotique de BARD1 corrèle donc avec la fonction de suppresseur de tumeur. De plus, cette étude démontre que la localisation nucléaire de BARD1 n’est pas exclusive, malgré la présence de nombreux NLS (signaux de localisation nucléaire). En effet, des expériences d’immunofluorescence ou avec la protéine de fusion BARD1-EGFP, et des protéines de délétion fusionnées avec EGFP ont montré que BARD1 peut également être exporté dans le cytoplasme. La détection cytoplasmique de BARD1 a pu se faire in vivo et in vitro : sur des sections de tissus de rate de souris par immunohistochimie d’une part, et sur des cellules en culture par immunofluorescence et par microscopie électronique d’autre part. Les extraits de cytoplasme et de noyau montrent par western blot une présence de BARD1 dans le cytoplasme qui augmente en fonction du temps après induction de l’apoptose. Cette augmentation sensible de BARD1 dans le cytoplasme est accompagnée de la présence d’une protéine tronquée de p67 qui est peut-être le résultat d’un clivage protéolytique. La double localisation nucléaire et cytoplasmique de BARD1 dénote une double fonction : nucléaire dans la réparation de l’ADN et cytoplasmique dans la mort cellulaire programmée.

7 3. L’expression de BARD1 pendant la spermatogenèse est associée à l’apoptose et peut être régulée hormonalement L’expression protéique de BARD1 est élevée dans les tissus germinaux males et pendant l’embryogenèse. Dans cette étude, nous démontrons que BARD1 est en fait exprimé à tous les stades de la spermatogenèse contrairement à BRCA1 qui est seulement exprimé dans les spermatides ronds et les spermatocytes primaires méiotiques. Alors que les spermatogonies expriment le messager complet de BARD1, les spermatocytes précurseurs tardifs expriment une nouvelle forme de BARD1, plus courte, qui est prédominante et qui est désignée BARD1β. Ce messager codant pour BARD1 tronquée, dépourvue de son RING domaine, a perdu sa capacité à se lier et d’interagir avec BRCA1. Par contre, BARD1β conserve son aptitude à induire l’apoptose. Ce fait est important dans la mesure où les spermatogonies qui prolifèrent rapidement ont besoin d’un système efficace pour éliminer les cellules surnuméraires par apoptose. La mort cellulaire par le truchement de BARD1, permet cette régulation. De plus, il a été démontré que la forme tronquée de BARD1β peut induire l’apoptose in vitro par transfection transitoire de cellules en culture. L’apoptose a été suivie in vivo par immunohistochimie sur des sections de testicules de souris. L’expression de BARD1 est corrélée avec l’expression de BAX et de la caspase-3 active ainsi que la fragmentation de l’ADN. Finalement, nous avons montré dans cette étude que, dans des cas de pathologies testiculaires telles que l’azoospermie obstructive, la cryptorchidie et le syndrome de Sertoli, l’expression de BARD1 est augmentée.

4. BARD1 induit l’apoptose en catalysant la phosphorylation de p53 par une kinase activée en réponse aux dommages de l’ADN Il a déjà été démontré que BARD1 joue un rôle dans la réponse apoptotique indépendamment de BRCA1, mais cela nécessite la présence de p53. Sans p53, la surexpression de BARD1 ne peut pas induire l’apoptose dans des cultures de cellules transfectées. Cette thèse est renforcée par le fait que BARD1 peut co- immunoprécipiter p53 et le stabiliser. L’activation de p53 pendant l’apoptose se fait par l’ajout post-traductionnel de groupements phosphates sur plusieurs résidus, notamment sur les serines 15 et 37. Les kinases identifiées à ce jour dans la réponse aux dommages de l’ADN sont multiples et se fait par ATM, ATR et DNA-PK. Dans

8 cet article, nous montrons que BARD1 peut catalyser la phosphorylation de p53 sur la serine 15. Cette phosphorylation est effectuée par une kinase, qui a donc besoin de la présence de BARD1 fonctionnel. Elle est sans doute effectuée à travers le rapprochement et l’attachement de BARD1 à p53. Pour démontrer que l’interaction est nécessaire nous avons co-immunoprécipité p53 avec des mutants de délétions fusionnés à la EGFP permettant la reconnaissance de la protéine recombinante. Les divers mutants nous indiquent que la zone d’attachement de BARD1 à p53 est relativement importante, puisqu’elle couvre pratiquement toute la séquence primaire de BARD1. Néanmoins, cette expérience nous montre que le mutant qui ne contient pas la séquence codant pour le RING domaine, ainsi que la EGFP seule, sont incapables de co-immunoprécipiter p53. Ce résultat nous indique également que BARD1 se lie à p53 sans le soutient de BCRA1. Dans cette étude, nous montrons que BARD1 peut aussi co-immunoprécipiter Ku-70, une kinase impliquée dans la reconnaissance de cassure d’ADN double brin. Cette kinase est activée après exposition à un stress nucléaire et cellulaire et elle peut être la kinase responsable de la phosphorylation de la serine 15 de p53 induite par BARD1, puisque BARD1 peut se lier à elle.

5. BARD1 interagit avec BRCA2 afin de réguler la progression du cycle cellulaire BARD1, BRCA1 et BRCA2 sont des suppresseurs de tumeurs qui permettent le maintien de l’intégrité des chromosomes pendant la mitose. La ségrégation des chromosomes doit se faire sans perte ou gain sinon la résultante est une instabilité génomique. Dans les souris knock-out, la suppression des gènes susmentionnés provoque une mort embryonnaire précoce due à des problèmes de prolifération cellulaire et non à l’apoptose. Les cellules dépourvues de BARD1, BRCA1 ou BRCA2 par knock-down siRNA ont une grande propension à devenir instables génétiquement, la marque universelle des cellules tumorales. Cette étude vise donc à identifier les déterminants et les liens entre la suppression tumorale réglée par BARD1 et la maintenance de l’instabilité chromosomique dans les cellules en division. En utilisant un siRNA de BARD1 pour réduire l’expression de son messager et par conséquent de son produit protéique, nous observons une augmentation de temps du cycle cellulaire, sa complétion est donc ralentie. De surcroît, les cellules déficientes en BARD1 présentent des anomalies dans la cytokinèse. En examinant

9 l’état du génome, après analyse du caryotype des cellules transduites avec le siRNA de BARD1, nous avons constaté l’apparition de cellules génétiquement instables contenant des chromosomes surnuméraires ou présentant des pertes chromosomiques. De plus, il a été démontré par nous et par d’autres groupes que BARD1 varie pendant le cycle cellulaire et atteint un pic d’expression pendant la mitose, soit en G2/M. Cette augmentation de BARD1 s’accompagne d’une co- localisation partielle de BARD1 avec les microtubules du fuseau mitotique. Cette co- localisation a été observée par microscopie à fluorescence. L’expérience étant basée sur la spécificité de l’anticorps, les contrôles de spécificité de l’anticorps dans ces cas sont importants. Nous avons montré que l’anticorps anti-BARD1 choisi réagit uniquement avec la protéine de fusion BARD1-EGFP et non avec les protéines tronquées en N-terminal, ce qui défini la région de l’épitope. Pour comprendre les mécanismes de BARD1 dans la cytokinèse, nous avons voulu savoir si BARD1 pouvait interagir avec les kinases qui sont impliquées dans la cytokinèse. Effectivement, BARD1 co-immunoprécipite Aurora B kinase et non Aurora A. De plus, et à notre surprise, BRCA2 peut co-immunoprécipiter avec BARD1 seulement dans la phase G2/M au moment de la phosphorylation de BRCA2. Ces résultats nous donnent une indication supplémentaire sur le rôle de BARD1 dans la régulation du cycle cellulaire. Les voies signalétiques de cette régulation ne sont néanmoins pas encore connues, bien que la fonction ubiquitine ligase de l’hétérodimère peut être mise en cause.

6. Le rôle de BARD1 dans le maintien des télomères Nous savons que la majorité des cellules cancéreuses ont une instabilité chromosomique ainsi qu’une télomèrase active. Nous avions précédemment vu que la non expression de BARD1 dans des cellules en culture ou bien dans des souris knock-out produit une augmentation de l’instabilité génomique. De plus, il a été démontré que BARD1 et BRCA1 sont des facteurs qui s’agrègent dans les corps nucléaires, PML, dans les cellules négatives pour la télomèrase et que le complexe BRCA1-Mre11-Rad50-Nbs1, qui intervient dans la réparation d’ADN, est aussi présent dans le complexe télomèrique. En sachant que BARD1, tout comme les télomères, s’assemblent en agrégats nucléaires, et que les protéines télomèriques sont nécessaires dans le maintien de l’intégrité des chromosomes, nous avons voulu déterminer s’il y avait un lien de causalité entre un dysfonctionnement de BARD1,

10 des télomères et une instabilité chromosomique. En d’autres termes, est-ce que BARD1 peut moduler le fonctionnement des protéines télomèriques et le maintien des télomères? Nous avons voulu savoir si BARD1 avait une influence fonctionnelle sur la longueur des télomères, sur l’activité de la télomèrase et si BARD1 pouvait se localiser avec les structures télomèriques. Les résultats d’immunohistochimie avec des sondes télomèriques et l’anticorps dirigé contre BARD1 sur des cellules en cultures et sur des sections de tissus nous montrent qu’une fraction de BARD1 a tendance à se localiser sur ou près des régions télomèriques. De plus, il apparaît dans certains cas que BARD1 peut co-localiser avec TRF-2 une protéine couvrant la longueur des télomères. Afin de voir s’il y avait une interaction directe entre BARD1 et les télomères, nous avons tenté d’immunoprécipiter l’ADN télomèrique avec un anticorps anti-BARD1. Le résultat obtenu par chromatine IP (ChIP) s’est révélé peut concluant ne démontrant pas d’interaction forte entre BARD1 et la chromatine télomèrique. La longueur des télomères des cellules épithéliales de glande mammaire de souris, qui ont été réprimées pour BARD1, a été mesurée par des méthodes de flow-FISH et de TRF. Il semblerait que ces cellules, comparées aux cellules normales, aient subit dans certains cas un raccourcissement des télomères. En fait, la longueur des télomères devient surtout beaucoup plus hétérogène dans les cellules BARD1 réprimées, ce qui est peut être l’expression d’un dérèglement du maintien des télomères. Puisque l’inactivation de BARD1 peut induire un phénotype néoplasique, et que la majorité des cellules tumorales ont une réactivation de la télomèrase, nous avons voulu savoir si la diminution de l’expression de BARD1 avait une influence négative sur l’activité de la télomèrase. Nous avons donc mesuré l’activité de la télomèrase par un test enzymatique et par PCR (TRAP) dans les cellules où l’expression de BARD1 était réduite. Ces expériences n’ont pas apporté de résultats concluants. En effet, les cellules de glandes mammaires de souris utilisées sont négatives pour la télomèrase à l’état sauvage. Les prochaines expériences tenteront de voir s’il y a une diminution de la longueur des télomères dans des lignées de cellules primaires et cancéreuses où on a réduit l’expression de BARD1 par transduction lentivirale de siRNA. La mesure de la diminution de la longueur des télomères devra s’effectuer sur plusieurs générations par la méthode dite de « Southern », par hybridation d’une sonde télomèrique marquée sur un gel d’ADN télomèrique (méthode TRF, telomere restriction fragment assay). Les résultats sont préliminaires et ne permettent pas de statuer sur une fonction de

11 BARD1 sur les télomères. Il est possible qu’en dépit d’un effet de BARD1 sur les télomères, que son action soit indirecte, un épiphénomène.

7. Caractérisation du promoteur de BARD1 Nous avons déjà constaté que BARD1, au niveau de son messager et de sa protéine, est augmentée dans des cas de stress génotoxique et qu’il est régulé hormonalement. De plus l’expression et la stabilité de BARD1 et de BRCA1 sont interdépendantes. Afin d’étudier les mécanismes de régulation d’expression de BARD1 dans les diverses conditions de stress cellulaire, de tumeurs, de réponse à une exposition aux hormones, de son rôle dans l’inflammation, de mort cellulaire, ou même dans le développement embryonnaire, il était important d’isoler et de caractériser le promoteur de BARD1 et la région promotrice minimale requise pour répondre à tous ces stimuli. Nous avons donc, dans un premier temps, caractérisé la région initiatrice de la transcription, le site cap en 5’ en amont de l’exon 1. Par une expérience 5’RACE et par PCR nous avons défini le site cap en amont de ce qui a déjà été publié. Nous avons amplifié par PCR à partir d’ADN génomique humain une région promotrice supposée que nous avons cloné dans un vecteur contenant le gène reporteur de la luciférase. Après transfection dans différentes lignées de cellules animales, nous avons constaté que la séquence de 856 paires de bases en amont du 5’UTR est suffisante pour l’activation constitutive de BARD1, mais en revanche ne semble pas contenir de sites de liaison à d’éléments régulateur. En effet, après une exposition à un stress cellulaire ou un traitement hormonal, les cellules transfectées avec le gène reporter ne montrent pas de variation notoire dans l’expression de la luciferase. Néanmoins, des travaux sont en cours pour caractériser une région qui pourrait réguler sensiblement l’expression du gène de BARD1. Notamment, une région de 2402 paires de bases en amont du 5’UTR a été clonée pour effectuer des tests par le système du gène reporter. Cette région contient des sites putatifs d’attachement à la p53 et au NF-κB entre autres, qu’il convient d’évaluer par des « shifts assay », « super shifts » et du DNA « footprinting » par exemple, en présence ou non de facteurs stimulants tels que des cytokines ou du TNF-α. Il serait intéressant de voir si cette région promotrice peut être activée par des cytokines, puisqu’on sait que la surexpression de BRCA1 fait augmenter la production cellulaire de NF-κB et que la sous-unité p50 peut se lier à BARD1 par

12 l’intermédiaire de Bcl-3. Ce serait une voie possible de régulation de l’expression de BARD1 par BRCA1, puisque l’on sait que BARD1 et BRCA1 se stabilisent mutuellement.

Conclusion Cette thèse divisée en plusieurs points se concentre sur une même thématique : le rôle de BARD1 dans la suppression de tumeurs et dans le maintien de la stabilité chromosomique et génétique d’une manière générale. Nous montrons que BARD1 agit souvent dans l’ombre de BRCA1, mais qu’elle peut avoir des fonctions indépendantes de BRCA1 dans plusieurs processus cellulaires. BARD1 possède une fonction proapoptotique. Bien que BARD1 soit décrite comme une molécule nucléaire, elle est également une protéine dynamique pouvant se localiser dans le cytoplasme. De plus, la fonction apoptotique est corrélée à sa localisation cytoplasmique. En outre, BARD1 joue un rôle dans l’apoptose des spermatocytes surnuméraires. BARD1 se lie à p53, la stabilise et est impliquée dans sa phosphorylation. Elle régule la complétion du cycle cellulaire, par TACC1, Aurora B et BRCA2 et semble avoir un rôle dans le maintien de l’intégrité des télomères. BARD1 est donc une protéine multifonctionnelle qui doit encore nous révéler bien des secrets au niveau de ses voies signalétiques et de ses fonctions.

Preface

The purpose of cancer

Question. Cancer is one of the leading causes of death in the world. In fact, it is the second leading cause of death after cardiovascular diseases. It has been predicted that one person in four will be afflicted with cancer during their life time. It is without any doubt a terrible and devastating disease. However, for a Doctor of Philosophy, that should not be the only reason for studying cancer. Compellingly, tumour development raises profound questions about life and death, and particularly, on the proliferation, survival and death of a single cell. So what is cancer, how does it occur and what purpose does it serve?

What. Cancer is a paradox: it is life and death at the same time. Cancer is life because it is nothing else but the story of a cell escaping the sentence of death and becoming immortal. The cancer cell will divide and make a clone. It will create a population of cells that have acquired non-stop cell division. Cancer cells, like unicellular organisms, behave selfishly. The never ending self-replication is the default survival mechanism of all unicellular organisms, a mechanism without which life on earth would not be possible. However, in higher organisms, homeostasis and renewal of complex tissues requires regulated cell proliferation. Regulated cell proliferation means that cell division needs to be flawlessly counter-balanced by apoptosis, i.e. programmed cell death. In essence, the number of dividing cells should equal precisely the number of eliminated cells. Disrupting that equilibrium with a shift towards cell survival and uncontrolled proliferation is cancer. Unfortunately, neoplasia, or malignant cellular transformation, inexorably ensues in death, in the decease of its host. Therefore, cancer is also the expression of death.

How. A large body of evidence has demonstrated that evolution is a consequence of genetic mutability in germ cells followed by a selection process under the pressure of the environment. Consequently, genetic variability emerging either in point mutations or genome alterations during meiosis is the necessary driving force of evolution and speciation. Likewise, tumour cells arise through a series of pair-wise mutations,

14 clonal selection and waves of expansion, which may be considered as a consequence of Darwinian selection. Therefore, cancer can well be regarded as an evolutionary consequence of genetic instability in somatic cells. Although environmental stress increases mutation rate, genetic instability, and cancer incidence, tumour cells may acquire mutations at a normal rate. However, cancer remains a naturally occurring genetic disease. Consequently, all cancers go through a state of genomic instability, resulting in chromosomal alterations and in aneuploidy.

Why. Our own desire of eradicating cancer is, in a way, the expression of our yearning for immortality, or perhaps more modestly, a healthy long life. Because evolution requires the removal of old and deleterious genes and the renewal of the gene pool, the fitness and survival of an entire species relies on the elimination of a living organism at a pre-reproductive stage, but also at a post reproductive stage. Furthermore, in order to avoid depletion of limited resources in a finite environment by overcrowding and to provide an efficient turnover of generations, death of the individual at a post-reproductive age is essential. Thus, if we humans could be immortal, we would be considered as cancers, because we would be a liability to our natural environment. In other words, programmed cell death is a necessity for the survival of the whole organism, such as the death of an individual is a necessity for the perpetuation of the species and its evolution.

Solution. Because mutations occur naturally over time, cancer incidence increases with age. Coincidently, the process of aging is also a by-product of genetic instability, just like cancer. Therefore, if we humans lived long enough, we would all eventually die of cancer, unless we genetically acquired “anti-cancer” mutations. Since death of a human being is a prerequisite for the survival of the human race and that there is no selective pressure preventing death, cancer would ensure, over time, death of an individual. Finally, it could simply mean that cancer is a necessity maintained through natural selection, in order to provide speciation and survival. In this case, cancer would be the ultimate barrier to an extended lifespan in a disease-free world.

Question. Is cellular immortality a natural suicidal mechanism of an individual?

Review on BARD1 and its diverse functions

I. Breast cancer and the BRCA genes

BRCA1 and BRCA2 mutations in cancer Breast and ovarian cancers are highly prevalent in western societies. For instance, in the United States, the cumulative risk of developing breast cancer is 11% of women by the age of 80 (Casey et al., 1997)1. Most cases of breast and ovarian cancers are sporadic since only about 10% are hereditary (Wooster and Weber, 2003)2. Less than half of the familial breast and ovarian cancers, carry germ-line mutations in the breast cancer susceptibility gene 1 or 2 (BRCA1 or BRCA2) (Hall et al., 1990; Futreal et al., 1994; Miki et al., 1994, Wooster et al.,1994, 1995)3-7 (Figure 1).

Breast and Ovarian Cancer Genes

other genes BRCA1 20% BRCA2 20% CHEK2 5% TP53 <1% PTEN <1% STK11/LKB1 <1% ATM <1% FANCD2 <1%

Figure 1. Representation of susceptibility genes predisposing to breast and ovarian tumours. Only half of the hereditary genes have been discovered, the other half is probably polygenic and could have environmental and multifactorial origins. These genes represent only 10% of all breast and ovarian cancers. The rest are sporadic cases. (Data compiled from Wooster and Weber, 2003).

Other known inherited mutated genes in familial breast and ovarian cancers include PTEN (Shugart, 1999)8, and CHEK2 (Meijers-Heijboer, 2002; Schutte et al., 2003; Caligo, 2004)9-11. Mutations in other genes such as TP53, associated with Li- Fraumeni syndrome, ATM in Ataxia telangectasia, FANCD2,which is inactivated in

16 Fanconi anaemia, and STK11/LKB1 mutated in cases of Peutz-Jeghers syndrome, are also associated with breast cancer, but predispose at low frequencies (Smith et al., 1993; Ford et al., 1995; Chen et al., 2000)12-14. The other familial breast and ovarian cancers do not have an apparent autosomal dominant inheritance pattern and are probably polygenic with environmental influences (Mincey, 2003)15.

BRCA mutations are highly penetrant, since women harbouring mutations in either BCRA1 or BRCA2 have a 80-90% life-time risk of developing tumours in the breast or in the ovaries, and account for about 40-50% of early onset of breast and ovarian cancers (Easton et al., 1993,1994; Ford et al., 1994, Rahman and Stratton, 1998)16-19. Moreover, in tumours from patients with inherited mutations in either BRCA1 or BRCA2, the mutation of one allele is typically associated with the loss of their wild- type allele, incurring a loss of function. This loss of function, also termed loss-of- heterozygosity (LOH), means that BRCA1 and BRCA2 act as potent tumour suppressors (Futreal et al., 1994)4 and correlates with the occurrence of breast and ovarian cancer (Ford et al., 1998)20. Moreover, BRCA1 acts as a tumour suppressor because its overexpression in tumour cells injected in nude mice induces growth retardation of the tumour cells (Holt et al., 1996)21. Some sporadic breast and ovarian tumours show defects in BRCA1 and BRCA2 genes or in their activity in tumour tissues. This underpins the importance of epigenetic silencing pathways in breast and ovarian tumours, adding another factor of complexity to BRCA-related tumours. BRCA1 is a highly ubiquitous protein as it is expressed in almost all tissues. However, tumours arise only in the breast and ovaries that have lost the remaining healthy wild- type allele of individuals carrying germ-line mutations in the BRCA1 gene. LOH occurring in other tissues has not been reported. Possibly because nullizygous Brca1 mutation in mice is non-viable for a developing embryo (Hakem et al., 1996; Gowen et al., 1996)22,23. In these heterozygous individuals, other tissues are not affected and do not develop tumours, and they do not appear to be able to lose their wild-type allele. This conundrum, discussed in numerous reviews on BRCA1 (Monteiro, 2003; Starita and Parvin, 2003; Venkitaraman, 2002, 2004)24-27, raises fundamental questions on the function of BRCA1 and its differential activity in breast and ovaries. One may ask why and how breast and ovarian tissues bear this permissive BRCA1 dysfunction compared to other tissues.

17 Genetic models for BRCA1 and BRCA2 To assess the function of BRCA1 and BRCA2 genes in breast cancer, knockout mouse models were generated. The knockout mice, Brca1-/- or Brca2-/-, are not viable and die early in embryogenesis. Several groups have shown that mouse embryos with homozygous deletion in the Brca1 gene, die early in embryogenesis, between days E5.5 and E13.5 depending on the type of deletion effectuated (Gowen et al., 1996; Hakem et al., 1996; Liu et al., 1996; Ludwig et al., 1997)22,23. Such mice typically showed several defects in gastrulation and in cellular proliferation. The Brca2 knockout mice, carrying a homozygous truncation of exon 11 in Brca2, displayed embryonic death at days E8.5-9.5 (Hakem et al., 1998)28. Mice which were heterozygous for either Brca1 or Brca2 developed normally and were not more susceptible to breast cancer than the normal wild-type littermates. However, mice carrying conditional deletion knockout mutants for Brca1, driven under a mammary tissue specific promoter, displayed mammary gland tumours by 10-13 months of age (Xu et al., 1999a)29.

Overview of BRCA1 and BRCA2 functions The structure and functions of BRCA1 and BRCA2 as well as the mechanisms-of- action of BRCA-driven tumours have been widely discribed in numerous reviews (Zheng et al., 2000; Scully and Livingston, 2000; Wang et al, 2000; Kerr and Ashworth, 2001; Mueller and Roskelley, 2002; Moynahan, 2002; Narod and Foulkes, 2004; Venkitaraman, 2004)27,30-36. The BRCA1 and BRCA2 proteins interact with a large number of proteins. They have a wide spectrum of activities since they play roles in a variety of different pathways, coordinate and integrate various pathways, which include DNA repair pathways and DNA replication cycle on one hand, and centrosome duplication and mitotic checkpoints on the other.

BRCA1 is a ubiquitously expressed protein of 1863 amino acids consisting of two highly conserved domains: a RING finger domain and two BRCT domains. Without going into the detail of the multitude of BRCA1 functions, BRCA1 is involved in diverse pathways such as DNA damage repair of double stranded breaks (DSB), transcription-coupled repair, transcriptional regulation, chromatin remodelling, ubiquitination, centrosome duplication and cell-cycle checkpoints (Deng and Brodie, 2000; Khanna, 2001; Starita and Parvin, 2003; Venkitaraman, 2004; Narod and

18 Foulkes, 2004; Deng, 2002; Hsu and white, 1998; Hsu, 2001; Lotti et al.,2002; Schlegel et al., 2003)25,27,36-41. One hypothesis could be that BRCA1 serves as a scaffolding protein for the assembly of a multi-protein complex that plays a role in integrating the aforementioned mechanisms.

The BRCA2 gene codes for a large protein of 3,418 amino acids, highly conserved throughout evolution, and widely expressed in adult and embryonic tissues (Rajan et al., 1997)42. It is structurally and phylogenetically unrelated to BRCA1 and bears no homology with amino acid sequences of BRCA1 whatsoever. The function of BRCA2 is less diverse than that of BRCA1. Like BRCA1, BCRA2 is specifically involved in homologous-directed repair (HDR or HR) and in non-homologous end joining (NHEJ). BRCA2 attaches to Rad51 through its BRC repeats and binds directly to DNA domains at sites of double stranded breaks (DSB).

To summarize, all the functions of BRCA1 and BRCA2 converge towards one goal which is to maintain genome integrity. Since BRCA1 and BRCA2 are involved in DSB repair, the common phenotypical feature of BRCA1 and BRCA2-deficient cells is that they have a hypersensitivity to DNA damage-inducing agents such as ionising radiation and inter-strand cross-linking drugs. These BRCA deficient cells display increased genomic instability, as manifested by visible chromosomal aberrations and aneuploid karyotypes (reviewed by Jasin, 2002; Moynahan, 2002)35,43. Chromosomal aberrations are common to all, if not most, cancers and could be the pathogenic basis of breast and ovarian cancers caused by mutations in BRCA1 or BRCA2. However, investigating the function of these tumour suppressors, their associated proteins and their molecular pathways is paramount in the fight over gynaecological cancers.

II. BARD1 protein structure

BARD1 discovery and phylogenetic analysis In the search for novel partners of BRCA1, BARD1 (BRCA1-Associated RING finger Domain protein 1) was discovered in a yeast-two-hybrid screen using the N-terminus fragment of BRCA1 containing the RING domain as bait (Wu et al., 1996)44.

19 RING Finger Ankyrin repeats BRCT NLS 131 NLS 408 NLS 693

mBARD1 765 aa 66 95 53 97 77 91 % of conservation with hBARD1 hBARD1 777 aa

BRCA1 1823 aa

3418 aa BRCA2

Transactivation BRC repeats NLS domain (Not to scale)

Figure 2. Schematic of human and mouse BARD1, BRCA1 and BRCA2 proteins showing conserved functional domains. BARD1 and BRCA1 are homologues since they share two conserved domains with high homology, whereas BRCA2 is completely unrelated to either BARD1 or BRCA1.

The human BARD1 gene is localized on chromosome 2 (2q34-q35) and the cDNA encodes for a protein of 777 amino acids (Wu et al., 1996; Thai et al., 1998)44,45. However, a doubt remains on the initiation site of translation, which could be situated either at amino acid position 1 or 26. The BARD1 structure resembles BRCA1’s structure, in that BARD1 shares sequence homology with BCRA1’s conserved domains (Figure 2). Like BRCA1, the cloned human BARD1 contains a RING finger domain at its N-terminus (residues 46-90) and two BRCT domains at the C-terminus (residues 616-653 and 743-777). Moreover, BARD1, albeit less than half the size of the BRCA1 protein (1863 residues), contains in addition three ankyrin domains (ANK). Apart from the conserved domains, the rest of BARD1 bears no homology with other proteins. BRCA1 is the only vertebrate protein that shares homology with BARD1 in both the RING and BRCT domains. Homology in gene structure and protein sequence of BARD1 and BRCA1 suggests that both proteins are phylogenetically related. In contrast, BRCA1 and BRCA2 show a poor degree of conservation through evolution. Indeed, mouse and human orthologues of BRCA1 or BRCA2 share less than 60% of identical amino acid residues, but the functional domains are conserved. The fact that the mouse Brca1 and Brca2 proteins share

20 less than 60% homology with their human counterparts, contrasts with other known tumour suppressors such as p53 or NF1, with 78% and 98% identity, respectively (Connor et al.1997b)46. Comparison of amino acid homology between BARD1 and BRCA1 shows that they had a common genetic ancestor and that they have co- evolved at similar rates during evolution providing further clues that these proteins may function in the same complex.

BARD1 orthologues Alignment of human and mouse BARD1 orthologues shows low levels of amino acid sequence homology, i.e. 70.4% over the total protein, whereas the RING, ANK and BRCT motifs have 86.7% and 90.1% an 79.8% identity respectively (Irminger-Finger et al., 1998; Ayi et al.,1998)47,48 (Figure 2). The fact that RING, BRCT and ANK domains of BARD1 are highly conserved throughout evolution, and the rest of the protein shows poor levels of homology, suggests that the three functional domains mediate essential functions that are conserved through evolution. Furthermore, since the isolation of BARD1 (Wu et al., 1996)44, orthologues from other species have been cloned: Xenopus laevis (773 aa) (McCarthy et al., 2003), Rattus norvegicus (768 aa), and Mus musculus (765 aa) (Figure 3).

Homo sapiens (human) 777 aa

similar domain architectures

Gallus gallus (chicken) 750 aa

Gallus gallus (chicken) 1083 aa

Xenopus laevis (toad) 772 aa

Rattus norvegicus (rat) 768 aa

Mus musculus (mouse) 765 aa

Takifugu rubripes (fugu fish) 734 aa

Caenorhabditis elegans (nematode) 670 aa

Pan troglodytes (chimpanzee) 602 aa

Arabidopsis thaliana (thale cress) 1548 aa

Figure 3. Representation of known BARD1 orthologues in other species with conserved identical domains showing similar domain architectures (source: http://www.ncbi.nlm.nih.gov/entrez/)

Since then, other assumed orthologues from other species have been deduced from their sequence homologies by reciprocal BLAST analysis. A predicted BARD1

21 orthologue encoding two of the three motifs exists in Arabidopsis thaliana (Joukov et al., 2001; Irminger-Finger et al., 1998)47,49. The Caenorhabditis elegans BARD1 orthologue has been identified and conserves the same function as human BARD1 (Boulton et al., 2004)50. The chimpanzee orthologue has an overall homology of 99%, but lacks the C-terminus and the two BRCT domains (Figure 3). In addition to the three functional domains, human BARD1 contains 6 predicted nuclear localizing signal (NLS) sequences, situated in the vicinity or embedded in each of the three functional domains, inferring a predicted nuclear localization of BARD1. In comparison to human BARD1, mouse BARD1 has only three NLS sequences with a marginally lower prediction score for nuclear localization (Jefford et al., 2004)51.

BRCT RING DOMAIN DOMAIN A ANKYRI N BRCT REPEATS DOMAIN hBARD1

hBRCA1

Figure 4. Solution structure of the N-terminal and C-terminal domains of BARD1 and BRCA1. The RING finger domain permits the interaction of BARD1 and BRCA1 creating a 4 alpha-helix bundle, held together by hydrophobic bonds. The RING domain is flanked by the two alpha helices in the primary structure. The RING motif contains the zinc binding domain. The two BRCT domains pack together forming a compact structure (Modified from Baer; 2001, with reproductions from Brzovic et al., 2001; Williams et al., 2001).

RING finger domain The most studied domain in BARD1 and in BRCA1 is the RING finger domain. The RING finger protein sequence motif was discovered 15 years ago and stands for Really Interesting New Gene (Borden et al., 1998)52. The RING sequence motif is defined as a unique array of conserved cysteine and histidine residues found at the extreme N- or C-terminus of proteins that are typically involved in ubiquitination pathways (Freemont, 2000)53. RING finger domains mediate also protein-protein interactions and are involved in supra-molecular self-assemblies (Kentsis and Borden 2004)54. The conserved RING motif of BARD1 includes residues 50 to 86 and corresponds to residues 24 to 64 in BRCA1 (Figure 4b). The RING finger binds two atoms of zinc in a unique “cross-brace” conformation. The spacing between the second and third pairs of cysteine and histidine residues implies that the distance is conserved between the two zinc binding sites. BARD1 is the main binding partner of BRCA1 and both proteins heterodimerize through their N-terminal RING finger domains to form the active enzymatic complex (Figure 4a). The heterodimeric interaction is strong, and although BRCA1 and BARD1 homodimers may be produced in vitro, it is usually the heterodimers that are found in vivo (Meza et al.,1999)55. Limited proteolysis analysis has defined that the region necessary for heterodimerization includes residues 1-109 of BRCA1 and 26-119 of BARD1 (Meza et al., 1999)55, (fig 5a). The cognate BARD1 and BRCA1 proteins heterodimerize by forming an extensive 4-helix bundle each consisting of two anti-parallel alpha helices and bind through their hydrophobic residues (Brzovic et al.,2001a; Morris et al., 2002)56,57. The resolution of the crystal structure reveals that BARD1 has two alpha helices, which flanks the RING motif in the primary sequence, and two short beta sheets of the RING motif is separated by a loop which has the conserved pattern of seven cysteine and one histidine residues which houses the two separate zinc- binding sites (I and II) (Brzovic et al., 2001b)58 (fig. 4b). On the other hand, the BRCA1 RING domain which has a similar structure contains three alpha helices and two beta-sheets. RING finger domains are essential for the proper function of proteins that contain them and for ubiquitination function. This is evidenced by the multiple cancer predisposing mutations within the BRCA1 RING domain which destroys BRCA1/BARD1 tumour suppressor and ubiquitin ligase activities (see below). Several known cancer-predisposing mutations have been identified within

23 this region. A missense mutation at either cysteine residue C39G, C64G, or C61G of BRCA1 alters the Zn2+ binding site II and prevents the metal atom from binding to site II. The site II cancer predisposing mutations C61G and C64G do not disrupt heterodimer formation, but only the RING domain’s zinc binding capabilities (Morris et al., 2002)57. Several residues have been identified within the alpha helices of BARD1 that are required for heterodimer formation (Figure 5); these residues do not participate in binding the zinc atom (Morris et al., 2002)57. Furthermore, site II cancer- predisposing mutations in BARD1 RING domain have not yet been discovered, possibly because the binding site for the E2/UbcH5 conjugating enzyme is localized on the face of BRCA1 RING domain (Brzovic et al., 2003)59. It is rather mutations in the hydrophobic interface that affect structural stability, even though some mutations away from helical core are also capable of inhibiting heterodimer formation (Morris et al., 2002)57.

BARD1

BRCA1

Figure 5. Identification of residues of BARD1 required for the BRCA1/BARD1 heterodimer interaction. A) Depiction of the positions of the amino acids which can inhibit heterodimer formation when mutated. The zinc atoms are the grey spheres. B) Summary of mutations that inhibit heterodimer formation that were discovered in a yeast two-hybrid screen. (Reproduced from Morris et al., 2002).

24 Ankyrin repeats Ankyrin domains are usually found in sets of repeats, usually of 3 or 4, but can have up to 20 repeats. They mediate protein-protein interactions in very diverse families of proteins, (for a review, refer to Mosavi et al., 2004)60. Their precise functions in BARD1 remain elusive, but could be responsible for the numerous interactions BARD1 may have with several classes of proteins implicated in tumour suppression.

BRCT domain The BRCT domain (BRCA1-C-terminus) was first identified in BRCA1 (Koonin et al., 1996). It is a conserved domain which is defined by distinct clusters of hydrophobic residues folding into a unit of approximately 95 amino acids. The crystal structure of XRCC1 BRCT domain has been elucidated and showed that pairs of these structures may form homodimers as well as heterodimers (Zhang et al., 1998, Huyton et al., 2000)61,62. The two BRCT domains of BCRA1 may bind together head-to-tail fashion tethered by a poorly defined 23 amino acid linker (Williams et al., 2001)63 (Figure 4c), forming a functional domain that can mediate transactivation functions and serve as a multi-protein scaffold for several protein-protein interactions (Huyton et al., 2000)62. BRCT repeats are found in many proteins involved in cell-cycle checkpoint pathways responsive to DNA damage, DNA repair and recombination, such as 53BP1, RAD9, RAD4, DNA ligase III and XRCC1 which bind to each other strongly (Ljunquist et al., 1994; Caldecott et al., 1995)64,65. The BRCT domain of BRCA1 is essential for DNA repair, transcriptional regulation, as well as several tumour suppressor functions (Hall et al., 1990, Miki et al., 1994; Futreal et al., 1994; Friedman et al., 1994)3-5,66. BRCT may bind to other BRCT repeats and other proteins with various unrelated structures. Also, several studies have shown that the BRCT element of BRCA1 may bind or interact with a number of proteins involved in transcriptional regulation, such as CtIP co-repressor, histone deacetylases, p53, p300 and the DNA damage-associated helicase BACH1 (Cantor et al., 2001; Deng and Brodie 2000)37,67. Furthermore, a study showed that the tumour suppressor function of BRCA1 requires that the two BRCT domains remain packed together (Huyton et al., 2000; Williams et al., 2001)62,63. Two missense mutations within the BRCT domains of BRCA1 that were found to be linked to breast and ovarian cancer (Miki et al., 1994, Futreal 1994)4,5 have been shown to impair correct BRCT homodimerization (Williams et al., 2001)63. The tandem BRCT domains of BARD1 are predicted to behave in the same fashion,

25 but its exact function still remains to be elucidated (Huyton et al. 2000)62. It would be interesting to see whether the BRCT domains of BARD1 and BRCA1 interact.

III. Ubiquitin ligase function of BRCA1/BARD1

RING finger domain proteins are ubiquitin ligases Many proteins containing a RING domain exhibit ubiquitin (Ub) ligase activity (E3) (Freemont, 2000). The BRCA1/BARD1 heterodimer is an E3 ubiquitin ligase. There are 890 genes in Homo sapiens that contain a RING domain and 213 are known to be involved in ubiquitin-related processes (PubMed). Represented in all species, except in prokaryotes, the function of the RING finger domain proteins is very well conserved. The roles of ubiquitination are multiple and are essential in cellular homeostasis, cell cycle progression and in cancer. E3 ubiquitin ligases regulate the expression of many cell-cycle regulators which are targeted for degradation through the proteasome pathway (Yew, 2001). Some of these cell cycle regulators, which are over-expressed in several tumours, include cyclin D1 and E1, p27, p21, and INK4A. Furthermore, ubiquitination plays an important role in tumorigenesis, because the RING finger domain is found in many tumour suppressors, such as BRCA1, BARD1, MDM2, Cbl, and Rbx1 (Freemont, 2000; Ohta and Fukuda, 2004)68. Moreover, several nuclear oncoproteins like c-myc, c-fos, and E1A are degraded by the ubiquitin system (Ciechanover et al., 1991). Therefore, defects in ubiquitination affect a range of cellular processes such as cell-cycle progression, cell differentiation, apoptosis, DNA damage pathways, and transcriptional regulation (Weissman, 2001; Pickart, 2001; Hicke, 2001)69-71.

Ubiquitination and de-ubiquitination Ubiquitination is a post–translational modification of proteins by attachment of ubiquitin side chains. It is a function that modulates protein half-life by degradation of substrates targeted with ubiquitin. Ubiquitinated proteins may either undergo proteolysis through the proteasomal pathway or be reused after cleavage of the ubiquitin chains by cysteine proteases, called de-ubiquitinating enzymes (DUBs). The ubiquitin-proteasome machinery is classically composed of five essential elements: the ubiquitin polypeptide of 76 amino acids (Ub), a ubiquitin-activating enzyme (E1), a ubiquitin-conjugating enzyme or transferase (E2 or Ubc), a ubiquitin ligase (E3),

26 and the proteasome unit (for an extensive review see Hershko and Ciechanover, 1998; short review see Wilkinson, 2000; or Freemont, 2000)53,72,73. The E1 ubiquitin- activating enzyme binds ubiquitin by forming a thiolester bond, in an ATP dependent way, and then transfers ubiquitin to the E2 conjugating enzyme which, in turn, forms an isopeptide bond with the substrate via the E3 ligase. The substrates may be ubiquitinated in several ways and therefore may serve various functions. Substrates may be either mono- or poly-ubiquitinated (or even multiubiquitinated), and may be linked to each other by several different residues (Ohta and Fukuda, 2004)68. Proteins tagged with a polyubiquitin chain attached by their K48 residues are usually targeted for degradation through the 26S proteasome pathway. However, other polyubiquitin chains can also be synthesized with links between the C-terminus of ubiquitin and the K6, K11, K29 and K63 on the adjacent ubiquitin. Proteins with polyubiquitinated chains linked by their K63 residues are a signal for endocytosis, IκB kinase activation, ribosome activation and DNA repair, whereas monoubiquitination plays a role in the regulation of histones (Pickart, 2000)70.

BRCA1/BARD1 heterodimer is an E3 ubiquitin ligase There are two main groups of E3 ligases, the HECT domain ligases such as the E6- AP (Huibregste et al., 1995)74 and the RING finger ligases, such as BRCA1 and BARD1 (Joazeiro and Weissman, 2000)75. BRCA1 is a bona fide E3 ubiquitin ligase that may ubiquitinate its substrates or itself (Lorick et al., 1999). Cancer predisposing mutations, C61G and C64G, within the RING domain of BRCA1, abolish the E3 ubiquitin-ligase activity of the BRCA1/BARD1 heterodimer and its tumour suppressor function (Hashizume et al., 2001; Ruffner et al., 2001; Brzovic et al, 2001b)58,76,77. Furthermore, these cancer mutations display hypersensitivity to γ-irradiation, showing a link between ubiquitination, DNA repair and tumour suppression (Ruffner et al., 2001). The stability of BRCA1 is increased in the presence of BARD1. Expression of both is required proteins equally for high Ub-ligase activity (Hashizume et al., 2001)76. Although, BARD1 and BRCA1 may individually carry out ubiquitination in vitro, BRCA1 ubiquitin ligase activity is significantly enhanced when bound to BARD1 through their RING domains (Hashizume et al., 2001; Xia et al., 2003)76,78. The aforementioned cancer predisposing mutations such as C61G and C64G perturb binding of the E2/UbcH5c and E2/UbcH7 conjugating enzymes to BRCA1 (Brzovic et al., 2003)59 (Figure 6). In vitro experiments with purified RING structures from

27 unrelated proteins such as promyelocytic leukaemia protein (PML), KAP-1/TIF1B, Z, Mel18, BRCA1 and BARD1 self-assemble in supra-molecular structures that resemble the ones they form in cells (Kentsis et al., 2002). The same report shows that these structures may enhance ubiquitination reactions performed by the BRCA1/BARD1 E3 ligase and its auto-ubiquitination (Kentsis et al., 2002)79. Therefore, the main biochemical function attributed to BARD1 is its ubiquitin ligase activity, which is essentially mediated through its RING domain together with BRCA1. This ubiquitination function is therefore driven mostly by the BRCA1/BARD1 heterodimer and could be responsible for mediating all cellular functions attributed to BRCA1 and BARD1 (reviewed in Baer and Ludwig, 2002).

Ubc5Hc Ubc7H BARD1 binding binding BRCA1 site site

Figure 6. Representation of E2 ubiquitin conjugating binding site on BRCA1. A) Ribbon structure showing mutation sites that perturb binding of E2 conjugating enzymes UbcH5c and UbcH7. B) Surface structure showing that the ubiquitin conjugating enzymes only contact BRCA1 and not BARD1 (Brzovic et al., 2003).

Ubiquitin targets of the BARD1/BRCA1 heterodimer In the search for novel targets of the BRCA1/BARD1 E3 ubiquitin ligase function, it was found that BRCA1 and BARD1 can be auto-ubiquitinated in vitro and in vivo in the presence of the E2 conjugating enzyme Ubc5c and ubiquitin (Chen et al., 2002)80. This auto-ubiquitination occurs on non-K48 residues, since a missense mutation on this residue did not hinder poly-ubiquitination reactions in vitro. However, BARD1 and BRCA1 auto-ubiquitination was postulated not to be a signal for proteasomal degradation, but could rather serve other signalling pathways.

28 Furthermore, this auto-ubiquitination increases ubiquitin ligase activity of the BRCA1/BARD1 heterodimer on itself 20-fold (Mallery et al., 2002). The auto- ubiquitination reactions promote formation of poly-linked ubiquitin chains attached at K6 (Wu-Baer et al., 2003; Nishikawa et al., 2003)81,82. Specifically, BRCA1/BARD1 induces formation of K6-linked conjugated ubiquitin structures at sites of DNA replication and repair (Morris et al., 2004)83. In vitro ubiquitination reactions may be performed with a truncated BRCA1 (1-639) (Chen et al., 2002)80 and full length forms of BRCA1 and BARD1 (Mallery et al., 2002)84. Although the minimal interacting regions for RING formation are BRCA1aa1-109 and BARD1aa26-119, they are not sufficient for E3 ligase activity inferring that a larger domain is required for proper ligase activity (Mallery et al., 2002)84. BARD1 may serve an accessory role in ubiquitination, since the BARD1 protein or a truncated form from residues 8 to 142, in which the RING finger domain lacked Ub-ligase activity in vitro, significantly enhanced the E3 ligase activity of BRCA1/BARD1 duplex (Xia et al., 2003)78. Furthermore, through NMR spectroscopic analysis and site-directed mutagenesis the binding site of the E2 conjugating enzyme, UbcH5c or UbcH7, maps to the BRCA1 RING domain and not to BARD1 (Figure 6) (Brzovic et al., 2003)59. Although it was shown that it is the heterodimer which is auto-ubiquitinated, no studies have shown where and on which molecule this ubiquitination takes place and whether BARD1 is mono-ubiquitinated. Since expression of BARD1 and BRCA1 proteins are cell-cycle dependent and it was proposed that BARD1 and BRCA1 are degraded by the proteasome pathway (Choudhury et al., 2004)85.

Some of the first identified targets of BRCA1/BARD1 ubiquitin ligase function are the histones H2A and H2AX (Ruffner et al., 1998). The BARD1/BRCA1 heterodimer is capable of catalysing the mono-ubiquitination of the histone H2A/H2AX in vitro (Chen at al., 2002)80. Attachment of a single ubiquitin to histones H2A and H2B leads to alteration of chromatin structure and opens DNA for transcriptional activity (Levinger and Varshavsky 1982; Davie et al., 1990, 1991)86-88, underpinning a role for BRCA1/BARD1 in transcriptional activation.

Another potential target for BRCA1/BARD1 ubiquitination is the FANCD2 protein, since its mono-ubiquitination is reduced in cells that are defective for BRCA1 (Garcia- Higuera et al., 2001)89. FANCD2 can be mono-ubiquitinated in vitro by

29 BRCA1/BARD1 heteroduplex, together with E1 and UbcH5a (Vanderberg et al., 2003)90. However, although the depletion of BRCA1 by siRNA in human cells resulted in defective localization of FANCD2 to sites of DNA damage, it did not lead to loss of mono-ubiquitination of FANCD2 (Vanderberg et al., 2003)90. Therefore, the BRCA1/BARD1 E3 ligase is not necessary for mono-ubiquitination of FANCD2.

Autoubiquitination Chromatin decondensation Ub

BRCA1/BARD1 Ub BRCC36 – BRCC45 H2A, H2AX

DNA repair BARD1 Ub BRCA1 Ub Ub Ub Ub Ub FANCD2 Ub Ub P P Rbp1

Ub Ub Holo-pol II γ-tubulin Nucleophosmin/B23

Cell cycle Centrosome duplication cycle Transcription regulation Figure 7. Ubiquitination function of BRCA1/BARD1 showing known targets of the BRCA1/BARD1 E3 ubiquitin ligase. BRCA1/BARD1 autoubiquitinates which increases ubiquitination function. The BRCC36- BRCC45 appears also to increase autoubiquitination function.

Recently some light was shed on the role of BARD1 and BRCA1 in cell-cycle events through ubiquitination processes. Indeed, it was shown that BRCA1/BARD1 mono- ubiquitinates γ-tubulin which regulates centrosome number and duplication cycle (Starita et al., 2004)91. Another purported target for BRCA1/BARD1 E3 ligase is nucleophosmin/B23 which may be ubiquitinated for its stabilization and not for proteasomal degradation (Sato et al., 2004)92. Another a study shows that BRCA1/BARD1 ubiquitin ligase activity is down-regulated in a cell-cycle dependent manner by CDK2-cyclin E1/A1, but not by CDK1-cyclin B1 (Hayami et al., 2005)93. A role for BRCA1/BARD1 ubiquitin ligase has been unveiled in DNA repair, since a

30 recombinant four-subunit complex comprising BRCA1/BARD1/BRCC45/BRCC36 enhanced E3 ligase activity compared to that of the BRCA1/BARD1 heterodimer alone (Dong et al., 2003)94. These studies expand further the range of BRCA1/BARD1 ubiquitination towards various cell cycle actions, and increase the weight of a tumour suppressor role for BARD1 and BRCA1.

In the search for BRCA1 binding partners, BAP1, a ubiquitin hydrolase was discovered in a yeast two-hybrid screen and interacts with the RING domain of BRCA1 (Jensen et al., 1998)95. However, it is not clear if BAP1 competes with BARD1 for the binding sites on BRCA1 or if it binds to the heterodimer forming a novel functional complex. In any case, it does not appear that BAP1 is capable of de- ubiquitinating poly-ubiquitinated BRCA1/BARD1 heterodimers in vitro (Mallery et al., 2002). However, BAP1 could possibly deubiquitinate some of the unknown BRCA1/BARD1 E3 targets.

IV. BARD1 functions and interacting proteins

Most breast and ovarian molecular cancer research was focused on BRCA1 and BRCA2, as testified by more than 6000 publications on the matter during the last ten years, compared to the 100 odd articles on BARD1. This discrepancy does not reflect the importance that BARD1 may have in tumour suppression in gynaecological or other tumours. However, BARD1’s function is tightly related to BRCA1 function since it is the heterodimer which is the main functional form. However, a high number of proteins interact or associate with BARD1 (Figure 8). BARD1 may, through BRCA1 or independently regulate, chaperone and serve as a scaffold for numerous proteins involved in a number of cellular pathways ranging from DNA repair, transcription- coupled repair, transcriptional regulation, apoptosis, genomic integrity and mitotic events like centrosome duplication and cell division (Jasin, 2002)43 (Figure 9). It is likely that most of these functions are mediated through the ubiquitin function of the BRCA1/BARD1 heterodimer.

31 AuroraB BRCA2

hMSH2-hMSH6 TACC1 p53 BRCC36-BRCC45

RING ANKYRIN BRCT

Bcl-3 EWS CstF-50 BRCA1 Ku-70 IκBα NF-κB/p50 RAD 51 MRE11 RAD50 Holo-pol II

BASC NBS1 XIST p300/CBP

Figure 8. Illustration showing the known proteins that interact with BARD1. Proteins that are thought to have a direct interaction are shown in colour. Proteins that are known to bind indirectly with BARD1 are shown in grey, all of which may be detected in biochemical complexes.

Knockout mouse models and genomic instability phenotype BARD1 shares a common feature with tumour suppressors BRCA1 and BRCA2 in that knockout mouse follows in embryonic death and displays genomic instability (Gowen et al.,1996; Hakem 1996; Liu 1996; Ludwig 1997; McCarthy 2003)22,23,96-98. Cell lines lacking wild type BRCA1 are also deficient in DNA repair and homologous recombination (Gowen et al., 1998; Moynahan et al., 1999; Scully et al., 1999)99-101. Human BARD1 and BRCA1 counterparts of Xenopus laevis show that essential functions as well as structure are conserved since knockouts of these genes are non- viable (Joukov et al., 2001)49. The BARD1-null mouse embryos died in utero between day E7.5 and E9.5 post-fecundation (McCarthy et al., 2003)98. Death was due to severe cell proliferation defects and not to apoptosis. Partial rescue was obtained in BARD1-/-;p53-/- double knockout embryos, since embryonic death was delayed until day E9.5. Cytogenetic analysis of the BARD1-/-; p53-/- cells displayed an increase of structural and numerical chromosome aberrations compared to p53-/- cells (McCarthy et al., 2003)98. Furthermore, conditional knockout experiments of BARD1 results in mammary cancers, chromosomal instability and proliferation defects (personal communication Thomas Ludwig) and manifest the same characteristics of human breast cancers. The drastic phenotypes of the knockout mice means that BARD1 is essential for a wide panel of cellular events (reviewed by Jasin, 2002)43. It is clear that BARD1 assures vital functions for cell cycle progression and maintenance of genome integrity (Figure 9).

BARD1 in DNA-damage repair It has been established that BARD1, in conjunction with BRCA1, is essential for maintaining chromosomal stability. This is done partly through mechanisms of homology-directed repair of DNA double-strand breaks. In fact, BRCA1 regulates a variety of DNA damage pathways. Cells lacking functional BRCA1 have severe defects in transcription-coupled repair, homology-directed repair (HDR), non- homologous-end-joining (NHEJ) and microhomology-end-joining repair pathways (Gowen et al., 1998; Abbott et al., 1999; Moynahan et al., 1999; Snouwaert et al., 1999; Zhong et al., 2002a, 2002b)99,100,102-105. It is now clear that BARD1 is also reqired in those DNA repair pathways (Westermark et al., 2003)106. It is the BRCA1/BARD1 heterodimer which is the functional unit in DSB repair (Jasin, 2002)43. However, it is not known whether BARD1 plays other roles in these pathways.

A functional interaction between hMSH2 and BRCA1 was discovered in a yeast-two- hybrid screen, which was confirmed by co-localization and immunoprecipitation studies (Wang et al., 2001)107. Further investigation showed that hMSH2 associates with BARD1. In fact, BARD1 may also associate with other enzymes of the same pathway such hMSH3 and hMSH6. The interaction of BARD1 with hMSH2-hMSH6 substantiates a role for BARD1 and BRCA1 in DNA mismatch repair, and suggests that BARD1 cannot be dissociated from its partner in DNA damage sensing and signalling (Wang et al., 2001)107. It is noteworthy that BRCA1 interacts with numerous other proteins involved in the repair pathways, the list is long, but one may note that ATM, ATR, DNA-PKs, Ku-70 and Ku-80 are involved in sensing DNA breaks and signalling through phosphorylation of BRCA1 that the DNA repair pathways should be switched on. Lastly, it would be interesting to evaluate the participation of BARD1 in all these interactions. Finally, it was shown that the BRCA1/BARD1 orthologues in C. elegans are also required for DNA repair (Boulton et al., 2004)50, supporting the thesis that these proteins have highly conserved functions in different species.

Cellular localization of BARD1 and BRCA1 during DNA repair At the cellular level, the expression levels of BARD1 protein were first reported to be relatively constant throughout the cell cycle, in contrast to the elevated levels of

33 BRCA1 in S-phase (Jin et al. 1997)108. Subsequently, it was shown that cells that were arrested in G0-G1 by serum withdrawal express low levels of BRCA1. The levels progressively accumulate after release from starvation in G1 phase, peaking at the G1/S border. They remain high during S-phase, mirroring cyclin A expression levels (Chen et al., 1996; Vaughn, 1996; Gudas et al., 1996; Rajan et al. 1996; Jin et al., 1997)108-112. These reports obviously suggest a role for BRCA1 during S phase. However, further studies show that BARD1 expression levels fluctuate in a cell-cycle- dependent manner, with an increase during mitosis (Jefford et al., 2004; Choudhury et al., 2004; Hayami et., 2005)51,85,93. Concomitant expression of BARD1 and BRCA1 was observed during S-phase (Hayami et al., 2005)93. Evidence of a BRCA1/BARD1 interaction came from immunofluorescence experiments, where BARD1 co-localized with BRCA1 and Rad51 during S-phase in “nuclear foci” (Scully et al., 1997b, Jin et al., 1997 108,113. Upon DNA damage by hydroxyurea (HU), the BRCA1 and BARD1 nuclear dots disperse, but re-aggregate at new foci containing PCNA (Proliferating Cell Nuclear Antigen). The BRCA1/BARD1/Rad51 appears to relocate to areas of DNA damage and play a role in repairing damaged DNA (Scully et al., 1997b)113. These data are supported by other findings, demonstrating that BRCA1/BARD1 heteroduplex associates with DNA at stalled replication forks (Paull et al., 2001)114. The loss of the BRCA1 foci was accompanied by a dose-dependent increase of BCRA1 phosphorylation. Concordantly with these findings, BARD1 was biochemically identified with BRCA1 in hydroxyurea-inducing complexes (HUIC) formed after treatment with HU (Chiba and Parvin, 2001)115. The BRCA1 protein was reported to interact with the Mre11-Rad-50-Nbs1 (MRN) repair complex (Zhong et al., 1999)116. However, the HUIC complex is distinct from the BRCA1-Mre11-Rad50- Nbs1 complex (Chiba and Parvin, 2001)115.

BARD1 in transcriptional regulation and chromatin remodelling Because BRCA1 and BARD1 share a homologous BRCT domain, the first clues of a purported role for BARD1 in transcription derived from transient transfection experiments with BRCA1. BRCA1 was shown to be able to activate transcription in vitro (Chapman et al., 1996; Monteiro et al., 1996, 1997)117-119. Further evidence showed that the BRCT domains of BRCA1 induces transcriptional activation in vitro (Haile et al., 1999)120. Additionally, BRCA1 interacts with the RNA polymerase II holoenzyme (holo-pol) in association with RNA Helicase A, a protein also involved in

34 transcription (Anderson et al., 1998)121. On the other hand, it is not known whether BARD1 is required for these transcription-related interactions. In later experiments, it was shown that BRCA1 can bind to DNA at sites of DNA branching (Paull et al., 2001)114. This direct binding is another clue for BRCA1-driven transcription. However, conclusive evidence for a BRCA1-induced transcription activation came from biochemical experiments demonstrating that BRCA1 is a bona fide component of the RNA polymerase II holoenzyme, since BRCA1 co-purifies with the holoenzyme complex (Scully et al., 1997; Neish et al., 1998)122,123. Further studies showed that BARD1 was also part of this multimeric complex (Chiba and Parvin, 2002)124, implicating BARD1 in transcriptional regulation. By using deletion mutants of BRCA1, it was also shown that the N-terminal end of BRCA1 containing the RING domain was necessary for the activity of the holoenzyme, whereas the C-terminal end deletion showed little reduction in regulation of transcription (Chiba and Parvin, 2002)124. This latter fact also implies that BARD1 is the linking protein tethering BRCA1 to the holo-pol thereby confirming BARD1’s role as transcriptional co-factor.

More evidence on BARD1’s role in transcription came from the discovery that BARD1 interacts with the NF-κB/Rel transcription factors. The NF-κB signalling pathway is conserved through evolution. The NF-κB transcription factors play numerous, crucial roles in inflammation, immunity and apoptosis; being over expressed in many tumours (Baldwin 1996, 2001)125,126. BARD1 binds to Bcl-3, which is part of the IκB family of NF-κB inhibitors. Bcl-3 serves as a bridge between the p50, one of the five known components of the NF-κB co-factors, and BARD1 (Dechend et al., 1999)127. This binding could be mediated through Bcl-3’s and BARD1’s ankyrin domains. Furthermore, it has also been shown that the p65/RelA subunit of NF-κB binds to BRCA1, and so causing an increase of the transcription levels of NF-κB target genes, such as Fas and interferon β (IFNβ) (Benezra et al., 2003)128. Transcription can be diminished by BARD1 and a BRCA1 RING domain mutants (Benezra et al., 2003)128. The plot between NF-κB and BARD1 thickens, because BARD1 has a slight binding affinity with IκBα (Dechend et al., 2003)127 and because IκBα is ubiquitinated for degradation by the proteasome after being phosphorylated on serines 32 and 36. (reviewed in Chen and Greene, 2003)129. The question remains open as to whether it is the BARD1/BRCA1 E3 ubiquitin ligase that is responsible for tagging IκBα with

35 ubiquitin. However, the complexity of these pathways, (which are never linear), increases, because p50 and RelA are acetylated at multiple serine residues probably by the CBP/p300 acetyltransferase, which was evidenced by BRCA1 and CBP/p300 interactions seen in vitro and in vivo (Cui et al., 1998; Pao et al., 2000)130,131. It is also noteworthy that CBP (CREB binding protein) is a component of the polymerase II holoenzyme (von Mikecz et al., 2000)132. BARD1 is the main co-partner of BRCA1 in a CBP/p300 mediated transcription. The cAMP response element binding protein (CREB) binding protein (CBP) and p300 are paralogous proteins involved in transcriptional regulation because they may bind CREB and other transcription factors like TFIIB and TATA box-binding protein. The CBP/p300 can function as a co- activator in a BRCA1-mediated transactivation (Pao et al., 2000)131. The CBP/p300 proteins are also histone acetyltransferases (HATs) (Ogryzko et al., 1996; Bannister and Kouzarides, 1996)133,134, and may recruit other HAT proteins. Acetylation of N- terminal lysine residues of histones enables chromatin decondensation so favouring transcriptional activation. Other factors are also involved in chromatin remodelling. The SWI/SNF-related complex binds to BRCA1 further confirming a role for BRCA1/BARD1 in transcriptional activity (Neish et al., 1998; Bochar et al., 2000)123,135. In the same line of thought, BARD1 and BRCA1 may also be directly involved in heterochromatin re-structuring and in X chromosome inactivation because BRCA1 and BARD1 co-associate with XIST RNA (Ganesan et al., 2002)136. It was first discovered that BRCA1 decorates the unpaired X chromosome in human pachytene spermatocytes upon staining of meiotic chromosomes (Scully et al., 1997b)137.

BARD1 in mRNA processing BARD1, together with BRCA1 interacts with the mRNA polyadenylation factor CstF- 50 and represses the activity of the polyadenylation machinery in vitro (Kleiman and Manley, 1999)138. The cleavage stimulation factor (CstF) is a protein complex involved in the polyadenylation process of all eukaryotic mRNAs. The CstF is required for the endonucleolytic cleavage step of mRNA and it helps to properly identify the site of processing (Takagaki, 1990,1997)139,140. It is a heterotrimeric protein with subunits of 77, 64 and 50 kDa. In a yeast two hybrid screen using CstF- 50 as bait, BARD1 was identified as having one of the strongest interactions with CstF-50 (Kleiman and Manley, 1999)138. Furthermore, CstF/BARD1/BRCA1 complex

36 is involved in the inhibition of mRNA 3’ processing in cell lines that were treated with DNA damage-inducing agents such as HU or UV (Kleiman and Manley, 2001)141. Furthermore, addition of exogenous BARD1 may also inhibit polyadenylation. Regulation of polyadenylation could play an important role in the control of cellular proliferation (Colgan et al., 1997; Zhao and Manley, 1998)142,143. It is therefore possible that BARD1-mediated inhibition of CstF polyadenylation prevents specific RNA processing during DNA damage-induced repair, thus helping to stall the cell cycle during a BRCA1/BARD1-mediated DNA repair. Further evidence of the involvement of BARD1 in tumour suppression through mRNA processing, came from the fact that the Ewing’s sarcoma gene product EWS interact via its NH2 terminus to BARD1 (Spahn et al., 2002)144. However, its modus operandi remains speculative.

P BARD1 Increase of BARD1 in G2/M BARD1 repression CDK1/2 BRCA2- TACC1- Cytokinesis Aurora B P Genetic Instability Tumour phenotype BARD1 BARD1 U calpain Ub BRCA1 Ub p53 Inhibition of polyadenylation BARD1 Apoptosis CstF-50 RAD51 p67 cleavage product

BASC

Transcription regulation Replication S-phase XIST X silencing Bcl-3 HU-UV MRE11 NF-κB/p50 RAD50 DNA Holo-pol II PCNA RAD51 NBS1 hMSH2-hMSH6 Transcriptional block Relocation in PCNA aggregates DNA repair, MMR, NHEJ, HDR

ATM-ATR- DNA damage DNA-PKs

Figure 9. The BARD1 network. This illustration shows the various pathways in which BARD1 is involved. BARD1 is up-regulated upon DNA damage, genotoxic insult and in the G2/M phase of the cell cycle. BARD1 down-regulation induces a genetic instability phenotype and a tumour phenotype. BARD1 is involved in DNA repair pathways, in replication, and in transcriptional regulation.

BRCA1-independent pro-apoptotic functions of BARD1 Since BARD1 and BRCA1 were not consistently expressed in all tissues, differential expression led to the hypothesis that BARD1 might play a role in a BRCA1- independent function (Irminger-Finger et al., 1998)47. Indeed, the first clues on the crucial role of BARD1 function in tumorigenesis, independently of BRCA1, came from BARD1 repression experiments, through ribozyme and mRNA anti-sense production in a mouse mammary epithelial cell line in vitro culture. The abrogation of BARD1 expression induced a spectrum of biological alterations, such as drastic morphological cell change, loss of contact inhibition, aberrant cell-cycle progression and abnormal DNA content, suggestive of a premalignant phenotype and genomic instability(Irminger-Finger et al., 1998)47. These data were later confirmed by others showing chromosomal instability in BARD1-/- cells as evidenced by aneuploidy and abnormal karyotypes (Joukov et al., 2001; McCarthy et al., 2003)49,98. Indeed, the main characteristic of cells with a deficient BRCA1 or BARD1 expression, following RNA interference treatment, is an increase of chromosomal alterations, as observed by cytogenetic analysis of karyotypes. Depletion of BRCA1 mRNA by siRNA expression can cause genomic instability in Fanconi anaemia cells (Bruun et al, 2003)145.

Since BARD1 has a vital role in normal cell survival, BARD1 expression was measured during apoptosis. It was found that BARD1 expression, through transcription, was up-regulated in response to genotoxic stress or after induction of an ischemic stroke in mouse (Irminger-Finger et al. 2001)146. Additionally, overexpression of exogenous BARD1 leads to DNA fragmentation and caspase-3 activation indicative of apoptosis (Irminger-Finger et al., 2001)146. It is dependent of p53, but independent of BRCA1, since BARD1 may trigger apoptosis in the absence of BRCA1 and not in p53 deficient cell lines (Irminger-Finger et al. 2001)146. These experiments identified BARD1 as a mediator between pro-apoptotic stress and p53- dependent apoptosis. The fact that Q564H missense mutation of BARD1 was defective in inducing apoptosis when transfected in cultured cells, implies that the region of BARD1 around Q564H could serve a role necessary for tumour suppression and for the pro-apoptotic function of BARD1. Furthermore, it was also shown that BARD1 co-immunoprecipitates with p53, suggesting a physical interaction

38 between p53 and BARD1 in order to induce apoptosis. BARD1 up-regulation upon genotoxic stress is accompanied by p53 expression and stabilization (Irminger-Finger et al., 2001). Activation and stabilization of p53 depend on its phosphorylation at multiple sites, by a number of kinases, including phosphorylation on serine 15. (Meek, 1994; Milczarek et al., 1997)147,148. Moreover, the stabilization and phosphorylation of p53 may be performed through BARD1, since the absence of functional BARD1 is sufficient for abolishing p53 phosphorylation on serine 15 (Fabbro et al, 2004)149. It was shown that the BRCA1/BARD1 heterodimer is required for phosphorylation of p53 on serine 15. This phosphorylation of p53 is necessary for a G1/S cell cycle arrest following DNA damage induced by ionising radiation (Fabbro et al., 2004a)149. Further evidence showed that BARD1 overexpression can catalyse the phosphorylation of p53 on serine 15 by a DNA-damage response kinase (Feki et al., 2005)150. It was also shown that BARD1 binds to Ku-70 in co-immunoprecipitation experiments as well as phosphorylated p53, identifying a candidate kinase for p53 phosphorylation (Feki et al., 2005)150. Identification of the region of BARD1 which binds to p53 was performed through a series of co-immunoprecipitations experiments of deletion mutants fused to EGFP. BARD1 may co-immunoprecipitate p53 over a large, domain but not the RING finger domain. Even the deletion mutants lacking the RING functional domain, which normally binds BARD1 to BRCA1, are capable of co- immunoprecipitating p53 (Feki et al., 2005)150. These experiments exclude the preconception that p53 was pulled down through an interaction with BRCA1. The p53 protein must be phosphorylated on serine residues for a function in apoptosis. It appears that BARD1 stabilizes p53 for DNA repair and for apoptosis.

BRCA1 may also bind to p53 in two regions: to the region 224-500 and to the BRCT domain 1760-1863 (Chai et al., 1999)151. This interaction is functional since BRCA1 may regulate p53-dependent gene expression (Ouchi et al., 1998)152 and that, conversely, p53 is required to modulate BRCA1 expression (Arizti et al., 2000)153. It appears that BARD1 follows a similar BRCA1 behaviour since BRCA1 overexpression triggers apoptosis (Harkin et al., 1999)154 and causes growth retardation in several breast or ovarian cell lines (Holt et al., 1996; Jensen et al., 1996; 1998)21,95,155.

39 Mapping of the pro-apoptotic domain of BARD1 BARD1’s function in the nucleus is mainly linked to DNA repair and transcriptional activity, but little is known on its dynamic properties and its role within the cytoplasmic compartment. BARD1, like BRCA1, has been described until now mostly as nuclear protein. However, BARD1 is synthesized in the cytoplasm and translocated into the nucleus localizing to foci (Scully et al., 1997)113. Human BARD1 has 6 predicted NLS (Nuclear Localizing Signal) sequences, whereas the mouse has only 3 NLSs. In both species, the prediction score for nuclear localization is high. BARD1 even serves as a chaperone for BRCA1, by retaining BRCA1 in the nucleus by masking BRCA1’s NES (Nuclear Export Signal) sequence when the two are bound together (Rodriguez et al., 2000; Fabbro et al., 2002; Schuechner et al., 2005)156-158.

However, contrary to previous reports stipulating that BARD1 had an exclusive nuclear localization, we showed that BARD1 is also localized in the cytoplasm in vitro and in vivo, albeit in discreet levels (Jefford et al., 2004)51. We showed that apoptosis is concomitant with enhanced cytoplasmic localization of BARD1, as well as the appearance of a p67 cleavage product (Jefford et al., 2004)51. Moreover similar observations suggest that BARD1 can shuttle from the nucleus to the cytoplasm, increasing its apoptotic activity (Rodriguez et al.,2004)159. Mapping the apoptotic domain of BARD1 was performed by using deletion constructs, which confirmed the apoptotic-inducing region to residues 510-604 in between the ankyrin repeats and the BRCT domains. This region coincides with two known cancer predisposing mutations C557S and Q564H (Thai et al., 1998; Ghimenti et al., 2002; Karppinen et al., 2004; Jefford et al., 2004)45,51,160,161. This region is necessary for BARD1-induced apoptosis, but it is not known if it is sufficient. BARD1 post-translational modifications and its degradation have not been investigated thoroughly, but it was shown that a p67 BARD1 proteolytic product cleaved by calpain can act as a tumour antigen. It is associated with apoptotic bodies in rat colon cancer cells (Gautier et al., 2000)162.

BRCA1 and BARD1 functions in cell cycle BARD1 and BRCA1 have several roles in cell-cycle progression that are mediated through their ubiquitin function and controlled by a cyclin dependent kinase, CDK2 (Hayami et al. 2005). Furthermore, BARD1 is phosphorylated by CDK1/2 on its NH2 terminus (Hayami et al., 2005)93. A role for BRCA1 in centrosome duplication has

40 been described, since BRCA1 associates with centrosomes during mitosis (Hsu and White, 1998)39 and co-immunoprecipitates with γ-tubulin. The γ-tubulin binding site was mapped to exon 11 of BRCA1 (Hsu and White, 2001)40. BRCA2 is also implicated in stages of cytokinesis, since depletion of BRCA2 increases cell division defects (Daniels et al., 2004)163. To further ascertain the role of BARD1 in cell cycle progression and cytokinesis, immunoprecipitation studies were performed in our laboratory and show that BARD1 co-aggregates withTacc1/AuroraB/BRCA2 at the midbody during completion of cytokinesis (Jefford and Irminger-Finger, submitted). Furthermore, this study has also shown that depletion of BARD1 clearly disrupts cell- cycle progression, cytokinesis and creates cellular fusion. These results provide an explanation for the mechanisms leading to aneuploid karyotypes and chromosomal instability as a cause for carcinogenesis in cells with deficient expression of BARD1 and BRCA1.

Figure 10. Mutations in BRCA1 span the entire gene. A total of 657 BRCA1 breast and ovarian cancer predisposing mutations have been documented. (Human Gene Mutation Database: http://archive.uwcm.ac.uk/uwcm/mg/hgmd0.html)

41 V. BARD1 mutations and expression in cancer

BARD1 tumour suppressor mutations in breast and ovarian cancers It was demonstrated that BRCA1 and BRCA2 mutations predispose women to cancer (Miki et al., 1994)5, but do not account for all familial breast and ovary cancer predispositions. The cancer predisposing mutations of BRCA1 span the entire gene and are numerous (Figure 10). A specific cancer predisposing mutation, C61G, within the RING domain of BRCA1, disrupts formation of the BRCA1 homodimer (Figure 4b) (Brzovic et al., 1998)164. Moreover, this mutation impedes ubiquitin protein ligase activity and tumour suppressor function of the BRCA1/BARD1 heterodimer (Hashizume et al., 2001; Ruffner et al., 2001)76,77. It was therefore hypothesized that BARD1 mutations should also predispose to cancer. After screening a panel of sporadic breast, ovarian and endometrial cancers, three missense alterations were identified in the BARD1 gene at the amino acid positions Q564H, V695L, and S761N (Thai et al., 1998)45. Loss-of-heterozygosity was accompanied in two cases (Q564H and S671N), substantiating BARD1’s role as a tumour suppressor. The V695L and S761N mutations arose in somatic breast tissue and were not found in the germ-line, whereas the Q564H mutation was found in the germ line of a patient with clear cell adenocarcinoma of the ovary (Thai et al., 1998)45. The latter mutation was screened against a panel of over 300 healthy individuals, suggesting that this alteration is not a polymorphism. Five alterations were discovered in an Italian cohort with familial breast and ovarian cancers that was chosen for its absence of BRCA1 and BRCA2 gene alterations in its proband (Ghimenti et al., 2002)160. These mutations include 3 missense mutations, K312R, C557S, N295S, and an in-frame deletion of 7 amino acid residues, 1139Del21-(PLPECSS). The last alteration is a C1579G transversion with no amino acid change at position A502, which was found in 15 probands, indicative of a novel polymorphism variant (Ghimenti et al., 2002)160. The mutations C557S and 1139Del21 were described previously by Thai et al., (1998) but were considered as polymorphisms. However, segregation analysis showed that the C557S mutation may be linked with the tumour with a statistically borderline significance (Ghimenti et al., 2002)160. This mutated allele was further confirmed as being involved in hereditary susceptibility to breast cancer in a Finnish population of gynaecological cancers (Karppinen et al., 2004)161. Individuals carrying the C557S allele showed a significantly increased risk of breast cancer. The observed incidence

42 of 7.4% for breast cancer against 1.4% in healthy controls suggests that it could be a common susceptibility allele with low penetrance (Karppinen et al.,2004)161. Mutational analysis of BARD1 in familial breast cancer patients in Japan, that were tested negative for BRCA1 or BRCA2 germ-line mutations, revealed six alterations: (S241C, G378S, N470S, V507, 1139Del21) (Ishitobi et al., 2003)165. Of the six mutations, only one missense mutation, N470S, was found in the germ-line of a patient and defined as a cancer predisposition mutation, because it did not appear in a large background of healthy controls (Ishitobi et al., 2003)165. So far, these observations show that BARD1 germ-line mutations have a low association with non BRCA hereditary breast and ovary tumours and account for a very small fraction of familial breast cancers (Figure 11). This fact may question the implication of BARD1 in predisposition to gynaecological cancers. However, expression of BARD1 is necessary in developing embryos, since homozygous Bard1 knockout mice die in utero at an early stage (McCarthy et al., 2003)98 and that the conditional knockout of the Bard1 allele causes tumours in mammary glands several months after induction (personal communication Thomas Ludwig).

BARD1 expression in normal and tumour tissues The regulation of transcription of BARD1 has not been totally elucidated, but BARD1 gene structure spans a 10 kb region close to the telomere on chromosome 2q34-q35 (Wu et al., 1996; Thai et al., 1998)44,45. BARD1 cDNA is 2530 base pairs in length and is composed of 11 exons. Several splice variants have been identified for BRCA1 (Orban and Olah, 2000; McEachern et al.,2003)166,167. Likewise, BARD1 has also several transcripts supplied by alternative splicing (Feki et al., 2004, 2005)150,168. Nevertheless, BARD1 and BRCA1 mRNA expression patterns as observed from northern blots are coordinated in several tissues.

In most murine tissues, Bard1 and Brca1 are concomitantly expressed. Northern blot experiments showed that BARD1 RNA messengers were abundantly expressed in spleen and testis, but not in heart, brain, liver, lung, skeletal muscle or kidney tissues (Ayi et al., 1998)48. RNase protection assays showed high expression levels in spleen and testis, but that Bard1 was also expressed in various other murine tissues, but less than Brca1 (Irminger-Finger et al., 1998)47. Hormonally regulated organs were also assayed for mBard1 expression, and showed that Bard1 in uterus is

43 increased from di-oestrus through post-oestrus phase, whereas Brca1 increases from diestrus to early oestrus and decreases during oestrus and post-oestrus (Irminger- Finger, 1998)47. This non-coordinate expression of Bard1 with Brca1 was the first indication of a BRCA1-independent role of BARD1. In our laboratory, Bard1 expression in testis was further explored, showing that Bard1 is expressed at all stages of spermatocyte maturation, whereas Brca1 expression is only seen in meiotic and early round spermatocytes (Feki et al. 2004)169. Furthermore, it was shown that BARD1 transcripts result from alternative splicing. The messenger RNA mBARD1β and mBARD1γ from rat testis, could have a role in triggering apoptosis (Feki et al., 2004)169. Finally it was also found that cells from the cytotrophoblast express also splice variants for BARD1 and protein expression was detected in the extra cellular matrix. Secretion of BARD1 is presently being investigated (personal communication by Bischof and Irminger-Finger).

Expression of BRCA1 mRNA is often reduced in sporadic breast carcinomas (Thompson et al., 1995)170, even in the absence of distinct BRCA1 mutations. This gene silencing anomaly is often imputed to epigenetic effects such as BRCA1 promoter methylation on CpG rich islands (Mueller and Roskelley, 2003)34. Abnormal

5’UTR RING Finger ANKYRIN REPEATS BRCT DOMAINS 3’UTR

1 (74) 2530 bp i ii iii iv v vi vii viii ix x xi

G203 T3 51 A502 H506

P24S K153E S241C R378S V507M R658C 777 aa

Del 358-364

N295S L312N N470S C557S Q564H V695L * S761N * LOH LOH

Silent mutations (4)

Polymorphisms (7) Putative cancer predisposing mutations (7) * Somatic mutations

Figure 11. Diagram showing all the documented mutations pertaining to BARD1. No cancer predisposing mutations were found in the RING domain. A total of 7 mutations were found in a population of cases of breast cancer that were negative for BRCA1 or BRCA2, which were screened against a large background of healthy individuals. Only two cases of loss-of-heterozygosity were found in the tumours of breast cancer patients (Q564H and S761N). (Compiled from Thai et al., 1998; Ghimenti et al., 2002; Ishitobi et al., 2003; Karppinen, 2004).

44 reduction of BRCA1 expression was observed in about 30% of breast carcinomas cases in a Japanese population (Yoshikawa et al., 2000)171. In contrast, expression of BARD1 and of the two mismatch repair enzymes, hMLH1 and hMSH2, was not reduced as frequently (Yoshikawa et al., 2000)171. Furthermore, p53 expression in sporadic breast cancers is diminished, which is accompanied by the frequent detection of a mutated p53 (Feki and Irminger-Finger, 2004)168. A recent report has examined the expression pattern of several genes, Smad7, Smad2 and Bard1, implicated in the TGFβ signalling pathways of normal and breast cancers. The expression of these genes are induced by TIEG (TGF-β inducible early gene) which is a nuclear zinc-finger transcription factor (Rheinholz et al., 2004)172. The expression was measured by real-time RT-PCR and the result was a decrease in breast cancer, which supports the notion that these genes are tumour suppressors repressed in tumours (Rheinholtz et al., 2004)172. Another study also showed a diminution of BARD1 expression at the mRNA level in breast carcinomas (Qiu et al., 2004)173. However, this contrasts with a recent study, where it was found that a mutated form of BARD1 was over-expressed in a number of cancerous breast tissues and its expression was localized in the cytoplasm (Jian-Wu et al., 2005 in press). This abnormal cytoplasmic over-expression could be due to a dysfunctional negative feedback loop, which explains the accumulation of BARD1 in the cytoplasm, since its down stream effectors are non-responsive. These apparently contrasting results demonstrate the discrepancies between mRNA expression and protein expression. The explanation could be that in abnormal or precancerous cells BARD1 upregulation is necessary for a signalling towards apoptosis, resulting in cytoplasmic localization for programmed cell death signalling. However, since the tumour tissues do not respond to the BARD1 protein, BARD1 accumulates in the cytoplasm, which results in a negative feedback loop thereby switching off mRNA transcription.

VI. Conclusion

BARD1 activities reflect the mirror image of BRCA1 functions in DNA repair, transcription and in maintenance of genome integrity, because BARD1 may perform the cellular roles imputed to BRCA1. However, on the other side of the coin, BARD1 may be involved in several BRCA1-independent functions, just as BRCA1 may have

45 several BARD1-independent functions. Indeed, BARD1, with differential expression, has functions in DNA repair mediating, through p53, but independently of BRCA1, an apoptotic response. BARD1 is possibly the effector or the co-activator in an apoptosis-signalling pathway, since it is up-regulated in apoptosis, it contributes to p53 phosphorylation and its over-expression may induce apoptosis.

Clearly, ordinate cellular functions, mediated by the heterodimer, must rely on the BARD1/BRCA1 equilibrium. BRCA1 stabilizes BARD1 and vice versa. For instance, BRCA1 over-expression induces BARD1 up-regulation. Moreover, it is worth noticing that BARD1 post-translational expression is modified in the absence of BRCA1, since BARD1 loses its ubquitinating functions and its ubiquitin moiety.

Like BRCA1, BARD1 interacts with a high number of proteins involved in various cellular functions. BRCA1 and BARD1 have several ubiquitination targets that affect many and various systems. It is likely that BRCA1 and BARD1 serve as a platform for coordinating a large number of cellular functions, probably through its main ubiquitinating functions. The BARD1 and BRCA1 proteins, either together or independently, play important roles in various systems, which include DNA-related functions (DNA repair, replication, chromatin remodelling and transcription) and mitotic events (centrosome duplication and checkpoint kinases). Thus, BARD1 and BRCA1 could serve as the main mediator between the DNA-related functions and cell cycle events.

The multitude of interacting proteins and pathways that BARD1 and BRCA1 are involved in is flabbergasting. The unifying model proposes that all the pathways that BARD1 is involved in converge towards a unique goal, an integrated system safeguarding the integrity of the genome. Epigenetic effects of BARD1 and BRCA1 may be partly explained from this point of view. In all cases, it looks like BARD1 and BRCA1 are at the crossroads of multiple pathways coordinating different systems in an integrated network.

Results Publications

1. Identification of BARD1 as a mediator between proapoptotic stress and p53-dependent apoptosis Irminger-Finger I, Leung WC, Li J, Dubois-Dauphin M,Harb J, Feki A, Jefford CE, Soriano JV, Jaconi M, Montessano R, Krause KH. Mol Cell. 2001 Dec; 8(6):1255-66. This seminal paper shows that BARD1 is a mediator between proapoptotic stress signals and induction of programmed cell death through p53 activation. Although my contribution was small, it is a crucial report since its premises serves as a basis of subsequent work and constitutes the hypotheses for my thesis. In this study, we showed that BARD1 expression at the mRNA and protein levels is augmented upon genotoxic stress in vitro, and by hypoxia in vivo in cerebral ischemia. Upregulation of BARD1 expression upon cell death induced by genotoxic insult, such as UV and doxorubicin treatment, is accompanied by elevated p53 expression in mouse mammary gland and embryonic stem cells. Cells devoid of functional BARD1 appear not to undergo apoptosis as measured by DNA fragmentation assays and caspase-3 activity. We showed that BARD1 over-expression in transient transfection experiments may induce apoptosis even in the absence of a functional BRCA1, but not in the absence of p53, which identifies BARD1 as a bona fide signalling molecule towards apoptosis. BARD1 induces apoptosis in concentration-dependent and time- dependent manners. The pro-apoptotic activity of BARD1 coincides with p53 elevation. Furthermore, we showed that p53 co-immunoprecipitates with BARD1, indicative of a physical interaction between BARD1 and p53. This interaction implies the participation of BARD1 in the signalling towards cell death. My contribution consisted in the various assays, the preparation of cells, transfection experiments, and the repetition of the functional apoptotic assays, in which apoptosis was measured by DNA fragmentation assays. Furthermore, I also worked on optimising the BARD1-p53 co-immunoprecipitation assays.

47 Molecular Cell, Vol. 8, 1255–1266, December, 2001, Copyright 2001 by Cell Press Identification of BARD1 as Mediator between Proapoptotic Stress and p53-Dependent Apoptosis

Irmgard Irminger-Finger,1,7 Wai-Choi Leung,5 nant phenotype and genomic instability (Irminger-Finger Jian Li,1 Michel Dubois-Dauphin,2 Jean Harb,6 et al., 1998). The BARD1/BRCA1 complex was shown Anis Feki,1,3 Charles Edward Jefford,1 to associate with the polyadenylation factor CstF-50 Jesus V. Soriano,4 Marisa Jaconi,1 (Kleiman and Manley, 1999), presumably to prevent RNA Roberto Montesano,4 and Karl-Heinz Krause1 processing at sites of DNA repair (Kleiman and Manley, 1 Biology of Aging Laboratory 2001). The BRCA1-BARD1 heterodimeric RING finger Department of Geriatrics complex was recently shown to possess ubiquitin ligase 2 Department of Psychiatry activity in vitro (Hashizume et al., 2001). However, 3 Department of Gynecology and Obstetrics BARD1 and BRCA1 are not consistently coexpressed 4 Department of Morphology in different tissues (Irminger-Finger et al., 1998), sugges- Faculty of Medicine tive of the existence of independent functions for both University of Geneva genes. Of particular interest in this context is the pre- Switzerland viously observed high expression level of BARD1 but 5 Department of Pathology and Tulane Cancer Center undetectable BRCA1 concentrations in mouse uterus Tulane University School of Medicine during the estrus phase (Irminger-Finger et al., 1998), New Orleans, Louisiana i.e., the moment of the estrous cycle when massive cell 6 Institut de Biologie death (in part through apoptosis) of the endometrium INSERM U419 occurs (Ferenczy, 1993). As induction of apoptosis is Nantes an important mechanism for tumor suppression, we hy- France pothesized that BARD1 is involved in the regulation of cell death.

Summary Results

The BRCA1-associated protein BARD1 is a putative BARD1 Upregulation in Response to Hypoxia In Vivo tumor suppressor. We suggest that BARD1 is a media- To investigate a putative role of BARD1 in cell death, tor of apoptosis since (1) cell death in vivo (ischemic we used a well-established mouse stroke model (Mar- stroke) and in vitro is accompanied by increased levels tinou et al., 1994). To induce ischemic stroke, median of BARD1 protein and mRNA; (2) overexpression of cerebral artery occlusion (MCAO) was performed in the BARD1 induces cell death with all features of apopto- right brain hemisphere. Necrotic cell death occurs dur- sis; and (3) BARD1-repressed cells are defective for ing the first few days in the stroke region, while apopto- the apoptotic response to genotoxic stress. The pro- sis develops over several weeks in the surrounding tis- apoptotic activity of BARD1 involves binding to and sue, the penumbra (Martinou et al., 1994). In the brain elevations of p53. BRCA1 is not required for but par- of untreated animals, no BARD1 was found (Figure 1Aa), tially counteracts apoptosis induction by BARD1. A consistent with the previously described absence of tumor-associated mutation Q564H of BARD1 is defec- BARD1 mRNA in the central nervous system (Ayi et al., tive in apoptosis induction, thus suggesting a role of 1998). Positive BARD1 immunostaining was detected BARD1 in tumor suppression by mediating the signaling after ischemia predominantly in the penumbra (Figure from proapoptotic stress toward induction of apoptosis. 1Ac), increasing from day 1 up to day 14 in the ischemic hemisphere (Figure 1B, left panel). In contrast, BRCA1 Introduction was detected neither in the brain of untreated animals nor of animals treated with MCAO (Figures 1Ab and 1B, BARD1 (BRCA1-associated RING domain 1) is described right panel). As positive control for the BRCA1 antibody, as a nuclear protein that associates with the breast cancer sections of mouse ovarian tissue were analyzed and susceptibility gene product BRCA1 (Wu et al., 1996; Miki showed expression of BARD1 and BRCA1 in ovarian et al., 1994). The two proteins interact in vivo and in vitro follicles (Figure 1Ad–f). These results suggest that the through their respective RING finger domains (Wu et al., role of BARD1 in hypoxia-induced brain damage is inde- 1996; Meza et al., 1999; Scully et al., 1997). As mutations pendent of BRCA1. BARD1 induction in ischemia would in the BRCA1 RING finger domain (Bienstock et al., 1996) be compatible with its involvement in cellular stress re- lead to increased cancer susceptibility, BARD1 was sponse and possibly the induction of apoptosis. To fur- thought to be implicated in BRCA1-mediated tumor sup- ther clarify the potential role of BARD1 in apoptosis, we pression. Consistent with this hypothesis, BARD1 muta- proceeded with in vitro studies. tions were found in breast, ovarian, and uterine tumors (Thai et al., 1998), and reduced expression of BARD1 BARD1 Expression in Response is associated with spontaneous breast cancer cases to Genotoxic Stress In Vitro (Yoshikawa et al., 2000). The in vitro repression of BARD1 We first studied the response of various cell lines to pro- in murine mammary gland epithelial cells led to a premalig- apoptotic stress. Addition of the DNA-damaging chemo- therapeutic agent doxorubicin to mouse mammary epithe- 7 Correspondence: [email protected] lial TAC-2 cells (Soriano et al., 1995) not only led to an Molecular Cell 1256

Figure 1. BARD1 Expression Is Upregulated upon Stress (A) BARD1 but not BRCA1 is upregulated in a mouse stroke model. In brains from untreated animals, neither BARD1 (a) nor BRCA1 (not shown) was detected by immunocytochemistry. As shown at day 7 after MCAO, BARD1 was not detected in the infarct core region (*) but in the penumbra (c); staining remained negative for BRCA1 (b). Similar results were obtained at days 3 and 14. Bar, 550 ␮m. Unlike in the brain, BRCA1 (d) and BARD1 (e) are expressed in the mouse ovary. Primary antibody was omitted in (f). Bar, 100 ␮m. (B) As assessed by Western blotting, an increase of BARD1 can be observed from day 1 through day 14 after MCAO, in extracts from the treated hemisphere (ϩ) but not in the untreated hemisphere (Ϫ) (left panel). Expression of BARD1 and BRCA1 was compared on liver and nontreated (nt) or ischemic (isch) brain tissue (right panel). For both immunocytochemistry and Western blotting, the BARD1 antibody N-19 (Santa Cruz sc-7373) was used. The same staining was observed with a C-terminal anti-BARD1 antibody (Santa Cruz sc-7372). Anti-BRCA1 antibody was M-16 (Santa Cruz). Antibody preabsorption with specific peptides (Santa Cruz) or omission of primary antibody resulted in absence of the signal (not shown). (C–E) BARD1 protein and mRNA is upregulated in cells exposed to genotoxic stress. Increase of p53 and BARD1 protein in TAC-2 cells, treated with doxorubicin (0, 5, or 10 ␮g/ml) for 12 hr, is demonstrated by Western blotting (C). Similarly, BARD1 expression is increased after exposure to UV light for 1 to 4 min (2.5 to 10 JmϪ2) (D). The expression of BARD1 was tested with anti-Bard1 antibody (PVC, Irminger-Finger et al., 1998), and p53 expression was probed with anti-p53 antibody (FL-393, Santa Cruz). (E) RT-PCR of RNA from mouse ES cells exposed to UV light for 0, 1, or 4 min (0, 2.5, or 10 JmϪ2) or treated with doxorubicin (10 ␮g/ml) shows an increase of BARD1 expression, while expression of the control housekeeping gene ␤-tubulin remains constant. BARD1 Signaling toward p53-Mediated Apoptosis 1257

Figure 2. BARD1 Overexpression Induces Apoptosis In Vitro (A) TAC-2 cells were transfected with pcDNA3 vector sequences, BARD1, or the p53 sequences cloned into pcDNA3. Apoptosis induction was monitored by TUNEL staining 24 hr after transfection. Ten photographic fields were randomly chosen to evaluate the mean percentage of stained nuclei (bar chart). (B) DNA laddering was observed in cells transfected with BARD1 or p53 containing plasmids but not in cells transfected with pcDNA3. “Marker” indicates molecular weight marker smart ladder (Stratagene). (C) Caspase-3 activity assays were performed, and the fluorometric results of five independent transfection experiments are presented. Caspase-3 activity was significantly increased in BARD1 and p53-transfected cells. (D) BARD1 protein levels after doxorubicin treatment and after BARD1 transfection were compared in different cell lines on Western blots. Western blots were stripped and reprobed with anti-␤-tubulin antibodies. (E) Comparison of mean expression levels of BARD1 in TAC-2 cells by flow cytometry after anti-BARD1 antibody staining, presented as x values of anti-BARD1-FITC. The increase of mean x values (arrow heads) in cells treated by doxorubicin or transfected by BARD1 as compared to untreated cells is a direct measure of the increase in cellular BARD1 content. This increases of BARD1-derived fluorescence are similar in doxorubin-treated and BARD1-transfected cells. Molecular Cell 1258

Figure 3. Mapping of Proapoptotic Activity BARD1 wild-type or mutant protein was expressed by transient transfection in mouse ES cells. Apoptosis induction in control transfectants and transfected cells was monitored 24 hr after transfection by DNA laddering (A) or TUNEL assays, analyzed by flow cytometry (B). The expression after transfection was tested on Western blots of nontransfected (nt), BARD1- transfected, or BARD1Q564H (BARD1QϾH) mutant-transfected cells (C). An increase of 97 kDa BARD1 protein can be observed, while expression of actin is constant. Transfection efficiency was tested by cotransfection of GFP and was at least 20%. increase in cellular p53 levels but also to marked elevations trol transfectants (empty vector or GFP) showed either of cellular BARD1 levels (Figure 1C). Similar increase of no or only marginal signs of apoptosis. Thus, BARD1 BARD1 in response to doxorubicin treatment was also transfection induced cell death, which displayed fea- observed in HeLa cells and human SH-SY5Y neuro- tures of apoptosis. We also observed apoptosis induced blastoma cells (data not shown), as well as in mouse by BARD1 transfection in mouse ES, human SH-SY5Y, embryonic stem (ES) cells (see below). To test whether HeLa, and MCF-7 breast cancer cells, albeit to different cellular damage induced by means other than doxorubi- extents (data not shown). Thus, BARD1 is a potent in- cin also resulted in an increase of BARD1, cells of differ- ducer of apoptosis in cells of different tissue or species ent tissue origins were exposed to UV light. BARD1 was origins. The relative increase of BARD1 protein levels induced in HeLa and TAC-2 cells (data not shown) and observed after transient transfection were comparable mouse ES cells (Figure 1D) after UV treatment and fur- to the increase after doxorubicin treatment, as assessed ther incubation for 3 hr. The increase of BARD1 might by Western blotting (Figure 2D). However, since not all be regulated by transcriptional activation, as is demon- cells express BARD1 in a transient transfection assay, strated by RT-PCR. Most strikingly in mouse ES cells, we also investigated BARD1 levels in individual cells by no BARD1 mRNA could be detected in untreated cells, flow cytometry. Mean values of BARD1 levels in doxoru- while BARD1 mRNA was clearly present after UV or bicin-treated cells were increased on average by a factor doxorubicin treatment (Figure 1E). These results sug- of 3.7 (Ϯ 2.4) with 5 ␮g/ml doxorubicin (Figure 2E), while gest that BARD1 upregulation upon genotoxic stress is mean values for BARD1 levels in BARD1-transfected transcriptionally regulated. cells increased 2.5-fold (Ϯ 1.8) over controls, showing a broader distribution (Figure 2E). Thus, the mean cellular Elevated Expression of BARD1 Leads to Apoptosis BARD1 levels are raised to comparable levels in doxoru- To address the question of whether BARD1 upregulation bicin-treated and BARD1-transfected cells. causes cell death, we transfected TAC-2 cells with a To study the mechanisms of proapoptotic signaling BARD1 expression plasmid. Attempts to establish sta- by BARD1, we analyzed the induction of apoptosis by ble BARD1-transfected cell lines were unsuccessful. a BARD1 deletion mutant and the Q564H missense mu- Only mock-transfected (empty vector or GFP) but not tation (Figures 3A and 3B). TAC-2 cells or mouse ES BARD1-transfected cells yielded viable cell lines, sug- cells were transfected with pcDNA, BARD1,orthe gesting deleterious effects of BARD1 overexpression. BARD1Q564H mutant. Transfection efficiency was stan- We therefore analyzed transiently transfected cells. dardized, and the protein expression levels of exoge- Transient transfection of TAC-2 cells with BARD1 led to nously expressed BARD1 and BARD1Q564H were com- apoptosis as assessed by TUNEL staining, DNA lad- parable (Figure 3C). DNA laddering and TUNEL assays dering, caspase-3 activity tests (Figures 2A–2C), as well were performed to monitor apoptosis induction. Inter- as annexin V staining and nuclear condensation moni- estingly, the BARD1Q564H point mutation was largely tored by DAPI staining (data not shown). Transfection devoid of apoptosis-inducing activity. Since the Q564H of cells with the bona fide proapoptotic protein p53 mutation was shown to be associated with breast and (Sionov and Haupt, 1999) led to a similar extent of apo- endometrial cancer (Thai et al., 1998), its reduced apoptosis as transfection of BARD1 (Figures 2A–2C). Con- ptotic capacity provides a possible link between the BARD1 Signaling toward p53-Mediated Apoptosis 1259

Figure 4. BARD1-Induced Apoptosis Is Independent of BRCA1 Transfection of pcDNA, BARD1,orBRCA1 expression plasmids was performed, and apoptosis induction was monitored 24 hr after transfection. Efficiency of transfection was 20% as determined by transfection of GFP expressing plasmids. DNA laddering was observed in BARD1- transfected cells but not in BRCA1- or pcDNA-transfected cells (A). Inhibition of BARD1-induced apoptosis by BRCA1 is presented in cotransfection experiments in ES cells (B). Transient transfection assays were performed with pcDNA, BARD1, BARD1 ϩ BRCA1,orBRCA1. The extent of apoptosis induction was measured by TUNEL staining and monitored by flow cytometry. Results presented are mean x (TUNEL- fluorescence) Ϯ range (n ϭ 2). Expression of BARD1 and BRCA1 was monitored on Western blots (C). Gels were scanned, and increase of BARD1 and BRCA1 was measured and were similar for both proteins. Influence of BRCA1 on apoptosis induction by BARD1 was analyzed in Brca1Ϫ/Ϫ and wild-type (wt) ES cells. DNA laddering was performed to qualitatively demonstrate apoptosis induction after doxorubicin treatment (5 ␮g/ml) or transient BARD1 transfection (D). Apoptosis induction under the same conditions was quantified by TUNEL assays of wild-type and Brca1Ϫ/Ϫ ES cells (E). Results presented are mean x (TUNEL- fluorescence) Ϯ range (n ϭ 2). tumor suppressor function of BARD1 and its proapo- 4B). Similar increase of expression was monitored for ptotic activity. BRCA1 and BARD1 after transfection (Figure 4C). Inter- estingly, the cotransfection of BRCA1 diminished rather Apoptosis Induction by BARD1 Is Independent than enhanced apoptosis induction by BARD1, as deter- of Functional BRCA1 mined by TUNEL staining and flow cytometry. To defini- An involvement of BRCA1 in apoptotic signaling had tively clarify whether apoptosis induction by BARD1 oc- been suggested previously (Harkin et al., 1999; Thangar- curs independently of BRCA1, we studied apoptosis aju et al., 2000). Thus, the BARD1 effects might be medi- induction in Brca1-deficient mouse ES cells (Aprelikova ated through or require BRCA1. To investigate this ques- et al., 2001). As assessed by DNA laddering (Figure 4D), tion further, we transfected BRCA1 into ES cells (Figure BARD1 transfection induced apoptosis in Brca1-defi- 4A) and into TAC-2 cells (data not shown); no apoptosis cient cells as efficiently as doxorubicin. These results occurred under these conditions, while DNA laddering demonstrate unequivocally that BRCA1 is not required and positive TUNEL staining was observed after trans- for BARD1-induced apoptosis. fection of BARD1 (Figure 4A). Thus, overexpression of When apoptosis was assessed quantitatively by BRCA1 by itself does not induce apoptosis. To test TUNEL assay, the Brca1-deficient cells clearly showed whether BRCA1 synergized with BARD1 in apoptosis increased sensitivity to apoptosis induction by both induction, we cotransfected BRCA1 and BARD1 (Figure BARD1 and doxorubicin (Figure 4E). Thus, cotransfection Molecular Cell 1260

Figure 5. Repression of BARD1 Reduces the Apoptotic Response to Genotoxic Stress BARD1 repression was achieved by stable transfection of BARD1 ribozyme in ES cells (ES riboBARD1) or a BARD1 antisense in murine mammary cells (TAC-2/ABI). After treatment with doxorubicin (5 ␮g/ml, 6 hr), apoptosis was monitored by flow cytometric analysis of TUNEL staining, as shown for ES cells and ES/riboBARD1 cells (A). Comparison of results obtained for ES, ES/riboBARD1, TAC-2, TAC-2/ABI, or ES/ riboNox4 (transfected with an unrelated ribozyme) is shown in (B) with mean x (TUNEL-fluorescence) Ϯ SEM (n ϭ 3). Cell numbers of TAC-2 cells or BARD1-repressed TAC-2/ABI cells in the absence or presence of doxorubicin (10 ␮g/ml) were monitored after 2 and 4 days (C). Five fields of cells from each time point and each cell type were analyzed, and the mean Ϯ SEM remaining adherent cells are shown (right panel). Caspase-3 activity (Molecular Probes) was measured by fluorometry after treatment with doxorubicin (10 ␮g/ml) for the indicated periods of time (D). Results are mean Ϯ SEM (n ϭ 3). Experiments were performed in the presence and absence of the caspase-3 inhibitors DEVD. BARD1 Signaling toward p53-Mediated Apoptosis 1261

Figure 6. BARD1-Induced Apoptosis Is Associated with p53 Accumulation The p53 protein is upregulated in cells overexpressing BARD1 (A). Expression of p53 protein in cells harvested 24 hr after transfection with indicated amounts of BARD1 and pcDNA3 or BARD1 was analyzed on Western blots (top panel). Effects of BARD1 and BARD1Q564H mutant (BARD1QϾH) on p53 expression were compared (middle and lower panels). While BARD1 increase is observed in BARD1- and BARDQ564H mutant-transfected cells, significant increase of p53 is observed only in BARD1-transfected cells. The bar graph shows a comparison of p53 expression of cells transfected with pcDNA3 or BARD1Q564H mutant (BARD1QϾH) as a percentage of p53 expression in BARD1-transfected cells. Increase of p53 in response to doxorubicin is compared in ES and TAC-2 cells, in BARD1-repressed ES/riboBARD1 and TAC-2/ABI cells, and in control transfectants ES/riboNox4 (B). Cells were incubated for 12 hr with doxorubicin (0, 5, or 10 ␮g/ml), and p53 and BARD1 accumulation was monitored by Western blotting. Unchanged levels of actin are shown. p53 upregulation is not due to transcriptional upregulation (C). p53 mRNA expression is tested by RT-PCR of RNA prepared from untransfected, pcDNA-, or BARD1-transfected cells (left panel). Protein (␣-p53) and mRNA (RTPCR) expression are compared in TAC-2 cells after the indicated time of incubation with doxorubicin (right panel). Control of independent gene expression was performed with primers against mouse ␤-tubulin. of BRCA1 diminishes BARD1-induced apoptosis, and the exert its proapoptotic activity either as a homodimer or Brca1Ϫ/Ϫ genetic background enhances BARD1-induced in a complex with other proteins. apoptosis. This suggests that BRCA1 actually antagonizes BARD1. Indeed, a BARD1 deletion mutant (RING finger Repression of BARD1 Reduces Apoptotic deletion of amino acids 1 through 237) retains apoptosis Response to Genotoxic Stress inducing activity (data not shown). Taken together, these So far we have demonstrated that BARD1 levels in- results suggest that the BRCA1/BARD1 complex is not crease in response to apoptotic stimuli and elevation of involved in apoptosis induction and that BARD1 must BARD1 levels is sufficient to induce apoptosis. To as- Molecular Cell 1262

Figure 7. BARD1 Induces Apoptosis through Interaction with Functional p53 BARD1-p53 interaction was assayed by coimmunprecipitation (A). Anti-p53 (agarose-coupled; Santa Cruz) or anti-BARD1 antibodies (N-19; Santa Cruz) were used for immunoprecipitations (IP) from nontreated (non-treat) and doxorubicin-treated (doxo) cells, and Western blots were incubated with anti-BARD1 (PVC, Irminger-Finger et al., 1998) and anti-PCNA (Santa Cruz) or anti-p53, respectively. Supernatants (S) and pellet (P) fractions are presented. Efficiency of BARD1-p53 interaction is compared in transient transfections of BARD1 or BARD1Q564H (BARD1QϾH) mutant (B). Western BARD1 Signaling toward p53-Mediated Apoptosis 1263

sess whether BARD1 is required for the induction of mRNA after doxorubicin treatment were compared. apoptosis, we studied the effect of BARD1 repression. While p53 protein levels were undetectable in untreated For this purpose, we used two different systems for cells and increased after a few hours of treatment, p53 BARD1 repression, ribozymes and antisense RNA. mRNA levels, as detectable by RT-PCR, were elevated Mouse ES cells stably expressing anti-BARD1 ribo- in untreated cells and did not increase significantly after zymes were generated, and TAC-2 cells stably express- exposure to doxorubicin (Figure 6C, right panel). It is ing BARD1 antisense RNA were described previously therefore unlikely that BARD1 and doxorubicin-induced (TAC-2/ABI; Irminger-Finger et al., 1998). In both sys- p53 protein accumulation are due to transcriptional tems, doxorubicin induced much less apoptosis (i.e., upregulation. It rather appears that BARD1 exerts its TUNEL-positive cells), as compared to control cells or action on p53 at a posttranslational level, consistent cells transfected with an irrelevant ribozyme (Figures 5A with the concept of posttranslational regulation of p53 and 5B). Resistance to doxorubicin-induced apoptosis levels during apoptosis (Lakin and Jackson, 1999). through BARD1 antisense expression could also be monitored by simple cell count (Figure 5C) or by measur- BARD1-p53 Interaction Is Required ing caspase-3 activity (Figure 5D). In control cells, doxo- for BARD1-Induced Apoptosis rubicin led to almost 100% cell death within a few days, To determine how BARD1 induces p53 accumulation, whereas BARD1-repressed cells showed delayed and we investigated whether the two proteins interact physi- reduced response. Taken together, these results sug- cally by performing coimmunoprecipitation experiments gest that the apoptotic response to doxorubicin is, at (Figure 7A). Cell lysates from TAC-2 cells (Figures 7A– least in part, mediated through BARD1. 7C), mouse ES cells, or HeLa cells (data not shown), untreated or after treatment with doxorubicin, were Apoptosis Induction by BARD1 Affects tested. When using either anti-BARD1 antibodies or p53 Protein Accumulation anti-p53 antibodies, BARD1 and p53 coimmunoprecipi- To further study the mechanism of BARD1-induced apo- tated. Using p53 antibodies, 36% (Ϯ4; n ϭ 2) of BARD1 ptosis, we investigated the relationship between BARD1 was found in the pellet after treatment with doxorubicin and the p53 pathway of apoptosis. Transfection of (Figure 7A, upper panel), and p53 coimmunprecipitation BARD1 into TAC-2 cells, which express wild-type p53 with BARD1 antibodies resulted in 52% (Ϯ3; n ϭ 2) (see Experimental Procedures; RT-PCR), led to a of the protein in the pellet fraction after doxorubicin marked increase in p53 protein levels (Figure 6A), signifi- treatment (Figure 7A, lower panel). The nuclear protein cantly higher than after transfection of vector sequences PCNA, shown previously to be associated with BRCA1 (Figure 6A) or expression of unrelated proteins (data not in DNA repair functions (Scully et al., 1997) did not coim- shown). Importantly, transfection of the BARD1 mutation munoprecipitate under our experimental conditions, Q564H, which showed reduced apoptotic capacity when demonstrating specificity of the p53-BARD1 interaction. expressed in TAC-2 cells or ES cells (Figure 3), resulted However, this coimmunoprecipitation was observed in significantly less p53 accumulation than that obtained only in doxorubicin-treated cells. The lack of coimmuno- with wild-type BARD1 (Figure 6A, middle panel). precipiation of BARD1 and p53 in nontreated cells may If BARD1 were a relevant link between DNA damage simply be due to the very low p53 protein levels in non- and p53 elevations, a decreased expression of p53 in treated cells. The interaction between BARD1 and p53 BARD1-suppressed cells could be expected. Indeed, was also observed in TAC-2 cells in which p53 elevations BARD1 repression led to reduced p53 elevations in dox- were induced by BARD1 transfection (Figure 7B). How- orubicin-treated cells, as shown for the two cell lines ever, coimmunoprecipitation was markedly decreased described above (Figure 6B, top and middle panels). for the BARD1 mutant Q564H (Figure 7B). Only 19% (Ϯ2; Transfection of an irrelevant ribozyme (Nox4) did not n ϭ 3) of p53 coimmunprecipitated with BARD1Q564H, alter p53 induction (Figure 6B, lower panel). The upregu- while cells transfected with wild-type BARD1 showed lation of p53 observed at the protein level could be 58% of p53 protein in the pellet fraction. Thus, the tumor- due to transcriptional upregulation of p53. RT-PCR was associated BARD1Q564H mutant interacts less avidly performed to determine the changes in the p53 mRNA with p53 than wild-type BARD1. levels. No significant differences, either of p53 mRNA To further ascertain the role of p53 in BARD1-induced or of the control housekeeping gene ␤-tubulin, were apoptosis, we investigated the apoptotic activity of BARD1 observed in mock-transfected or pcDNA-transfected in p53-deficient mouse ES cells (Corbet et al., 1999). Trans- cells when compared to BARD1-transfected cells (Fig- fection of BARD1 into p53Ϫ/Ϫ cells did not lead to apopto- ure 6C, left panel). To further analyze p53 accumulation, sis, as determined by annexin V staining (Figure 7C) and the time course of expression of p53 protein and p53 DNA ladder assay (Figure 7D), while apoptosis was in-

blots were probed with anti-p53 and anti-BARD1 antibodies. BARD1-induced apoptosis depends on functional p53, as demonstrated by annexin V staining (C) and DNA ladder assay (D) of wild-type or p53Ϫ/Ϫ ES cells transiently transfected with pcDNA3 or BARD1. BARD1 is required for p53 stabilization through protein-protein interaction as demonstrated by cotransfection of BARD1 and p53 in p53-deficient ES cells (E); p53Ϫ/Ϫ ES cells were transfected with p53 or BARD1 plus p53. Increase of p53 was monitored on Western blots, and p53 protein bands were quantified. Bar graph presents intensities of band as arbitrary units. Model of dual functionality of BARD1 (F). Increase of BARD1 upon stress: pathway (1) BRCA1-BARD1 heterodimer formation, observed as nuclear dots (Scully et al., 1997), induction of DNA repair functions; pathway (2) BARD1 excess over BRCA1 (possibly as homodimers), BARD1 interaction with p53, affecting p53 stability and induction of apoptosis. Molecular Cell 1264

duced in the corresponding wild-type cells. Thus, p53 in Brca1-deficient embryos contribute to embryonic le- is required for BARD1-induced apoptosis. thality? Likewise, there is a high frequency of p53 muta- The data presented so far demonstrate that increase tions in tumors with BRCA1 mutations (Buller et al., 2001; of BARD1 leads to an increase of p53 protein, which is Greenblatt et al., 2001; Reedy et al., 2001). Thus, is not accompanied by detectable elevations of p53 the p53-dependent proapoptotic activity of BARD1 an mRNA. Together with the direct protein-protein interac- obstacle toward malignant progression in cells with tion of the two molecules shown above, this suggests BRCA1 mutations, which has to be overcome through posttranslational stabilization of p53 by BARD1. To fur- p53 mutations? ther substantiate this point, we transfected p53-deficient ES cells with vector sequence, p53 plus control Mechanisms of BARD1-Induced p53 Elevations vector, or p53 plus BARD1. In this system, p53 (ex- Our results demonstrate that DNA damage leads to pressed from the constitutive CMV promoter) cannot be upregulation of BARD1, presumably by altering RNA controlled on a transcriptional level, but p53 protein levels (Figure 1E). Increase of BARD1 protein subse- stabilization must result from interaction with BARD1. quently affects p53 protein stabilization through a mech- Indeed, as shown in Figure 7E, markedly higher levels anism that most likely involves direct BARD1-p53 proof p53 protein are observed in cells cotransfected with tein-protein interaction. What could be the precise p53 and BARD1 than in cells transfected with p53 only. biochemical mechanisms of the BARD1-induced p53 upregulation? The most straightforward explanation Discussion would be BARD1-induced changes of the p53 molecule leading to protein stabilization. Alternatively, however, it Our results demonstrate a function of BARD1 in signaling might be due to an interference of BARD1 with ubiquitin- between genotoxic stress and induction of apoptosis: dependent p53 degradation. Indeed, p53 turnover is BARD1 levels increase in response to genotoxic stress controlled by the cellular protein degradation machinery and are necessary and sufficient for p53 upregulation that involving ubiquitin ligases, such as E6-AP (Scheffner et results in apoptotic response (Sionov and Haupt, 1999). al., 1993; Rodriguez et al., 2000) and MDM-2 (Honda et There are several interesting parallels between our real., 1997). Several observations point toward a role of sults and previously published observations. First, we BARD1 in ubiquitination: BARD1 possesses an N-termi- show decreased sensitivity to apoptosis-inducing drugs nal RING finger domain found in many proteins impli- in BARD1-repressed cells (Figures 5A–5D), reminiscent cated in ubiquitination (Freemont, 2000), and as recently of the aberrantly reduced expression levels of BARD1 shown, the BARD1/BRCA1 complex possesses ubiqui- reported in spontaneous breast tumors (Yoshikawa et tin ligase activity (Scully and Livingston, 2000; Hashi- al., 2000). Second, we show elevations of BARD1 during zume et al., 2001). Our data do not exclude that BARD1 apoptosis, reminiscent of BARD1 found in apoptotic alters p53 ubiquitination; however, as BARD1 induction tumor cells (Gautier et al., 2000). Third, we show that of apoptosis is BRCA1 independent, ubiquitination the BARD1Q564H mutant has a decreased proapoptotic would have to occur through mechanisms other than activity (Figure 3B), matching with its association with those described (Hashizume et al., 2001). Also, it is very breast and endometrium cancer (Thai et al., 1998). unlikely that the recently described function of BARD1 in inhibition of mRNA 3Ј end processing (Kleiman and Relationship between BRCA1 and BARD1- Manley, 2001) is linked to the BARD1-induced apoptosis Induced Apoptosis pathway described here, since it involves the formation Hitherto described BARD1 functions depend on its as- of a BARD1/BRCA1/CstF-50 complex. sociation with BRCA1, and a function of BRCA1 in apoptosis induction was proposed previously (Harkin et al., Dual Mode Hypothesis of BARD1 Function 1999). However, the function of BARD1 as apoptosis Based on the BRCA1-dependent BARD1 functions de- inducer, described here, has to be attributed to BARD1 scribed previously and on the BRCA1-indepedent independently of its association with BRCA1, because BARD1 function described in this paper, we propose a (1) only BARD1 but not BRCA1 increased after stroke; “dual mode of action” model of BARD1 function (Figure (2) the cotransfection of BRCA1 did not enhance 7F). In the survival mode, BARD1 acts in a heterodimeric BARD1-induced apoptosis; and (3) BARD1 induced apo- complex with BRCA1 and is involved in DNA repair and ptosis in BRCA1-deficient cells. Thus, BRCA1 is not cell survival. In the death mode, BARD1 acts indepen- required for apoptosis induction by BARD1. Our results dently of BRCA1 and induces apoptosis. Thus, ac- even indicate that the interaction of BRCA1 with BARD1 cording to this model, the ratio of BRCA1 and BARD1 reduces apoptosis induction, as BARD1-induced apo- expressed in a given cell would determine cell fate; a ptosis is diminished by cotransfection of BRCA1 but high BRCA1/BARD1 ratio would lead to DNA repair and enhanced in BRCA1-deficient cells. survival, while a low ratio would lead to cell death. This The BRCA1-dependent decrease of BARD1-induced model would be compatible with the observed expres- apoptosis raises some intriguing questions concerning sion of BARD1 but not BRCA1 under conditions where recently published results. Brca1-deficient mice are em- cell death occurs, e.g., stroke (see above) and the estrus bryonic lethals (reviewed in Hakem et al., 1998) but can phase of the uterine cycle (Irminger-Finger et al., 1998). be rescued through elimination of p53 (Ludwig et al., It would also be compatible with the observed develop- 1997). Similarly, Brca1 delta11/delta11 mice are rescued ment of a premalignant phenotype in vitro (Irminger- from lethality by elimination of one p53 allele (Xu et al., Finger et al., 1998) and tumorigenesis (Yoshikawa et al., 2001). Thus, does the proapoptotic activity of BARD1 2000) under conditions of reduced BARD1 levels. BARD1 Signaling toward p53-Mediated Apoptosis 1265

Experimental Procedures primers were designed to amplify region 1840 through 2360 of the BARD1 cDNA, and p53 primers were designed to amplify region Cerebral Ischemia 118 through 310 of the p53 cDNA sequence. The p53 coding se- Cerebral ischemia was induced in the right brain hemisphere of quence was cloned by RT-PCR from TAC-2 cells (GenBank acces- C57BL/6 mice by medium cerebral artery occlusion (MCAO) as de- sion number AY044188). scribed (Martinou et al., 1994). Mice were sacrificed at 1, 3, 7, and 14 days after MCAO, and their brains were prepared for immunohis- Quantification of Apoptosis tochemistry and Western blots. Protein extracts from brain tissue Apoptosis was monitored by several criteria, including changes in of the right and left hemisphere were prepared separately. cellular morphology observed by light microscopy and nuclear morphology observed after DAPI staining; DNA laddering was performed Western Blotting and Immunoprecipitation with Quick Apoptotic DNA Laddering Kit (Biosource International), For Western blots, protein extracts from tissues or cell cultures were annexin V staining and TUNEL assays were performed with kits from prepared in standard lysis buffer (150 mM NaCl, 0.1% SDS, 50 mM Molecular Probes, and analyses were carried out on DAKO Galaxy Tris [pH 8.0], and 2 mM EDTA [pH 8.0]) and analyzed by Western pro flow cytometer. Caspase-3 activity tests were performed with blotting using anti-p53 (Santa Cruz FL-393), anti-BARD1 PVC (Ir- kits from Molecular Probes and analyzed on a multilabel counter minger-Finger et al., 1998), N-19, and C-20 (Santa-Cruz sc-7373), Victor from Perkin Elmer (Switzerland). or anti-␤-tubulin (Beohringer) antibodies. Immunoprecipitation was performed by homogenizing cell samples in 100 ␮l (100Ϫ150 ␮g Acknowledgments total protein) RIPA buffer (150 mM NaCl, 1% NP-40, 0.5% NaDOC, 0.1% SDS, 50 mM Tris [pH 8.0], and 2 mM EDTA [pH 8.0]). Cell This work was supported by a Johnson and Johnson Focused Giving extracts were incubated with agarose-coupled p53 antibodies (Fl grant to I.I.F., grants from the AETAS Foundation to I.I.F. and K.H.K., 393 Santa Cruz) in a 1 to 100 dilution for 2 hr, or BARD1 N-19 and grants from the Swiss National Science Foundation to K.H.K., antibodies in 1 to 100 dilution overnight, followed by incubation with M.D.D. (NCCR), and R.M. We are grateful to J.-C. Irminger, M. Mer- sepharose-bound protein G for 2 hr. Extracts were centrifuged, and cola, and B. Vercher for critical comments on the manuscript. We pellets were washed twice with RIPA buffer and resuspended in are indebted to P. Vallet for MCAO surgery on mice, to F. Gautier 100 ␮l RIPA buffer. 25 ␮l of supernatant and pellet fractions were for generating the BARD1 point mutation Q564H, and to N. Molnarfi analyzed by Western blotting. Total protein content in supernatant for technical support. In particular, we thank Beverly Koller for pro- and pellet fractions was compared by Ponceau S staining after viding Brca1Ϫ/Ϫ and David Lane for providing p53Ϫ/Ϫ embryonic stem protein transfer and was 90% to 10% at least. Antibody reactive cells. bands were visualized, scanned, and quantified using Imagequant. Received March 13, 2001; revised July 11, 2001. Doxorubicin Treatment and UV Exposure TAC-2, ES, or HeLa cells were grown to subconfluence in 100 mm References Petri dishes, exposed to UV light to reach 2.5 to 10 JmϪ2, and cultured for another 3 hr at 37ЊC before harvesting. Doxorubicin (10, Aprelikova, O., Pace, A.J., Fang, B., Koller, B.H., and Liu, E.T. (2001). 50, 100 ␮g/ml) was added to the culture medium for 6 to 12 hr BRCA1 is a selective co-activator of 14–3-3 sigma gene expression before harvesting for apoptosis tests. in mouse embryonic stem cells. J. Biol. Chem. 276, 25647–25650. Ayi, T.C., Tsan, J.T., Hwang, L.Y., Bowcock, A.M., and Baer, R. Flow Cytometry (1998). Conservation of function and primary structure in the BRCA1- Cells were permeabilized and fixed with CytoFix (Pharmingen), and associated RING domain (BARD1) protein. Oncogene 17, 2143– incubated with anti-BARD1 antibodies and FITC-coupled secondary 2148. antibodies for flow cytometric analysis on a Galaxy Pro flow cyto- Bienstock, R.J., Darden, T., Wiseman, R., Pedersen, L., and Barrett, meter (Dako, Switzerland). J.C. (1996). Molecular modeling of the amino-terminal zinc ring domain of BRCA1. Cancer Res. 56, 2539–2545. Generation of Expression Clones and Cell Lines Buller, R.E., Lallas, T.A., Shahin, M.S., Sood, A.K., Hatterman-Zogg, BARD1 expression clone was produced by cloning the coding se- M., Anderson, B., Sorosky, J.I., and Kirby, P.A. (2001). The p53 quence of the mouse BARD1 cDNA (Irminger-Finger et al., 1998) mutational spectrum associated with BRCA1 mutant ovarian cancer. into the KpnI and NotI sites of pcDNA3. The Q564H mutation was Clin. Cancer Res. 7, 831–838. generated with Quick Change Site-directed mutagenesis kit (Stra- Corbet, S.W., Clarke, A.R., Gledhill, S., and Wyllie, A.H. (1999). P53- tagene). The murine BRCA1 cDNA, a generous gift of G. Lenoir, was dependent and -independent links between DNA-damage, apopto- cloned into the pcDNA3 vector. sis and mutation frequency in ES cells. Oncogene 18, 1537–1544. Transfections were performed reproducibly with transfecten (Qia- gen). 1 to 4 ␮g of DNA was transfected per 100 mm Petri dish. Ferenczy, A. (1993). Ultrastructure of the normal menstrual cycle. Transfection efficiency was between 20 and 30% as assayed by Microsc. Res. Tech. 25, 91–105. parallel transfection of GFP cloned into pcDNA3 and analyzed by Freemont, P.S. (2000). RING for destruction? Curr. Biol. 10, 84–87. flow cytometry and fluorescence microscopy. Gautier, F., Irminger-Finger, I., Gregoire, M., Meflah, K., and Harb, J. (2000). Identification of an apoptotic cleavage product of BARD1 Generation of BARD1 Antisense and Ribozyme Cell Lines as an autoantigen: a potential factor in the antitumoral response The ribozyme-carrying mouse ES cells were generated by polyclonal mediated by apoptotic bodies. Cancer Res. 60, 6895–6900. selection for neomycin resistance, using a BARD1-specific ribozyme Greenblatt, M.S., Chappuis, P.O., Bond, J.P., Hamel, N., and (Irminger-Finger et al., 1998). As control for nonspecific ribozyme Foulkes, W.D. (2001). TP53 mutations in breast cancer associated effects, mouse ES cells were transfected with an irrelevant ribo- with BRCA1 or BRCA2 germ-line mutations: distinctive spectrum zyme (riboNox4). The mouse mammary gland cell clone TAC-2/ABI, and structural distribution. Cancer Res. 61, 4092–4097. which expresses BARD1 antisense RNA (Irminger-Finger et al., 1998) also reduces BARD1 expression by 50 to 60%. The p53-deficient ES Hakem, R., de la Pompa, J.L., and Mak, T.W. (1998). Developmental cells were a generous gift of Alain Clarke and were described before studies of Brca1 and Brca2 knock-out mice. J. Mammary Gland (Lakin and Jackson, 1999). Brca1-deficient ES cells were generously Biol. Neoplasia. 7, 431–445. provided by the laboratory of B. Koller (Aprelikova et al., 2001). Harkin, D.P., Bean, J.M., Miklos, D., Song, Y.H., Truong, V.B., Englert, C., Christians, F.C., Ellisen, L.W., Maheswaran, S., Oliner, J.D., and RT-PCR Haber, D.A. (1999). Induction of GADD45 and JNK/SAPK-dependent Total RNA was prepared from cell cultures with Qiagen purification apoptosis following inducible expression of BRCA1. Cell 97, kits. RT-PCR (Perkin Elmer) was performed in simultaneous one- 575–586. step or in two-step reactions, leading to identical results. BARD1 Hashizume, R., Fukuda, M., Maeda, I., Nishikawa, H., Oyake, D., Molecular Cell 1266

Yabuki, Y., Ogata, H., and Ohta, T. (2001). The RING heterodimer Identification of a RING protein that can interact in vivo with the BRCA1-BARD1 is an ubiquitin ligase inactivated by a breast cancer- BRCA1 gene product. Nat. Genet. 14, 430–440. derived mutation. J. Biol. Chem. 276, 14537–14540. Xu, X., Qiao, W., Linke, S.P., Cao, L., Li, W.M., Furth, P.A., Harris, Honda, R., Tanaka, H., and Yasuda, H. (1997). Oncoprotein MDM2 C.C., and Deng, C.X. (2001). Genetic interactions between tumor is a ubiquitin ligase E3 for tumor suppressor p53. FEBS Lett. 420, suppressors Brca1 and p53 in apoptosis, cell cycle and tumorigene- 25–27. sis. Nat. Genet. 28, 266–271. Irminger-Finger, I., Soriano, J.V., Vaudan, G., Montesano, R., and Yoshikawa, K., Ogawa, T., Baer, R., Hemmi, H., Honda, K., Yamauchi, Sappino, A.P. (1998). In vitro repression of Brca1-associated RING A., Inamoto, T., Ko, K., Yazumi, S., Motoda, H., et al. (2000). Abnormal domain gene, Bard1, induces phenotypic changes in mammary epi- expression of BRCA1 and BRCA1-interactive DNA-repair proteins thelial cells. J. Cell Biol. 143, 1329–1339. in breast carcinomas. Int. J. Cancer 88, 28–36. Kleiman, F.E., and Manley, J.L. (1999). Functional interaction of Accession Numbers BRCA1-associated BARD1 with polyadenylation factor CstF-50. Science 285, 1576–1579. The accession number for p53 cDNA expressed in mouse mammary Kleiman, F.E., and Manley, J.L. (2001). The BARD1-CstF-50 interac- epithelial cell line TAC-2 is AY044188. tion links mRNA 3Ј end formation to DNA damage and tumor suppression. Cell 104, 743–753. Lakin, N.D., and Jackson, S.P. (1999). Regulation of p53 in response to DNA damage. Oncogene. 18, 7644–7655. Ludwig, T., Chapman, D.L., Papaioannou, V.E., and Efstratiadis, A. (1997). Targeted mutations of breast cancer susceptibility gene homologs in mice: lethal phenotypes ofBrca1, Brca2, Brca1/Brca2, Brca1/p53, and Brca2/p53 nullizygous embryos. Genes Dev. 11, 1226–1241. Martinou, J.C., Dubois-Dauphin, M., Staple, J.K., Rodriguez, I., Frankowski, H., Missotten, M., Albertini, P., Talabot, D., Catsicas, S., Pietra, C., et al. (1994). Overexpression of BCL-2 in transgenic mice protects neurons from naturally occurring cell death and experimental ischemia. Neuron 13, 1017–1030. Meza, J.E., Brzovic, P.S., King, M.C., and Klevit, R.E. (1999). Mapping the functional domains of BRCA1. Interaction of the ring finger domains of BRCA1 and BARD1. J. Biol. Chem. 274, 5659–5665. Miki, Y., Swensen, J., Shattuck-Eidens, D., Futreal, P.A., Harshman, K., Tavtigian, S., Liu, Q., Cochran, C., Bennett, L.M., Ding, W., et al. (1994). A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science 266, 66–71. Reedy, M.B., Hang, T., Gallion, H., Arnold, S., and Smith, S.A. (2001). Antisense inhibition of BRCA1 expression and molecular analysis of hereditary tumors indicate that functional inactivation of the p53 DNA damage response pathway is required for BRCA-associated tumorigenesis. Gynecol. Oncol. 81, 441–446. Rodriguez, M.S., Desterro, J.M., Lain, S., Lane, D.P., and Hay, R.T. (2000). Multiple C-terminal lysine residues target p53 for ubiquitin- proteasome-mediated degradation. Mol. Cell. Biol. 20, 8458–8467. Scheffner, M., Huibregtse, J.M., Vierstra, R.D., and Howley, P.M. (1993). The HPV-16 E6 and E6-AP complex functions as a ubiquitin- protein ligase in the ubiquitination of p53. Cell 75, 495–505. Scully, R., and Livingston, D.M. (2000). In search of the tumour- suppressor functions of BRCA1 and BRCA2. Nature 408, 429–432. Scully, R., Chen, J., Ochs, R.L., Keegan, K., Hoekstra, M., Feunteun, J., and Livingston, D.M. (1997). Dynamic changes of BRCA1 subnuclear location and phosphorylation state are initiated by DNA damage. Cell 90, 425–435. Sionov, R.V., and Haupt, Y. (1999). The cellular response to p53: the decision between life and death. Oncogene 18, 6145–6157. Soriano, J.V., Pepper, M.S., Nakamura, T., Orci, L., and Montesano, R. (1995). Hepatocyte growth factor stimulates extensive development of branching duct-like structures by cloned mammary gland epithelial cells. J. Cell Sci. 108, 413–430. Thai, T.H., Du, F., Tsan, J.T., Jin, Y., Phung, A., Spillman, M.A., Massa, H.F., Muller, C.Y., Ashfaq, R., Mathis, J.M., et al. (1998). Mutations in the BRCA1-associated RING domain (BARD1) gene in primary breast, ovarian and uterine cancers. Hum. Mol. Genet. 7, 195–202. Thangaraju, M., Kaufmann, S.H., and Couch, F.J. (2000). BRCA1 facilitates stress-induced apoptosis in breast and ovarian cancer cell lines. J. Biol. Chem. 275, 33487–33496. Wu, L.C., Wang, Z.W., Tsan, J.T., Spillman, M.A., Phung, A., Xu, X.L., Yang, M.C., Hwang, L.Y., Bowcock, A.M., and Baer, R. (1996). 2. Nuclear-cytoplasmic translocation of BARD1 is linked to its apoptotic activity Jefford CE, Feki A, Harb J, Krause KH, Irminger-Finger I. Oncogene. 2004 Apr 29; 23(20):3509-20. The work performed in this report is a continuation of the previous paper in that it defines the region necessary for induction of apoptosis. According to our previous results, we know that BARD1 can induce apoptosis in transient transfection experiments. In order to identify the BARD1 protein domain or region responsible for triggering the apoptotic response, we constructed a series of deletion mutants of BARD1. We then analysed their capacity to induce apoptosis by TUNEL assay, DNA laddering assays and morphometric measurements and assessed their nuclear localization by immunohistochemistry, by epi-fluorescence microscopy of GFP- tagged BARD1 deletion recombinants. We demonstrated in particular that the minimal region required for inducing apoptosis maps to a region that does not contain a functional domain, which lies in between the ankyrin repeats and the BRCT domain. Surprisingly, this region, comprising the amino acids 510-604, coincides with 2 presumed cancer predisposition mutations C557S and Q564H and correlates with the tumour suppressor function of BARD1. In contrast with previous reports which stipulated an exclusive localization of BARD1, we showed that BARD1 localizes to the cytoplasm in vitro and in vivo. Furthermore, we showed by using a BARD1-EGFP fusion and BARD1-EGFP deletion proteins that BARD1 localizes to the cytoplasm in spite of several predicted nuclear localizing signal sequences (NLSs). Finally, we showed that apoptosis is concomitant with enhanced cytoplasmic localization of BARD1, as well as the appearance of a p67 cleavage product. The electron microscopy (EM) images were obtained by Jean Harb, and the western blot and the immunohistochemistry performed by Anis Feki.

Nuclear–cytoplasmic translocation of BARD1 is linked to its apoptotic activity

Charles Edward Jefford1, Anis Feki1, Jean Harb2, Karl-Heinz Krause1 and Irmgard Irminger-Finger*,1

1Biology of Aging Laboratory, Department of Geriatrics, University of Geneva, 1225 Geneva, Switzerland; 2Institut de Biologie, INSERM U419, 9 quai Moncousu, 44035 Nantes Ce´dex 03, France

The tumor suppressor protein BARD1 plays a dual role in by upregulation of BARD1. Thus, BARD1 serves as a response to genotoxic stress: DNA repair as a BARD1– mediator between proapoptotic stress signals and p53- BRCA1 heterodimer and induction of apoptosis in a dependent apoptosis. In line with its tumor suppressor BRCA1-independent manner. We have constructed a function, depletion of BARD1 protein in vitro through series of BARD1 deletion mutants and analysed their antisense BARD1 mRNA or ribozyme expression, cellular distribution and capacity to induce apoptosis. As annihilates p53 upregulation and apoptotic response to opposed to previous studies suggesting an exclusively stress and leads to genomic instability and a premalig- nuclear localization of BARD1, we found, both in tissues nant phenotype (Irminger-Finger et al., 1998, 2001; and cell cultures, nuclear and cytoplasmic localization of Soriano et al., 2000). BARD1 is implicated in a number BARD1. Enhanced cytoplasmic localization of BARD1, of other functions most of them dependent on its as well as appearance of a 67 kDa C-terminal proteolytic interaction with the tumor suppressor protein BRCA1, cleavage product, coincided with apoptosis. BARD1 of which it is the major binding partner in a yeast two- translocates to the nucleus independently of BRCA1. hybrid screen (Wu et al., 1996). For recruitment to nuclear dots, however, the BRCA1- BRCA1 and BARD1 heterodimerize through their interacting RING finger domain is required but not respective N-terminal RING finger domains (Meza et al., sufficient. Protein levels of N-terminal RING finger 1999). Association of the C64G mutation within the N- deletion mutants were much higher than those of full- terminal RING finger of BRCA1 with familial breast length BARD1, despite comparable mRNA levels, sug- and ovarian cancer (Wu et al., 1996; Ruffner et al., 2001) gesting that the N-terminal region comprising the RING suggests a relevant function for the BRCA1–BARD1 finger is important for BARD1 degradation. Sequences interaction in tumor suppression. Structural analysis of required for apoptosis induction were mapped between the the BARD1–BRCA1 heterodimeric complex by NMR ankyrin repeats and the BRCT domains coinciding with (Brzovic et al., 2001b) and mutational analysis demon- two known cancer-associated missense mutations. We strated that abolishing heterodimer formation (Morris suggest that nuclear and cytoplasmic localization of et al., 2002) results in genomic instability, uncontrolled BARD1 reflect its dual function and that the increased cell proliferation and tumorigenesis (Baer, 2001; Parvin, cytoplasmic localization of BARD1 is associated with 2001). apoptosis. Evidence for BARD1/BRCA1 heterodimer formation Oncogene (2004) 23, 3509–3520. doi:10.1038/sj.onc.1207427 in vivo comes from the observation that BARD1 Published online 12 April 2004 colocalizes with BRCA1 and the repair protein Rad51 in nuclear dots during S phase (Jin et al., 1997) and to Keywords: BARD1; BRCA1; apoptosis; nuclear export; nuclear foci in response to DNA damage (Scully et al., protein stability; RING 1997b). Mutations in the RING finger of BRCA1, disrupting BRCA1/BARD1 interactions, annihilate the formation of nuclear foci (Chiba and Parvin, 2002; Fabbro et al., 2002), which suggests that the interaction Introduction with BARD1 is required for this localization. A recent report shows that BARD1 plays a role as A function of BARD1 in a pathway of stress-induced chaperone for the correct translocation of BRCA1 into signaling towards apoptosis was discovered previously the nucleus (Fabbro et al., 2002). Deletion of the (Irminger-Finger et al., 2001). Overexpression of BRCA1-RING domain leads to exclusion of BRCA1 BARD1 inducing apoptosis in a number of cell lines, from the nucleus, and a BRCA1 mutant lacking NLS, and genotoxic stress triggering apoptosis is accompanied but retaining the RING domain structure, is translocated to the nucleus by BARD1 overexpression. Most importantly, the binding of BARD1 inhibits the nuclear *Correspondence: I Irminger-Finger; E-mail: [email protected] export of BRCA1 by masking its nuclear export signal Received 22 July 2003; revised 20 November 2003; accepted 2 December (NES) (Brzovic et al., 2001a; Fabbro et al., 2002). Since 2003; Published online 12 April 2004 more than 75% of all BRCA1 is complexed with Nuclear–cytoplasmic translocation of BARD1 CE Jefford et al 3510 BARD1 (Baer and Ludwig, 2002), BARD1 plays an spleen, a BRCA1-associated function of BARD1 could important role in trapping BRCA1 within the nucleus. be expected, as well as a function in apoptosis. We Whether BARD1 itself depends on other proteins for applied immunohistochemistry to detect the BARD1 entering and exiting the nucleus has not been protein in the spleen. BARD1 staining was observed in determined. the red pulp and the white pulp, both regions known for The BRCA1/BARD1 heterodimer exhibits ubiquitin the high turnover of lymphocytes (Figure 1a). The ligase activity, which is abolished by mutations within intracellular localization of BARD1 was both nuclear the RING finger domain of BRCA1 (Hashizume et al., and cytoplasmic and in some cells exclusively 2001; Chen et al., 2002). BARD1 supports the associa- cytoplasmic (Figure 1a). tion of BRCA1 with Polymerase II holoenzyme, a It was interesting to determine the intracellular suspected target of BARD1/BRCA1 ubiquitylation, localization of BARD1 in tissues where BARD1 is which is abrogated by a deletion of the BRCA1-RING upregulated in response to cellular stress. In the brain, finger domain (Chiba and Parvin, 2002). Furthermore, no BARD1 expression can be found normally but the stability of BARD1 and BRCA1 proteins themselves maximum BARD1 expression is observed in the regions might be controlled by ubiquitylation (Mallery et al., adjacent to the stroke induced by ischemia (Irminger- 2002; Xia et al., 2003). Besides degradation, ubiquityla- Finger et al., 2001), in the penumbra, where apoptosis tion can act as a regulator of nuclear–cytoplasmic has been described (Ferrer and Planas, 2003). Immuno- shuttling, as described for the nuclear export of p53 (Gu histochemisty on mouse brain sections after ischemia et al., 2001; Lohrum et al., 2001). A similar mechanism demonstrates that the intracellular localization of might exist in the case of BARD1 and BRCA1, in BARD1 is rather cytoplasmic than nuclear (Figure 1b). particular since BARD1 and BRCA1 become ubiquiti- nylated upon association (Chen et al., 2002). It was suggested that nuclear–cytoplasmic shuttling has functional implications since BARD1 and BRCA1 are less prone for degradation when bound together but their dissociation after ubiquitylation could lead to nuclear export and degradation (Fabbro and Henderson, 2003). In addition to its interaction with BRCA1, BARD1 associates with a number of other proteins involved in different functions (Irminger-Finger and Leung, 2002), all of which imply a nuclear localization such as mRNA polyadenylation factor CstF50 (Kleiman and Manley, 1999; Kleiman and Manley, 2001), the NFK-B regulator oncoprotein Bcl-3 (Dechend et al., 1999), the complex containing BRCA1 and CtIP (Yu and Baer, 2000), and the Ewing’s sarcoma protein EWS (Spahn et al., 2002). BARD1 structurally relates to BRCA1, as it contains N-terminal RING finger and C-terminal BRCT domains (Wu et al., 1996; Ayi et al., 1998); however, novel functions of BARD1 might relate to its ankyrin repeats, which are found in proteins with very diverse functions, and to regions without known protein motifs. Here, we report that BARD1 is found in the nucleus and the cytoplasm and that its apoptotic function is associated with its cytoplasmic localization. Furthermore, by mapping the regions responsible for intracellular localization or required for its apoptotic function, using an enhanced green fluorescent protein (EGFP), tagged to the C-terminal end of full-length BARD1 or various deletion variants, we demonstrate their respective dynamic intracellular localization and the correlation of cytoplasmic localization and apoptotic activity.

Figure 1 In vivo localization of BARD1. (a) BARD1 staining on Results sections of mouse spleen using anti BARD1 N-19 and PVC antibodies. BARD1 can be localized to the red pulp and white pulp (magnification 10). Intracellular localization is observed with Cytoplasmic localization of BARD1 both antibodies. Bar 100 mm. (b) BARD1 staining (anti-BARD1 N- 19) is shown in a mouse brain after ischemia. Penumbra region is The tissues with the highest expression of BARD1 and shown in overview in ( 4.5). BARD1 staining is cytoplasmic in BRCA1 mRNAs are spleen and testis (Wu et al., 1996; most cases, as exemplified by arrows in higher magnifications in Ayi et al., 1998; Irminger-Finger et al., 1998). In the ( 40). Bar 100 mm

Oncogene Nuclear–cytoplasmic translocation of BARD1 CE Jefford et al 3511 Strong evidence for cytoplasmic localization of BARD1 protein is the observed staining of protrusions of neuronal cells (Figure 1b). Control staining without primary antibody or in the presence of antigenic peptide did not produce staining (not shown). Antibodies against the N-terminal and the C-terminal portion of the protein present the same distribution. These data suggest that in vivo, apoptosis, occurring physiologically or induced upon stress, is accompanied by a cytoplasmic localization of BARD1, and that the apoptotic function of BARD1 might be conﬁned to the cytoplasm.

Subcellular distribution of BARD1 in vitro Previous reports stipulate that BARD1 is found in nuclear extracts and localizes to BRCA1 foci in the nucleus during the S phase (Jin et al., 1997; Scully et al., 1997a) and to distinct intranuclear foci upon genotoxic stress (Scully et al., 1997a). To explore the dynamics of BARD1 localization at various stages of the cell cycle and apoptosis, immunofluorescent staining and electron microscopy (EM) were performed on NIH 3T3 cells (Figure 2). Immunoreactivity with anti-BARD1 antibodies results in a punctuate staining in the nucleus of interphase cells but diffuse staining in the cytoplasm as well (Figure 2a). Similar results were obtained when BARD1 protein localization was assayed in other cell lines (TAC2, HEK 293T, HeLa) and when other antibodies (N-19, C-20, H300) were used (Figure 2b). Enhanced staining of BARD1 in nuclear dots is obtained by confocal microscopy. By EM, immunor- Figure 2 Cytoplasmic and nuclear localization of BARD1 in vitro. eactive dots of BARD1 were identified in the nucleus (a) Indirect immunofluorescent staining of BARD1 protein in NIH3T3 cells using anti-BARD antibody (PVC). Interphase cells and with similar frequency in the cytoplasm (Figure 2c) show immunoreactive dots in the nucleus and the diffuse staining in corroborating the data obtained by immunofluores- the cytoplasm. In mitotic cells, BARD1 is excluded from the cence. Interestingly, we also observed that cells progres- chromatin. Nuclear staining with DAPI of identical field is shown. sing through mitosis accumulate higher levels of Bar 10 mm. (b) Immunofluorescent staining of HeLa cells with BARD1 than G1 or S-phase cells. BARD1 is excluded various anti-BARD1 antibodies (PVC, C-20, N-19, H-300) show nuclear dots and cytoplasmic staining. (c) EM photomicrograph of from the condensed chromatin during metaphase– an interphase cell. BARD1 reactive dots are evenly dispersed in the anaphase stages of mitosis (Figure 2a). This localization cytoplasm and the nucleus. EM image of an early mitotic cell shows of BARD1 contrasts with the reported binding of that BARD1 reactive dots are excluded from the condensed BRCA1 to the centrosomes during mitosis (Hsu and chromatin White, 1998; Deng, 2002; Lotti et al., 2002). Our data suggest that BARD1 might have a specific function in the cytoplasm, and that BARD1 is not engaged in functions associated with the centrosomal location of BRCA1. fraction values add up to 47.8% implying a possible role for BARD1 within the cytoplasm. Human BARD1 has Intracellular localization of BARD1-EGFP and BARD1- six putative NLS sequences and a higher prediction EGFP deletion mutants score for the nucleus of 82.6%. In order to ascertain BARD1’s intracellular localiza- Mouse BARD1 has three putative NLS sequences tion and to determine which domains of BARD1 or located close to or within each functional domain which NLS are necessary for nuclear import, we (Figure 3a): NLS1 -RKKNSIKMWFSPRSKKV- start- generated either EGFP-tagged full-length mouse ing at position 130, NLS2 -PARKRNH- at 408 and BARD1 or deletion mutants (Figure 3a). Constitutive NLS3 -RKPK- at 693. When applying Reinhardt’s expression of EGFP-BARD1 fusion proteins was method (http://psort.nibb.ac.jp/) for the prediction of obtained under the transcriptional control of the CMV nuclear localization with a reliability coefficient of promoter. To determine the localization of BARD1- 94.1%, the prediction for intracellular localization for EGFP or deletion mutants, we transfected the BARD1- mouse BARD1 has a 52.2% score for the nucleus, EGFP plasmids in various cell lines and monitored their 30.4% for the mitochondria, 13% for the cytoplasm and localization by fluorescent microscopy at different time a 4.3% for the cytoskeleton. Together the cytosolic points (12–30 h) after transfection. The intracellular

Oncogene Nuclear–cytoplasmic translocation of BARD1 CE Jefford et al 3512 distribution of all BARD1-EGFP fusion proteins differed greatly from the nuclear and cytoplasmic localization of EGFP alone (Figure 3b). The analysis of a number of 8–12 microscopic fields from at least three independent transfection experiments at 24 h after transfection (Figure 3c), showed that full-length BARD1-EGFP locates to the nucleus more frequently (76%) than to the cytoplasm (24% of the cases). Surprisingly, the D-RING-EGFP and D-HIND-EGFP, which lack the first NLS at position 130, but also lack the BRCA1-interacting RING finger domain, exhibited a most pronounced preference for the nucleus. Interest- ingly, D-RING-EGFP, which localized exclusively to the nucleus, never aggregates within nuclear dots during the S phase. The RING domain by itself when fused to EGFP localizes evenly to the cytoplasm and nucleus, as did ANK-EGFP (Figure 3b). Both constructs have only a single NLS. Most interestingly, the C-terminal deletion, D-BRCT-EGFP, localized almost exclusively to the nucleus and formed distinct speckles within the nucleus, as did the full-length BARD1-EGFP. These data indicate that the nuclear localization of BARD1 is independent of BRCA1, since the BARD1 deletion constructs lacking the RING finger have even increased nuclear localization. However, the aggregation within nuclear dots might depend on BRCA1, since neither D- RING-EGFP nor D-HIND-EGFP, or ANK-EGFP concentrate on nuclear dots. The N-terminal region containing the BRCA1 interaction domain might be required but not sufficient for BARD1 localization to nuclear dots.

Mapping of apoptotic function of BARD1 While the function of the conserved RING finger domain is well described, less contributions have been made to elucidate the functional significance of the ankyrin repeats, the BRCT domains, or the intervening sequences. To determine the proapoptotic region of BARD1 and to investigate whether any of the conserved sequence motifs was involved, we analysed the induction of apoptosis by BARD1 deletion mutants missing either RING finger, ankyrin, or BRCT domain (Figure 4). Maximal induction of apoptosis, as tested by DNA laddering (Figure 4a) and TUNEL staining (Figure 4b), Figure 3 Subcellular localization of EGFP-tagged BARD1 was observed only with the full-length BARD1 con- deletion mutants. (a) Schematic representation of mouse BARD1 struct. Efficient induction of apoptosis was observed and BARD1-EGFP fusion proteins. Relative positions of mouse with a variety of deletion mutants (Figure 4c), namely BARD1 functional domains (RING, green, ANKYRIN, blue, and BRCT, red), and three NLS (blue) are indicated. Schematic deletion of the BARD1 C-terminal BRCT domains (D- diagram of the various deletion mutants of BARD1 fused to the BRCT), of the region comprising the ankyrin repeats (D- EGFP. (b) Merge of DNA stain DAPI and epifluorescent images of ANK), of the N-terminal domain comprising the RING HEK-293T shows subcellular localization of transfected BARD1- finger (D-RING), or the deletion of N-terminal and the deletion mutants tagged with EGFP 30 h post transfection. (c) Intracellular localization of BARD1 and deletion mutants. 293-T C-terminal regions (ANK2). One mutant was devoid of cells were transfected with BARD1-EGFP mutants and fixed in apoptosis-inducing activity, namely of the construct PFA 2%. Histograms show distribution of cells displaying either expressing the BARD1 N-terminus, RING. From these nuclear (N), nuclear þ cytoplasmic (NC), or cytoplasmic localiza- experiments, it can be concluded that the region tion. Statistics of localization of EGFP fluorescence was performed sufficient for apoptosis induction includes sequences on eight different randomized fields under fluorescent microscope. Results from at least three different experiments were pooled to from amino acid 316 through 604 and that a minimal give significant numbers of transfected cells region required for apoptosis induction comprises sequences from amino acid 510 through 604.

Oncogene Nuclear–cytoplasmic translocation of BARD1 CE Jefford et al 3513

Figure 4 Mapping of the apoptotic domain of BARD1. Apoptosis induction, as observed 48 h post transfection in TAC2 cells, was monitored of BARD1 and deletion mutants. (a) BARD1 and BARD1-deletion mutants induce DNA laddering and apoptosis, except deletion mutant RING lacking aa 316–777 (excluding the ANKYRIN and BRCT domains). (b) Apoptotic cells were quantiﬁed by TUNEL assay. FITC-positive cells were counted by ﬂow cytometry. (c) Schematic presentation of BARD1 and regions expressed on deletion constructs is presented. Red bracket indicates minimal required region for apoptosis induction. Position of cancer associated missense mutations are indicated (Thai et al., 1998; Ghimenti et al., 2002)

To demonstrate that apoptosis induction was directly early time points after transfection (24–48 h) the due to the expression of BARD1, we determined the frequency of apoptosis was lower for D-RING-EGFP, apoptosis inducing capacity of BARD1-EGFP and D-HIND-EGFP, and D-BRCT-EGFP than for other BARD1 deletion mutants fused to EGFP in transient deletion mutants or for BARD1-EGFP, and at all times transfection assays in TAC-2 cells. With comparable insignificantly low for EGFP and RING-EGFP. transfection efficiencies, the overexpression of the exogenous BARD1-EGFP proteins induces morpholo- Cytoplasmic localization of BARD1 during apoptosis gic changes and nuclear fragmentation, which is not observed with cells transfected with control plasmid Since endogenous and exogenous expression of BARD1 EGFP only or in nontransfected cells. All constructs is found in both the nucleus and cytoplasm, it was comprising the minimal apoptotic region led to apop- speculated that the apoptotic function of BARD1 was tosis induction after transient transfection. Staining with correlated with its cytoplasmic localization as observed DNA dye DAPI demonstrates that apoptotic cells, for other gene products of the apoptotic pathway recognized by their nuclear fragmentation, are clearly (Conus et al., 2000). When individual cells were correlated with cells expressing EGFP fusion proteins in monitored after transient transfection with BARD1- the case of BARD1-EGFP, D-RING-EGFP, D-BRCT- EGFP, it was observed that the EGFP-tagged BARD1, EGFP, and ANK-EGFP, while expression of EGFP, or or truncated BARD1, D-RING-EGFP, was translo- RING-EGFP was not correlated with apoptosis cated from the nucleus to the cytoplasm during (Figure 5). Inspection of random fields showed that at apoptosis (Figure 6a). This was specifically pronounced

Oncogene Nuclear–cytoplasmic translocation of BARD1 CE Jefford et al 3514

Figure 5 Apoptosis induction by EGFP-tagged BARD1 and BARD1-deletion mutants. (a) Epifluorescence images, merged with DNA stain DAPI, of TAC-2 cells transfected with the full-length or the various deletion-bearing BARD1-EGFP plasmids. Cells were fixed and stained with DAPI 48 h after transfection. Constructs used for transfection were as described in Figure 3. Nuclear fragmentation in EGFP positive cells is observed for all BARD1 EGFP fusion constructs except for RING-EGFP. Apoptosis progression of EGFP-positive cells was correlated with intensity of EGFP stain. (b) Percentage of GFP-positive apoptotic cells in transcient transfection assays. Six microscopic fields of two to three independent transfection assays were analysed. GFP-positive apoptotic cells were determined based on nuclear morphology. Percentages of apoptotic cells are presented

in cells transfected with D-RING-EGFP that after hypothesis that excess of BARD1 over BRCA1 could transfection is located exclusively to the nucleus. To lead to cytoplasmic localization of BARD1 and initiation demonstrate that exogenous BARD1 D-RING-EGFP of the apoptotic pathway (Irminger-Finger et al., 2001). and endogenous BARD1 were both translocated from To further address the apoptosis-related translocation the nucleus to the cytoplasm during apoptosis, immuno- of BARD1, its distribution between nucleus and fluorescence microscopy was performed on cells trans- cytoplasm was assayed after treatment with the apop- fected transiently with D-RING-EGFP. Staining with tosis inducing drug doxorubicin, both by immunofluor- anti-BARD1 antibodies (PVC) directed against the escence microscopy and Western blotting. MCF7 cells RING domain (Irminger-Finger et al., 1998) demon- were analysed with or without doxorubicin treatment. In strates that D-RING-EGFP, not recognized by anti- untreated cells, BARD1 protein levels are very low but BARD1-PVC, first localized to the nucleus, then at later higher in the nucleus than in the cytoplasm; upon stages of apoptosis is translocated to the cytoplasm, apoptosis, overall BARD1 levels are increased, but the while endogenous BARD1, detected with anti-BARD1 distribution of BARD1 between the nucleus and antibody PVC, is still localized to nuclear dots. At late cytoplasm is inversed (Figure 7a). Interestingly, BRCA1 stages of apoptosis, both exogenous and endogenous remains localized to nuclear dots after doxorubicin BARD1 are found mostly excluded from the nucleus treatment, as observed by staining with anti-BRCA1 (Figure 6b). This observation is consistent with the antibodies (Figure 7a).

Oncogene Nuclear–cytoplasmic translocation of BARD1 CE Jefford et al 3515

Figure 6 BARD1-EGFP translocates to the cytoplasm during apoptosis. (a) NIH3T3 cells transfected with D-RING-EGFP are monitored at different time points after transfection. FITC ﬂuorescence is extruded from the nucleus. (b) Comparison of endogenous and exogenous EGFP-tagged BARD1 location, D- RING-EGFP mutant is presented. Endogenous BARD1 was detected with anti-BARD1 antibody PVC reacting with the BARD1 N-terminal region (Irminger-Finger et al., 1998), which is omitted in D-RING-EGFP. Merge of EGFP signal (FITC) and anti-BARD1 signal (rhodamin) images shows that both the Figure 7 Endogenous BARD1 translocates to the cytoplasm exogenous and the endogenous BARD1 are translocated from during apoptosis. (a) BARD1 staining is shown in MCF-7 cells. the nucleus to the cytoplasm in cells that are undergoing apoptosis. BARD1 is localized primarily to the nucleus in untreated cells and An early (arrow) and a late (arrow head) apoptotic cell are shown translocates to the cytoplasm after UV exposure. Note that low levels of BARD1 in untreated cells were visualized by overexposure of the image. UV exposure was as described previously (Irminger- Finger et al., 2001). BRCA1 staining was performed with anti- To investigate BARD1 translocation after doxorubi- BRCA1 antibody 5-MO. (b) Western blot analysis of nuclear versus cytoplasmic extracts in NIH3T3 cells following exposure to cin treatment biochemically, protein extracts from cells doxorubicin in a time-dependent manner shows increased expres- treated with doxorubicin were prepared and nuclear and sion of BARD1 during apoptosis and demonstrates the appearance cytoplasmic fractions were analysed on Western blots of a different truncated form of BARD1 found in the cytoplasm. (Figure 7b). To follow the translocation of BARD1 to Antibodies used were C-20 (Santa Cruz) recognizing a C-term the cytoplasm after BARD1-induced apoptosis, we epitope (** represents the 97 kDa isoform and * the 67 kDa.) monitored BARD1 expression in cytoplasmic and nuclear fractions at different time points after treatment. Using antibodies against different regions of BARD1, we observed that full-length 97 kDa BARD1 concentra- accumulates during apoptosis due to cleavage by the tions were increased at early time points after treatment caspase-dependent kinase calpain (Gautier et al., 2000). with doxorubicin, and decreased at later time points. Analysis of nuclear and cytoplasmic extracts demon- Apoptotic function of BARD1 regulated through protein strates that the concentration of BARD1 in the nucleus stability is increased during 6 h of doxorubicin treatment and then decreased. In the cytoplasm, however, BARD1 of It was observed that BARD1-EGFP and EGFP-tagged 97 kDa is slightly increased and a protein of 67 kDa is deletion constructs did not give rise to identical protein massively increased after 5 h of treatment. These data expression levels of the fusion products after transfec- could be explained with the following hypothesis: tion. To investigate whether the differences observed BARD1 levels increase after apoptosis induction, but were due to differences in transcriptional activity, the excess BARD1 translocates to the cytoplasm and is regulation of translation, or protein stability, we cleaved and gives rise to the stable C-terminal 67 kDa monitored the expression of BARD1-EGFP and of fragment. The appearance of a C-terminal 67 kDa BARD1 deletion mutants on the level of mRNA and BARD1 cleavage product is consistent with the previous protein expression (Figure 8a–c). RT–PCR was per- report that a truncated 67 kDa product of BARD1 formed using primers directed against EGFP and

Oncogene Nuclear–cytoplasmic translocation of BARD1 CE Jefford et al 3516 expression levels after transfection of EGFP-tagged constructs appeared to vary. Western blots were probed with antibodies against GFP in cell extract collected 24 h after transfection. Probing of protein extracts after transfection of the various BARD1 expression constructs exhibited signiﬁcant differences in expression levels. Highest expression was observed for D-RING- EGFP, less for D-HIND-EGFP and ANK-EGFP, very little for full-length BARD1-EGFP, which was compensated by increasing the protein concentration for BARD1-EGFP loaded on the gel (Figure 8c). Repeat- edly, a C-terminal cleavage product could be detected more readily with anti-GFP antibodies than full-length BARD1-EGFP, suggesting that BARD1 and BARD1 deletion mutants that comprise the N-terminal region of BARD1 are prone for degradation.

Discussion

Nuclear–cytoplasmic distribution of BARD1 The general idea that BARD1 is a nuclear protein is based exclusively on in vitro studies. We have investigated the localization of BARD1 in tissues. In particular, we were interested to determine the intracellular localization of BARD1 in tissues where apoptosis Figure 8 Differential stability of BARD1 and BARD1 deletion occurs, either physiologically or induced. Our results proteins. (a) RT–PCR analysis of cell extracts after transfection with plasmids as indicated. Primers were against two different demonstrate that BARD1 is localized to both the regions of BARD1 or against EGFP. Similar amounts of mRNA nucleus and the cytoplasm in vivo. We further explored were amplified from cells transfected with the various transcripts. the localization of BARD1 in a variety of cell lines The RING-EGFP construct can only be detected with the EGFP in vitro. Both immunofluorescence and electromicro- primers. To visualize loading differences, two different volumes were loaded. (b) In vitro transcription and translation of BARD1 scopy revealed that endogenous BARD1 resides in the and deletion bearing constructs. Plasmids were transcribed and nucleus and the cytoplasm. Using EGFP-tagged translated (with S-35 labeled methionine) in vitro, and analysed by BARD1 and BARD1 deletion mutants, we confirmed PAGE. All constructs gave rise to comparable amounts of protein. that all BARD1 deletion proteins were translocated to (c) Western blot analysis of whole-cell extracts of cells transfected the nucleus, but a variable proportion of the proteins with the aforementioned BARD1-EGFP-fusion plasmids and probed with an anti-EGFP (TP-401) antibody. Expression of full was also detected in the cytoplasm. These data contrast length was reduced compared to N-terminal deletion mutants and with previous reports showing that BARD1 is localized was loading was fivefold increased. Full-length BARD1-EGFP and exclusively to the nucleus colocalizing with BRCA1 in D-RING-EGFP give rise to a degradation product that comigrates discreet dots during the S phase (Scully et al., 1997a). It with D-HIND-EGFP. Triangles indicate proteins with expected size for each fusion protein on the left (for EGFP and ANK- is possible that in human cells with human BARD1, EGFP) and on the right side (for D-HIND-EGFP, BARD1-EGFP, which has six NLS, the propensity of nuclear localiza- and D-RING-EGFP) tion is higher than that for mouse BARD1, which has only three putative NLS. All BARD1-EGFP fusion proteins, described here, are translocated to the nucleus, against BARD1. The mRNA expression levels of full- indicating that a single NLS sequence is sufficient for the length BARD1-EGFP and of the diverse BARD1- correct addressing of BARD1 to the nucleus. The EGFP deletion mutants were compared by using differential intracellular localization of the EGFP- primers either covering different regions of the mouse tagged constructs may be correlated with the number BARD1 coding sequence or directed against the GFP of NLS present within each specific construct. Interest- portion of the fusion proteins. The mRNA levels were ingly, the BARD1-RING finger motif is not required for similar in all observed cases (Figure 8a), indicating that nuclear localization, and nuclear localization of BARD1 mRNA expression levels were directly correlated to the is therefore independent of BRCA1. In fact, it has been concentration of plasmid DNA transfected. shown that on the contrary BRCA1 requires BARD1 To test protein translation potential of the various for entering and remaining in the nucleus, and this is constructs, in vitro transcription/translation was per- dependent on the BRCA1-RING domain (Fabbro et al., formed to monitor protein stability in vitro. Full-length 2002). Furthermore, we demonstrate that the BRCT- BARD1 and deletion mutants were transcribed and deletion mutant of BARD1 localizes to specific nuclear translated into protein with similar efficiency, although dots, as does full-length BARD1, but not the RING slightly elevated levels of protein were obtained with the domain by itself, suggesting that RING is not sufficient D-RING construct (Figure 8b). However, protein for localization of BARD1 in nuclear dots.

Oncogene Nuclear–cytoplasmic translocation of BARD1 CE Jefford et al 3517 An alternative localization of BARD1 occurs during apoptosis. BARD1 and a truncated form of BARD1, p67 BARD1, appears in the cytoplasm during apoptosis. This isoform of BARD1 represents the C-terminal portion of the protein, recognized by antibodies directed against 50 C-terminal amino acids. A 67 kDa C-terminal truncated form of BARD1 was reported previously to be generated during apoptosis in various cell lines through cleavage by the caspase-dependent protease calpain (Gautier et al., 2000). The p67 protein observed in the cytoplasmic fraction is consistent with the accumulation of the p67 BARD1 cleavage product in apoptotic tumor cells (Gautier et al., 2000).

Apoptosis is triggered by overexpression of a minimal required region of BARD1 Figure 9 Model of BARD1 cytoplasmic translocation. BARD1 Overexpression of all forms of BARD1-EGFP and enables BRCA1 to be transported to the nucleus. Excess BARD1 is deletion mutants, with the exception of the RING- translocating to the cytoplasm more readily. However, full-length BARD1 might be exported and degraded. BARD1 degradation EGFP construct, induced apoptosis, based on TUNEL depends on the presence of the RING structure. A C-terminal and DNA fragmentation assays, and visualized by the fragment, p67 BARD1, presumably due to proteolytic cleavage, is condensed and fragmented nuclear morphology as stable and found in the cytoplasm. p67 BARD1 is no binding compared to the EGFP control. Furthermore, using partner for BRCA1 but has apoptotic activity deletion mutants of BARD1, a minimal region required for triggering apoptosis could be determined. As observed with the overexpression of full-length BARD1, 2002). Possibly, the BARD1-RING domain is a target cells transfected with BARD1-EGFP, or BARD1- for protein degradation by the ubiquitin pathway, as deletion mutants cannot be cultured over time due to speculated for BRCA1 (Fabbro and Henderson, 2003), the apoptotic effect of the fusion proteins. The minimal and BARD1–BRCA1 may target excess BARD1 for region required for the apoptotic function comprises the degradation, but BARD1–BRCA1 dimer formation pro- sequence between the end of the ankyrin repeats and the tects from degradation. Furthermore, it was also hypo- beginning of the BRCT domain. Interestingly, this thesized that ubiquitylation could act as nuclear export region harbors two point mutations (C557S and signal, as it is the case for p53 (Gu et al., 2001; Lohrum Q564H) associated with tumors of the breast, ovary, et al., 2001), and that BARD1 influences the nuclear and uterus (Thai et al., 1998; Ghimenti et al., 2002). In export of BRCA1, which is controlled by ubiquitylation line with these findings, we have previously reported (Fabbro and Henderson, 2003). The observation of that the mutant Q564H when used in transient BARD1 translocation to the cytoplasm, together with transfections is less efficient in apoptosis induction than its described degradation, suggests that BARD1 trans- full-length BARD1 (Irminger-Finger et al., 2001). Taken location could be based on the ubiquitylation, specifi- together, these data suggest that the primary tumor cally since BARD1 does not have an NES on its own. suppressor function of BARD1 is linked to its BRCA1- independent function in inducing apoptosis. The model derived from these observations It was suggested that the BRCA1/BARD1/Polymerase Protein stability is increased in the absence of the RING II holoenzyme complex is the sensor for double- domain stranded DNA breaks while arresting the cell in S phase When expression of BARD1-EGFP or the tagged fusion for repair mechanisms to occur (Parvin, 2001). Accord- proteins was monitored on Western blots, the protein ing to our model (Figure 9), BARD1 may be the key levels varied according to the specific plasmid construct molecule that could trigger the cell-cycle block as a and despite identical transfection conditions and iden- BARD1–BRCA1 complex and apoptosis through an tical plasmid DNA concentrations used. Interestingly, increase of BARD1. Initiation of apoptosis is accom- BARD1-EGFP, RING-EGFP and D-BRCT-EGFP panied by BARD1 cleavage and accumulation of a constructs showed increased susceptibility for degrada- stable C-terminal cleavage product, which might repre- tion. However, BARD1 protein stability appears to be sent an irreversible decision for apoptosis. BRCA1 may increased in the absence of the RING domain. recruit BARD1 to activate ubiquitylation of the Poly- Consistent with this observation, all BARD1-EGFP merase II holoenzyme, and provoking its degradation deletion-mutants that bear the RING finger domain through the proteasome pathway. BRCA1 was sug- have lower expression levels than the mutants lacking gested to be liberated from BARD1 at later stages the RING domain. One possible explanation for the (Fabbro and Henderson, 2003), although it is not clear degradation of these fusion proteins is the reported what triggers the separation of BARD1 and BRCA1. In ubiquitylation activity of the RING domain (Chen et al., case of a high ratio of BARD1/BRCA1, the excess

Oncogene Nuclear–cytoplasmic translocation of BARD1 CE Jefford et al 3518 BARD1 is found in the cytoplasm and might be (Irminger-Finger et al., 1998) was used to generate the degraded, but the cleavage mechanism that eliminates following constructs in pcDNA3 behind a CMV promoter: the N-terminal sequences including the RING domain (1) full-length BARD1 (aa 1–765); (2) DRING (aa 137–765) produces a stable C-terminal portion of BARD1. This using the EcoRI(396) restriction site; (3) DBRCT (aa 1–604) p67 cleavage product of BARD1 is mimicked by the ScaI(1812); (4) DANK (aa 1–316/510–765) Stu/Hpa; (5)ANK2 (aa 316–604) StuI/ScaI; (6) RING (aa 1–266) EcoRI. The deletion mutant D-RING. Since D-RING retains plasmid pEGFP-N1 (Enhanced Green Fluorescent Protein) apoptotic activity, it is likely that the cleaved form of was purchased from Clontech and was used to generate either BARD1 has an apoptotic function. Most importantly, the full-length BARD1-EGFP or BARD1 deletion bearing both the BARD1 cleavage product p67 and D-RING are mutants fused in frame with the EGFP tag. The following devoid of the RING finger and seem more resistant inserts were ligated in frame with the EGFP: (1); (2); (3); (6) against degradation. Therefore the cleavage of BARD1 and (7) DHIND (aa 394–765); (8) ANK (aa 316–604). during apoptosis could provide a positive regulatory feedback loop upon apoptosis induction. Transfection and whole-cell extract preparation In conclusion, BARD1 has at least five different Cells were seeded in 10 cm Petri dishes and transfected with functions in binding to BRCA1, all of which are 2 mg of DNA using the Effectene reagents by Qiagen. Cells disrupted by mutations that effect the interaction of were harvested at 18, 24 and 48 h post-transfection. They were BRCA1with BARD1: (1) tumor suppression and genetic centrifuged and washed once in PBS, resuspended in 0.3 ml of instability (Wu et al., 1996; Ruffner et al., 2001), (2) ice-cold radio immunoprecipitation assay (RIPA) buffer colocalization in nuclear dots upon genotoxic stress (150 mM NaCl, 1% Nonidet P-40, 0.5% NaDOC, 0.1% (Scully et al., 1997a, b), (3) nuclear translocation of SDS, 50 mM Tris, pH 8.0, 2 mM EDTA, pH 8.0) and BRCA1 (Fabbro et al., 2002), (4) ubiquitin ligase supplemented with protease inhibitors (1 mM PMSF, 3 mg/ml activity of the BARD1/BRCA1 heterodimer (Hashi- aprotinin, 10 mg/ml leupeptin)). Cells were incubated on ice for g zume et al., 2001; Chen et al., 2002), (5) recruiting of 30 min. The extracts were centrifuged at 13 000 in a microcentrifuge for 15 min at 41C in order to remove cell Polymerase II holoenzyme (Chiba and Parvin, 2002). debris and clear the cell lysate. The localization of BARD1 in nuclear dots requires RING domain, but also the additional domains that Nuclear and cytoplasmic fractions might promote binding of other proteins than BRCA1, since the BARD1-RING domain by itself does not For separation of cytosolic fraction, cells were incubated in localize to nuclear dots. It could be concluded, that full- Lysis Buffer (Triton X-100 (1%), HEPES pH 7.6. (50 mM), length BARD1 might be required for BRCA1-depen- NaCl (150 mM), NaF (100 mM), Na-pyrophosphate (50 mM), EDTA (4 mM), Na3VO4 (10 mM)) supplemented with protease dent functions associated with nuclear localization, but inhibitors (as above) and rotated at 41C for 30 min. Super- a C-terminal portion of BARD1 is sufficient for natant was separated from nuclear fractions by centrifugation apoptotic activity, associated with cytoplasmic localiza- at 13 000 r.p.m. for 15 min. The pellet was washed in the Wash tion (Figure 9). Buffer (Lysis Buffer þ 25% glycerol) and centrifuged once more as above. The supernatant wash was added to cytosolic fraction. Nuclear fraction was lysed in the nuclear lysis buffer Materials and methods (NLB) (Wash Buffer with 330 mM NaCl), sonicated, incubated on ice for 30 min and centrifuged as above to separate cell Cell cultures debris from nuclear fraction. TAC-2 cells is a clonal subpopulation derived from the Western blots NMuMG normal murine mammary gland epithelial cell line (CRL 1636; American Type Culture Collection, Rockville, In vitro transcription/translation products were obtained using MD, USA). They were cultured in collagen-coated tissue a kit from Promega. Equal concentrations of all in vitro culture dishes in high-glucose DMEM supplemented with 10% transcription/translation, whole-cell extracts as well as cyto- fetal calf serum (FCS), penicillin (110 mg/ml) and streptomycin solic and nuclear fractions per gel were loaded onto SDS–PAA (110 mg/ml). The Human Embryonic Kidney HEK 293T cell gels according to Laemmli’s protocol and were transferred to line, as well as HeLa cell lines, were obtained from the polyvinylidene fluoride (PVDF) membranes. All primary American Tissue Type Culture Collection. NIH-3T3 and antibodies were incubated at room temparature (RT) at MCF-7 cell lines were purchased from the NIH (Bethesda, indicated dilutions for 1 h in TBS/5% nonfat dry milk and MD, USA). All cell lines were cultured in 10 cm plastic tissue washed five times 3 min in TBS/0.1% Tween 20. Secondary culture dishes (NUNC, Roskilde, Denmark) and incubated at HRP-conjugated antibodies were incubated at a 1 : 2000 371C in humidified air containing 5% CO2. Adherent dilution (Santa Cruz) at RT for 1 h, and bands were revealed subcultures were detached from culture dishes using a solution using the Enhanced Chemiluminescence (ECL) system by of Trypsin/EDTA in HBSS without Ca2 þ or Mg2 þ . Subcon- Boehringer. fluent cell cultures were passaged regularly at 1 : 10 dilution twice a week. All cell culture media, solutions, buffers and Antibodies antibiotics were purchased from GIBCO (Invitrogen AG, Basel, Switzerland). The anti-BARD1 (N-19, C-20, H-300), and anti-p53 (FL-393) antibodies were purchased from Santa Cruz. Anti-BRCA1 (5- MO) was a generous gift from Dr A Vincent and G Lenoir. Plasmid constructions Anti-GFP (TP-401) was purchased from Chemokine (Torrey Two sets of deletion mutants were generated with and without Pines Biolabs, Houston, TX, USA)). PVC is a previously the EGFP fusion tag. The full-length mouse cBARD1 described anti-BARD1 antibody (Irminger-Finger et al., 1998).

Oncogene Nuclear–cytoplasmic translocation of BARD1 CE Jefford et al 3519 Secondary conjugated antibodies to horseradish peroxidase immunocytochemical staining. The endogenous peroxidase (HRP) were purchased from Santa Cruz and were compatible was quenched by 15-min incubation in 2% hydrogen peroxide with Cruz Molecular Weight Markers (Santa Cruz, CA, USA). in PBS. Unmasking of the epitopes was carried out by boiling the deparaffinized rehydrated sections for 10 min (two times, Assessment of apoptosis 5 min each) in 10 mM citrate buffer, pH 6.0, using a microwave oven at 5000 W power output. Primary antibodies were used in Cells were harvested 48 h post transfection. Trypsinized cells a 1 : 50 dilution. were centrifuged and washed once with PBS prior assay. Quantification of apoptosis was measured by performing TUNEL assay, using the APO-DIRECT kit (Pharmingen). Immunogold labeling and silver enhancement for EM At least 10 000 events were measured on a flow cytometer from Cells were fixed with 3% freshly depolymerized paraformalde- DAKO corporation and analysed using the software package hyde and 0.15%. glutaraldehyde in 0.1 M phosphate buffer FlowMax from PARTEC. Assessment of DNA fragmentation (PB) pH 7.2 for 1 h at room temperature. They were then was performed with Suicide-Track DNA isolation kit (Onco- permeabilized with PB containing 0.1% Triton X-100. The gene) and DNA ladders were stained with ethidium bromide immunostaining was then performed using ultrasmall gold on 1% agarose gels. conjugates and R-Gent SE-EM silver enhancement reagent using the Aurion Kit (Biovalley, Marne-la-Valle´ e, France) as Fluorescence microscopy indicated by the manufacturer. Primary antibody used was C- Cells were seeded on glass coverslips in 6-well culture dishes or 20 diluted at 1/100. After immunostaining, the cells were plated on an 8-well coverslide and transfected or not with the postfixed for 1 h at 41C with osmium tetraoxide buffered at pH aforementioned plasmids. Cells were washed in HBSS, and 7.2 with symmetric collidin. After two washes in the same either fixed 2% paraformaldehyde (PFA) in Hank’s balanced buffer, the preparations were dehydrated through a series of salt solution (HBSS) 15 min at RT or in methanol for 6 min at graded ethanol and propylene oxide, and the pellets embedded 201C and rinsed in acetone for 30 s. Coverslides were in Epon 812 medium. Ordinary thin sections were then cut mounted and observed under a Nikon epi-fluorescence with a Reichert ultramicrotome, stained with uranyl acetate microscope and images captured with a 3.3 mega-pixel CCD and lead citrate, or left unstained. All sections were then camera and processed with MetaMorph software (Visitron). examined and photographed under a JEM electron microscope. Tissue preparation for immunohistochemistry Two adult male mice Balb/c were used in this part of the study. This study was conducted according to the rules written by the Note added in proof Swiss veterinary office (Bern). The animals were killed by cervical dislocation. After the animals were killed, the thoracic Coincidentally, our results are corroborated by similar findings aorta was cannulated and the vasculature flushed with sodium (Rodriguez et al., 2003) published recently in this journal as chloride solution (0.9 g/l). The fixation was performed by our article was undergoing final revision. perfusion with 2% glutaraldehyde and 2% paraformaldehyde in 0.05 M phosphate buffer, pH 7.4. Acknowledgements This work was supported by Swiss National Science Founda- Immunohistochemistry tion grant to IIF and KHK, and Johnson & Johnson and The immersion-fixed mouse brain and spleen were embedded AETAS awards to IIF. We are grateful to Dr Gilbert LeNoir in paraffin. Consecutive orthogonal 5 mm sections were and Dr Anne Vincent for the generous gift of the BRCA1 mounted on polylysine-coated slides. Sections were counter- antibody, Dr Monica Sauer for discussing with us unpublished stained with hematoxylin/eosin (HM). The first section of each observations, Dr Wai-Choi Leung for critical comments on the set of sections was stained HM and used to determine tubule manuscript, and Aure´ lie Caillon for excellent technical stages. The remaining sections were further processed for support.

References

Ayi TC, Tsan JT, Hwang LY, Bowcock AM and Baer R. Deng CX. (2002). Oncogene, 21, 6222–6227. (1998). Oncogene, 17, 2143–2148. Fabbro M and Henderson BR. (2003). Exp. Cell Res., 282, Baer R and Ludwig T. (2002). Curr. Opin. Genet. Dev., 12, 59–69. 86–91. Fabbro M, Rodriguez JA, Baer R and Henderson BR. (2002). Baer R. (2001). Nat. Struct. Biol., 8, 822–824. J. Biol. Chem., 277, 21315–21324. Brzovic PS, Meza JE, King MC and Klevit RE. (2001a). Ferrer I and Planas AM. (2003). J. Neuropathol. Exp. Neurol., J. Biol. Chem., 276, 41399–41406. 62, 329–339. Brzovic PS, Rajagopal P, Hoyt DW, King MC and Klevit RE. Gautier F, Irminger-Finger I, Gregoire M, Meﬂah K and Harb (2001b). Nat. Struct. Biol., 8, 833–837. J. (2000). Cancer Res., 60, 6895–6900. Chen A, Kleiman FE, Manley JL, Ouchi T and Pan ZQ. Ghimenti C, Sensi E, Presciuttini S, Brunetti IM, Conte P, (2002). J. Biol. Chem., 277, 22085–22092. Bevilacqua G and Caligo MA. (2002). Genes Chromosomes Chiba N and Parvin JD. (2002). Cancer Res., 62, 4222–4228. Cancer, 33, 235–242. Conus S, Rosse T and Borner C. (2000). Cell Death Differ., 7, Gu J, Nie L, Wiederschain D and Yuan ZM. (2001). Mol. Cell. 947–954. Biol., 21, 8533–8546. Dechend R, Hirano F, Lehmann K, Heissmeyer V, Ansieau S, Hashizume R, Fukuda M, Maeda I, Nishikawa H, Oyake D, Wulczyn FG, Scheidereit C and Leutz A. (1999). Oncogene, Yabuki Y, Ogata H and Ohta T. (2001). J. Biol. Chem., 276, 18, 3316–3323. 14537–14540.

Oncogene Nuclear–cytoplasmic translocation of BARD1 CE Jefford et al 3520 Hsu LC and White RL. (1998). Proc. Natl. Acad. Sci. USA, 95, Parvin JD. (2001). Proc. Natl. Acad. Sci. USA, 98, 5952–5954. 12983–12988. Rodriguez JA, Schuchner S, Au WW, Fabbro M and Irminger-Finger I and Leung WC. (2002). Int. J. Biochem. Cell Henderson BR. (2003). Oncogene. Biol., 34, 582–587. Ruffner H, Joazeiro CA, Hemmati D, Hunter T and Verma Irminger-Finger I, Leung WC, Li J, Dubois-Dauphin M, Harb IM. (2001). Proc. Natl. Acad. Sci. USA, 98, 5134–5139. J, Feki A, Jefford CE, Soriano JV, Jaconi M, Montesano R Scully R, Chen J, Ochs RL, Keegan K, Hoekstra M, Feunteun and Krause KH. (2001). Mol. Cell, 8, 1255–1266. J and Livingston DM. (1997a). Cell, 90, 425–435. Irminger-Finger I, Soriano JV, Vaudan G, Montesano R and Scully R, Chen J, Plug A, Xiao Y, Weaver D, Feunteun J, Sappino AP. (1998). J. Cell Biol., 143, 1329–1339. Ashley T and Livingston DM. (1997b). Cell, 88, 265–275. Jin Y, Xu XL, Yang MC, Wei F, Ayi TC, Bowcock AM and Soriano JV, Irminger-Finger I, Uyttendaele H, Vaudan G, Baer R. (1997). Proc. Natl. Acad. Sci. USA, 94, Kitajewski J, Sappino AP and Montesano R. (2000). Adv. 12075–12080. Exp. Med. Biol., 480, 175–184. Kleiman FE and Manley JL. (1999). Science, 285, 1576–1579. Spahn L, Petermann R, Siligan C, Schmid JA, Aryee DN and Kleiman FE and Manley JL. (2001). Cell, 104, 743–753. Kovar H. (2002). Cancer Res., 62, 4583–4587. Lohrum MA, Woods DB, Ludwig RL, Balint E and Vousden Thai TH, Du F, Tsan JT, Jin Y, Phung A, Spillman MA, KH. (2001). Mol. Cell. Biol., 21, 8521–8532. Massa HF, Muller CY, Ashfaq R, Mathis JM, Miller DS, Lotti LV, Ottini L, D’Amico C, Gradini R, Cama A, Belleudi Trask BJ, Baer R and Bowcock AM. (1998). Hum. Mol. F, Frati L, Torrisi MR and Mariani-Costantini R. (2002). Genet., 7, 195–202. Genes Chromosomes Cancer, 35, 193–203. Wu LC, Wang ZW, Tsan JT, Spillman MA, Phung A, Xu XL, Mallery DL, Vandenberg CJ and Hiom K. (2002). EMBO J., Yang MC, Hwang LY, Bowcock AM and Baer R. (1996). 21, 6755–6762. Nat. Genet., 14, 430–440. Meza JE, Brzovic PS, King MC and Klevit RE. (1999). J. Biol. Xia Y, Pao GM, Chen HW, Verma IM and Hunter T. (2003). Chem., 274, 5659–5665. J. Biol. Chem., 278, 5255–5263. Morris JR, Keep NH and Solomon E. (2002). J. Biol. Chem., Yu X and Baer R. (2000). J. Biol. Chem., 275, 18541–18549. 277, 9382–9386.

Oncogene 3. BARD1 expression during spermatogenesis is associated with apoptosis and hormonally regulated Feki A, Jefford CE, Durand P, Harb J, Lucas H, Krause KH, Irminger-Finger I. Biol Reprod. 2004 Nov; 71(5):1614-24. Since we know that BARD1 expression is high and necessary during embryogenesis and in testis, we investigated the expression pattern of BARD1 at the mRNA and protein levels during spermatogenesis in rat testis. In this study, we showed that BARD1 is expressed at all stages of spermatogenesis. This fact contrasts with BRCA1 which is only expressed in meiotic spermatocytes and early round spermatids. While spermatogonia expressed full-length BARD1 mRNA, later stage spermatocyte precursors express predominantly a novel, shorter splice variant BARD1β. This BARD1β form lacks the RING finger domain, which abrogates its interaction with BRCA1, but conserves its apoptosis-inducing capabilities. Furthermore, it is well known that apoptosis is necessary to regulate the overproduction of early germ cells in testis. Therefore, in order to assess the role of BARD1 and apoptosis in testis, we monitored the expression pattern of BARD1 with that of apoptotic markers such as BAX, active caspase-3, and DNA fragmentation on histological sections of rat testis. We found that BARD1 expression correlates with apoptosis as indicated by BAX and active caspase-3 coincidental spatial and temporal expression. Furthermore, we tested and showed the ability of BARD1β splice variant to trigger apoptosis in vitro by transient over-expression. Finally, we show that elevated BARD1 protein expression correlates with testis pathologies such as obstructive azoospermia, cryptorchidy and Sertoli cell syndromes. My contribution consisted in providing the BARD1-EGFP constructs, performing the transfections, some of the western blot as well as some technical help on apoptosis assays are shown in Figures 3 and 5.

73 BIOLOGY OF REPRODUCTION 71, 1614±1624 (2004) Published online before print 7 July 2004. DOI 10.1095/biolreprod.104.029678

BARD1 Expression During Spermatogenesis Is Associated with Apoptosis and Hormonally Regulated1

Anis Feki,3,4 Charles-Edwards Jefford,3 Philippe Durand,5 Jean Harb,6 Herve´ Lucas,4 Karl-Heinz Krause,3 and Irmgard Irminger-Finger2,3 Biology of Aging Laboratory,3 Department of Geriatrics, Department of Gynecology and Obstetrics,4 University Hospitals, CH-12225 Geneva, Switzerland INSERM-INRA U 418,5 Hoˆpital Debrousse, Lyon, 69322 Cedex 05, France Institut de Biologie,6 INSERM, U419 Nantes, France

ABSTRACT cells is balanced by selective apoptosis [1, 2]. In the adult rat, A2±4 spermatogonia and spermatocytes undergo apo- The BRCA1-binding RING-finger domain protein BARD1 may ptosis [2, 3], thus maintaining a constant number of cells act conjointly with BRCA1 in DNA repair and in ubiquitination, but it may also induce apoptosis in a BRCA1-independent man- entering meiosis. Spontaneous germ cell apoptosis can be ner. In this study, we have investigated BARD1 expression during enhanced after various insults, including testicular injuries, spermatogenesis. In contrast with BRCA1, which is expressed withdrawal of hormonal support [4, 5], radiation [6], toxi- only in meiotic spermatocytes and early round spermatids, cant [7, 8] and heat exposure [9]. Hence, whether male BARD1 is expressed during all stages of spermatogenesis. How- germ cells survive or die is determined by a complex net- ever, while spermatogonia expressed full-length BARD1 mRNA, work of signals. These include paracrine signals such as later stages of spermatocyte precursors express predominantly stem cell factor (SCF), leukemia inhibitory factor (LIF), a novel, shorter splice form BARD1␤. BARD1␤ lacks the and desert hedgehog (Dhh), as well as endocrine signals BRCA1-interacting RING finger but maintains its proapoptotic such as pituitary gonadotrophs and testosterone [10]. Like activity. Consistently, BRCA1 can counteract the proapoptotic other cell types, male germ cells respond to external signals activity of full-length BARD1 but not of BARD1␤. Several lines and their internal milieu by activating intracellular signaling of evidence suggest that BARD1 is involved in proapoptotic sig- pathways that ultimately determine their fate [10]. naling in testis: i) both BARD1 isoforms are mostly found in cells In the adult rat, the rate of spontaneous apoptosis extends that stain positive for TUNEL, Bax, and activated caspase 3; ii) to 75% and occurs mostly in spermatogonia [11±13]. Ap- BARD1␤, capable of inducing apoptosis even in the presence of optotic signaling pathways lead to caspase 3 activation and BRCA1, is specifically expressed in BRCA1-positive later stages of spermatogenesis; iii) antiapoptotic hormonal stimulation involve Bax and Apaf1 or the FasL/Fas and FADD [14]. leads to BARD1 downregulation; and iv) BARD1 expression is Expression of p53 was also reported in spermatogonia and associated with human pathologies causing sterility due to in- early meiotic prophase cells associated with DNase I ex- creased germ cell death. Our data suggest that full-length pression and commitment for apoptosis [15]. The upregu- BARD1 might be involved in apoptotic control in spermatogonia lation of p53 might either lead to the repair of DNA by and primary spermatocytes, while a switch to the BRCA1-inde- inducing cell cycle arrest or apoptosis by activating the pendent BARD1␤ might be necessary to induce apoptosis in proapoptotic gene Bax, a pathway well described in sper- BRCA1-expressing meiotic spermatocytes and early round spermatogenesis [16]. matids. BARD1, a protein that interacts with p53 in vitro [17], apoptosis, BARD1, BRCA1, FSH, infertility, meiosis, spermato- originally identi®ed as binding partner for BRCA1 [18], is genesis, splicing, steroid hormones, testosterone also implicated in the apoptotic pathway involving p53 [17]. The expression of BARD1 is highly elevated in testis INTRODUCTION [19, 20], suggesting a role of BARD1 in spermatogenesis. The mRNAs of BRCA1 and BARD1 are quite abundant Spermatogenesis entails a complex series of events in in preparations from whole testis [19, 20], and an additional which germ cells proceed through successive rounds of mitosis, meiosis, and cellular differentiation and become ma- 2 kilobase (kb) smaller BARD1 transcript of 2 kb is found ture spermatozoa. Maturation of germ cells is closely linked in testis, but not in other tissues, by Northern blotting. Mea- to Sertoli cells; however, their nourishing and protective surements of BRCA1 mRNA levels in puri®ed somatic function is limited, and the overproduction of early germ cells of the testis and in staged germ cells showed that high- level BRCA1 mRNA expression is limited to the germ cell. 1Supported by focused giving grant from Johnson and Johnson and Swiss Within the germ cell lineage, the high expression was de- National Science Foundation grant to I.I.F. tected in meiotic cells, speci®cally pachytene spermatocytes 2Correspondence: Irmgard Irminger-Finger, Biology of Aging Laboratory, and in postmeiotic round spermatids. In contrast, little or Department of Geriatrics, University of Geneva, 2 ch. Petit-Bel-Air, 1225 no BRCA1 mRNA was found in premeiotic germ cells Chene-Bourg/Geneva, Switzerland. FAX: 41 22 305 5455; [21]. In situ hybridization localized BRCA1 mRNA to early e-mail: [email protected] meiotic prophase spermatocytes [22]. A partial understand- ing of BRCA1 function in meiosis comes from studies on Received: 15 March 2004. meiotic chromosomes where BRCA1 localizes to recom- First decision: 6 April 2004. Accepted: 25 June 2004. bination nodules [23] and the ®nding that Brca1 Ϫ/Ϫ mice ᮊ 2004 by the Society for the Study of Reproduction, Inc. lack crossover during the pachytene stage and fail to enter ISSN: 0006-3363. http://www.biolreprod.org diplotene [24]. 1614 BARD1 IN SPERMATOGENESIS 1615

Although exhaustive studies on the localization and continuous polyacrylamide gels and transferred overnight to polyvinyli- function of BARD1 and BRCA1 proteins during spermato- dene ¯uoride membranes. Filters were blocked for 1 h with 5% nonfat milk and then incubated for 2 h with polyclonal BARD1 antibodies (C20: genesis are not available, portions of the BRCA1 and 1:200; JH3:1:1000). N-19, which was used in immunohistochemistry, did BARD1 proteins localize to the XIST RNA on the inactive not work on Western blots. After washing, membranes were incubated X-chromosome during the pachytene stage [25] and suggest with horseradish-peroxidase-conjugated anti-rabbit antibodies for JH3 con- a function in the maintenance of its repressed state. In this jugated anti-goat antibodies for C20 (1:1000), and the resulting complexes present study, we intend to elucidate the function of were visualized by enhanced chemiluminescence autoradiography. BARD1 in spermatogenesis, including its potential role in apoptosis suggested by earlier studies on BARD1 and Preparation of Sertoli Cell Conditioned Media BRCA1. Sertoli cells were plated in tissue culture ¯asks at a density of 2 ϫ 105 cells/cm2 and were cultured for 3 days in HEPES-buffered F12/DMEM MATERIALS AND METHODS supplemented with insulin (10 ␮g/ml), transferrin (10 ␮g/ml), vitamin C (10Ϫ4 M), vitamin E (10 ␮g/ml), retinoic acid (3.3 ϫ 10Ϫ7 M), retinol (3.3 Tissue Preparation ϫ 10±7 M), pyruvate (1 mM) (all products from Sigma, La VerpillieÁre, France), 0.2% fetal calf serum (Life Technologies, Cergy-Pontoise, France) Two adult male Wistar rats were used in each part of the study. Ani- in the absence or presence of 10Ϫ7 M testosterone (Sigma) and/or 1 ng/ mals were anesthetized, the tunica albuginea of the right testis was incised ml bovine NIH FSH-20 obtained through NIDDK (lot no. AFP-7028D). from the proximal to the distal pole, and the parenchyma was immersion On Day 3, media were replaced by serum-free media supplemented or not ®xed with 10% formaldehyde in 0.1 M phosphate buffer, pH 7.4. The with hormones. On Day 5, culture media were recovered, centrifuged to thoracic aorta was then cannulated and the vasculature ¯ushed with buf- eliminate cell debris, and conserved at Ϫ20ЊC until used. Four Sertoli cell fered sodium chloride before perfusion ®xation of the left and the right conditioned media (SCCM) were prepared: control (no FSH, no testoster- testes with 2% glutaraldehyde and 2% paraformaldehyde in 0.05 M phos- one [FϪ/TϪ]), FSH (1 ng/ml) (Fϩ/TϪ), testosterone 10Ϫ7 M(FϪ/Tϩ), phate buffer, pH 7.4. Procedures relating to the care and use of animals and a combination of both hormones (Fϩ/Tϩ). were approved by the Swiss cantonal veterinary of®ce. Isolation of Rat Sertoli Cells, Pachytene Spermatocytes, Immunohistochemistry Round Spermatids, and Spermatogonia/Preleptotene The immersion-®xed right and left testes were processed for paraf®n Spermatocyte Fractions embedding. Consecutive orthogonal sections (5 ␮m) across the seminiferous tubules were mounted on polylysine-coated slides. The ®rst section Sertoli cells from 20-day-old rats and pachytene spermatocytes and of each set of sections was stained with hematoxylin eosin and used to round spermatids from 90- to 120-day-old rats were isolated as described determine tubule stages. The remaining sections were further processed previously [26]; the purity of these different fractions was assessed by for immunocytochemical staining. The endogenous peroxidase was ¯ow cytometry. In Sertoli cell fractions, 77% Ϯ 1% of the isolated cells quenched by 15 min of incubation in 2% hydrogen peroxide in PBS. were 2C cells, 5.5% Ϯ 1% were 4C cells; in pachytene spermatocyte Unmasking of the epitope was carried out by boiling deparaf®nized re- fractions, 94% Ϯ 3% of cells were 4C cells, 3% Ϯ 2% were 2C cells, and hydrated sections (twice for 5 min) in 10 mM citrate buffer, pH 6.0, using 1% Ϯ 0.5% were 1C cells; in round spermatid fractions, 67.2% Ϯ 5.2% a microwave oven at 5000 W power output. Primary antibodies were as were 1C cells, 10.6% Ϯ 6.6% were 4C cells, and 9.1% Ϯ 1.6% were 2C follows: anti-BARD1 N19 polyclonal antibody (1:20) directed to N-ter- cells. Procedures relating to the care and use of animals were approved minus of BARD1 (Santa Cruz); anti-BARD1 C20 polyclonal antibody (1: by the French Ministry of Agriculture according to the French regulations 20), directed to carboxyl-terminus of BARD1 (Santa Cruz); anti-BARD1 for animal experimentation. JH3 polyclonal antibody (1:20), directed to the amino acids 527±540; anti- Spermatogonia/preleptotene spermatocytes were prepared by centrifu- BRCA1 D16 (1:50), epitope corresponding to the amino-terminus; anti- gal elutriation of germ cells isolated from 21- to 23-day-old rats, which BRCA1 M20 (1:20), directed to the carboxyl terminus; anti-p53 (1:20) do not yet produce round spermatids in their testes. These spermatogonia/ (Santa Cruz), epitope corresponding to amino acids 1±393. Secondary an- preleptotene spermatocytes eluted in the fraction of elutriation in which tibodies were peroxidase coupled and negative controls were processed in round spermatids from mature rats are recovered. In this fraction, 64.8% an identical manner except that the primary antibody was replaced by PBS. Ϯ 7.3% of cells were 2C cells, 29.1% Ϯ 5.4% were 4C cells, and 5.3% Ϯ 2.8% were 1C cells.

Generation of Polyclonal Anti-BARD1 Antibody JH-3 Incubation of Germ Cells in Sertoli Cells Conditioned Peptides were generated corresponding to the region including amino Media acids 527±540 and polyclonal antibodies JH-3 were generated in rabbits. Whole sera were used for Western blotting and immunohistochemistry. Pachytene spermatocytes, round spermatids, spermatogonia/preleptotene spermatocytes were incubated for 24 h in the different conditioned media. At the end of the incubation period, the cells were centrifuged and Reverse Transcription-Polymerase Chain Reaction recovered for RNA extraction. Total RNA was puri®ed from physically isolated rat germ cells of different stages using Qiagen reagent. RNA was reverse transcribed using Generation of BARD1␤ Expression Clone oligo-dT and superscript II (Life Technologies). BARD1 primers used were: 56 forward (ccatggaaccagctaccg) and 2307 reverse (tcagctgtcaagag- BARD1␤ expression clone was produced by cloning the sequence of gaagca). GAPDH primers were 176 forward (CTACCCACGGCA- BARD1␤ PCR product cDNA into pcDNA3-EGFP in frame with EGFP. AGTTCAAT) and 557 reverse (ACTGTGGTCATGAGCCCTTC). Re- Transfections were performed reproducibly with Effecten (Qiagen). verse transcription (RT) products were subjected to PCR analysis using One to 4 ␮g of DNA was transfected per well of mouse embryonic stem speci®c primers for rat BARD1 cDNA (covering BARD1 coding regions). cells, CGR8 [17]. Transfection ef®ciency was between 20% and 30% as assayed by parallel transfection of GFP cloned into pcDNA3 and analyzed PCR cycles were: 94ЊC 15 min, 94ЊC 1 min, 56ЊC 1 min, 72ЊC 2 min 30 by ¯ow cytometry and ¯uorescent microscopy. Thirty-six hours after (35 ϫ), then 72ЊC 10 min. Equal volumes of PCR products were analyzed on 1% agarose gel. transfection, cells were harvested and apoptosis was monitored by 7-AAD viability probe (BD Pharmingen) and TUNEL assay (Molecular Probes) by ¯ow cytometry (DAKO galaxy pro). Western Blot BARD1 expression was monitored by Western blot analysis. Germ RESULTS cells harvested by elutriation were lysed in SDS loading buffer (4% SDS, 10% glycerol, 4% 2-mercaptoethanol, 0.125 M Tris base, and 0.02% brom- BARD1 expression is most abundant in testis, as is the ophenol blue, pH 6.8) containing protease inhibitors. Protein concentra- case for BRCA1 [19, 20]. While the function of BRCA1 tions were determined using Bio-Rad protein analysis solution (Bio-Rad, had been related to meiotic recombination, based on colo- Hercules, CA). Protein samples (40 ␮g) were size separated on 10% dis- calization of BRCA1 with RAD51 to recombination nod- 1616 FEKI ET AL.

FIG. 1. Immunohistology of BARD1 and BRCA1 expression in adult rat testis. A) Seminiferous tubes showing BARD1 staining. BARD1 is present in spermatogonia (a) and preleptotene spermatocytes and pachytene spermatocytes (b). BARD1 antibodies also stain material in Sertoli cell. B) Seminiferous tubes showing BRCA1 staining. BRCA1 expression is predominant at the meiotic pachytene stage (c) and less frequent at the preleptotene stage (d). C) Background staining with omission of primary antibody is shown.

ules [23], the function of BARD1 in spermatogenesis responding to a molecular mass of 97 and 74 kDa, were mains to be elucidated. found on Western blots probed with different antibodies (Fig. 2A). Spermatogonia were prepared from 9-day-old BARD1 Expression Is Not Correlated with BRCA1 rats, at which age spermatogenesis is not induced [27], and Expression spermatogonia but not primary spermatocytes are present. While in spermatogonia from very young rats (9 days), the To determine the cell type and stage-speci®c expression 97-kDa BARD1 was expressed, it was less abundant in of BARD1, we performed immunohistochemistry on sec- preleptotene spermatocytes from young rats (23 days). The tions of testis from adult rats. Interestingly, in the testis of 74-kDa protein was found in pachytene spermatocytes of young adult rats (23 days) BARD1 protein is expressed in young (23 days) and adult rats (3 mo), as well as in round many, but not all, spermatogonia and preleptotene sper- spermatids. Depending on which antibody was used for de- matocytes, and it is less abundant during later stages of tection, the 97-kDa and 74-kDa proteins could be detected spermatogenesis (Fig. 1A). Staining was also observed in at the preleptotene stage. This protein expression pattern some cells at later stages of meiosis and in round sperma- suggests that a shorter isoform of BARD1 is expressed at tids (Fig. 1A). During early stages, BARD1 staining is lo- all stages with the exception of spermatogonia. The 97-kDa calized to the nucleus, but it is also found in the cytoplas- BARD1 was also found in Sertoli cell preparations but mic prolongations of Sertoli cells. The same staining could might be derived from BARD1 staining of residual bodies be observed when different antibodies against the N-ter- phagocytosed by the Sertoli cells (data not shown). Simi- minal region of BARD1 were used. No staining was ob- larly, p53 and Bax immunohistochemical staining on served when the primary BARD1-speci®c antibody was phagocytosed residual apoptotic bodies has been reported omitted (Fig. 1C). However, when JH-3, an antibody di- previously [15, 28]. rected against the middle region of BARD1 was used, spermatogonia showed strong staining but also later stage germ cells were stained. Stage-Speciﬁc BARD1 mRNA Expression Because it could be expected that BARD1 and BRCA1 act in concert during spermatogenesis, we determined the To determine whether stage-speci®c isoforms of BARD1 speci®c stages at which the BRCA1 protein is expressed were generated at the protein or the mRNA level, we in- by immunohistochemistry with anti-BRCA1 antibodies. vestigated BARD1 mRNA expression at different stages of Consistent with previous observations of BRCA1 mRNA spermatogenesis. For this purpose, rat testes were dissected expression, the BRCA1 protein was predominantly detected and differentially-staged germ cells were fractionated [26]. at the pachytene stage and rarely in preleptotene spermato- Total RNA was prepared from each of the isolated cell cytes or spermatogonia (Fig. 1B). These data demonstrate types and RT-PCR was performed to monitor BARD1 that BRCA1 expression is mostly limited to the pachytene mRNA expression pro®les. Primers were designed for am- stage, while BARD1 expression is found in spermatogonia pli®cation of the entire BARD1 coding region. While con- and preleptotene spermatocytes. The elevated expression of trol RT-PCR of the GAPDH shows similar expression lev- BARD1 but not BRCA1 in spermatogonia and primary els in all cell types tested, BARD1 mRNA was found in spermatocytes is indicative of a BRCA1-independent func- spermatogonia and less abundantly in primary spermato- tion of BARD1 in spermatogenesis. cytes and round spermatids. Interestingly, RT-PCR produced two products of slightly different size (Fig. 2B). The primers corresponding to regions of the translation initia- Stage-Speciﬁc Isoforms of BARD1 tion and stop codon were expected to amplify a 2251-base To characterize the expression pattern of BARD1 further, pair (bp) fragment, corresponding to the coding region of isolated cells from different stages of spermatogenesis were wild-type BARD1. This was only found in spermatogonia analyzed on Western blots. Two forms of BARD1, corre- and was less pronounced in preleptotene stages. A fragment BARD1 IN SPERMATOGENESIS 1617 of approximately 2000 bp was ampli®ed in preleptotene and pachytene spermatocytes as well as in round spermatids (Fig. 2B). As observed on the protein level, on the transcript level, two different mRNAs are transcribed in a stage-speci®c fashion, full-length BARD1 in spermatogonia and a shorter form in all stages except spermatogonia. In preleptotene stages, both BARD1 mRNAs and both proteins of 97 and 74 kDa are expressed. This might re¯ect the puri®cation procedure, which does not permit the separation of spermatogonia and preleptotene spermatocytes.

A Testis-Speciﬁc Isoform of BARD1 Is Generated by Differential Splicing

We cloned and sequenced the RT-PCR fragments cor- FIG. 2. Stage-specific expression of BARD1. A) Western blots performed responding to the 2.2-kb and the approximately 2000-bp on cell extracts from purified stages of germ cells: spermatogonia from 9- fragments. The 2.2-kb fragment was identi®ed as 2251 bp day-old rats (G), preleptotene spermatocytes from 23-day-old rats (PL), of full-length rat BARD1 cDNA [29]. The 2000-bp frag- pachytene spermatocytes of 23-day-old rats (Pjr), pachytene spermato- ment encoded a 1964-bp sequence identical to the known cytes of 3-mo-old rats (P), and round spermatids from 3-mo-old rats (RS). rat BARD1 sequence but missing the regions including nu- Two proteins of 97 and 74 kDa can be detected with antibodies JH-3 and C-20, corresponding to the full-length BARD1 protein, 97 kDa, and the cleotides 143±348 and nucleotides 1287±1367. The deleted calculated molecular mass of the testis-specific BARD1␤, which is about sequences are homologous to exons 2 and 3, and 5, re- 74 kDa. B) The mRNA expression in different stages of spermatogenesis. spectively, of the corresponding human BARD1 sequence RT-PCR was performed in isolated germ cells as described in (A). Expected (Fig. 3A). To determine whether the equivalent testis-spe- length of 2251 bp was amplified in G; two bands, 2251 bp and 1964 bp, ci®c isoform, called BARD1␤ hereafter, is unique to the were amplified in samples from PL stage, and 1964 bp in all other stages. rat, RT-PCR was con®rmed on RNA isolated from mouse Control primers were directed against the coding region of housekeeping testis. Cloning and sequencing RT-PCR products showed gene GAPDH. that a similar splice variant exists in the mouse. The abun- dance of mouse BARD1␤ when cloned from total RNA primarily produced positive staining in spermatogonia and from mouse testis was fourfold lower that full-length preleptotene spermatocytes coinciding speci®cally with BARD1 cDNA. Our data suggest that intron-exon bound- anti-BARD1 staining when using antibody N-19 (Fig. 4A). aries are conserved between mouse and human sequences TUNEL staining was also observed at later stages of sper- and that the same intron-exon boundaries are used in hu- matogenesis, in round spermatids, coinciding with BARD1 man, mouse, and rat. staining. Only a few TUNEL positive cells could be de- The missing BARD1 exons 2 and 3 encode part of the tected at the pachytene stage. Therefore, the spatial and RING-®nger structure, and exon 5 encodes one of the an- developmental distribution of BARD1 staining coincides kyrin repeats. However, deletion of nucleotides 143±348 with apoptosis at all stages of spermatogenesis. leads to a frame shift that would result in translation of 46 To further demonstrate the correlation between BARD1 amino acid peptide before ending with a stop codon (Fig. expression and apoptosis induction, we also tested the coex- 3A). Alternatively, ATG at position 389, 42 nucleotides pression of BARD1 with other proteins involved in apo- downstream of the deletion, could serve as translation ini- ptosis pathways, such as increased p53, Bax, and activated tiation codon. Translation initiation at nucleotide 389 would caspase 3. Staining with BARD1 antibodies against the result in a protein of approximately 70 kDa, which is con- amino-terminus colocalized with cells positive for activated sistent with the observed 74-kDa protein detected in pre- caspase 3, tested on adjacent sections, mostly in spermato- leptotene and pachytene spermatocytes and round sperma- gonia (Fig. 4B), while expression of activated caspase 3 tids. We used a deletion construct D-RING-EGFP (nucle- was also observed at later stages. When using an antibody otides 1±340), designed to be translated from the ATG at against the middle region of BARD1, JH-3, staining was position 389 and producing a truncated BARD1-GFP fu- observed in spermatogonia and later stages of spermato- sion protein [30] and compared its expression with genesis (Fig. 4B). Similar staining was observed for the BARD1␤ fused to GFP. Both constructs expressed a trun- proapoptotic protein Bax. At these stages, the expression cated BARD1-EGFP fusion protein of approximately 97 of BARD1 was primarily cytoplasmic, which is consistent kDa, which can be detected with antibodies directed against with an apoptotic function, as reported recently [30, 31]. GFP (Fig. 3B), indicating that ATG at position 389 is a The increase of a C-terminal but not N-terminal epitope at functional translation initiation codon in vitro. This sup- the pachytene stage and postmeiotic stages is consistent ports the assumption that wild-type BARD1 is expressed in with the expression of a new splice form BARD1␤ at those spermatogonia and the protein product of the splice variant stages and suggests that BARD1 and BARD1␤ expression BARD1␤, schematically presented in Figure 3C, corre- is associated with apoptotic events at all stages of sper- sponds to the 74-kDa protein expressed in pachytene spermatogenesis. matocytes and round spermatids. BARD1␤, a Potent Apoptosis Inducer BARD1 Expression Is Correlated with Apoptosis To test whether BARD1␤ is capable of apoptosis induc- The stage-speci®c pattern of BARD1 expression during tion, the BARD1␤ sequence was cloned into pcDNA and spermatogenesis was reminiscent of the reported occur- was transiently transfected into mouse embryonic stem rence of apoptosis [14]. To con®rm this correlation, we per- cells, which were previously reported to readily induce ap- formed TUNEL experiments and BARD1 staining on serial optosis in response to exogenous expression of BARD1 sections from testes of a young adult rat. TUNEL assays [17]. The testis-speci®c splice variant BARD1b induced ap- 1618 FEKI ET AL.

FIG. 3. Differentially-spliced testis-specific BARD1. A) Alignment of deduced protein sequence of BARD1␤ (testis) with human, mouse, and rat BARD1 cDNAs. RING-finger and ankyrin motifs are boxed. Regions deleted in BARD1␤ are indicated. Potential translation of nucleotides 1–142 would end in a stop (*) and produce a protein of 46 amino acids. An alternative ATG initiation codon at position 389 is indicated in blue (M). In-frame deletion of exon 5 is presented within the ankyrin repeats. B) Transient expression of BARD1-EGFP (124 kDa), ⌬RING-EGFP (97 kDa), and BARD1␤-EGFP (97 kDa) and analysis on Western blots probed with anti-GFP. Protein of identical size is detected after transfection of delta-RING-EGFP, and BARD1␤- EGFP. C) Schematic presentation of BARD1 and presumed BARD1␤ protein. BARD1 is presented with RING finger (green), ankyrin repeats (blue), and BRCT repeats (red), as well as approximate location of BARD1 antibodies. BARD1b is presented with presumed location of introns (triangles), translated region (filled heavy line), transcribed region (thin line), and deleted regions (dotted lines). Epitopes recognized by particular antibodies (␭) are indicated. optosis in vitro as well as the full-length BARD1 sequence, bilization of p53. It is likely that BARD1␤ might have a pcBARD1. Apoptosis was quanti®ed by vital staining of similar function in vivo. living cells with 7ЈAAD and analyzed by ¯ow cytometry (Fig. 5A). Interestingly, the RING-®nger de®cient splice BARD1 Expression Is Implicated in Pathologies form BARD1␤ is as ef®cient in apoptosis induction as BARD1. This apoptotic capacity could be due to the lack of Defective Spermatogenesis of the RING ®nger, thus liberating BARD1 from apoptosis- Several pathologies are known that result in infertility competing binding to BRCA1, which was found previously due to abortive spermatogenesis, such as obstructive azo- [17]. Indeed, cotransfection of BARD1␤ with BRCA1 did ospermia, Sertoli cell syndrome, and cryptorchidy. Those not lead to a reduction of apoptosis induction, while co- diseases are marked by increased levels of apoptosis of transfection of BRCA1 with BARD1 decreased apoptotic germ cells at different stages of spermatogenesis. We have capacity of BARD1 (Fig. 5, A and B). Apoptosis induction analyzed the expression of BARD1 in sections of human by BARD1␤ could be due to increased protein stability of testis samples of those pathologies. An upregulation of BARD1␤, as compared with full-length BARD1, because BARD1 expression is found in round spermatids and in an N-terminal deletion renders BARD1 more stable [30]. apoptotic germ cells phagocytosed by the Sertoli cells on Apoptosis induction by BARD1 is dependent on a func- sections from patients suffering from azoospermia (Fig. tional p53 [17]; we therefore tested whether BARD1␤ ex- 6A). The expression of BARD1 clearly coincides with ap- pression affected p53 stability. Indeed, p53 is upregulated optosis, as can be determined by the formation of apoptotic in cells that are transfected with BARD1 and even more so bodies. Cryptorchidism in humans is known to prevent all in cells that are transfected with BARD1␤ (Fig. 5C). From spermatogenesis in the undescended testis and germ cell these data, we concluded that BARD1␤, like BARD1, in- development is inhibited. We investigated the expression of duces apoptosis when overexpressed in vitro, through sta- BARD1 in the cryptorchid testis and the contralateral de- BARD1 IN SPERMATOGENESIS 1619

FIG. 4. BARD1 expression is correlated with apoptosis. A) BARD1 staining, as observed with antibody N-19, colocalizes with TUNEL staining on adjacent section (a and b). Bar 10 ϭ␮m. B) BARD1 staining colocalizes with staining against activated caspase 3. Regions where activated caspase 3 staining was observed (a), correspond to staining pattern with N-19 (b). Magniﬁcation in insets (a) and (b) was fourfold. C) Bax staining was observed at all stages. Note that BARD1 staining with antibody JH3 is cytoplasmic in most cells. Bar ϭ 10 ␮m. 1620 FEKI ET AL.

FIG. 5. Apoptosis induction by testis-specific BARD1␤. Transient transfection assays were performed in ES cells CGR8. A)The extent of apoptosis induction was measured by vital staining and monitored by flow cytometry. Proportion of vital cells (R2), apoptotic cells (R3), and necrotic cells (R4) were measured in CGR8, CGR8 plus doxorubicin (doxo), CGR8 plus BARD1␤, CGR8 plus full-length BARD1, CGR8 plus BARD1␤ plus BRCA1, CGR8 plus full-length BARD1 plus BRCA1. B) Histogram presenting percentage of cell death, as determined in three different transfection experiments. C) Increased p53 protein expression after transfection with BARD1␤. Western blot of cell extracts after transfection experiments or doxorubicin treatment demonstrates p53 increase after BARD1␤, BARD1, and BARD1␤ plus BRCA1 transfection, but not after transfection of BARD1 plus BRCA1. Ponseau staining of the membrane was applied to confirm loading of equal amounts of protein.

scended testis of the same individual (Fig. 6B). Within the nia and primary spermatocytes through the paracrine sig- descended testis, heavy BARD1 staining could be ob- naling of the Sertoli cells. To test this hypothesis, we cul- served, and increased apoptosis and BARD1 expression tured isolated germ cells, speci®cally spermatogonia/pre- was clearly associated with apoptotic cells and phagocy- leptotene stage, pachytene, and round spermatids, either in tosed apoptotic bodies within the Sertoli cells. This is con- normal culture medium, as de®ned previously [26], or in sistent with the reported reduced fertility of individuals conditioned culture medium, obtained from Sertoli cells with cryptorchidy. In the cryptorchid testis, which contains that were preincubated with hormones, to mimic in vivo only Sertoli cells, no BARD1 staining could be detected paracrine signaling and maturation. FSH and testosterone (Fig. 6, B, a and b), indicating that BARD1 is not expressed were added to the culture medium. The response of BARD1 in Sertoli cells per se. These data are consistent with our to hormone exposure, FSH or testosterone or both, was ®nding that BARD1 mRNA is not expressed in Sertoli cells monitored on the mRNA level. RT-PCR was performed to and supports our interpretation that BARD1 antibody stain- detect BARD1 mRNA expression in RNA isolated from the ing in Sertoli cells is derived from the incorporation of different cultures (Fig. 7). apoptotic germ cells. Interestingly, in spermatogonia/preleptotene germ cells, BARD1 expression therefore is clearly associated with no reduction of expression was observed with the addition germ cell apoptosis in vivo and with apoptosis in pathol- of testosterone. FSH, however, led to a complete repression ogies marked by reduced spermatogenesis. of BARD1, but the combination of FSH and testosterone had no effect, suggesting that testosterone compensated the Regulation of BARD1 Transcription effect of FSH. In all conditions, two forms of BARD1 Since BARD1 is associated with developmental and mRNA were detected that can be correlated with the wild- pathological events of apoptosis, it was interesting to in- type full-length BARD1 and with BARD1b, respectively, vestigate the conditions that drive BARD1 expression. We when primers amplifying regions including nucleotides 56± have observed that BARD1 is expressed at all stages of 2307 were used (Fig. 7A). At the pachytene stage, the ad- spermatogenesis, although to a different extent. We hy- dition of hormones did not result in a variation of the ex- pothesized that BARD1 expression is linked to the presence pression level of BARD1. At the round spermatid stage, or absence of hormones driving sexual maturation [32]. In addition of hormones produced a similar repression pattern, particular, FSH and testosterone have been described suf- as observed at the spermatogonia/preleptotene stage, but ®cient for triggering spermatogenesis in vitro [33, 34]. This testosterone had no inhibitory effect on FSH-induced re- implies that BARD1 expression is induced in spermatogo- pression of BARD1. Both forms of BARD1, full length and BARD1 IN SPERMATOGENESIS 1621

FIG. 6. BARD1 expression in human pathologies. A) BARD1 staining shown on cross-section of seminiferous tubes. The syndrome of azoospermia is characterized by abortive spermatogenesis and increased formation of apoptotic bodies, which show BARD1 staining (arrow heads) at stages corresponding to round spermatids. Few germ cells are developed in Sertoli cell syndrome. Germ cells phagocytosed by the Sertoli cells are stained positively for BARD1 (arrows). B) Human cryptorchidy. Hematoxylin and eosin staining shows suppression of germ cell development and presence of only a few Sertoli cells (a), and BARD1 staining is negative (b)inthe intra-abdominal testis. In the contralateral descended testis, hematoxylin staining shows a large number of condensed, apoptotic nuclei (c). BARD1 staining (d) is localized to cells of different stages, presumably spermatogonia (arrow 1), preleptotene (arrow 2), and pachytene (arrow 3). In- creased number of apoptotic cells and apoptotic bodies are observed in association with BARD1 staining. A and B) Original magniﬁcation ϫ40.

BARD1␤, were obtained, although BARD1␤ was increased the control gene ␤-tubulin, which remained unchanged in proportionally. These results indicate that FSH acts as a the various conditions. transcriptional repressor of BARD1 in spermatogonia/pri- In summary, our data suggest that, at the preleptotene mary spermatocytes and round spermatids but has no effect and round spermatid stages, BARD1 is directly or indirectly on pachytene stage spermatocytes. Interestingly, however, repressed by FSH through paracrine signaling of the Sertoli testosterone, by itself, does not have any in¯uence on cells. The same treatment affects only mild repression of BARD1 mRNA expression at any of the stages tested, but BRCA1 and only in preleptotene cells (data not shown). in combination with FSH, it annihilates the repressive effect of FSH. DISCUSSION In contrast, when cells were grown in preconditioned medium, medium from Sertoli cells that had been exposed Two mechanisms seem to be of crucial importance dur- to the hormones, the addition of FSH and FSH plus testos- ing spermatogenesis: meiotic recombination and apoptosis. terone, but not testosterone alone, resulted in suppression BARD1 and BRCA1 were reported to have maximal ex- of BARD1 expression in spermatogonia/preleptotene sper- pression in testis. BRCA1 is mainly expressed during mei- matocytes and in round spermatids. No effect of either hor- osis [21±24], where, most likely, it is involved in meiotic mone was observed under these conditions in pachytene repair. BARD1, however, is mainly expressed in spermato- spermatocytes (Fig. 7A). Interestingly, testosterone alone, gonia and primary spermatocytes and to a lesser extent dur- when applied through Sertoli cell-conditioned media, led to ing and after meiosis. BARD1 expression rather correlates BARD1 repression in round spermatids. Furthermore, tes- with apoptosis, which is known to occur at several stages tosterone had no compensatory effect on BARD1 repres- of spermatogenesis, including spermatogonia [14]. BARD1 sion by FSH, but even a repressive effect by itself in round speci®cally colocalized with TUNEL staining (Fig. 4A) and spermatids. These data indicate that FSH, when applied to with proteins implicated in apoptotic pathways, such as ac- Sertoli cells, could act as a messenger for BARD1 repres- tivated caspase 3, p53, and Bax (Fig. 4B). However, there sion at the spermatogonia/preleptotene stage and in round are more cells expressing BARD1 than apoptosis effector spermatids. genes, such as Bax. This could re¯ect the fact that BARD1 To test whether other genes, the products of which pre- acts upstream of the apoptosis pathway and that other ad- sumably interact with BARD1, were also hormonally reg- ditional signals are required to activate apoptosis. These ulated in this in vitro system, we monitored the expression data are consistent with a role of BARD1 in a caspase- of p53 mRNAs (Fig. 7B). The expression of p53 showed dependent apoptotic pathway, as reported previously [17]. only minor, insigni®cant changes under conditions of FSH Other functions cannot be ruled out, however, such as the and/or testosterone addition. No changes were observed for binding of BARD1 together with BRCA1 to XIST RNA 1622 FEKI ET AL.

BARD1, is a translation product of the differentially spliced form BARD1␤. The temporal expression patterns of BARD1 mRNAs and BARD1 proteins isoforms show a similar distribution, a 97-kDa protein corresponds to full-length BARD1 and is expressed in spermatogonia, as is the full-length BARD1 transcript. BARD1␤ mRNA is expressed at all stages except in spermatogonia, as is a 74-kDa protein, which is recognized by C-terminal antibodies, suggesting that the 74-kDa is derived from differential splicing rather than from posttranslational modi®cation of BARD1. Interesting- ly, the presumed protein product of BARD1␤ lacks the RING-®nger domain, required for the interaction of BARD1 with BRCA1 [18, 35], but retains regions suf®cient for its apoptotic function [30]. Expression of BARD1␤ in vitro resulted in similar levels of apoptosis as BARD1. However, the in vivo apoptosis induced by BARD1␤ could be more ef®cient due to increased stability of BARD1␤ compared with full-length BARD1, as determined on Western blot analysis using antibodies against different regions of BARD1 (data not shown) and due to the lack of BRCA1 interaction domain. BRCA1 could act as an inhibitor of BARD1-induced apo- FIG. 7. Hormonal regulation of BARD1 expression during spermatogenesis. Puriﬁed germ cells, spermatogonia/preleptotene (GPL), pachytene ptosis [17]; therefore, we demonstrate that BRCA1 reduces (P), or round spermatids (RS) were cultured. A) BARD1 expression after BARD1-induced apoptosis but has no affect on the apo- direct addition of FSH (F) and/or testosterone (T) or after incubation with ptotic capacity of BARD1␤ (Fig. 5, A and B). BARD1b Sertoli cell-conditioned medium (SCCM), was monitored by RT-PCR. not only induces apoptosis but also shows p53 stabilization, SCCM was prepared as described in the Materials and Methods. Both as does wild-type BARD1 (Fig. 5C). Therefore, BARD1␤ forms of BARD1 (2.2 kb and 2.0 kb) are coexpressed. A third and much acts in a p53-dependent apoptosis pathway. It could be less abundant band can be observed and represents a form without deletion of exon 5 but not exon 2 and 3. Control RT-PCR was performed speculated that BARD1␤ acts as apoptosis inducer in stages with primers directed against ␤-tubulin. B) The p53 or ␤-tubulin (␤-tub) where BRCA1 and BARD1 are coexpressed. expression of cultured germ cells was monitored after incubation with This hypothesis stipulates that, during premeiotic stages, SCCM medium. Sertoli cells were cultured with FSH and/or testosterone in the absence of BRCA1, full-length BARD1 proteins are for 1 day and culture medium was added to germ cell cultures. RT-PCR expressed and presumably are involved in apoptotic func- was performed to compare the expression proﬁles of BARD1, p53, and tions. To ensure apoptosis induction by BARD1 in the pres- the housekeeping gene ␤-tubulin. ence of the competitor BRCA1 [17], the testis-speci®c splice variant BARD1␤ is expressed. Besides the importance of apoptosis in normal sper- on the inactive X chromosome [25]. BARD1 interaction matogenesis, the loss of germ cell homeostasis, or dereg- with BRCA1 might compete for binding to other proteins ulated apoptosis, can result in infertility. In line with these and inhibit its apoptotic activity [17]. Consequently, the thoughts, BARD1 is associated with pathologies of reduced expression of BARD1 in the absence of BRCA1 could lead germ cell maturation due to increased apoptosis. Loss or to increased apoptotic capacity. reduction of apoptosis, on the other hand, can lead to un- BARD1 knockouts have been generated but are lethal controlled proliferation and it could be speculated that during the early stages of embryogenesis and thus cannot BARD1 plays a role as tumor suppressor in germ cell can- shed light on the function of BARD1 during spermatogen- cers. esis. We therefore performed experiments to further dissect Male germ cell apoptosis and development is regulated the speci®c local and temporal expression pattern of by different growth-promoting or -repressing signals, one BARD1 on the mRNA and the protein level. We found that of the regulators being hormones. Testosterone deprivation a novel isoform of BARD1, generated by differential splic- leads to germ cell apoptosis [5] and estradiol increases ing, was expressed in the testis in addition to wild-type germ cell survival [36, 37]. We speculated that BARD1 BARD1. The testis-speci®c new splice variant, BARD1␤, expression was hormonally regulated because BARD1 mu- shows a deletion of exons 2, 3, and 5. The translation of tations are implicated in female gynecological cancers [38, BARD1␤ results in a frame shift after excision of exons 2 39] and its expression pattern in ovary and uterine tissue and 3 and would end with a stop codon (Fig. 3A). However, re¯ected a hormonal modulation [19]. Here we report hor- downstream of the splice acceptor site, an ATG at position monally regulated transcriptional activation or repression of 389 could act as an alternative translation initiation site. BARD1. Interestingly, BARD1 transcription is repressed by Western blot analysis is consistent with this site of trans- the addition of FSH or FSH and testosterone to isolated lation initiation because the proteins detected with anti- germ cells, but not testosterone alone (Fig. 7A). But either BARD1 antibodies correspond to the expected size for the FSH or testosterone are capable of transcriptional repres- presumed translation product of BARD1␤. Expression of a sion of BARD1 when added in the presence of Sertoli cells. deletion construct, missing regions 1±380, results in a pro- Sertoli cells can convert testosterone to estradiol in the tein of similar size as translation of BARD1␤. It is therefore presence of FSH, and estradiol is required for progression likely that the 74-kDa protein, expressed at all stages of of spermatogenesis [40]. Our data therefore suggest that the spermatogenesis with the exception of spermatogonia and repressive effect on BARD1 transcription is due to estradiol detected with antibodies against the C-terminal portion of rather than testosterone. BARD1 IN SPERMATOGENESIS 1623

In pachytene spermatocytes, no effect is observed by Wang C. Single exposure to heat induces stage-speci®c germ cell ap- either hormones added, neither directly nor as conditioned optosis in rats: role of intratesticular testosterone on stage speci®city. Endocrinology 1999; 140:1709±1717. medium of Sertoli cells. In round spermatids, however, a 10. Print CG, Loveland KL. Germ cell suicide: new insights into apopto- similar response is observed as in spermatogonia/prelepto- sis during spermatogenesis. Bioessays 2000; 22:423±430. tene spermatocytes. It is important to emphasize that the 11. Huckins C. The morphology and kinetics of spermatogonial degen- pattern of expression of the two BARD1 splice forms is eration in normal adult rats: an analysis using a simpli®ed classi®ca- in¯uenced by additional factors in vivo (Fig. 2), which are tion of the germinal epithelium. Anat Rec 1978; 190:905±926. not reproduced in vitro (Fig. 7). Interestingly, BRCA1 ex- 12. De Rooij DG, Lok D, Huckins C. Regulation of the density of spermatogonia in the seminiferous epithelium of the Chinese hamster: II. pression parallels the expression of BARD1. This could be Differentiating spermatogonia. The morphology and kinetics of sper- due to similar transcriptional repression of BRCA1 or to matogonial degeneration in normal adult rats: an analysis using a sim- BARD1 mRNA or protein affecting BRCA1 transcription, pli®ed classi®cation of the germinal epithelium. Anat Rec 1987; 217: although the latter possibility is unlikely, considering ex- 131±136. periments performed with xBARD1 and xBRCA1 [41]. As 13. Oakberg EF. Duration of spermatogenesis in the mouse. Nature 1957; expected, the expression of p53 mRNA was only slightly, 180:1137±1138. 14. Sinha Hikim AP, Lue Y, Diaz-Romero M, Yen PH, Wang C, Swerdloff if at all, modulated. Our data are consistent with a model RS. Deciphering the pathways of germ cell apoptosis in the testis. J that predicts that BARD1 is repressed by FSH and/or es- Steroid Biochem Mol Biol 2003; 85:175±182. tradiol produced in Sertoli cells but not by testosterone. 15. Stephan H, Polzar B, Rauch F, Zanotti S, Ulke C, Mannherz HG. BARD1 acts as mediator between paracrine signals and ap- Distribution of deoxyribonuclease I (DNase I) and p53 in rat testis optosis by transcriptional response to hormone levels, as and their correlation with apoptosis. Histochem Cell Biol 1996; 106: increased transcript and protein levels of BARD1 lead to 383±393. 16. Yan W, Samson M, Jegou B, Toppari J. Bcl-w forms complexes with increased p53 levels and apoptosis [17]. A pathway of Bax and Bak, and elevated ratios of Bax/Bcl-w and Bak/Bcl-w cor- FSH-induced apoptosis to caspase activation and apoptosis respond to spermatogonial and spermatocyte apoptosis in the testis. induction has been described previously [34]. This would Mol Endocrinol 2000; 14:682±699. mean that cells in contact with Sertoli cells are more prone 17. Irminger-Finger I, Leung WC, Li J, Dubois-Dauphin M, Harb J, Feki to be exposed to the suppressive effect of FSH even in the A, Jefford CE, Soriano JV, Jaconi M, Montesano R, Krause KH. Iden- presence of testosterone, consistent with survival rather ti®cation of BARD1 as mediator between proapoptotic stress and p53- dependent apoptosis. Mol Cell 2001; 8:1255±1266. than apoptosis and consistent with a limited support func- 18. Wu LC, Wang ZW, Tsan JT, Spillman MA, Phung A, Xu XL, Yang tion of Sertoli cells. MC, Hwang LY, Bowcock AM, Baer R. Identi®cation of a RING Although the correlation of BARD1 expression and ap- protein that can interact in vivo with the BRCA1 gene product. Nat optosis in spermatogenesis is intriguing, it remains to be Genet 1996; 14:430±440. considered that components of the apoptotic machinery in 19. Irminger-Finger I, Soriano JV, Vaudan G, Montesano R, Sappino AP. male germ cells are required for and activated during sper- In vitro repression of BRCA1-associated RING domain gene, BARD1, induces phenotypic changes in mammary epithelial cells. J matogenesis without completion of apoptosis, as demon- Cell Biol 1998; 143:1329±1339. strated for Drosophila [28]. Whether similar mechanisms 20. Ayi TC, Tsan JT, Hwang LY, Bowcock AM, Baer R. Conservation of exist in mammals remains to be determined. function and primary structure in the BRCA1-associated RING domain (BARD1) protein. Oncogene 1998; 17:2143±2148. ACKNOWLEDGMENTS 21. Zabludoff SD, Wright WW, Harshman K, Wold BJ. BRCA1 mRNA is expressed highly during meiosis and spermiogenesis but not during We are grateful to M. F. Pelte, D. Chardonnens, A. Agostini, and G. mitosis of male germ cells. Oncogene 1996; 13:649±653. Bianchi for contributing with their expertise and with critical comments, 22. Blackshear PE, Goldsworthy SM, Foley JF, McAllister KA, Bennett to W.-C. Leung for fruitful discussions, and to A. Caillon, C. Genet, M. LM, Collins NK, Bunch DO, Brown P, Wiseman RW, Davis BJ. H. Saw and M. Vigier for excellent technical assistance. BRCA1 and BRCA2 expression patterns in mitotic and meiotic cells of mice. Oncogene 1998; 16:61±68. 23. Scully R, Chen J, Plug A, Xiao Y, Weaver D, Feunteun J, Ashley T, REFERENCES Livingston DM. Association of BRCA1 with Rad51 in mitotic and 1. Bartke A. Effects of growth hormone on male reproductive functions. meiotic cells. Cell 1997; 88:265±275. J Androl 2000; 21:181±188. 24. Xu X, Aprelikova O, Moens P, Deng CX, Furth PA. Impaired meiotic 2. Sinha Hikim AP, Swerdloff RS. Hormonal and genetic control of germ DNA-damage repair and lack of crossing-over during spermatogenesis cell apoptosis in the testis. Rev Reprod 1999; 4:38±47. in BRCA1 full-length isoform de®cient mice. Development 2003; 3. Allan DJ, Harmon BV, Roberts SA. Spermatogonial apoptosis has 130:2001±2012. three morphologically recognizable phases and shows no circadian 25. Ganesan S, Silver DP, Greenberg RA, Avni D, Drapkin R, Miron A, rhythm during normal spermatogenesis in the rat. Cell Prolif 1992; Mok SC, Randrianarison V, Brodie S, Salstrom J, Rasmussen TP, 25:241±250. Klimke A, Marrese C, Marahrens Y, Deng CX, Feunteun J, Livingston 4. Hikim AP, Wang C, Leung A, Swerdloff RS. Involvement of apoptosis DM. BRCA1 supports XIST RNA concentration on the inactive X in the induction of germ cell degeneration in adult rats after gonad- chromosome. Cell 2002; 111:393±405. otropin-releasing hormone antagonist treatment. Endocrinology 1995; 26. Weiss M, Vigier M, Hue D, Perrard-Sapori MH, Marret C, Avallet O, 136:2770±2775. Durand P. Pre- and postmeiotic expression of male germ cell-speci®c 5. Woolveridge I, de Boer-Brouwer M, Taylor MF, Teerds KJ, Wu FC, genes throughout 2-week cocultures of rat germinal and Sertoli cells. Morris ID. Apoptosis in the rat spermatogenic epithelium following Biol Reprod 1997; 57:68±76. androgen withdrawal: changes in apoptosis-related genes. Biol Reprod 27. Jahnukainen K, Chrysis D, Hou M, Parvinen M, Eksborg S, Soder 1999; 60:461±470. O. Increased apoptosis occurring during the ®rst wave of spermato- 6. Meistrich ML. Effects of chemotherapy and radiotherapy on sper- genesis is stage-speci®c and primarily affects mid-pachytene spermatogenesis. Eur Urol 1993; 23:136±141. Discussion 142. matocytes in the rat testis. Biol Reprod 2004; 70:290±296. 7. Li LH, Wine RN, Chapin RE. 2-Methoxyacetic acid (MAA)-induced 28. Arama E, Agapite J, Steller H. Caspase activity and a speci®c cyto- spermatocyte apoptosis in human and rat testes: an in vitro compari- chrome C are required for sperm differentiation in Drosophila. Dev son. J Androl 1996; 17:538±549. Cell 2003; 4:687±697. 8. Ku WW, Wine RN, Chae BY, Ghanayem BI, Chapin RE. Spermato- 29. Gautier F, Irminger-Finger I, Gregoire M, Me¯ah K, Harb J. Identi- cyte toxicity of 2-methoxyethanol (ME) in rats and guinea pigs: evi- ®cation of an apoptotic cleavage product of BARD1 as an autoanti- dence for the induction of apoptosis. Toxicol Appl Pharmacol 1995; gen: a potential factor in the antitumoral response mediated by apo- 134:100±110. ptotic bodies. Cancer Res 2000; 60:6895±6900. 9. Lue YH, Hikim AP, Swerdloff RS, Im P, Taing KS, Bui T, Leung A, 30. Jefford CE, Feki A, Harb J, Krause KH, Irminger-Finger I. Nuclear- 1624 FEKI ET AL.

cytoplasmic translocation of BARD1 is linked to its apoptotic activity. gens on spermatogenesis at puberty and the relationship to adult testis Oncogene 2004; 23:3509±3520. size and fertility: evidence for stimulatory effects of low estrogen 31. Rodriguez JA, Schuchner S, Au WW, Fabbro M, Henderson BR. Nu- levels. Endocrinology 2000; 141:3898±3907. clear-cytoplasmic shuttling of BARD1 contributes to its proapoptotic 37. Pentikainen V, Erkkila K, Suomalainen L, Parvinen M, Dunkel L. activity and is regulated by dimerization with BRCA1. Oncogene Estradiol acts as a germ cell survival factor in the human testis in 2004; 23:1809±1820. vitro. J Clin Endocrinol Metab 2000; 85:2057±2067. 32. Billig H, Furuta I, Rivier C, Tapanainen J, Parvinen M, Hsueh AJ. 38. Thai TH, Du F, Tsan JT, Jin Y, Phung A, Spillman MA, Massa HF, Apoptosis in testis germ cells: developmental changes in gonadotropin Muller CY, Ashfaq R, Mathis JM, Miller DS, Trask BJ, Baer R, Bow- dependence and localization to selective tubule stages. Endocrinology cock AM. Mutations in the BRCA1-associated RING domain 1995; 136:5±12. (BARD1) gene in primary breast, ovarian and uterine cancers. Hum 33. Tesarik J, Mendoza C, Greco E. The effect of FSH on male germ cell Mol Genet 1998; 7:195±202. 39. Ghimenti C, Sensi E, Presciuttini S, Brunetti IM, Conte P, Bevilacqua survival and differentiation in vitro is mimicked by pentoxifylline but G, Caligo MA. Germline mutations of the BRCA1-associated ring not insulin. Mol Hum Reprod 2000; 6:877±881. domain (BARD1) gene in breast and breast/ovarian families negative 34. Tesarik J, Nagy P, Abdelmassih R, Greco E, Mendoza C. Pharmaco- for BRCA1 and BRCA2 alterations. Genes Chromosomes Cancer logical concentrations of follicle-stimulating hormone and testosterone 2002; 33:235±242. improve the ef®cacy of in vitro germ cell differentiation in men with 40. Robertson KM, O'Donnell L, Jones ME, Meachem SJ, Boon WC, maturation arrest. Fertil Steril 2002; 77:245±251. Fisher CR, Graves KH, McLachlan RI, Simpson ER. Impairment of 35. Morris JR, Keep NH, Solomon E. Identi®cation of residues required spermatogenesis in mice lacking a functional aromatase (cyp 19) gene. for the interaction of BARD1 with BRCA1. J Biol Chem 2002; 277: Proc Natl Acad Sci U S A 1999; 96:7986±7991. 9382±9386. 41. Joukov V, Chen J, Fox EA, Green JB, Livingston DM. Functional 36. Atanassova N, McKinnell C, Turner KJ, Walker M, Fisher JS, Morley communication between endogenous BRCA1 and its partner, BARD1, M, Millar MR, Groome NP, Sharpe RM. Comparative effects of neo- during Xenopus laevis development. Proc Natl Acad Sci U S A 2001; natal exposure of male rats to potent and weak (environmental) estro- 98:12078±12083. 4. BARD1 induces apoptosis by catalysing phosphorylation of p53 by DNA damage response kinase Feki A, Jefford CE, Berardi P, Wu JY, Cartier L, Krause KH, Irminger-Finger I. Oncogene. 2005 Mar 14. (In press). It was previously shown that BARD1 plays a role in mediating apoptosis, independently of BRCA1, but it requires p53 for signalling towards apoptosis. This was later confirmed because BARD1-repressed cells exhibit resistance in signalling apoptosis. Furthermore, p53 stability and activation requires its phosphorylation on serine 15. In order to investigate further the interactions between BARD1 and p53, and map the region imputable to this binding ability, we performed co- immunoprecipitation assays and western blots. In this study we reveal that BARD1 over-expression may be sufficient to activate p53 phosphorylation on serine 15. We identify the region of BARD1 which binds to p53 through a series of co- immunoprecipitations of deletion mutants fused to EGFP. We can see that even the deletion mutants lacking the RING functional domain, which normally binds BARD1 to BRCA1, are capable of co-immunoprecipitating p53. This results rules out the preconception that p53 was co-immunoprecipitated through interaction with BRCA1. We show also that BARD1 binds to Ku-70 in co-immunoprecipitation experiments as well as phosphorylated p53. These result further points to a role for Ku-70 in phosphorylating p53. My involvement consisted in furnishing the various plasmids coding for the BARD1-EGFP fusion proteins, immunocytochemistry, co- immunoprecipitation and western blots appearing in Figures 2 and 3. I also furnished some of the data shown in Figure 4 by repeating the experiments in order to confirm validity of our results.

85 Oncogene (2005), 1–11 & 2005 Nature Publishing Group All rights reserved 0950-9232/05 $30.00 www.nature.com/onc ORIGINAL PAPER BARD1 induces apoptosis by catalysing phosphorylation of p53by DNA-damage response kinase

Anis Feki1,2, Charles Edward Jefford1, Philip Berardi1,3, Jian-Yu Wu1, Laetitia Cartier1, Karl-Heinz Krause1 and Irmgard Irminger-Finger*,1

1Biology of Aging Laboratory, Department of Geriatrics, University of Geneva, Chemin de Petit Bel Air 2, CH-1225 Geneva/Cheˆne-Bourg, Switzerland; 2Department of Gynecology and Obstetrics, University Hospital of Geneva, Geneva, Switzerland; 3Biochemistry and Molecular Biology and Oncology, University of Calgary, Calgary, Canada

The BRCA1-associated RING domain protein BARD1 line, the tumor suppressor p53, a key element in the acts with BRCA1 in double-strand break repair and apoptosis response pathway, is mutated in more than ubiquitination. BARD1 plays a role as mediator of apop- 50% of tumors. Several signaling pathways converge on tosis by binding to and stabilizing p53, and BARD1- the activation of p53, which leads either to cell cycle repressed cells are resistant to apoptosis. We therefore arrest and DNA repair or senescence, or apoptosis investigated the mechanism by which BARD1 induces p53 (Levine, 1997). P53 activation and stabilization depend stability and apoptosis. The apoptotic activity of p53is on its phosphorylation at multiple sites, by a number of regulated by phosphorylation. We demonstrate that kinases (Meek, 1994; Milczarek et al., 1997). Phosphor- BARD1 binds to unphosphorylated and serine-15 phos- ylation at serines 6 and 9 by casein kinase 1-delta and phorylated forms of p53in several cell types and that the casein kinase 1-epsilon occurs both in vitro and in region required for binding comprises the region sufficient vivo (Knippschild et al., 1997; Kohn, 1999), the for apoptosis induction. In addition, BARD1 binds to Ku- checkpoint kinases Chk1 and Chk2 phosphorylation at 70, the regulatory subunit of DNA-PK, suggesting that serine 20 enhances its tetramerization, stability, and the mechanism of p53-induced apoptosis requires BARD1 activity (Shieh et al., 1999; Hirao et al., 2000). for the phosphorylation of p53. Upregulation of BARD1 Phosphorylation of p53 at serine-392 is observed in alone is sufficient for stabilization of p53and phosphor- vitro by CDK-activating kinase (CAK) (Lu et al., 1997) ylation on serine-15, as shown in nonmalignant epithelial and in vivo (Hao et al., 1996; Lu et al., 1997), but is cells and ovarian cancer cells, NuTu-19, which are altered in human tumors. Serine-392 phosphorylation defective in apoptosis induction and express aberrant has been reported to influence the growth suppressor splice variants of BARD1. Stabilization and phosphoryla- function, DNA binding, and transcription activation of tion of p53in NuTu-19 cells, as well as apoptosis, can be p53 (Hao et al., 1996; Lohrum and Scheidtmann, 1996; induced by the exogenous expression of wild-type Lu et al., 1997; Kohn, 1999). Phosphorylation of p53 at BARD1, suggesting that BARD1, by binding to the serine-46 is important for regulating its ability to induce kinase and its substrate, catalyses p53phosphorylation. apoptosis (Oda et al., 2000). However, the rapid Oncogene advance online publication, 14 March 2005; response to DNA damage is induced by phosphoryla- doi:10.1038/sj.onc.1208491 tion of p53 at serines 15, 20, and 37 and leads to reduced interaction of p53 with its negative regulator, oncopro- Keywords: apoptosis; BARD1; DNA-PK; Ku-70; p53; tein MDM2 (Shieh et al., 1997). phosphorylation Known kinases for the DNA damage response are ATM, ATR, and DNA-PK, which can phosphorylate p53 at serines 15 and 37 (Shieh et al., 1997; Tibbetts et al., 1999). These phosphorylation events impair the ability of MDM2 to bind p53, promoting both the Introduction accumulation and functional activation of p53 in response to DNA damage (Shieh et al., 1997; Tibbetts Apoptosis is an important means of eliminating et al., 1999). MDM2 acts as inhibitor of p53 function by dangerously damaged cells. Cancer cells have developed targeting it for ubiquitination and proteasomal degra- strategies to escape apoptosis and consequently become dation (Honda et al., 1997; Chehab et al., 1999). resistant to apoptosis inducing treatments. Along this The tumor suppressor BRCA1 Associated Ring Domain protein (BARD1) can act as a mediator *Correspondence: I Irminger-Finger; between genotoxic stress and apoptosis by binding to E-mail: [email protected]; URL: http://www.medecine.unige.ch/recherche/biologie_du_vieillissement/ and stabilizing p53 (Irminger-Finger et al., 2001; Received 22 July 2004; revised 8 November 2004; accepted 20 December Irminger-Finger and Leung, 2002). BARD1 is the major 2004 protein-binding partner of BRCA1 (Wu et al., 1996) BARD1 induces apoptosis A Feki et al 2 and the BARD1/BRCA1 heterodimer has functions in DNA repair (Jin et al., 1997; Scully et al., 1997) and ubiquitination (Baer and Ludwig, 2002). Both proteins are homologous within their RING domains and two BRCT domains. The BRCT domains of BRCA1 have recently been characterized as modules for kinase and target interaction (Manke et al., 2003; Yu et al., 2003) and a role of BARD1–BRCA1 complexes in signaling from DNA damage to p53 phosphorylation has been described recently (Fabbro et al., 2004). The repression of BARD1 expression in vitro results in genomic instability and cellular changes suggestive of a premalignant phenotype (Irminger-Finger et al., 1998) and resistance to apoptosis (Irminger-Finger et al., 2001). Similarly, BARD1, as well as BRCA1, knockout cells exhibit high levels of genomic instability (Joukov et al., 2001; Ludwig et al., 2001; McCarthy et al., 2003). However, excess of BARD1 over BRCA1 results in apoptosis independently of BRCA1 (Irminger-Finger et al., 2001). Interestingly, the expression of BARD1, but not BRCA1, is hormonally controlled in uterine tissue (Irminger-Finger et al., 1998), suggesting a role in tissue homeostasis. Further evidence for a role of BARD1 in tumor suppression is presented by BARD1 mutations found in breast, ovarian, and most intrigu- ingly in endometrial tumors (Thai et al., 1998; Hashi- zume et al., 2001; Ghimenti et al., 2002; Ishitobi et al., 2003). In contrast, BRCA1 mutations have not been found in uterine cancers, supporting a BRCA1- independent role of BARD1 in tumor suppression by apoptosis induction (Irminger-Finger and Leung, 2002). To further elucidate the mechanism by which BARD1 induces apoptosis, we investigated its possible function in the regulation of p53 phosphorylation required for apoptosis (Lakin and Jackson, 1999). Here we report that BARD1 is involved in p53ser15 phosphorylation and BARD1 overexpression is sufficient for this phosphorylation. We identified a cancer cell line which is resistant to apoptosis and deficient in p53ser15 phosphorylation in response to genotoxic stress. Figure 1 p53 and phospho-p53 expression correlated with Indeed, BARD1 is mutated and deleted in this cell line BARD1 expression. (a) Doxorubicin treatment of TAC-2 cells ser15 induces BARD1, p53 and phospho-p53 (p-p53). Western blots were and exogenous expression can restore p53 phosphory- performed with respective antibodies on cell extracts treated with lation and apoptosis. doxorubicin for various intervals. (b) BARD1 is expressed in TAC- 2 but not NuTu-19 cells after treatment with doxorubicin. Correlated expression of p53 and phospho-p53 is shown. (c) Exogenous expression of BARD1 restores p53 expression and phosphorylation. HEK293T cells with constitutive expression of Results p53 and NuTu-19 cells were transduced with lentiviral vector expressing BARD1. The membranes were probed with anti-actin as Given the role of BARD1 in p53 stabilization, we loading control investigated its expression in relation to p53 in various cell types. In nonmalignant mammary gland cells, TAC- 2, treatment with the apoptosis-inducing drug doxorubicin resulted in the upregulation of BARD1 and reported stabilization of p53 by phosphorylation upon accumulation of the p53 protein, as shown previously stress induction (Shieh et al., 1997). Phosphorylation of (Irminger-Finger et al., 2001). Simultaneously to the serines 15, 20, and 37 is essential for p53 function during increase of BARD1 and p53 protein levels upon apoptosis (Shieh et al., 1997; Tibbetts et al., 1999). Since genotoxic stress, the accumulation of phosphorylated serine 15, but not serines 20 and 37, is conserved p53ser15 was observed when phospho-epitope-specific between human, mouse, and rat p53, we determined antibodies against phospho-p53ser15 were used on Wes- whether this site was implicated in the resistance to tern blots (Figure 1a). This is consistent with the apoptosis in cancer cells.

Oncogene BARD1 induces apoptosis A Feki et al 3 We first compared the effect of doxorubicin treatment These data indicate that upregulation of BARD1 applied to TAC-2 cells and to highly malignant rat protein is sufficient for p53 upregulation and phosphory- ovarian cancer cells, NuTu-19 (Rose et al., 1996). lation, suggesting that the function of BARD1 in p53 NuTu-19 lack the full-length BARD1 protein and stabilization involves phosphorylation of p53 at the key showed only a slight upregulation of p53, as compared residue serine-15 and that increased BARD1 protein to TAC-2 cells (Figure 1b). Most importantly, no trace levels can induce this post-translational modification. of phospho-p53 could be detected in doxorubicin- To investigate whether BARD1 and p53 or phospho- treated NuTu-19 cells, while phospho-p53 was readily p53 physically interact, we used HEK293T cells trans- detectable in TAC-2 cells. fected with a cDNA expression vector of a BARD1– Since overexpression of BARD1 by itself can lead to EGFP fusion construct expressed from the CMV p53 stabilization and apoptosis (Irminger-Finger et al., promoter (Jefford et al., 2004). Immunofluorescence 2001), we tested the effect of BARD1 expression on microscopy was performed to visualize BARD1–EGFP, p53 phosphorylation. HEK293T cells were used and p53, and phospho-p53ser15 with specific antibodies. When compared to malignant NuTu-19 cells, since both cell antibodies recognizing total p53 were used, we observed types showed similar transduction efficiency with that all cells expressed p53 independently of BARD1– lentiviral vectors. Transduction of HEK293T and EGFP expression, whereas some accumulation of p53 in NuTu-19 cells with wild-type BARD1, under the control nuclear dots was correlated with BARD1–EGFP of the EF1-alpha promotor, resulted in increased expression (Figure 2a). Using p53 antibodies specific expression of BARD1 in HEK293T cells and expression for phospho-serine-15, no staining was observed in of exogenous BARD1 in NuTu-19 cells. An increase of untransfected HEK293T cells, while phospho-p53 was total p53 in HEK293T cells, and less pronounced in expressed in BARD1–EGFP-positive cells, and NuTu-19 cells, was observed. Phosphorylation of p53 BARD1–EGFP and phospho-p53ser15 co-localized in p53ser15 was observed in HEK293T cells and NuTu-19 nuclear dots (Figure 2a). Comparison of p53 and cells after exogenous expression of BARD1 (Figure 1c). phospho-p53ser15 in nontransfected cells and in

Figure 2 BARD1 co-localizes with phospho-p53. (a) HEK293T cells nontransfected or transfected with BARD1–EGFP expression vector were used for immunoﬂuorescence microscopy. DAPI staining, BARD1–EGFP ﬂuorescence, anti-p53, and anti-phospho-p53 staining are shown. Arrowheads mark cells with high BARD1–EGFP content, arrows mark those with moderated BARD1–EGFP expression. Merge shows colocalization (arrow) of BARD1–EGFP and phospho-p53. (b) The histogram demonstrates BARD1, p53, and phospho-p53 expression in nontransduced and BARD1-transduced cells, derived from three independent transduction experiments

Oncogene BARD1 induces apoptosis A Feki et al 4 BARD1–EGFP-expressing cells clearly shows that cells, using a C-terminal BARD1 antibody (Figure 3a). phospho-p53 is only present in BARD1–EGFP expres- To obtain increased protein levels of BARD1 and sing cells, and the amount of phospho-p53 labeling is p53, HEK293T and NuTu-19 cells were transduced correlated with the level of BARD1–EGFP expression. with BARD1-expressing lentiviral vector, and TAC-2 The quantitative analysis of BARD1–EGFP and phos- cells were treated with doxorubicin. To quantify the pho-p53ser15 expression shows similar percentage of transduction efﬁciency, control transductions were BARD1- and phospho-p53ser15-positive cells (Figure 2b). performed using a GFP-expressing lentiviral vector. As These results are consistent with the observation that shown previously (Irminger-Finger et al., 2001), the overexpression of BARD1 can induce p53 phosphoryla- increase of BARD1 was associated with the increase of tion (Figure 1c). p53 expression as compared to control transduction. We have previously shown that BARD1 binds to p53 Moreover, p53 and phospho p53ser-15 levels were elevated in co-immunoprecipitation assays (Irminger-Finger in doxorubicin-treated TAC-2 cells and in BARD1- et al., 2001). To test BARD1 binding to phospho-p53, transduced HEK293T and NuTu-19 cells. BARD1 immunoprecipitation experiments were performed with antibodies co-immunoprecipitated p53 and phospho cell extracts from HEK293T, TAC-2, and NuTu-19 p53ser-15 in all cell types. Phospho-p53ser-15 was co-

Figure 3 BARD1 interacts with p53 and with phospho-p53. (a) Co-immunoprecipitations were performed with HEK293T, NuTu-19, and TAC-2 cells, using anti-BARD1 antibody C-20. TAC-2 cells, with or without doxorubicin treatment, and HEK293T and NuTu- 19, nontransduced or transduced with BARD1 expression vector, were compared. Western blots were probed with anti-p53 antibodies or anti-phospho epitope serine-15 antibodies. The left panel shows control immunoprecipitation supernatants, the right panel shows pellets. (b) BARD1 stabilizes wild-type (wt) and triple mutant 33-81-315 (tri), but not p53 mutants of ser15 or ser37. Prostate cancer cells PC3, deﬁcient of p53 (Honda et al., 2002), were transfected ( þ ) or not transfected (À) with BARD1 and cotransfected with p53 or p53 mutants. Western blots of cell extracts were probed with anti-p53 antibodies. (c) Region sufﬁcient for p53 binding includes ANK and the region between ANKand BRCT. EGFP-tagged BARD1 and deletion constructs, and EGFP alone, were transiently transfected. Immunoprecipitation was performed with anti-p53 antibodies and Western blots were probed with anti-GFP antibodies. The supernatant (S) and pellet (P) fractions show the fractions of the respective fusion proteins. (d) Schematic diagram of BARD1 protein sequence and deletion-bearing fusion constructs is presented. Percentage of p53 binding, determined by gel intensity scan, and capacity of apoptosis induction reported previously, (Jefford et al., 2004), are indicated. Arrows above the protein scheme indicate relative positions of tumor-associated mutations (Thai et al., 1998; Ghimenti et al., 2002; Karppinen et al., 2004)

Oncogene BARD1 induces apoptosis A Feki et al 5 immunoprecipitated with BARD1 as efficiently as p53, formed on lysates from HEK293T cells, or HEK293T albeit the amounts of p53 and phospho-p53ser-15 were cells transduced with BARD1–EGFP, revealed that reduced in NuTu-19 as compared to TAC-2 and HEK BARD1 and p53 were co-immunoprecipitated with Ku- 293T cells. These results indicate that BARD1 interacts 70. When anti-p53 antibodies were used to precipitate with p53 and with phospho-p53ser-15 in different cell p53 or interacting proteins, p53 immunoprecipitation types and cells from different species. was nearly 100%, as was BARD1 co-immunoprecipita- To further investigate the specificity of BARD1- tion with anti-Ku-70 antibodies (Figure 4a). dependent p53ser15 phosphorylation, we tested the We were interested whether NuTu-19 cells expressed mutated forms of p53. Cotransfection assays were per- Ku-70 and immunoprecipitation experiments were formed in p53-deficient human prostate cancer cells PC3 performed with untransfected and BARD1-transfected (Honda et al., 2002). No p53 can be detected in PC3 cells NuTu-19 cells (Figure 4b). Only exogenous BARD1 without exogenous p53 expression, also ser15 and ser37 could accumulate detectable amounts of Ku-70 in im- mutants do not express detectable amounts of protein munoprecipitation. No precipitation was observed when after transfection. Triple mutant 33-81-315, however, is BARD1 antibodies were omitted. stable (Zacchi et al., 2002). BARD1 cotransfection leads As further evidence for the implication of DNA-PK, a to an increase of wild-type p53 and of the triple mutant, member of the phosphoinositide 3-kinase related kinase but had no effect on p53 mutated at ser15 and ser37 (PIKK) family, in phosphorylation of p53 and inter- (Figure 3b). action with BARD1, we treated cells with caffeine and The interaction of BARD1 and p53 was also tested doxorubicin. Caffeine is a well-known inhibitor of with BARD1–EGFP fusion constructs, using antibodies PIKK kinase activity and as a result can effectively against p53 to co-immunoprecipitate BARD1–EGFP, inhibit the phosphorylation of p53ser-15. Doxorubicin on which was assayed with anti-EGFP antibodies on the other hand induces genotoxic stress on cells, Western blots (Figure 3c). To determine the specific consequently resulting in phosphorylation of p53 on region of BARD1 required for this interaction, BARD1- the same residues inhibited by caffeine. After treatment EGFP deletion constructs were used in transfection of HEK293T cells with 50 m M caffeine alone, we assays followed by immunprecipitations with anti-p53 observed a slight elevation in p53 levels as compared to antibodies. Interestingly, all deletion constructs co- untreated cells; however, there was no change in the immunoprecipitated with anti-p53 except RING-EGFP, phospho-p53 levels (Figure 4c). Doxorubicin treatment which represents the amino-terminal 89 amino acids of induces the expression of both p53 and BARD1, as BARD1 (Figure 3c, d). The minimal region required for described previously (Irminger-Finger et al., 2001; binding to p53 was deletion construct ANK-EGFP, Jefford et al., 2004). Since HEK293T cells have which was previously identified as the minimal region constitutive p53 expression, no significant changes in sufficient for apoptosis induction (Jefford et al., 2004). p53 levels with or without genotoxic stress were This finding suggests that the molecular pathway of observed. We did not observe substantial increase in BARD1 signaling towards apoptosis is based on its role phospho-p53 protein levels co-immunoprecipitating in p53 stabilization by phosphorylation. with BARD1 when treated with caffeine, but when Since p53 phosphorylation on serine 15 can be treated with doxorubicin. The combined treatment with induced by overexpression of BARD1, it was tempting caffeine and doxorubicin resulted in decreased phospho- to speculate that BARD1 might act as a mediator p53 levels in both the supernatant and pellet fractions of between p53 and its specific kinase. Phosphorylation of the BARD1 immunocomplexes (Figure 4c). This result p53ser-15 and p53ser-37 is required for p53 stabilization and provides further evidence that p53 is phosphorylated by for p53-dependent response to genotoxic stress (Shieh a PIKK family member and that this reaction might be et al., 1997; Tibbetts et al., 1999; Jack et al., 2004). catalysed by the presence of BARD1, since BARD1 A role of BARD1–BRCA1 complexes in phosphoryla- immunocomplexes contain both phosphorylated and tion of p53ser-15 in an ATM/ATR pathway has been unphosphorylated species of p53. The same immuno- described recently (Fabbro et al., 2004). We suspected precipitation extracts were probed with anti-ATM that DNA-PKkinase might be responsible for p53 ser-15 antibodies and no binding of ATM to BARD1 could phosphorylation in a BARD1-dependent pathway, since be observed (Figure 4c), thus supporting that DNA-PK DNA-PKcan phosphorylate p53 ser-15 upon genotoxic rather than ATM is responsible for BARD1-dependent stress (Woo et al., 1998, 2002) and DNA-PKand p53ser-15 phosphorylation. Ku-70, the active subunit of DNA-PK, are upregulated While p53 phosphorylation was induced in several cell in ATM/ATR-dependent stress response (Brown et al., types by exogenous expression of BARD1, this effect 2000; Shangary et al., 2000). Most recently, it was found was most striking in malignant ovarian cancer cells that Ku-70 mutation partially suppresses the homo- NuTu-19. NuTu-19 cells were generated by continuous logous-repair defects of BARD1 disruption (Stark et al., in vitro culture of ovarian epithelial cells leading to 2004), suggesting that both act in a common pathway. spontaneous malignant transformation (Rose et al., We performed co-immunoprecipitation assays with 1996). These cells lack full-length BARD1 protein anti-p53 antibodies, anti-Ku-70, the active subunit of (Figure 1b, c). Cloning and sequencing of the BARD1 DNA-PK, or anti-BARD1 antibodies to investigate the mRNAs expressed in NuTu-19 cells revealed that none interactions between DNA-PK, p53, and BARD1 of the cDNAs encoded a full-length BARD1 gene (Figure 4a). Immunoprecipitation assays, when per- (Figure 5a, c, d). The cDNA corresponding to the 2.2 kb

Oncogene BARD1 induces apoptosis A Feki et al 6

Figure 4 BARD1 interaction with p53 and DNA-PKsubunit Ku-70.( a) HEK293T (293T) nontransduced or transduced with BARD1 were used for immunoprecipitation assays with Ku-70, p53, and BARD1 antibodies. Supernatants (S) and pellet (P) fractions are shown. (b) NuTu-19 cells nontransduced or transduced with BARD1 were used to demonstrate BARD1–Ku-70 interaction. Little co-precipitation is observed in the absence of exogenous BARD1. Control experiment without antibodies shows no precipitation (beads). (c) P53 phosphorylation is induced (doxo) or inhibited (caffeine). Immunoprecipitation performed with BARD1 antibody C- 20 to show interaction between BARD1, phospho-p53, p53, and ATM. Supernatants (S) and pellet (P) fractions are shown

wild-type BARD1 transcript contained point mutations and the ankyrin repeats (Figure 5c, d). Therefore, leading to a premature translation stop at position 1786 NuTu-19 cells do not express full-length BARD1 between the ankyrin repeats (ANK) and the BRCT molecules and none of the BARD1 transcripts encode domains (Figure 5a). A smaller 2 kb fragment was due ANKrepeats and the region between ANKand BRCT. to deletion of exons 2 and 3. This mRNA species, herein Interestingly, nucleotides 1618–1641 represent an designated BARD1g, was similar to the testis-specific inverted repeat of region 804–826, which could act as mRNA BARD1b (Feki et al., 2004). This finding was antisense to abrogate the translation of BARD1, but not corroborated by Western blots performed with three BARD1d transcripts. Mutations and deletions in the different previously characterized anti-BARD1 antibo- BARD1 coding region were in strong contrast to the dies (Feki et al., 2004), which showed that full-length status of p53. Cloning and sequencing of the p53 cDNA BARD1 protein is absent in NuTu-19 cells (Figure 5b). from NuTu-19 cells revealed two polymorphisms, S66P HEK293T expressed a 94-kDa protein, detectable with and L192F, within the less conserved domains of p53, N-terminal antibodies H-300 and PVC, directed against but no mutations that predict structural changes of the the region adjacent to the RING finger, and JH3, encoded protein. directed against the regions between ANKand BRCT. We had evaluated the apoptotic activity of NuTu-19 None of the antibodies tested recognized a protein cells after treatment with UV or doxorubicin. NuTu-19 fragment corresponding to the molecular weight of full- cells show little response to apoptosis-inducing drugs length BARD1 in NuTu-19 cell extracts. Consistently, as measured by FACS and TUNEL assays. Doxorubi- the most abundant transcript of BARD1 in NuTu-19 cin treatment resulted in no significant increase of cells was an 800 bp RT–PCR product, a novel splice apoptotic cells as observed after TUNEL or 7AAD variant, hitherto named BARD1d. BARD1d lacks exons staining and flow cytometry analysis (Figure 6a). How- 2–7, which include regions coding for the RING finger ever, when we overexpressed wild-type BARD1 by

Oncogene BARD1 induces apoptosis A Feki et al 7

Figure 5 NuTu-19 cells lack full-length BARD1. (a) RT–PCR of p53 and BARD1 transcripts from NuTu-19 and control RT–PCR from TAC-2 cells. (b) Western blot of HEK293T and NuTu-19 cells probed with anti-BARD1 antibodies H-300, PVC, and JH-3. Expression of full-length 97 kDa BARD1 is observed in HEK293T but not in NuTu-19 cells. ( c) Schematic presentation of BARD1 protein with conserved regions RING, ankyrin (ANK) and BRCT, and epitopes for antibodies H-300, PVC, and JH-3 (l signs), aligned with RT–PCR products BARD1g and BARD1d. Triangles above indicate position of introns. Small arrows on BARD1g and BARD1d indicate position of inverted repeats. (d) Comparison of the deduced protein sequence of rat BARD1 with isoforms BARD1a, BARD1g, and BARD1d. Positions of point mutations leading to translation stop in BARD1a are indicated by asterisks, polymorphisms are in black. Boxed sequences indicate RING ﬁnger, ANK, and BRCT, respectively transient transfection, apoptosis was induced to a with wild-type BARD1 cloned into a lentiviral vector similar extent in NuTu-19 cells as in nonmalignant under the transcriptional control of a tetracycline- control cells, TAC-2. We also transduced NuTu-19 cells inducible promoter. Induction of BARD1 by increasing

Oncogene BARD1 induces apoptosis A Feki et al 8

Figure 6 Expression of BARD1 reverses apoptosis resistance in NuTu-19 cells. (a) TUNEL assay on NuTu-19 ovarian cancer cells or nonmalignant TAC-2 cells with or without treatment with doxorubicin (doxo) or transfection of BARD1. Percentage of TUNEL- positive cells was quantified by flow cytometry. (b) NuTu-19 cells and NuTu-19 transduced with lentiviral vector containing BARD1 were monitored for apoptosis. Cells were incubated with or without doxycyclin to induce BARD1 expression, or with doxorubicin (doxo). (c) Dose response of BARD1-induced phosphorylation is observed after transduction of NuTu-19 cells with BARD1. Nontransduced (0), transduced (1 Â ), or transduced with threefold (3 Â ) concentration of BARD1 expression viral vector, cells were probed on Western blot with anti-phospho-ser15 p53-specific antibody

doxycyclin levels clearly resulted in apoptosis in a dose- endogenous wild-type BARD1, overexpression of exo- dependent manner (Figure 6b). However, BARD1 genous BARD1 is sufficient to stabilize p53 and to expression and apoptosis in response to doxorubicin in induce p53ser-15 phosphorylation. In BARD1-deficient nontransduced NuTu-19 cells was comparable to back- NuTu-19 cells, phosphorylation of p53 cannot be ground levels of apoptosis induction in BARD1- induced by apoptosis-inducing drugs, but by the transduced cells without induction of gene expression exogenous expression of wild BARD1, without other by doxycyclin. stress signals, suggesting that BARD1 facilitates the Similarly, we tested p53-phosphorylation on p53ser15 phosphorylation of p53 by binding to p53 and Ku-70, as dose response to BARD1 expression levels in NuTu- the subunit of DNA-PK, and that this is sufficient and 19 cells. Nontransduced cells and cells transduced with required for apoptosis induction. increasing amounts of BARD1 expression vectors were compared on Western blots. Phospho-p53ser15 increase was observed in a dose-dependent manner on Western blots probed with antibodies against phospho-p53ser15 Discussion (Figure 6c). This experiment proved that expression of wild-type In the present study we demonstrate that BARD1 plays BARD1 could reverse apoptosis resistance in cells a critical role in phosphorylation of p53, which is lacking full-length BARD1. In nonmalignant cells with required for its apoptotic function. Several kinases

Oncogene BARD1 induces apoptosis A Feki et al 9 involved in p53 activation have been reported (Lu et al., suggesting that few genetic modifications led to 1997; Shieh et al., 1997, 1999; Tibbetts et al., 1999; the phenotype of resistance to undergo apoptosis. Hirao et al., 2000) and ATM/ATR-dependent phos- This process mimics the in vivo situation, as it has phorylation of p53ser-15, implicating BRCA1–BARD1 been hypothesized that proliferation associated with complexes, has been described very recently (Fabbro ovarian repair contributes to the risk of ovarian cancer et al., 2004). in humans (Fathalla, 1972). We speculated and confirmed It was shown before that BRCT domains, a protein here that one of the critical mutations for malignant motif also present in BARD1 and BRCA1, have transformation involves the tumor suppressor BARD1. phospho-epitope-binding capacities (Rodriguez et al., Indeed, rat ovarian cancer cells, NuTu-19, have 2003). A phospho-epitope-binding function was re- applied several strategies to eliminate the expression of ported specifically for BRCT domains of BRCA1. functional BARD1: mutations leading to a truncated BRCT domains are present in many other repair form of the protein, differential splicing leading to the proteins and seem to facilitate physical interactions deletion of essential parts of the protein, and possibly among proteins involved in the cellular response to repression of the partially active forms of the protein by DNA damage check point control and DNA repair expression of a short inverse repeat sequence that could (Bork et al., 1997; Callebaut and Mornon, 1997). It is function as antisense RNA in transcriptional repression speculated that BRCT domains are important modules of wild-type forms of BARD1. These mechanisms of for tumor suppressor functions, supported by cancer- inhibition of BARD1 function are consistent with the associated mutations within the BRCT domain of hypothesis that BARD1 is an essential tumor suppres- BRCA1 (Williams et al., 2001). sor, critical for apoptosis induction upon damage, by BARD1 contains tandem BRCT motifs, it has tumor stabilizing p53 (Irminger-Finger et al., 2001). BARD1 suppressor functions (Irminger-Finger and Leung, binding to p53 could also influence p53 stability by 2002), and it binds and stabilizes p53 (Irminger-Finger inhibiting its ubiquitination and/or its binding to et al., 2001) which is suggestive of a role in a pathway of MDM2 (Meek, 1994; Honda et al., 1997; Milczarek p53 phosphorylation. Here we show that, indeed, et al., 1997). BARD1 binds to p53 and phospho-p53 and, secondly, Consistently, no phosphorylation of p53 is observed in BARD1 interacts with the DNA-PKsubunit, Ku-70, NuTu-19 cells in the absence of exogenous expression of but not ATM. The region sufficient for p53 interaction wild-type BARD1. Co-immunoprecipitation experiments and apoptosis induction comprises ANK, the region suggest that BARD1 binds both the kinase and its between ANKand BRCT, and part of the BRCT respective target p53 and catalyses its phosphory- domains. It is possible that the BRCT domains are lation. This could be explained mechanistically by a binding to the kinase and that its target is binding to the higher affinity between BARD1 and Ku-70 and between adjacent region. BARD1 and p53 than between p53 and Ku-70. Our data Ku-70 is abundantly expressed in HEK 293T cells, as support this view, since co-immunoprecipitations of is p53, as compared to BARD1. Nevertheless, over- BARD1 and p53 or BARD1 and Ku-70 are more expression of BARD1, without an additional stimulus efficient than co-immunoprecipitations of p53 and Ku- through DNA damage, causes p53 phosphorylation in 70. In addition, BARD1 protein levels are considerably HEK293T cells and NuTu-19 cells, suggesting that lower in the cell than either p53 or Ku-70, therefore BARD1 is an essential and limiting partner for the BARD1 can be regarded as the critical and limiting formation of the p53–DNA–PKcomplex. Consistent factor in the formation of the p53/Ku-70 complexes. with this view, BARD1 co-localizes with phospho-p53 in Furthermore, the overexpression of BARD1 alone with- distinct nuclear dots (Figure 5b). Since overexpression out induction of the DNA damage pathway is sufficient of BARD1 is sufficient for p53ser15 phosphorylation, for p53 phosphorylation and supports the view that binding of BARD1 to the kinase and its target catalyses BARD1 catalyses p53 phosphorylation by DNA-PK. p53 phosphorylation. Supporting this view, several cancer-associated missense mutations (Thai et al., 1998; Ghimenti et al., 2002; Ishitobi et al., 2003), map to the region defined sufficient Materials and methods for p53 binding and apoptosis induction, and it is deleted or mutated in the NuTu-19 cells, described here. Cell cultures It is likely that BARD1 deficiencies are frequent in The HEK293T cell line, as well as HeLa cells, were obtained cancer cells that have wild-type p53 but are resistant to from the ATCC. NuTu-19 cells (Rose et al., 1996) were a apoptosis, and significant changes in BARD1 expression generous gift from Dr Attila Major, Geneva, PC3, human have been found associated with malignancies (Pomeroy prostate cancer cells, were obtained from Dr Timothy et al., 2002; Iyengar et al., 2003; Schafer et al., 2003; MacDonnell, Houston. All cell lines were cultured in 10 cm plastic tissue culture dishes (NUNC, Roskilde, Denmark) and Zuco et al., 2003). The NuTu-19 ovarian cancer cells, incubated at 371C in humidified air containing 5% CO2. to some extent, are a model of ovarian cancer, which Adherent subcultures were detached from culture dishes using suggests that BARD1 is a key target for mutations a solution of Trypsin/EDTA in HBSS without Ca2 þ or Mg2 þ . leading to carcinogenesis. NuTu-19 cells are derived Subconfluent cell cultures were passaged regularly at 1 : 10 from a spontaneous transformation of continuously dilution approximately twice a week. All cell culture media, cultured ovarian epithelial cells (Rose et al., 1996), solutions, buffers, and antibiotics were purchased from

Oncogene BARD1 induces apoptosis A Feki et al 10 GIBCO (Invitrogen AG, Basel, Switzerland). HEK293T cells to PCR analysis using specific primers for rat BARD1 cDNA were pretreated for 1 h with 50 mM caffeine, after which they (covering BARD1 coding regions) and rat p53 (covering p53 were either treated with doxorubicin (50 mg/ml) or left coding regions). PCR cycles were: 941C for 15 min, 941C for untreated as described previously (Irminger-Finger et al., 1 min, 561C for 1 min, 721C for 2 min 30 s for BARD1 and 1998). 1 min 30 s for p53 (35 Â ), then 721C for 10 min. Equal volumes of PCR products were analysed on 1% agarose gel. Western blotting For Western blots, protein extracts from cell cultures were Lentiviral vector production and transduction prepared in standard lysis buffer (150 mM NaCl, 0.1% SDS, The packaging constructs used in this study were the 50 mM Tris (pH 8.0)). Equal concentrations of all whole cell pCMVDR8.92 and the pCMVDR8.93 plasmids described extracts per gel were loaded onto SDS–PAA gels according to previously (Dull et al., 1998). The vesicular stomatitis virus Laemmli’s protocol and were transferred to polyvinylidene G (VSV-G) envelop was the pM2DG plasmid (Zufferey et al., fluoride (PVDF) membranes. Filters were blocked for 1 h in 1997). The BARD1 coding sequence was cloned into the PBS containing 5% non-fat milk and then incubated at room carrier pLOXEW plasmid (Zufferey et al., 1997). The viral temperature for 2 h with a polyclonal BARD1 (Irminger- particles were produced using the usual transient transfection Finger et al., 1998), p53 and P-p53 (Santa Cruz) antibodies. method (Zufferey et al., 1997). The 293T cells (2.8 Â 106 cells in After washing, membranes were incubated with horseradish 10-cm tissue culture dishes) were co-transfected with either peroxidase-conjugated secondary antibody and the resulting 10 mg of pLOXEW-BARD1 ires-GFP, 3.75 mgof complexes were visualized by an enhanced chemiluminescence pCMVDR8.92, 3.75 mg of pCMVDR8.93, and 2.5 mgof (ECL) system (Boehringer). pM2DG, or 10 mg of pHR0-CMV-BARD1, 3.75 mgof pCMVDR8.92, 3.75 mg of pCMVDR8.93, and 2.5 mgof Immunoprecipitation pM2DG. Immunoprecipitation was performed by homogenizing cell After an overnight incubation in the presence of the samples in 100 ml (100–150 mg total protein) RIPA buffer precipitate, the culture medium (10 ml) was changed. Two (150 mM NaCl, 1% NP-40, 0.5% NaDOC, 0.1 SDS, 50 mM days later, the supernatant was harvested, filtered through Tris (pH 8.0), and 2 mM EDTA (pH 8.0)). Cells extracts were 0.45-mm pore-sized polyethersulfone membrane and subse- incubated with p53 antibody (FL-393 Santa Cruz), or GFP quently 1 ml of each was added to NuTu-19 target cells in six- 4 antibody (Torrey Pines Biolabs, Inc) in a 1 : 200 dilution over well plates (10 cells/well). Vector particles were left on the cells night, followed by incubation with sepharose-bound protein G for 3 days. Transduction efficiency was monitored using a for 3 h. Extracts were centrifuged, and pellets were washed GFP-expressing vector. twice with RIPA buffer and re-suspended in 100 ml RIPA buffer. In all, 25 ml of supernatant and pellet fractions was Plasmid constructions and transfection analysed by Western blotting. Total protein content in supernatant and pellet fractions was compared by fast green Different BARD1 mutants fused with GFP, was described staining after protein transfer and was 90–10% at least. previously, were used. Briefly, the full-length mouse BARD1 Antibody reactive bands were visualized, scanned, and cDNA (Irminger-Finger et al., 1998) was used to generate the quantified using Imagequant. deletion constructs in pcDNA3 behind a CMV promoter. The plasmid pEGFP-N1 (enhanced green fluorescent protein) was Antibodies purchased from Clontech and was used to generate either the full-length BARD1–EGFP or BARD1 deletion-bearing mu- The anti-BARD1 (H300), anti-p53 (FL-393), and anti- tants fused in-frame with the EGFP tag. The deletion-bearing phospho p53 ser15 antibodies (Cell Signaling 5284) were constructs were the same as described (Jefford et al., 2004). purchased from Santa Cruz. Anti-GFP (TP-401) was pur- HEK293T cells were seeded in 10 cm petri dishes and chased from Chemokine (Torrey Pines Biolabs, Houston, TX, transfected with 2 mg of DNA using the Effectene reagents USA). WFS is a previously described anti-BARD1 antibody from Qiagen. Cells were harvested 48 h post-transfection. (Gautier et al., 2000). Horseradish peroxidase (HRP)-conjugated secondary antibodies were purchased from Santa Cruz and were compatible with Cruz Molecular Weight Markers Acknowledgements (Santa Cruz, CA, USA). We are grateful to MH Sow, A Caillon, and C Genet for technical help. We are specifically indebted to Dr A Major for supply and sharing of expertise in the NuTu-19 cell line. We RT–PCR are grateful to G Del Sal for his generous gift of expression Total RNA was purified from NuTu-19 cells using Qiagen plasmids of the p53 mutants and T McDonnell for PC3 cell reagent. RNA was reverse transcribed using oligo-dT and line. This work was supported by grant 3100-068222 from the superscript II (Life Technologies). RT products were subjected Swiss National Science Foundation to IIF and KHK.

References

Baer R and Ludwig T. (2002). Curr. Opin. Genet. Dev., 12, Chehab NH, Malikzay A, Stavridi ES and Halazonetis TD. 86–91. (1999). Proc. Natl. Acad. Sci. USA, 96, 13777–13782. Bork P, Hofmann K, Bucher P, Neuwald AF, Altschul SF and Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D Koonin EV. (1997). FASEB J., 11, 68–76. and Naldini L. (1998). J. Virol., 72, 8463–8471. Brown KD, Lataxes TA, Shangary S, Mannino JL, Giardina Fabbro M, Kienan S, Hobson K, Deans AJ, Powell SN, JF, Chen J and Baskaran R. (2000). J. Biol. Chem.., 275, McArthur GA and Khanna KK. (2004). J. Biol. Chem., 279, 6651–6656. 31251–31258. Callebaut I and Mornon JP. (1997). FEBS Lett., 400, 25–30. Fathalla MF. (1972). Obstet Gynecol. Surv., 27, 751–768.

Oncogene BARD1 induces apoptosis A Feki et al 11 Feki A, Jefford CE, Durand P, Harb J, Lukas H, Krause K-H McCarthy EE, Celebi JT, Baer R and Ludwig T. (2003). Mol. and Irminger-Finger I. (2004). Biol. Reprod., 71, 1614–1624. Cell. Biol., 23, 5056–5063. Gautier F, Irminger-Finger I, Gregoire M, Meﬂah Kand Harb Meek DW. (1994). Semin. Cancer Biol., 5, 203–210. J. (2000). Cancer Res., 60, 6895–6900. Milczarek GJ, Martinez J and Bowden GT. (1997). Life Sci., Ghimenti C, Sensi E, Presciuttini S, Brunetti IM, Conte P, 60, 1–11. Bevilacqua G and Caligo MA. (2002). Genes Chromosomes Oda K, Arakawa H, Tanaka T, Matsuda K, Tanikawa C, Cancer, 33, 235–242. Mori T, Nishimori H, Tamai K, Tokino T, Nakamura Y Hao M, Lowy AM, Kapoor M, Defﬁe A, Liu G and Lozano and Taya Y. (2000). Cell, 102, 849–862. G. (1996). J. Biol. Chem., 271, 29380–29385. Pomeroy SL, Tamayo P, Gaasenbeek M, Sturla LM, Angelo Hashizume R, Fukuda M, Maeda I, Nishikawa H, Oyake D, M, McLaughlin ME, Kim JY, Goumnerova LC, Black PM, Yabuki Y, Ogata H and Ohta T. (2001). J. Biol. Chem., 276, Lau C, Allen JC, Zagzag D, Olson JM, Curran T, Wetmore 14537–14540. C, Biegel JA, Poggio T, Mukherjee S, Rifkin R, Califano A, Hirao A, Kong YY, Matsuoka S, Wakeham A, Ruland J, Stolovitzky G, Louis DN, Mesirov JP, Lander ES and Yoshida H, Liu D, Elledge SJ and Mak TW. (2000). Science, Golub TR. (2002). Nature, 415, 436–442. 287, 1824–1827. Rodriguez M, Yu X, Chen J and Songyang Z. (2003). J. Biol. Honda R, Tanaka H and Yasuda H. (1997). FEBS Lett., 420, Chem., 278, 52914–52918. 25–27. Rose GS, Tocco LM, Granger GA, DiSaia PJ, Hamilton TC, Honda T, Kagawa S, Spurgers KB, Gjertsen BT, Roth JA, Santin AD and Hiserodt JC. (1996). Am. J. Obstet. Gynecol., Fang B, Lowe SL, Norris JS, Meyn RE and McDonnell TJ. 175, 593–599. (2002). Cancer Biol. Ther., 1, 163–167. Schafer R, Tchernitsa OI, Zuber J and Sers C. (2003). Adv. Iyengar P, Combs TP, Shah SJ, Gouon-Evans V, Pollard JW, Enzyme Regul., 43, 379–391. Albanese C, Flanagan L, Tenniswood MP, Guha C, Scully R, Chen J, Ochs RL, Keegan K, Hoekstra M, Feunteun Lisanti MP, Pestell RG and Scherer PE. (2003). Oncogene, J and Livingston DM. (1997). Cell, 90, 425–435. 22, 6408–6423. Shangary S, Brown KD, Adamson AW, Edmonson S, Ng B, Irminger-Finger I and Leung WC. (2002). Int. J. Biochem. Cell Pandita TK, Yalowich J, Taccioli GE and Baskaran R. Biol., 34, 582–587. (2000). J. Biol. Chem., 275, 30163–30168. Irminger-Finger I, Leung WC, Li J, Dubois-Dauphin M, Shieh SY, Ikeda M, Taya Y and Prives C. (1997). Cell, 91, Harb J, Feki A, Jefford CE, Soriano JV, Jaconi M, 325–334. Montesano R and Krause KH. (2001). Mol. Cell, 8, Shieh SY, Taya Y and Prives C. (1999). EMBO J., 18, 1255–1266. 1815–1823. Irminger-Finger I, Soriano JV, Vaudan G, Montesano R and Stark JM, Pierce AJ, Oh J, Pastink A and Jasin M. (2004). Sappino AP. (1998). J. Cell. Biol., 143, 1329–1339. Mol. Cell. Biol., 24 (21), 9305–9316. Ishitobi M, Miyoshi Y, Hasegawa S, Egawa C, Tamaki Y, Thai TH, Du F, Tsan JT, Jin Y, Phung A, Spillman MA, Monden M and Noguchi S. (2003). Cancer Lett., 200, 1–7. Massa HF, Muller CY, Ashfaq R, Mathis JM, Miller DS, Jack MT, Woo RA, Motoyama N, Takai H and Lee PW. Trask BJ, Baer R and Bowcock AM. (1998). Hum. Mol. (2004). J. Biol. Chem., 279, 15269–15273. Genet., 7, 195–202. Jefford CE, Feki A, Harb J, Krause KH and Irminger-Finger Tibbetts RS, Brumbaugh KM, Williams JM, Sarkaria JN, I. (2004). Oncogene, 23, 3509–3520. Cliby WA, Shieh SY, Taya Y, Prives C and Abraham RT. Jin Y, Xu XL, Yang MC, Wei F, Ayi TC, Bowcock AM (1999). Genes Dev., 13, 152–157. and Baer R. (1997). Proc. Natl. Acad. Sci. USA, 94, Williams RS, Green R and Glover JN. (2001). Nat. Struct. 12075–12080. Biol., 8, 838–842. Joukov V, Chen J, Fox EA, Green JB and Livingston DM. Woo RA, Jack MT, Xu Y, Burma S, Chen DJ and Lee PW. (2001). Proc. Natl. Acad. Sci. USA, 98, 12078–12083. (2002). EMBO J., 21, 3000–3008. Karppinen SM, Heikkinen K, Rapakko K and Winqvist R. Woo RA, McLure KG, Lees-Miller SP, Rancourt DE and Lee (2004). J. Med. Genet, 41, e114. PW. (1998). Nature, 394, 700–704. Knippschild U, Milne DM, Campbell LE, DeMaggio AJ, Wu LC, Wang ZW, Tsan JT, Spillman MA, Phung A, Xu XL, Christenson E, Hoekstra MF and Meek DW. (1997). Yang MC, Hwang LY, Bowcock AM and Baer R. (1996). Oncogene, 15, 1727–1736. Nat. Genet., 14, 430–440. Kohn KW. (1999). Mol. Biol. Cell, 10, 2703–2734. Yu X, Chini CC, He M, Mer G and Chen J. (2003). Science, Lakin ND and Jackson SP. (1999). Oncogene, 18, 7644–7655. 302, 639–642. Levine AJ. (1997). Cell, 88, 323–331. Zacchi P, Gostissa M, Uchida T, Salvagno C, Avolio F, Lohrum M and Scheidtmann KH. (1996). Oncogene, 13, Volinia S, Ronai Z, Blandino G, Schneider C and Del Sal G. 2527–2539. (2002). Nature, 419, 853–857. Lu H, Fisher RP, Bailey P and Levine AJ. (1997). Mol. Cell. Zuco V, Supino R, De Cesare M, Carenini N, Perego P, Gatti Biol., 17, 5923–5934. L, Pratesi G, Pisano C, Martinelli R, Bucci F, Zanier R, Ludwig T, Fisher P, Ganesan S and Efstratiadis A. (2001). Carminati P and Zunino F. (2003). Biochem. Pharmacol., 65, Genes Dev., 15, 1188–1193. 1281–1294. Manke IA, Lowery DM, Nguyen A and Yaffe MB. (2003). Zufferey R, Nagy D, Mandel RJ, Naldini L and Trono D. Science, 302, 636–639. (1997). Nat. Biotechnol., 15, 871–875.

Oncogene Results submitted for publication 5. BARD1 interacts with BRCA2 to regulate cytokinesis and maintain genomic stability Jefford CE, Delaval B, Ryser S, Birnbaum D, Irminger-Finger I. BRCA1, BRCA2 and BARD1 are caretaker proteins and bona fide tumour suppressors since mutation in either of these genes is sufficient for tumour initiation. Furthermore, a knockout of either of the aforementioned gene in mice induces early embryonic death due to proliferation defects and not to apoptosis. Tumour cells with mutated BRCA1, BRCA2 or BARD1 exhibit definite chromosomal instability; repression of either of these genes in cultured cells by knockdown experiments causes genomic instability, the hallmark of all tumour cells. In this study we investigate further the mechanisms that link BARD1-mediated tumour suppression and maintenance of genomic stability. It was shown by us and others that BARD1 expression is not only augmented upon genotoxic stress, but is also regulated during cell cycle. Here, we show by antibody staining that BARD1 is highly expressed during mitosis in several cell lines and it co-localizes with microtubule spindle. We showed that this staining is specific since the polyclonal antibody used recognizes the BARD1-EGFP constructs with the N-terminal domain and not the RING deleted BARD1-EGFP recombinants. Knockdown of BARD1 expression by transducing a anti-BARD1 shRNA results in slower cell cycles, delayed cytokinesis, and incompletion of mitosis. Furthermore, this phenotype is often accompanied by failure of efficient chromosome segregation as indicated by the appearance of aberrant karyotypes. Finally, we showed that BARD1 co-immunoprecipitates with Aurora B, but not with Aurora A. For the first time we reveal an interaction of BARD1 with BRCA2 in the regulation of cytokinesis, since BARD1 co-immunoprecipitates with BRCA2 during the G2/M phase of the cell cycle. These data give us new evidence that BARD1 may regulate cell-cycle progression through the Aurora B kinase pathway for completion of cytokinesis. The mechanisms involved in cell-cycle regulation and cytokinesis are not fully understood, but could be controlled by the ubiquitin ligase activity of BARD1/BRCA1 dependant on AuroraB phosphorylation. Cytogenetic analysis was provided by Sarantis Gagos, while some of the IPs were done in collaboration with the Birenbaum laboratory.

97 Jefford et al. 1 Nature Cell Biology Letter

Inhibition of cytokinesis after BARD1 depletion causes genomic instability

Charles Edward Jefford1, Bénédicte Delaval2, Stephan Ryser1#, Sarantis Gagos3#, Daniel Birnbaum2, and Irmgard Irminger-Finger1*

1Biology of Aging Laboratory, Department of Geriatrics, Geneva University Hospitals, Geneva, Switzerland 2Institut de Cancérologie de Marseille, Laboratoire d'Oncologie Moléculaire, UMR599 Inserm- Institut Paoli-Calmettes, Marseille, France 3Laboratory of Genetics, Foundation of Biomedical Research, Academy of Athens, Greece # These authors were contributing equally

*to whom correspondence should be addressed:

Dr. Irmgard Irminger-Finger Biology of Aging Laboratory Dept. of Rehabilitation and Geriatrics University and University Hospitals Geneva Chemin de Petit Bel Air 2 CH-1225 Geneva/Chêne-Bourg Switzerland Tel: +41 22 305 54 57 Fax: +41 22 305 54 55 E-Mail: [email protected] http://www.medecine.unige.ch/recherche/biologie_du_vieillissement/

Key words: BARD1, BRCA1, BRCA2, TACC1, Aurora B, cytokinesis, chromosomal instability Jefford et al. 2

Mutations in BARD1 (BRCA1 associated Ring protein1) are associated with breast and ovarian cancer2-5, and BARD1 repression leads to genomic instability6-8. Genomic instability is also the hallmark of cancers with in BRCA1 and BRCA2 mutations9. The BRCA1-BARD1 complex controls centrosome amplification through ubiquitin ligase activity10, and BRCA2 is involved in regulation of cytokinesis11, both mechanisms that are required for accurate chromosome segregation. Here we report that BARD1, overexpressed during mitosis12,13, is localized to the mitotic spindle and to the midbody at telophase and cytokinesis. In mitotic extracts BARD1 interacts with TACC1, Aurora B, and BRCA2, proteins with similar location and repression phenotypes at cytokinesis11,14. siRNA depletion of BARD1 leads to Aurora B stabilization on the midbody and inhibition of abscission of inter-sister cell microtubule bridges, associated with numerical and structural chromosomal instability. These findings suggest that BARD1 is required for regulation of Aurora B displacement/stability in a complex of BARD1-AuroraB-

BRCA2 that controls progression through cytokinesis.

A common feature of BRCA1, BRCA2, and BARD1 knock-out mice is embryonic lethality8, 15-

18, underscoring that these genes are vital for a variety of cellular events10, 19. During mitosis,

BRCA2 localizes to the midbody where it is involved in cytokinesis, as demonstrated by siRNA depletion of BRCA2, which impedes cell separation11. In contrast to BRCA2, BRCA1 is localized to centrosomes at anaphase onset, where in association with BARD1, it acts as E3 ubiquitin-ligase on γ-tubulin10. This is substantiated by the fact that abrogation of BRCA1 leads to excessive centrosome duplication, incurring genomic instability10, 20. BARD1 is the major protein binding partner of BRCA11 , and some of the functions of BARD1 are tightly linked to the ubiquitin ligase activity of the BARD1/BRCA1 heterodimer21. However, independently of

BRCA1, BARD1 upregulation mediates apoptosis induction by catalyzing p53 phosphorylation22, 23. Jefford et al. 3 Upregulated expression of BARD1 is also observed in mitotic cells12, 13, suggestive of its implication in mitotic mechanisms. To further characterize BARD1 expression and function in mitosis, indirect immunofluorescence was performed on non-synchronized cell populations.

Consistently BARD1 levels were increased in mitotic cells (Fig. 1A). BARD1 staining was accumulated around and along the mitotic spindle (Fig. 1B). This intracellular localization of

BARD1 during mitosis was observed when using different anti-BARD1 antibodies in different cell lines and across species, such as in human HeLa, MCF-7 (data not shown), PC3, and mouse non-malignant mammary gland TAC-2 cells6. Omission of the primary antibody or competition with blocking peptides did not lead to significant staining. The specificity of BARD1 staining was further confirmed with anti-BARD1 antibody H-300, directed against the N-terminal 300 amino acids, on cells expressing exogenous BARD1-EGFP fusion proteins or BARD1-EGFP deletion constructs (Support data Fig. 1A). Co-localization of anti-BARD1 staining and EGFP- fluorescence was observed with full length BARD1 and ∆-RING-EGFP but not with ∆-HIND-

EGFP, a deletion of the N-terminal coding half, or EGFP alone. This demonstrates that BARD1 antibodies specifically recognize epitopes in the amino terminus of BARD1 (Support data Fig.

1B).

To further ascertain the localization of BARD1 on mitotic microtubules (MT), we performed double-immuofluorescence staining with antibodies against BARD1 and against β-tubulin in three different cell lines. Clearly, BARD1 colocalizes with spindle MT, as demonstrated in metaphase cells (Fig. 1C). The localization to spindle MT is nearly exclusive in HeLa cells, but additional cytoplasmic staining is observed in PC3 and to some extent in TAC-2 cells. BARD1 concentration on MT seems much higher than the tubulin concentration; or, anti-BARD1 staining might be competitive for anti-tubulin staining, since the tubulin stain is less intense when the anti-BARD1 stain is strong in double labeling experiments. The upregulation of BARD1 during mitosis might be controlled at the protein level by CDK2, which regulates its ubiquitin ligase function13. Jefford et al. 4 We then investigated the association of BARD1 with MT at different stages of the cell cycle.

BARD1 localizes to spindle MT at all stages of cell cycle (Fig. 2). While nuclear dots and some cytoplasmic staining could be observed in typical interphase cells (Fig. 2A, S-phase merge), most

BARD1 was localized to MT emanating from the spindle poles at metaphase and anaphase.

BARD1 and β-tubulin co-localization was observed as yellow staining, and BARD1 and DNA co-localization as pink staining (Fig. 2B), indicating that a fraction of BARD1 co-localized with

MT and a small fraction with chromosomes. BARD1 and MT co-localization was specifically observed at anaphase (Fig. 2B). Excessive BARD1 staining was also observed at the spindle midzone and at cytokinesis at the midbody (Fig. 2A-B). While BARD1 staining was more abundant than tubulin staining from anaphase to telophase, similar intensities were observed at cytokinesis. During the furrowing of the cleavage plane, and until the end of cytokinesis, BARD1 staining intensified along the spindle midzone and even more so at the midbody.

These localizations of BARD1 at different stages of mitosis suggest that BARD1 migrates along

MT from the spindle pole to the midzone and accumulates at the midbody. While at onset of anaphase, BARD1 could act with BRCA1 as ubiquitin ligase on γ-tubulin10, functions at later stages of mitosis could be suspected.

Among the proteins that also localize to the midzone during anaphase and to the midbody during cytokinesis, are BRCA211 and transforming acidic coiled-coil-containing protein (TACC1)14.

TACC proteins are involved in MT stabilization and abnormal centrosome formation, and have been implicated in cancer progression (reviewed in24). TACC1 colocalizes and forms a functional complex with the mitotic kinase Aurora B during cytokinesis14. Aurora B depletion by siRNA- mediated interference prevents the formation of the midbody, consequently affects TACC1 localization to the midbody, and leads to abnormal cell division and multinucleated cells, a phenotype resembling BARD1 antisense depletion6. Since BARD1 localizes to the spindle midzone at anaphase and at the midbody during telophase and cytokinesis, we asked whether Jefford et al. 5 BARD1 interacted with TACC1 and Aurora B. TACC1 as a MT stabilizing protein could have an adaptor function for localization of BARD1 on MT.

Co-immunoprecipitation experiments were performed with anti-TACC1 and anti-BARD1 antibodies. When probing HeLa cell extracts, from non-synchronized cells or cells blocked at different stages of the cell cycle, BARD1 co-precipitated with TACC1 in cells blocked at the

G1/S or at the G2/M border (Fig. 3A). When co-immunoprecipitation experiments were performed with TACC1 antibodies and Western blots were probed with anti-BARD antibodies,

BARD1 was co-immunoprecipitated with TACC1 mostly in mitotic cells (Fig. 3B). An increase of BARD1 was observed in mitotic cell extracts. BARD1 protein appeared as a double band of

97 kD and slightly larger, which could represent the phosphorylated and unphosphorylated forms13. The fraction of BARD1 co-precipitating with TACC1 in mitotic cells corresponded to the lower, presumably unphosphorylated form. No co-immunoprecipitation of BARD1 was found in the control assay with beads only. The reverse experiment showed that anti-BARD1 antibodies co-precipitated TACC1 (Fig. 3B). In contrast to BARD1, TACC1 expression was not increased during mitosis and only a fraction of TACC1 was co-immunoprecipitated with

BARD1, but the interaction was restricted to cells arrested in G2/M. As for BARD1, TACC1 antibodies recognized an additional band with slightly higher molecular weight, which was increased in G2/M total lysates (Fig. 3A-B*). These results show that BARD1 and TACC1 interact in G2/M phase of the cell cycle and suggest a role for both proteins in a common pathway.

It was shown previously that TACC1 is coexpressed temporally and spatially with Aurora B, a mitotic kinase, critical for progression through mitosis25, 26. We therefore tested the BARD1-

Aurora B interaction. Western blots of anti-BARD1 immunoprecipitations were probed with antibodies against Aurora A and B (Fig. 3C). Both Aurora A and B levels were increased in G1/S and more in G2/M blocked cell extracts. However, co-immunoprecipitation with anti-BARD1 Jefford et al. 6 antibodies was only observed in G2/M cell extracts and only for Aurora B. This observation is consistent with the specific subcellular localization of TACC1 and Aurora B and their potential roles at the exit of mitosis14, in contrast to the localization of Aurora A, which acts with

BRCA127 at the spindle poles in centrosome duplication. The BRCA2 protein had also been localized to the midbody11 and we therefore tested coimmuneprecipitation of BRCA2 with

BARD1. BRCA2 was binding to BARD1, in mitotic extracts, while the bona fide binding partner

BRCA1 was binding to BARD1 in cell extracts of cells blocked at G1/S and at G2/M. This data suggest that during mitosis BARD1 sequentially interacts with BRCA1 and BRCA2. The specific interaction of BARD1 and BRCA2 in mitotic extracts suggests that BARD1 acts in a pathway involving TACC1, Aurora B, and BRCA2.

To assess the role of BARD1 during mitosis, we abrogated BARD1 expression in HeLa, MCF-7,

PC-3, and TAC-2 cells with siRNA and monitored the resulting phenotype. Immunofluorescence microscopy was performed on cells transciently transfected with BARD1 siRNA expressed from a constitutive promoter, using anti-BARD1 and anti–tubulin antibodies. When harvesting cells 36 hours after transfection, we observed a striking phenotype of cells cycle arrest in mitosis, specifically an accumulation of cells at late telophase (Fig. 4A). MT staining showed that separated sister cells at cytokinesis were connected by MT bridges, while exhibiting decondensed chromosomes. The number of cells connected by midbody bridges was ten fold increased in the siRNA treated cells, as compared to non-treated cells (Fig. 4B). Depletion of BARD1 was specific, since siRNA against mouse BARD1 had not effect, compared to mock or human siRNAs, as shown on Western blots (Fig. 4C). Residual expression of BARD1 is not found on

MT bridges when double labeling with anti-tubulin and anti-BARD1 antibodies was performed

(Fig. 4D) as compared to wild type cells (Fig. 2B). Thus, the depletion of BARD1 by siRNA leads to a delay or arrest of cell cycle in cytokinesis and suggests that BARD1 might be required for proper abscission of inter-sister cells MT bridges. Jefford et al. 7 We investigated the localization of TACC1, Aurora B and BRCA2 in BARD1 depleted cells and found striking differences in expression and localization for Aurora B (Fig. 4E), but not TACC1 or BRCA2 (data not shown). Aurora B localizes to distinct dots on inter-sister cells MT bridges, bracketing the abscission point14. Unlike the specific and exclusive localization of Aurora B to

MT bridges at cytokinesis in wild type cells, in BARD1 repressed cells Aurora B dots are larger and their location is less precise. Aurora B sustained on the cell membrane of daughter cells after cytokinesis (Fig. 4E), while in wild type cells Aurora B dislocates to interphase nuclei of sister cells. No differences were observed for Aurora B staining at other stages than cytokinesis. These findings suggest that BARD1 controls Aurora B stability at the exit of mitosis.

Since the BARD1 depletion phenotype is reminiscent of the Aurora B depletion phenotype, which also causes aneuploidy, it is suggestive that the interaction of BARD1 with Aurora B is functionally significant. Malfunction of chromosome segregation due to a delayed and abnormal cell division, could be caused by a deficient Aurora B- BARD1 complex.

The phenotype of BARD1 deficiency is also similar to the phenotype induced by siRNA inhibition of BRCA2, in particular the phenotype of the BRCA2 mutation Capan-111. Like the

Capan-1 mutation, BARD1 siRNA inhibition leads to the accumulation of cells with elongated midbodies. BARD1 and BRCA2 localize to the same regions during the late stages of mitosis and it is likely that interaction of BARD1 with Aurora B and BRCA2 are required for completion of cytokinesis.

The function of BARD1 in abscission of inter-sister cells MT bridges provides an explanation for the observed genomic instability in BARD1-deficient cells6-8. Inhibition or delay of cytokinesis could cause genomic instability due to improper chromosome segregation. To test this hypothesis we performed a profound cytogenetic analysis of BARD1 expressing and BARD1 depleted HeLa and MCF-7 cells. Jefford et al. 8 Using alpha-satellite probes specific for chromosomes 7, 17, 18, and X, and locus specific probes for chromosomal positions 13q12 and 21q12, we found that BARD1 repression leads to increased rates of chromosomal losses and overall numerical deviation in MCF-7 or HeLa cells

(Table 1). We also observed masked numerical chromosomal instability due to whole chromosome losses compensated by non-disjunctions in MCF-7 cells using dual color FISH specific for centromeres 7 and 17 (Fig. 5). The rates of numerical instability of centromeres 7 and

17 were twice as pronounced in the BARD1 depleted MCF-7 cells than in BARD1 expressing cells. Taken together these results show that loss of BARD1 leads to numerical chromosomal instability, presumably due to the defective abscission of inter-sister cells MT bridges, which is reminiscent of defects in mitotic fidelity as a consequences of Aurora-B ablation14.

The similarity of genomic instability phenotypes induced by the depletion of BARD1, BRCA1, or BRCA2 is only partially reflected in the specific functions that were attributed of each of these proteins. However, the sequential interaction of BARD1, first with BRCA1 at the centrosome as ubiquitin ligase on γ-tubulin, a mechanism of control of centrosome duplication, and secondly with BRCA2 at cytokinesis, provides an explanation for their overlapping functions resulting in similar phenotypes. As negative regulator of centrosome amplification, an obvious cause of aneuploidy28, 29, BARD1 acts as tumor suppressor with BRCA1. In regulation of cytokinesis,

BARD1 and BRCA2, together with Aurora B and TACC1, are required to ascertain proper cell division and chromosome segregation to avoid aneuploidy. Hence the dual role of BARD1 in mitosis, by interacting with BRCA1 and BRCA2, could explain the common phenotype of genomic instability induced by BARD1, BRCA1 or BRCA2 deficiencies.

Jefford et al. 9 Materials and Methods

Cell Culture

TAC-2 cells are a clonal sub-population derived from the NMuMG normal murine mammary gland epithelial cell line (CRL 1636; American Type Culture Collection, Rockville, MD) and were used previously 6. They were cultured in collagen-coated tissue culture dishes (Falcon,

Becton Dickinson, San Jose, CA) in high glucose DMEM (GIBCO, Invitrogen corporation) supplemented with 10% fetal calf serum (FCS, GIBCO), penicillin (110 µg/ml) and streptomycin

(110 µg/ml). The Human Embryonic Kidney HEK 293T cell line, as well as HeLa cell lines, were obtained from the American Tissue Type Culture Collection. The PC3 cell line was obtained from McDonnell. All cell lines were cultured in the aforementioned tissue culture medium (TCM) containing low glucose concentration, using 9 cm plastic tissue culture dishes and incubated at 37°C in humidified air containing 5% CO2. Adherent subcultures were detached from culture dishes using a solution of Trypsin/EDTA (Life Technologies, Inc.). Sub-confluent cell cultures were passaged regularly at 1:10 dilution twice a week.

Transfections of siRNA constructs

Cells were seeded in either 6 well plates or in 10 cm petri dishes and transfected with either

0.4µg or 2µg of DNA using the Effectene reagents provided by Qiagen. Cells were harvested at

24 and 48 hours post-transfection. They were centrifuged and washed once in PBS, resuspended in 0.3 ml of ice cold radio immuno-precipitation assay (RIPA) buffer [150mM NaCl, 1% Nonidet

P-40, 0.5% NaDOC, 0.1% SDS, 50mM Tris, pH 8.0, 2mM EDTA, pH 8.0] and supplemented with protease inhibitors [1mM PMSF, 3µg/ml aprotinin, 10µg/ml leupeptin] and phosphatase inhibitors [2mM NaF, 25 mM activated Na3VO4]. Cells were lysed on ice for 30 minutes and vortexed at regular intervals. The extracts were centrifuged at 13'000 rpm in a microcentrifuge for 15 minutes at 4°C in order to remove cell debris and clear the cell lysate. The human BARD1 Jefford et al. 10 siRNA construct was generated by annealing the following complementary oligonucleotides and inserted into the pSuper vector as a BglII/HindIII fragment: forward, 5'-G ATC CCC CAT TCT

GAG AGA GCC TGT GTT CAA GAG ACA CAG GCT CTC TCA GAA TGT TTT TGG

AAA-3', and reverse, 5'-AG CTT TTC CAA AAA CAT TCT GAG AGA GCC TGT GTC TCT

TGA ACA CAG GCT CTC TCA GAA TGG GG-3'. This construct was then transiently transfected in Hela cell as described. Mouse siRNAs were directed against the respective homologous regions.

Antibodies

The anti-BARD1 (H-300), anti-Aurora A and B, antis-BRCA1 and 2 antibodies were purchased from Santa Cruz. Anti-GFP (TP-401) was purchased from Chemokine (Torrey Pines Biolabs).

PVC and WSF were described previously6. Anti-TACC1 antibody was purchased from Upstate

Biotechnology Euromedex (Mundolsheim, France).

Secondary conjugated antibodies to horseradish peroxidase (HRP) were purchased from Santa

Cruz and were compatible with Cruz Molecular Weight Markers (Santa Cruz). Secondary immunoflurescent donkey anti-mouse, rabbit and goat conjugated to FITC or Alexa red 555 fluorochromes were obtained from Molecular Probes.

Immunofluorescence microscopy

Cells were seeded on glass cover slips in 6 well culture dishes or plated on a 8 well coverslide and transfected or not with the aforementioned plasmids. Cells were washed in HBSS, and either fixed 2% paraformaldehyde (PFA) in Hank's Balanced Salt Solution (HBSS) 15 min at room temperature (R.T.) or in methanol for 6 minutes at -20c and rinsed in acetone for 30 seconds.

PFA-fixed cells were permeabilized in 1% Triton/PBS for 15 minutes at R.T. and thereafter blocked for in 1% serum/PBS for 30 min. Coverslides were incubated with appropriate Jefford et al. 11 antibodies for 1 hour at R.T. in 1%FCS/PBS, washed and stained with DAPIC for 3 min. Finally coverslides were mounted with fluorogard solution, observed under a Nikon epi-fluorescence microscope and images captured with a 3.3 mega-pixel CCD camera. Images were processed with Metamorph software (Visitron).

Immunoprecipitation

Protein lysates used for immunoprecipitation correspond to HeLa cells synchronized (G1/S), synchronized and released (G2/M) and not synchronized (NS) using a double thymidine block.

24 h after plating, cells were arrested in S-phase using 2mM thymidine for 18 h, released from the arrest for 9 h, arrested a second time with thymidine, and released again to obtain a population enriched in mitotic cells. Proteins from lysates were precipitated with anti-TACC1 or anti-BARD1 antibodies, and bound proteins were detected with anti-BARD1, anti-TACC1, anti-

Aurora A or B, or anti-BRCA1 or 2 antibodies.

Interphase dual color cytogenetic analysis

To investigate numerical instability we applied dual-color interphase FISH, which is more accurate than conventional karyotype analysis, satellite probes specific for chromosomes 7, 17,

18, and X were used. We also applied locus specific probes hybridizing to the Rb region of chromosome 13 and the region critical for Down syndrome on chromosome 21. Probes were either purchased from Vysis, or produced and tested in house, using an indirect labeling Nick

Translation process (ROCHE) according to the manufacturer’s protocol. Cell cultures of high mitotic index were exposed to colcemid (0.1 µg/ml) (Gibco, BRL) for 1,5 h, at 37ºC and harvested according to routine cytogenetic protocols. FISH was based on pepsin pre-treatment, formamide target denaturation, over-night hybridization, and stringency post hybridization Jefford et al. 12 washes. For each chromosome pair studied (i.e. chromosome a and chromosome b), a modal number (Ma, Mb) was calculated as the most representative number of spots per nucleus per 100 cells/harvest. Chromosome loss was defined as Mn-1, chromosome gain as Mn+1. Overall deviation was calculated as the number of nuclei that do not show modal number of spots.

Metaphase dual colour cytogenetic analysis

Masked numerical chromosomal instability due to coupled chromosomal losses and non- disjunctions was explored in the MCF-7 cells using the same dual-color technique as described above. For this cytogenetic approach we performed conventional and multicolor FISH Karyotype analysis to select a specific pair of chromosomes that showed at least two different recombinant chromosomes of unequal size that could be easily identified on chromosome spreads. For MCF-7 cells centromeres 7 and 17 were a suitable pairs (Fig. 5). We deduced the stability of recombinant and intact chromosomes, by FISH and inverted DAPI, in 50 randomly selected compact metaphase spreads derived from BARD1 expressing or BARD1 depleted cells.

Chromosomal losses compensated by non-disjunction of one of the remaining homologous centromeres, were recorded as two events of numerical instability/metaphase. Jefford et al. 13

Figure legends

Figure 1. BARD1 expression during mitosis. (A) BAR1 is upregulated during in mitotic cells

(m). (B) BARD1 immunostaining of three different cell lines, TAC-2, HeLa, and PC-3. Indirect immunofluorescence images show that BARD1 accumulates around mitotic spindles during mitosis in all cell lines examined. BARD1 protein was flagged with H-300 antibody. Nuclei were stained with DAPI. (C) BARD1 co-localizes with beta-tubulin staining in various cell lines. (A)

Mouse mammary gland TAC-2 and (B) prostate cancer PC3 cells were stained with anti-β- tubulin labeled and anti-BARD1 (H-300) antibodies. Tubulin is labeled with FITC, BARD1 with

Alexa red 555, and nuclei are stained with DAPI.

Figure 2. Localization of BARD1 during stages of mitosis. (A) Immunostaining of an asynchronous population of PC-3 cells with anti-BARD1 (H-300) and anti-β-tubulin showing high immunoreactivity of BARD1 surrounding microtubule spindles at all stages of mitosis.

Tubulin is colored green and BARD1 in red. At anaphase BARD1 is mostly localized to the spindle pole, only partial colocalization with tubulin. (B) At metaphase colocalization of BARD1 and tubulin staining marked in yellow (short arrow) and abundant BARD1 staining at the spindle periphery (long arrow) can be observed. At telophase some of the colocalization with tubulin, marked yellow (short arrow) is observed, but abundant staining of BARD1 is localized to the midbody (long arrow), colocalization of BARD1 and DNA can be observed in pink (arrowhead).

In cytokinesis the most prominent BARD1 staining is seen at the midbody, colocalized with tubulin (yellow).

Figure 3. BARD1 interacts with TACC1 and Aurora B, but not Aurora A, and BRCA2 but not

BRCA1 in mitotic extracts. The co-immunoprecipitation assay shows that TACC1 can pull down Jefford et al. 14 full length BARD1 (C). Cells were either not enriched (--), enriched in S phase (S) with a double thymidine block or enriched in G2/M phase of the cell cycle (G2/M) released after double thymidine block. Western blot of total cell extract clearly shows that BARD1 is enriched during mitosis, as compared to the lower unrelated protein which serves as loading control. The reverse experiment shows that BARD1 can pull-down TACC1 (B), Aurora B, but not Aurora A (C),

BRCA1 in G1/S and G2/M extracts and BRCA2 in G2/M extracts only (D).

Figure 4. HeLa cells transiently transfected with BARD1 siRNA expressing plasmid. Cells were collected and stained 20 hours post transfection with anti-BARD1 (H-300) and anti-β-tubulin antibodies. Panel (A) demonstrates phenotype obtained with BARD1 repression, and percentage of cells, delayed or arrested at late cytokinesis, with abnormal abscission of midzone body is shown in (B). The fraction of cells with abnormal abscission is about 10 fold higher in BARD1 depleted cells than in the control cells transfected with mock siRNA. Residual BARD1 staining is not localized to the midbody (D). Aberrant localization of Aurora B in BARD1 depleted cells

(E). Arrow indicates persistent Aurora B staining in sister cells after mitosis.

Figure 5. Numerical chromosomal instability in BARD1 depleted cells. Centromere specific staining with probes for chromosomes 7 (orange) and 17 (green) was applied on MCF-7 cells depleted of BARD1 by siRNA expression. Chromosomal losses are monitored by centromere staining of interphase nuclei (a). Embedded partial karyotypes, representing the modal (most representative) imbalances of chromosomes 7 and 17, were defined as chromosomal markers m1, m2, m3, and m4. m1 and m2 were clonaly retained recombinant chromosomes derivatives of chromosome 7. m3 and m4 were clonaly retained recombinant chromosomes derivatives of chromosome 17 (G-Banding/Inverted DAPI FISH; magnification x1000) (b). Staining of four spots per centromere of chromosomes 7 and 17 is representative for majority of metaphase spreads (c). Loss of m4 and a translocation involving m3 is shown in (d). A non-disjunction of Jefford et al. 15 recombinant m3 leads to increased number of spots (five) for centromere 17 (e). Examples of masked numerical instability are shown in f-h: a loss of m4 is compensated by non-disjunction of recombinant m3 (f), non-disjunction of recombinant m1 coupled to loss of one of the two apparently intact chromosomes 7 (g), and loss of m1, coupled to non-disjunction of m2 (h).

Arrows indicate chromosomal non-disjunctions.

Support Figure 1. (A) Antibody control on cells transfected with various constructs. (B)

Schematic view of constructs.

Acknowledgements

We are grateful to T. McDonnell for the gift of PC3 cell line. We highly appreciate interesting suggestions and observations made by A. Feki, and discussions with I. Bondarev and with P.

Berardi. We are indebted to A. Caillon and M. Hiourea for excellent technical assistance. This work was supported by Swiss National Science Foundation grant 3100-068222 to I. I.-F. , Inserm and Cancéropôle grants to D. B.; Foundation of Biomedical Research of the Academy of Athens

Greece starting grant to S.G.. B. D. is supported by a fellowship from Ligue Nationale Contre le

Cancer. Jefford et al. 16

HeLa Chromosome Chromosome Loss% Gain% Overall deviation% BARD1 (+) (-) (+) (-) (+) (-) 13 3 13 3 7 8 25 18 12 35 29 15 52 63 21 26 38 2 7 31 48 X 15 8 6 17 23 35

MCF-7 Chromosome Chromosome Loss% Gain% Overall deviation% BARD1 (+) (-) (+) (-) (+) (-) 7 10 19 1 2 12 22 13 9 10 14 14 26 28 17 20 33 2 6 23 44 18 11 30 0 20 21 46 21 23 17 14 3 46 45 X 16 20 1 1 18 21

Table 1: Percentages of chromosomal instability of BARD1 expressing (+) vs BARD1 depleted cells (-). Jefford et al. 17 References

1. Wu, L.C. et al. Identification of a RING protein that can interact in vivo with the BRCA1 gene product. Nat Genet 14, 430-440 (1996). 2. Thai, T.H. et al. Mutations in the BRCA1-associated RING domain (BARD1) gene in primary breast, ovarian and uterine cancers. Hum Mol Genet 7, 195-202 (1998). 3. Ghimenti, C. et al. Germline mutations of the BRCA1-associated ring domain (BARD1) gene in breast and breast/ovarian families negative for BRCA1 and BRCA2 alterations. Genes Chromosomes Cancer 33, 235-242 (2002). 4. Ishitobi, M. et al. Mutational analysis of BARD1 in familial breast cancer patients in Japan. Cancer Lett 200, 1-7 (2003). 5. Karppinen, S.M., Heikkinen, K., Rapakko, K. & Winqvist, R. Mutation screening of the BARD1 gene: evidence for involvement of the Cys557Ser allele in hereditary susceptibility to breast cancer. J Med Genet 41, e114 (2004). 6. Irminger-Finger, I., Soriano, J.V., Vaudan, G., Montesano, R. & Sappino, A.P. In vitro repression of Brca1-associated RING domain gene, Bard1, induces phenotypic changes in mammary epithelial cells. J Cell Biol 143, 1329-1339 (1998). 7. Joukov, V., Chen, J., Fox, E.A., Green, J.B. & Livingston, D.M. Functional communication between endogenous BRCA1 and its partner, BARD1, during Xenopus laevis development. Proc Natl Acad Sci U S A 98, 12078-12083 (2001). 8. McCarthy, E.E., Celebi, J.T., Baer, R. & Ludwig, T. Loss of Bard1, the heterodimeric partner of the Brca1 tumor suppressor, results in early embryonic lethality and chromosomal instability. Mol Cell Biol 23, 5056-5063 (2003). 9. Grigorova, M., Staines, J.M., Ozdag, H., Caldas, C. & Edwards, P.A. Possible causes of chromosome instability: comparison of chromosomal abnormalities in cancer cell lines with mutations in BRCA1, BRCA2, CHK2 and BUB1. Cytogenet Genome Res 104, 333- 340 (2004). 10. Starita, L.M. et al. BRCA1-dependent ubiquitination of gamma-tubulin regulates centrosome number. Mol Cell Biol 24, 8457-8466 (2004). 11. Daniels, M.J., Wang, Y., Lee, M. & Venkitaraman, A.R. Abnormal cytokinesis in cells deficient in the breast cancer susceptibility protein BRCA2. Science 306, 876-879 (2004). 12. Jefford, C.E., Feki, A., Harb, J., Krause, K.H. & Irminger-Finger, I. Nuclear-cytoplasmic translocation of BARD1 is linked to its apoptotic activity. Oncogene 23, 3509-3520 (2004). 13. Hayami, R. et al. Down-regulation of BRCA1-BARD1 ubiquitin ligase by CDK2. Cancer Res 65, 6-10 (2005). 14. Delaval, B. et al. Aurora B -TACC1 protein complex in cytokinesis. Oncogene 23, 4516- 4522 (2004). 15. Gowen, L.C., Johnson, B.L., Latour, A.M., Sulik, K.K. & Koller, B.H. Brca1 deficiency results in early embryonic lethality characterized by neuroepithelial abnormalities. Nat Genet 12, 191-194 (1996). 16. Hakem, R. et al. The tumor suppressor gene Brca1 is required for embryonic cellular proliferation in the mouse. Cell 85, 1009-1023 (1996). 17. Liu, C.Y., Flesken-Nikitin, A., Li, S., Zeng, Y. & Lee, W.H. Inactivation of the mouse Brca1 gene leads to failure in the morphogenesis of the egg cylinder in early postimplantation development. Genes Dev 10, 1835-1843 (1996). 18. Ludwig, T., Chapman, D.L., Papaioannou, V.E. & Efstratiadis, A. Targeted mutations of breast cancer susceptibility gene homologs in mice: lethal phenotypes of Brca1, Brca2, Brca1/Brca2, Brca1/p53, and Brca2/p53 nullizygous embryos. Genes Dev 11, 1226-1241 (1997). Jefford et al. 18 19. Jasin, M. Homologous repair of DNA damage and tumorigenesis: the BRCA connection. Oncogene 21, 8981-8993 (2002). 20. Hsu, L.C., Doan, T.P. & White, R.L. Identification of a gamma-tubulin-binding domain in BRCA1. Cancer Res 61, 7713-7718 (2001). 21. Baer, R. & Ludwig, T. The BRCA1/BARD1 heterodimer, a tumor suppressor complex with ubiquitin E3 ligase activity. Curr Opin Genet Dev 12, 86-91 (2002). 22. Irminger-Finger, I. et al. Identification of BARD1 as mediator between proapoptotic stress and p53-dependent apoptosis. Mol Cell 8, 1255-1266 (2001). 23. Feki, A. et al. BARD1 induces apoptosis by catalysing phosphorylation of p53 by DNA- damage response kinase. Oncogene (2005). 24. Gergely, F. et al. The TACC domain identifies a family of centrosomal proteins that can interact with microtubules. Proc Natl Acad Sci U S A 97, 14352-14357 (2000). 25. Ducat, D. & Zheng, Y. Aurora kinases in spindle assembly and chromosome segregation. Exp Cell Res 301, 60-67 (2004). 26. Adams, R.R., Maiato, H., Earnshaw, W.C. & Carmena, M. Essential roles of Drosophila inner centromere protein (INCENP) and aurora B in histone H3 phosphorylation, metaphase chromosome alignment, kinetochore disjunction, and chromosome segregation. J Cell Biol 153, 865-880 (2001). 27. Ouchi, M. et al. BRCA1 phosphorylation by Aurora-A in the regulation of G2 to M transition. J Biol Chem 279, 19643-19648 (2004). 28. Brodie, S.G. & Deng, C.X. BRCA1-associated tumorigenesis: what have we learned from knockout mice? Trends Genet 17, S18-22 (2001). 29. Xu, X. et al. Centrosome amplification and a defective G2-M cell cycle checkpoint induce genetic instability in BRCA1 exon 11 isoform-deficient cells. Mol Cell 3, 389-395 (1999).

A B

m m HeLaPC-3 TAC-2

Figure 1A-B C DNA β-Tubulin BARD1 Merge

HeLa

PC-3

TAC-2

Figure 1C A

S-phase Metaphase Anaphase Telophase Cytokinesis DNA -tubulin β BARD1 merge

Figure 2A B Anaphase Telophase Cytokinesis

Figure 2B IP anti- A Cell lysate TACC1 Beads only

NS G1/S G2/M NS G1/S G2/M NS G1/S G2/M

BARD1* 83

IP anti- B Cell lysate BARD1 Beads only

NS G1/S G2/M NS G1/S G2/M NS G1/S G2/M 175 TACC1*

C Aurora A

Aurora B 32,5

D BRCA2

BRCA1 180

Figure 3 3.5 3 A B 3 2.5 2 1.5 1 0.5 0.38

% abnormal% abscission 0 Mock siRNA BARD1

C siBARD1 -mh α-BARD1

α-Actin Microtubule BARD1 Nucleus

Figure 4A-D E wildtype

siRNA BARD1

Figure 4E Figure 5 Supplemental results and ongoing projects 6. Role of BARD1 in telomere maintenance and crisis Introduction The BARD1 and BRCA1 proteins are involved in several mechanisms that maintain genomic stability, because mutation or absence in either of these genes leads to chromosomal instability and pre-cancerous lesions. Most cancer cells are prone to genomic instability which is often correlated with a reactivated telomerase, whereas normal somatic cells bear a repressed telomerase. BARD1 and BRCA1 form nuclear dots during S-phase that are relocated upon DNA damage induced by hydroxyurea. Furthermore, it was shown that BARD1 and BRCA1 aggregate in PML bodies, in telomerase negative cell lines, and that the BRCA1-Mre11-Rad50-Nbs1 complex, which intervenes during DNA repair, is also present in telomeric complexes. Telomeres are ribonucleoprotein complexes poised on the end of chromosomes that maintain the stability of the chromosomes.

a b c d

e fg BARD1- EGFP

Alexa HeLa TAC-2 Red555

Merge

α-TRF-2 α-BARD1

MCF-7 PC3

Figure 6.1. Co-localisation of telomeres and BARD1. a) CHO cells stained with anti-TRF-2. b) Confocal image of HeLa cells stained with anti-BARD1 forming the characteristic nuclear foci. c) FISH of telomeric probe by using PNA probe (DAKO), red dots represent telomeres. d) PNA hybridisation in BARD1-/- mouse embryos. e) The four panels represent double staining with PNA in green and anti-BARD1 in red in four different cell lines. These are overlay images, therefore co-localisation is in yellow and is indicated with yellow arrows. f) and g) 293T cells transfected with full-length BARD1-EGFP and stained with anti-TRF-2 in f) and with anti-BARD1 as a positive control in g). Nuclei are stained with DAPI in blue.

124 The absence of telomeres or of proteins responsible for maintaining telomere maintenance results in chromosomal instability and inaccurate segregation of chromosomes that perpetrate breakage-fusion-bridge cycles. Telomeres and their associated proteins such as TRF-1 and TRF-2 (Telomere Repeat binding Factor 1 and 2) form dot-like structures as seen by FISH (Fluorescent in Situ Hybridisation) experiments and by immunofluorescence respectively. In view of all the above evidence, we wanted to see if there was a link between BARD1, telomeres and chromosome instability. We investigated whether BARD1 repression would have an effect on telomere length or on telomerase activity and whether BARD1 can interact within telomeric complexes either by binding to telomeric DNA or to telomere proteins.

A Input mock α-BARD1 Ab Results and discussion -TRF2 1% 0,25% - pc N19 C20 JH3 H300 α Since BARD1 and telomeres form

Hela nuclear dots and that they share some of the same proteins in their

TAC2 complexes, we first investigated whether BARD1 and telomeres would B be part of the same biochemical 20000 18000 complex and would co-localize 16000 together in double immunofluorescent 14000 Hela TAC2 experiments. In order to observe this probe [a.u.] 12000 10000 co-localisation, we performed indirect 8000 immunofluorescence on paraffin telomeric 6000 sections from mouse embryos and in

signal 4000 2000 n.s.bl. cultured cells with anti-BARD1 0 antibody combined with FISH using a k c 9 % % c 20 1 5 p N1 C JH3 ,2 ut 0 mo ck- H300 TRF2 p t o telomere probe (PNA labelling system in u m p ChIP samples in from DAKO). It is possible to observe

Figure 6.2. Telomere Chromatin Immunoprecipitation some co-localization between BARD1 assays (Telo-ChIP). The several anti-BARD1 antibodies (N19, C20, JH3, H300) are incapable of and the PNA signal in certain places immunoprecipitating telomeric DNA, as compared to but it is not flagrant (Figure 6.1.e). TRF-2 suggesting that there is no interaction between BARD1 and telomeric chromatin in either HeLa or TAC2 cells.

125 G0 wild type G5 mTR -/-

5x 5x 20x

40x 5x 60x

5x 5x 20x Figure 6.3. Immunohistochemistry showing BARD1 expression. Paraffin embedded sections in the spleen and in the liver of wild type (G0) and 5th generation of mTR-/- knockout mice (G5) were immunostained with anti-BARD1 antibody. Left column represents sections from wild type tissue and show no reactivity. The two columns on the right side are from telomerase KO mice. Represented in brown the reactivity of N19 anti-BARD1 antibody secondary antibody is conjugated to HRP, DAB staining. Top two rows are taken from paraffin embedded liver sections and bottom row from spleen. Slides were counterstained with Hemalin.

We also performed PNA telomere hybridisation on sections of BARD1-/- embryos in order to evaluate the state of the telomere structures. It appears that BARD1 knockouts display a non-altered PNA stain compared to wild type mouse embryos (Figure 6.1.d). To further look at an interaction between BARD1 and telomeric DNA, we performed chromatin immunoprecipitation assays by using anti-BARD1 antibody and labelled telomeric DNA. The results are unfortunately not conclusive, since there is no strong signal indicating an attachment of BARD1 on the telomeric DNA (Figure 6.2). Furthermore, to see if BARD1 interacts with components of the telomere

126 complex, we performed double fluorescent immunohistochemistry using anti-TRF-2 or hTERT and anti-BARD1 antibodies on cultured cells. Here again, only a few spots of co-localization can be observed, but these slides need to be visualized with a confocal microscope in order to get a more precise image. In order to assess the interaction between BARD1 and TRF-2 or hTERT, we immuno-stained cells that were expressing a BARD1-EGFP fusion protein with TRF-2 antibody (Figure 6.1.f).

A Telo-Flow-FISH B TAC2/ABI TAC-2 DNA ladder MW Human low cont Human high cont SAOS Human lymphocyte CE s 350 Human lymphocyte LE s U2OS 300 250 200 21kb 150 100 50 0 TAC-2 ABI

C Telomere length Flow-FISH

180 160 140 120 100 80 60 40 20 Relative Fluorescence Relative 0 U2OS U2OS- JURKAT Fibroblasts SAR13 hTERT Cell lines

Figure 6.4. Measurement of telomere length in normal and BARD1 repressed cells. Measurements were made by telomere-Flow-FISH and by southern blot of terminal restriction fragments (TRF) probed with a DIG labelled telomere probe. A) TAC2 and BARD1 repressed TAC2/ABI do not show significant differences. Cells with FITC labelled telomeres by in situ hybridisation are analysed by flow cytometry. FITC signal per cell is proportional to telomere length. Usually 10’000 events are counted. Signal is normally subtracted from non-labelled cells representing background signal. B) TAC2 and TAC2/ABI cells as well as control cells were assayed for telomere length by TRF southern. This assay displays physical length of cells. It is more direct than Flow-FISH. However, TAC2 and TAC2/ABI have marginally the same telomere length. Mouse telomeres are double the size of human telomeres. Human telomere length averages between 4 and 15 kb, whereas mouse telomeres are about 20-40kb long. C) U2OS and SAOS2 are telomerase negative cell lines that have very long telomeres compared to Jurkat, fibroblasts or even other ovarian cancer cells (SAR13).

127

We observed that TRF-2 anti-body co-localizes to some of the dots formed by the BARD1-EGFP fusion protein. These results show partial co-localization of TRF-2 and BARD1. In the future, we would like to use the BARD1-EGFP recombinant for biochemical experiments and for co-immunoprecipitation studies by using the various proteins involved in telomere metabolism. These proteins include TRF-1, Rap-1, hTERT, and so on. We also examined the expression of BARD1 in tissues from telomerase knockout mice (mTR-/-). It is worth noticing that BARD1 expression is increased in mTR-/- tissues, possibly because mTR-/- mouse tissues are more prone to apoptosis. These mice show premature aging and telomere attrition (Figure 6.3).

In order to ascertain the effect of the absence of BARD1 on telomere length, we performed flow-FISH and TRF on BARD1 repressed cells (Figure 6.4.). Flow-FISH is an indirect labelling method to measure telomere length by fluorescent in situ hybridisation quantified by flow cytometry. TRF (terminal restriction fragment assay) utilizes southern blot method with a highly digested genomic DNA using a telomere probe to measure the physical length of telomeres. Since the BARD1 repressed cell lines did not give a clear result, we transfected primary cells and transformed cell lines with a siRNA of BARD1. We measured telomere length by using flow-FISH. Our preliminary results suggest that BARD1 repression could have an effect on telomere length, since telomere length appears to be diminished in siRNA transfected cells (Figure 6.5). These cells were assayed for telomerase activity by TRAP (telomere repeat amplification protocol); a very sensitive method which amplifies by PCR the telomere repeats added by telomerase elongation. However, no changes were observed on telomerase expression (Figure 6.6). Therefore, telomere attrition observed after BARD1 knock-down is not due to lack of telomerase activity. Furthermore, we transduced a short hairpin interfering BARD1 RNA (shRNA) by using a lentiviral system to obtain a constitutive and an inducible down regulation of BARD1. These cells have not been assayed yet for telomere length attrition. Several passages need to be created to observe an effect over time. Overall, our results do not allow to dress a complete picture of BARD1 interfering in telomere metabolism. However, these results do not exclude an indirect action of BARD1 on telomeres.

128 ABsiRNA M 1x 2x 3x C - Telomere Flow-FISH

BARD1 TAC2 120 100 80 HeLa 60 (-) 40 (+)siRNA MCF7 20 0 Relative Fluorescence Relative Jurkat NuTu-19 TAC-2 HeLA MCF-7 GAPDH Cell Lines

Figure 6.5. Telomere attrition in BARD1 knock-down cells. TAC2, HeLa and MCF-7 cells were transiently transfected with siRNA of BARD1 3 times over a course of 10 days. A) RT-PCR shows BARD1 mRNAlevels are decreased relatively efficiently. B) Shown in black the relative length of telomeres from the cell lines which were treated with siRNA BARD1.

HeLA HeLA +siRNA Buffer ABI p8 10bp DNA ladder MW H2O Buffer CHAPS TAC2 p16 TAC2 ABI p30 10bp DNA ladder MW +siRNA MCF-7 TAC2 p39 TAC2 RMC HeLA cont positive cont SAR negative cont SAR 2x negative siRNA + TAC-21 MCF-7 TAC-2

Figure 6.6. Measurement of telomerase activity by TRAP assay (Telomere Repeat Amplification Protocol). This PCR based assay amplifies telomeric repeats in presence of active telomerase. It appears that TAC2 cells are positive for telomerase at low passage (left panel). HeLa and MCF-7 cells transfected with siRNA BARD1 do not have repressed telomerase activity (middle and left panel).

129 7. Characterization of the BARD1 promoter It was established that BARD1 protein and mRNA are increased during genotoxic stress and during cell death. BARD1 is also expressed under hormonal control. Furthermore, it appears that BARD1 stabilizes BRCA1 and vice versa. This regulation is interdependent. In order to investigate the mechanisms regulating BARD1 expression under various physiological environments, such as hormonal treatment, inflammation, genotoxic insult, embryogenesis or cell death, we decided to isolate and characterize the BARD1 promoter region. The first step was to identify the 5’UTR and the site of the initiation of transcription (cap site). To this purpose, we performed 5’RACE and a so called “steplike RT-PCR” with forward primers at various positions upstream of the BARD1 ATG site. We amplified the cDNA of BARD1 with primers positioned at –114 upstream of the ATG, but not at position –192, demonstrating that BARD1 initiation site is situated within this region. A position situated further upstream of what has been previously published (Figure 7.1).

A ? ? Initiation start site - 153 - 132 -73

Exon 1 Exon 2 Exon 3 Exon 4 CTC CTG CAG

position forward primers ATG = + 1 reverse primers

-864 - 280- 192 - 114 -28 + 139 + 246 F 5=41 F 4=93F 3=92 F 2=91 F 1=90 R 1=72 R 2=94

B RT-PCR C

F1 F2 F3 F1 F2 F3 F1 F2 F3 F1 F2 F3 F4 F1 F2 F3 F4 F1 F2 F3 F4 F1 F2 F3 F4

H2O HeLa Lympho CTB

Reverse primer R 2 (+ 246) Gen DNA HeLa Lympho CTB H2O

Reverse primer R 1 (+139)

Figure 7.1. Identification of 5’UTR of BARD1 in humans. A) This figure depicts the “steplike-RT-PCR” that amplifies, with upstream primers of ATG, the cDNA derived from the BARD1 messenger. B) and C) RT_PCR using the indicated primers showing a step formation. F3 and F4 do not amplify any product.

130 We first isolated a primary region of 865 base pairs upstream. In a second step, we isolated a larger region of 2402 base pairs upstream of the BARD1 ATG by PCR on genomic DNA on two healthy young adults. We cloned these two regions into the pGL3 basic vector containing the luciferase reporter gene (Figure 7.2). This region was sequenced and analysed for candidate transcription factors (Figure 7.3). The luciferase gene is placed under the transcriptional control of the supposed BARD1 promoter. The vector with the BARD1 promoter region was then assayed for luciferase activity by transfecting the pGL3b-BARD1-promoter plasmid into several human and mouse cell lines (Figure 7.4).

A HindIII

-865 bp -2402 bp

HindIII

Figure 7.2. Cloning of putative BARD1 promoter region. Two fragments were cloned into pGL3 basic vector. BARD1 promoter of -865 and -2402 base pairs upstream from first ATG cloned in MCS of pGL3 basic. The promoter region of upstream of BARD1 was cloned from human lymphocytes from 2 different origins, male and female. They were inserted in-sense and anti-sense into pGL3 basic vector and sequenced.

131 After transfection in various cell lines, the BARD1 region of 865 base pairs appears to be sufficient for constitutive activity of BARD1 since there is a high signal in all cell lines. However, this region does not seem to have a regulatory potential since when the transfected cells were treated with doxorubicin to induce a genotoxic stress, no significant increase of the reporter luciferase was noticed (Figure 7.5). Furthermore, when transfected cells were treated with several hormones no change in signal was observed (Figure 7.6). In order to eliminate biological variation due to cell death or transfection discrepancies, these experiments were performed using a dual luciferase reporter system. The secondary Renilla luciferase serves as an internal control (pRL- TK). It is transfected at the same moment as the reporter vector containing promoter and is constitutively expressed under a thymidin kinase (TK) promoter, whereas the reporter gene is a Firefly luciferase. The results are then normalized according to the internal expression for each sample. Furthermore, for accuracy, the transfections are performed in triplicate and measured at three points each.

Putative initiation site CAG = - 74 -2400 -2200 -2000 -1800 -1600 -1400 -1200 -1000-800 -600 -400 -200 ATG =1 5’ 3’

AhR/Ar p300 NF-κB p53 - Sp1 and GC rich GC box -90 RORα1 Oct-1 Sp-1 HSF2 HSF2 GATA-3 GATA-2 GATA-2 AP-1 AP-1 AP-1 SRY SRY SRY SRY USF USF USF USF MZF1 MZF1 MZF1 MZF1 AML-1a AML-1a AML-1a AML-1a AML1-a C/EBPa C/EBP C/EBP C/EBPb C/EBP C/EBP -865 -8 -2411 2402-CE(+) luciferase

856-CE1(+) luciferase

856-LE5(+) luciferase

856-LE5(-) luciferase

Figure 7.3. Illustration of putative transcription factors within the upstream BARD1 5’UTR region.

132

BARD1 promoter response

10000000

1000000 TAC-2 100000 293 T 3T3 10000 PC-3 1000 HeLa luciferase activity

100 mock basic control (-) L5 L5 CE1 transfected plasmids

Figure 7.4. Luciferase activity in 5 different cell lines. This histogram shows directional expression of –865 bp BARD1 minimal promoter region. Biological variation between different cell lines is probably due to transfection efficiency. Control is pGL3 control vector containing a firefly luciferase under a CMV promoter and an enhancer for optimal activity. (-)L5 is the 856 sequence from L5 and inserted negatively and serves as a mock. It demonstrates that orientation is primordial in this context despite several putative transcription factor sites placed in the opposite direction. Non specific DNA in pGL3 basic vector is immune to aberrant cryptic responsiveness. TAC-2 and NIH 3T3 are mouse cells the others are human. The human promoter region appears to show some conservation in mice.

After analysis of its sequence for possible transcription factors, we found several sites of interest inferring that the –2402 region could be the regulatory region. This stretch of DNA has to be evaluated in future studies. Unique NF-kB, p53 and p300 binding sites were found as well as a repetitive sites for C/EBP. The promoter is a TATAless promoter region, rich in CpG and Sp-1 sites, which is characteristic of constitutive promoters. However, the NF-κB site could be important in the inflammation process and the regulation of BARD1 transcription. Further experiments should include foot-printing, band shift as well as super shift assays in order to determine the existence and the physical binding of the aforementioned transcription factors on this stretch of DNA. Furthermore, since it is known that BRCA1 overexpression can up-regulate NF-κB in vitro, it would be interesting to see if this region can be activated by cytokines such as TNF-α or by BRCA1 transfection. This would provide new insight on BARD1 regulation and the identification of its feedback loop.

133 Furthermore, we know that BARD1 may bind to the p50 sub-unit of NF-κB, through Bcl-3, and this could be the link in a possible regulated feedback loop for BARD1 expression.

3T3 BARD1 promoter assay duplicate analysis 293 T cells BARD1 promoter assay in duplicate

2500000 500000

400000 2000000

300000 1500000 non-treated non-treated Doxorubicin Doxorubicin 200000 1000000

100000 Activity Luciferase luciferase activity 500000 0 mock basic control neg L5 CE1 0 mock basic control (-) L5 L5 CE1 transfected plasmids Transfected samples

TAC-2 BARD1 promoter assay duplicate PC-3 BARD1 promoter duplicate analysis

60000 5000000 50000 non-treated 4000000 40000 Doxorubicin 3000000 non-treated 30000 2000000 Doxorubicin 20000 10000 1000000 activity luciferase

luciferase activity 0 0 Non Trans empty vector positive pGL3 (-) L5 BARD1- L5 BARD1- CE1 BA RD1- mock basic control (-) L5 L5 CE1 pGL3 basic control pro pro pro transfected plasmids transfected plasmids

HeLA BARD1 promoter assay (overall A+B)

5000

4000

3000 Série1 2000 Doxorubicin

1000 luciferase activity

0 mock basic control (-) L5 L5 CE1 transfected plasmids

Figure 7.5. Dual luciferase assay after treatment with doxorubicin. No significant change in luciferase expression after treatment with 5 µg/ml for 6 hrs in any cell line used.

134

Relative luciferase expression normalised to Renilla luciferase (TK-promoter)

250 non-treated 200 HCG 150 LH

in % 100 estrogen 50 doxorubicin 0 pGL3 pGL3 pGL3 pGL3 pGL3 Relative luciferase units luciferase Relative control basic L5(-) neg L5 CE1 sense plasmids transfected

Figure 7.6. Response of luciferase reporter gene after hormonal treatment. Dual luciferase assay.

135

Conclusion This thesis is dispersed over several points but concentrate on the same theme: the role of BARD1 in tumour suppression and maintenance of genomic stability through cell cycle mechanisms. We wanted to investigate the role of BARD1 in tumour suppression and how it controls genetic integrity. We have shown that BARD1 often reflects the actions normally performed by BRCA1. Indeed BARD1 repression creates genomic instability, loss of regular or normal cell cycle progression, proliferation defects, and a tumour phenotype. Moreover, knockouts of BARD1, BRCA1 or BRCA2 are not viable, since embryos die early in gestation. In this thesis we have shown that BARD1 may have BRCA1-independent functions in addition of a BRCA1-dependent role, such as pro-apoptotic response to genotoxic stress which is dependent on p53. Furthermore, BARD1 is up-regulated upon genotoxic insult, hypoxia and cell death in vitro and in vivo. BARD1 pro-apoptotic function has been mapped to a region spanning amino acids 510 to 604. Moreover, this is confirmed by the fact that the mutant Q564H is inefficient in promoting cell death. We have shown that BARD1 is a dynamic protein with a function in the cytoplasm, expressed in G2/M and which is associated with apoptosis. Furthermore, we showed that BARD1 binds to p53 and Ku-70 in co-immunoprecipitation assays, independently from BRCA1. BARD1 has many roles and could be mediated through BRCA1/BARD1 E3 ubiquitin ligase activity. Lastly, it appears that BARD1 has several important roles in spermatogenesis, embryogenesis, cell cycle progression, mitosis, centrosome duplication and cytokinesis. It interacts with BRCA2 during G2/M and it also interacts with TACC1 and Aurora B but not with Aurora A. In the future, it would be necessary to dissect the precise role for BARD1 in this part of cell physiology. BARD1 commands vital cellular functions and is definitely a multifunctional protein that still holds many secrets.

136

References

1. Casey, G. The BRCA1 and BRCA2 breast cancer genes. Curr Opin Oncol 9, 88-93 (1997). 2. Wooster, R. & Weber, B. L. Breast and ovarian cancer. N Engl J Med 348, 2339-47 (2003). 3. Hall, J. M. et al. Linkage of early-onset familial breast cancer to chromosome 17q21. Science 250, 1684-9 (1990). 4. Futreal, P. A. et al. BRCA1 mutations in primary breast and ovarian carcinomas. Science 266, 120-2 (1994). 5. Miki, Y. et al. A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science 266, 66-71 (1994). 6. Wooster, R. et al. Localization of a breast cancer susceptibility gene, BRCA2, to chromosome 13q12-13. Science 265, 2088-90 (1994). 7. Wooster, R. et al. Identification of the breast cancer susceptibility gene BRCA2. Nature 378, 789-92 (1995). 8. Shugart, Y. Y. et al. Linkage analysis of 56 multiplex families excludes the Cowden disease gene PTEN as a major contributor to familial breast cancer. J Med Genet 36, 720-1 (1999). 9. Meijers-Heijboer, H. et al. Low-penetrance susceptibility to breast cancer due to CHEK2(*)1100delC in noncarriers of BRCA1 or BRCA2 mutations. Nat Genet 31, 55-9 (2002). 10. Schutte, M. et al. Variants in CHEK2 other than 1100delC do not make a major contribution to breast cancer susceptibility. Am J Hum Genet 72, 1023-8 (2003). 11. Caligo, M. A. et al. The CHEK2 c.1100delC mutation plays an irrelevant role in breast cancer predisposition in Italy. Hum Mutat 24, 100-1 (2004). 12. Smith, S. A. & Ponder, B. A. Predisposing genes in breast and ovarian cancer: an overview. Tumori 79, 291-6 (1993). 13. Ford, D. & Easton, D. F. The genetics of breast and ovarian cancer. Br J Cancer 72, 805-12 (1995). 14. Chen, J. & Lindblom, A. Germline mutation screening of the STK11/LKB1 gene in familial breast cancer with LOH on 19p. Clin Genet 57, 394-7 (2000). 15. Mincey, B. A. Genetics and the management of women at high risk for breast cancer. Oncologist 8, 466-73 (2003). 16. Easton, D., Ford, D. & Peto, J. Inherited susceptibility to breast cancer. Cancer Surv 18, 95-113 (1993). 17. Easton, D. F., Narod, S. A., Ford, D. & Steel, M. The genetic epidemiology of BRCA1. Breast Cancer Linkage Consortium. Lancet 344, 761 (1994). 18. Ford, D., Easton, D. F., Bishop, D. T., Narod, S. A. & Goldgar, D. E. Risks of cancer in BRCA1-mutation carriers. Breast Cancer Linkage Consortium. Lancet 343, 692-5 (1994). 19. Rahman, N. & Stratton, M. R. The genetics of breast cancer susceptibility. Annu Rev Genet 32, 95-121 (1998). 20. Ford, D. et al. Genetic heterogeneity and penetrance analysis of the BRCA1 and BRCA2 genes in breast cancer families. The Breast Cancer Linkage Consortium. Am J Hum Genet 62, 676-89 (1998).

137 21. Holt, J. T. et al. Growth retardation and tumour inhibition by BRCA1. Nat Genet 12, 298-302 (1996). 22. Hakem, R. et al. The tumor suppressor gene Brca1 is required for embryonic cellular proliferation in the mouse. Cell 85, 1009-23 (1996). 23. Gowen, L. C., Johnson, B. L., Latour, A. M., Sulik, K. K. & Koller, B. H. Brca1 deficiency results in early embryonic lethality characterized by neuroepithelial abnormalities. Nat Genet 12, 191-4 (1996). 24. Monteiro, A. N. BRCA1: the enigma of tissue-specific tumor development. Trends Genet 19, 312-5 (2003). 25. Starita, L. M. & Parvin, J. D. The multiple nuclear functions of BRCA1: transcription, ubiquitination and DNA repair. Curr Opin Cell Biol 15, 345-50 (2003). 26. Venkitaraman, A. R. Cancer susceptibility and the functions of BRCA1 and BRCA2. Cell 108, 171-82 (2002). 27. Venkitaraman, A. R. Tracing the network connecting BRCA and Fanconi anaemia proteins. Nat Rev Cancer 4, 266-76 (2004). 28. Hakem, R., de la Pompa, J. L. & Mak, T. W. Developmental studies of Brca1 and Brca2 knock-out mice. J Mammary Gland Biol Neoplasia 3, 431-45 (1998). 29. Xu, X. et al. Conditional mutation of Brca1 in mammary epithelial cells results in blunted ductal morphogenesis and tumour formation. Nat Genet 22, 37-43 (1999). 30. Zheng, L., Li, S., Boyer, T. G. & Lee, W. H. Lessons learned from BRCA1 and BRCA2. Oncogene 19, 6159-75 (2000). 31. Scully, R. & Livingston, D. M. In search of the tumour-suppressor functions of BRCA1 and BRCA2. Nature 408, 429-32 (2000). 32. Wang, Q., Zhang, H., Fishel, R. & Greene, M. I. BRCA1 and cell signaling. Oncogene 19, 6152-8 (2000). 33. Kerr, P. & Ashworth, A. New complexities for BRCA1 and BRCA2. Curr Biol 11, R668-76 (2001). 34. Mueller, C. R. & Roskelley, C. D. Regulation of BRCA1 expression and its relationship to sporadic breast cancer. Breast Cancer Res 5, 45-52 (2003). 35. Moynahan, M. E. The cancer connection: BRCA1 and BRCA2 tumor suppression in mice and humans. Oncogene 21, 8994-9007 (2002). 36. Narod, S. A. & Foulkes, W. D. BRCA1 and BRCA2: 1994 and beyond. Nat Rev Cancer 4, 665-76 (2004). 37. Deng, C. X. & Brodie, S. G. Roles of BRCA1 and its interacting proteins. Bioessays 22, 728-37 (2000). 38. Khanna, K. K. & Jackson, S. P. DNA double-strand breaks: signaling, repair and the cancer connection. Nat Genet 27, 247-54 (2001). 39. Hsu, L. C. & White, R. L. BRCA1 is associated with the centrosome during mitosis. Proc Natl Acad Sci U S A 95, 12983-8 (1998). 40. Hsu, L. C., Doan, T. P. & White, R. L. Identification of a gamma-tubulin-binding domain in BRCA1. Cancer Res 61, 7713-8 (2001). 41. Schlegel, B. P., Starita, L. M. & Parvin, J. D. Overexpression of a protein fragment of RNA helicase A causes inhibition of endogenous BRCA1 function and defects in ploidy and cytokinesis in mammary epithelial cells. Oncogene 22, 983-91 (2003). 42. Rajan, J. V., Marquis, S. T., Gardner, H. P. & Chodosh, L. A. Developmental expression of Brca2 colocalizes with Brca1 and is associated with proliferation and differentiation in multiple tissues. Dev Biol 184, 385-401 (1997). 43. Jasin, M. Homologous repair of DNA damage and tumorigenesis: the BRCA connection. Oncogene 21, 8981-93 (2002).

138 44. Wu, L. C. et al. Identification of a RING protein that can interact in vivo with the BRCA1 gene product. Nat Genet 14, 430-40 (1996). 45. Thai, T. H. et al. Mutations in the BRCA1-associated RING domain (BARD1) gene in primary breast, ovarian and uterine cancers. Hum Mol Genet 7, 195-202 (1998). 46. Connor, F. et al. Cloning, chromosomal mapping and expression pattern of the mouse Brca2 gene. Hum Mol Genet 6, 291-300 (1997). 47. Irminger-Finger, I., Soriano, J. V., Vaudan, G., Montesano, R. & Sappino, A. P. In vitro repression of Brca1-associated RING domain gene, Bard1, induces phenotypic changes in mammary epithelial cells. J Cell Biol 143, 1329-39 (1998). 48. Ayi, T. C., Tsan, J. T., Hwang, L. Y., Bowcock, A. M. & Baer, R. Conservation of function and primary structure in the BRCA1-associated RING domain (BARD1) protein. Oncogene 17, 2143-8 (1998). 49. Joukov, V., Chen, J., Fox, E. A., Green, J. B. & Livingston, D. M. Functional communication between endogenous BRCA1 and its partner, BARD1, during Xenopus laevis development. Proc Natl Acad Sci U S A 98, 12078-83 (2001). 50. Boulton, S. J. et al. BRCA1/BARD1 orthologs required for DNA repair in Caenorhabditis elegans. Curr Biol 14, 33-9 (2004). 51. Jefford, C. E., Feki, A., Harb, J., Krause, K. H. & Irminger-Finger, I. Nuclear- cytoplasmic translocation of BARD1 is linked to its apoptotic activity. Oncogene 23, 3509-20 (2004). 52. Borden, K. L. RING fingers and B-boxes: zinc-binding protein-protein interaction domains. Biochem Cell Biol 76, 351-8 (1998). 53. Freemont, P. S. RING for destruction? Curr Biol 10, R84-7 (2000). 54. Kentsis, A. & Borden, K. L. Physical mechanisms and biological significance of supramolecular protein self-assembly. Curr Protein Pept Sci 5, 125-34 (2004). 55. Meza, J. E., Brzovic, P. S., King, M. C. & Klevit, R. E. Mapping the functional domains of BRCA1. Interaction of the ring finger domains of BRCA1 and BARD1. J Biol Chem 274, 5659-65 (1999). 56. Brzovic, P. S., Rajagopal, P., Hoyt, D. W., King, M. C. & Klevit, R. E. Structure of a BRCA1-BARD1 heterodimeric RING-RING complex. Nat Struct Biol 8, 833-7 (2001). 57. Morris, J. R., Keep, N. H. & Solomon, E. Identification of residues required for the interaction of BARD1 with BRCA1. J Biol Chem 277, 9382-6 (2002). 58. Brzovic, P. S., Meza, J. E., King, M. C. & Klevit, R. E. BRCA1 RING domain cancer- predisposing mutations. Structural consequences and effects on protein-protein interactions. J Biol Chem 276, 41399-406 (2001). 59. Brzovic, P. S. et al. Binding and recognition in the assembly of an active BRCA1/BARD1 ubiquitin-ligase complex. Proc Natl Acad Sci U S A 100, 5646-51 (2003). 60. Mosavi, L. K., Cammett, T. J., Desrosiers, D. C. & Peng, Z. Y. The ankyrin repeat as molecular architecture for protein recognition. Protein Sci 13, 1435-48 (2004). 61. Zhang, X. et al. Structure of an XRCC1 BRCT domain: a new protein-protein interaction module. Embo J 17, 6404-11 (1998). 62. Huyton, T., Bates, P. A., Zhang, X., Sternberg, M. J. & Freemont, P. S. The BRCA1 C-terminal domain: structure and function. Mutat Res 460, 319-32 (2000). 63. Williams, R. S., Green, R. & Glover, J. N. Crystal structure of the BRCT repeat region from the breast cancer-associated protein BRCA1. Nat Struct Biol 8, 838-42 (2001). 64. Ljungquist, S., Kenne, K., Olsson, L. & Sandstrom, M. Altered DNA ligase III activity in the CHO EM9 mutant. Mutat Res 314, 177-86 (1994).

139 65. Caldecott, K. W., Tucker, J. D., Stanker, L. H. & Thompson, L. H. Characterization of the XRCC1-DNA ligase III complex in vitro and its absence from mutant hamster cells. Nucleic Acids Res 23, 4836-43 (1995). 66. Friedman, L. S. et al. Confirmation of BRCA1 by analysis of germline mutations linked to breast and ovarian cancer in ten families. Nat Genet 8, 399-404 (1994). 67. Cantor, S. B. et al. BACH1, a novel helicase-like protein, interacts directly with BRCA1 and contributes to its DNA repair function. Cell 105, 149-60 (2001). 68. Ohta, T. & Fukuda, M. Ubiquitin and breast cancer. Oncogene 23, 2079-88 (2004). 69. Weissman, A. M. Themes and variations on ubiquitylation. Nat Rev Mol Cell Biol 2, 169-78 (2001). 70. Pickart, C. M. Ubiquitin in chains. Trends Biochem Sci 25, 544-8 (2000). 71. Hicke, L. Protein regulation by monoubiquitin. Nat Rev Mol Cell Biol 2, 195-201 (2001). 72. Hershko, A. & Ciechanover, A. The ubiquitin system. Annu Rev Biochem 67, 425-79 (1998). 73. Wilkinson, K. D. Ubiquitination and deubiquitination: targeting of proteins for degradation by the proteasome. Semin Cell Dev Biol 11, 141-8 (2000). 74. Huibregtse, J. M., Scheffner, M., Beaudenon, S. & Howley, P. M. A family of proteins structurally and functionally related to the E6-AP ubiquitin-protein ligase. Proc Natl Acad Sci U S A 92, 2563-7 (1995). 75. Joazeiro, C. A. & Weissman, A. M. RING finger proteins: mediators of ubiquitin ligase activity. Cell 102, 549-52 (2000). 76. Hashizume, R. et al. The RING heterodimer BRCA1-BARD1 is a ubiquitin ligase inactivated by a breast cancer-derived mutation. J Biol Chem 276, 14537-40 (2001). 77. Ruffner, H., Joazeiro, C. A., Hemmati, D., Hunter, T. & Verma, I. M. Cancer- predisposing mutations within the RING domain of BRCA1: loss of ubiquitin protein ligase activity and protection from radiation hypersensitivity. Proc Natl Acad Sci U S A 98, 5134-9 (2001). 78. Xia, Y., Pao, G. M., Chen, H. W., Verma, I. M. & Hunter, T. Enhancement of BRCA1 E3 ubiquitin ligase activity through direct interaction with the BARD1 protein. J Biol Chem 278, 5255-63 (2003). 79. Kentsis, A., Gordon, R. E. & Borden, K. L. Control of biochemical reactions through supramolecular RING domain self-assembly. Proc Natl Acad Sci U S A 99, 15404-9 (2002). 80. Chen, A., Kleiman, F. E., Manley, J. L., Ouchi, T. & Pan, Z. Q. Autoubiquitination of the BRCA1*BARD1 RING ubiquitin ligase. J Biol Chem 277, 22085-92 (2002). 81. Wu-Baer, F., Lagrazon, K., Yuan, W. & Baer, R. The BRCA1/BARD1 heterodimer assembles polyubiquitin chains through an unconventional linkage involving lysine residue K6 of ubiquitin. J Biol Chem 278, 34743-6 (2003). 82. Nishikawa, H. et al. Mass spectrometric and mutational analyses reveal Lys-6-linked polyubiquitin chains catalyzed by BRCA1-BARD1 ubiquitin ligase. J Biol Chem 279, 3916-24 (2004). 83. Morris, J. R. & Solomon, E. BRCA1 : BARD1 induces the formation of conjugated ubiquitin structures, dependent on K6 of ubiquitin, in cells during DNA replication and repair. Hum Mol Genet 13, 807-17 (2004). 84. Mallery, D. L., Vandenberg, C. J. & Hiom, K. Activation of the E3 ligase function of the BRCA1/BARD1 complex by polyubiquitin chains. Embo J 21, 6755-62 (2002). 85. Choudhury, A. D., Xu, H. & Baer, R. Ubiquitination and proteasomal degradation of the BRCA1 tumor suppressor is regulated during cell cycle progression. J Biol Chem 279, 33909-18 (2004).

140 86. Levinger, L. & Varshavsky, A. Selective arrangement of ubiquitinated and D1 protein- containing nucleosomes within the Drosophila genome. Cell 28, 375-85 (1982). 87. Davie, J. R. & Murphy, L. C. Level of ubiquitinated histone H2B in chromatin is coupled to ongoing transcription. Biochemistry 29, 4752-7 (1990). 88. Davie, J. R., Lin, R. & Allis, C. D. Timing of the appearance of ubiquitinated histones in developing new macronuclei of Tetrahymena thermophila. Biochem Cell Biol 69, 66-71 (1991). 89. Garcia-Higuera, I. et al. Interaction of the Fanconi anemia proteins and BRCA1 in a common pathway. Mol Cell 7, 249-62 (2001). 90. Vandenberg, C. J. et al. BRCA1-independent ubiquitination of FANCD2. Mol Cell 12, 247-54 (2003). 91. Starita, L. M. et al. BRCA1-dependent ubiquitination of gamma-tubulin regulates centrosome number. Mol Cell Biol 24, 8457-66 (2004). 92. Sato, K. et al. Nucleophosmin/B23 is a candidate substrate for the BRCA1-BARD1 ubiquitin ligase. J Biol Chem 279, 30919-22 (2004). 93. Hayami, R. et al. Down-regulation of BRCA1-BARD1 ubiquitin ligase by CDK2. Cancer Res 65, 6-10 (2005). 94. Dong, Y. et al. Regulation of BRCC, a holoenzyme complex containing BRCA1 and BRCA2, by a signalosome-like subunit and its role in DNA repair. Mol Cell 12, 1087- 99 (2003). 95. Jensen, D. E. et al. BAP1: a novel ubiquitin hydrolase which binds to the BRCA1 RING finger and enhances BRCA1-mediated cell growth suppression. Oncogene 16, 1097-112 (1998). 96. Liu, C. Y., Flesken-Nikitin, A., Li, S., Zeng, Y. & Lee, W. H. Inactivation of the mouse Brca1 gene leads to failure in the morphogenesis of the egg cylinder in early postimplantation development. Genes Dev 10, 1835-43 (1996). 97. Ludwig, T., Chapman, D. L., Papaioannou, V. E. & Efstratiadis, A. Targeted mutations of breast cancer susceptibility gene homologs in mice: lethal phenotypes of Brca1, Brca2, Brca1/Brca2, Brca1/p53, and Brca2/p53 nullizygous embryos. Genes Dev 11, 1226-41 (1997). 98. McCarthy, E. E., Celebi, J. T., Baer, R. & Ludwig, T. Loss of Bard1, the heterodimeric partner of the Brca1 tumor suppressor, results in early embryonic lethality and chromosomal instability. Mol Cell Biol 23, 5056-63 (2003). 99. Gowen, L. C., Avrutskaya, A. V., Latour, A. M., Koller, B. H. & Leadon, S. A. BRCA1 required for transcription-coupled repair of oxidative DNA damage. Science 281, 1009-12 (1998). 100. Moynahan, M. E., Chiu, J. W., Koller, B. H. & Jasin, M. Brca1 controls homology- directed DNA repair. Mol Cell 4, 511-8 (1999). 101. Scully, R. et al. Genetic analysis of BRCA1 function in a defined tumor cell line. Mol Cell 4, 1093-9 (1999). 102. Abbott, D. W. et al. BRCA1 expression restores radiation resistance in BRCA1- defective cancer cells through enhancement of transcription-coupled DNA repair. J Biol Chem 274, 18808-12 (1999). 103. Snouwaert, J. N. et al. BRCA1 deficient embryonic stem cells display a decreased homologous recombination frequency and an increased frequency of non-homologous recombination that is corrected by expression of a brca1 transgene. Oncogene 18, 7900-7 (1999). 104. Zhong, Q., Boyer, T. G., Chen, P. L. & Lee, W. H. Deficient nonhomologous end- joining activity in cell-free extracts from Brca1-null fibroblasts. Cancer Res 62, 3966- 70 (2002).

141 105. Zhong, Q., Chen, C. F., Chen, P. L. & Lee, W. H. BRCA1 facilitates microhomology- mediated end joining of DNA double strand breaks. J Biol Chem 277, 28641-7 (2002). 106. Westermark, U. K. et al. BARD1 participates with BRCA1 in homology-directed repair of chromosome breaks. Mol Cell Biol 23, 7926-36 (2003). 107. Wang, Q. et al. Adenosine nucleotide modulates the physical interaction between hMSH2 and BRCA1. Oncogene 20, 4640-9 (2001). 108. Jin, Y. et al. Cell cycle-dependent colocalization of BARD1 and BRCA1 proteins in discrete nuclear domains. Proc Natl Acad Sci U S A 94, 12075-80 (1997). 109. Chen, Y. et al. BRCA1 is a 220-kDa nuclear phosphoprotein that is expressed and phosphorylated in a cell cycle-dependent manner. Cancer Res 56, 3168-72 (1996). 110. Vaughn, J. P. et al. BRCA1 expression is induced before DNA synthesis in both normal and tumor-derived breast cells. Cell Growth Differ 7, 711-5 (1996). 111. Gudas, J. M. et al. Cell cycle regulation of BRCA1 messenger RNA in human breast epithelial cells. Cell Growth Differ 7, 717-23 (1996). 112. Rajan, J. V., Wang, M., Marquis, S. T. & Chodosh, L. A. Brca2 is coordinately regulated with Brca1 during proliferation and differentiation in mammary epithelial cells. Proc Natl Acad Sci U S A 93, 13078-83 (1996). 113. Scully, R. et al. Dynamic changes of BRCA1 subnuclear location and phosphorylation state are initiated by DNA damage. Cell 90, 425-35 (1997). 114. Paull, T. T., Cortez, D., Bowers, B., Elledge, S. J. & Gellert, M. Direct DNA binding by Brca1. Proc Natl Acad Sci U S A 98, 6086-91 (2001). 115. Chiba, N. & Parvin, J. D. Redistribution of BRCA1 among four different protein complexes following replication blockage. J Biol Chem 276, 38549-54 (2001). 116. Zhong, Q. et al. Association of BRCA1 with the hRad50-hMre11-p95 complex and the DNA damage response. Science 285, 747-50 (1999). 117. Chapman, M. S. & Verma, I. M. Transcriptional activation by BRCA1. Nature 382, 678-9 (1996). 118. Monteiro, A. N., August, A. & Hanafusa, H. Evidence for a transcriptional activation function of BRCA1 C-terminal region. Proc Natl Acad Sci U S A 93, 13595-9 (1996). 119. Monteiro, A. N., August, A. & Hanafusa, H. Common BRCA1 variants and transcriptional activation. Am J Hum Genet 61, 761-2 (1997). 120. Haile, D. T. & Parvin, J. D. Activation of transcription in vitro by the BRCA1 carboxyl-terminal domain. J Biol Chem 274, 2113-7 (1999). 121. Anderson, S. F., Schlegel, B. P., Nakajima, T., Wolpin, E. S. & Parvin, J. D. BRCA1 protein is linked to the RNA polymerase II holoenzyme complex via RNA helicase A. Nat Genet 19, 254-6 (1998). 122. Scully, R. et al. BRCA1 is a component of the RNA polymerase II holoenzyme. Proc Natl Acad Sci U S A 94, 5605-10 (1997). 123. Neish, A. S., Anderson, S. F., Schlegel, B. P., Wei, W. & Parvin, J. D. Factors associated with the mammalian RNA polymerase II holoenzyme. Nucleic Acids Res 26, 847-53 (1998). 124. Chiba, N. & Parvin, J. D. The BRCA1 and BARD1 association with the RNA polymerase II holoenzyme. Cancer Res 62, 4222-8 (2002). 125. Baldwin, A. S., Jr. The NF-kappa B and I kappa B proteins: new discoveries and insights. Annu Rev Immunol 14, 649-83 (1996). 126. Baldwin, A. S. Control of oncogenesis and cancer therapy resistance by the transcription factor NF-kappaB. J Clin Invest 107, 241-6 (2001). 127. Dechend, R. et al. The Bcl-3 oncoprotein acts as a bridging factor between NF- kappaB/Rel and nuclear co-regulators. Oncogene 18, 3316-23 (1999).

142 128. Benezra, M. et al. BRCA1 augments transcription by the NF-kappaB transcription factor by binding to the Rel domain of the p65/RelA subunit. J Biol Chem 278, 26333- 41 (2003). 129. Chen, L. F. & Greene, W. C. Regulation of distinct biological activities of the NF- kappaB transcription factor complex by acetylation. J Mol Med 81, 549-57 (2003). 130. Cui, J. Q. et al. BRCA1 splice variants BRCA1a and BRCA1b associate with CBP co- activator. Oncol Rep 5, 591-5 (1998). 131. Pao, G. M., Janknecht, R., Ruffner, H., Hunter, T. & Verma, I. M. CBP/p300 interact with and function as transcriptional coactivators of BRCA1. Proc Natl Acad Sci U S A 97, 1020-5 (2000). 132. von Mikecz, A., Zhang, S., Montminy, M., Tan, E. M. & Hemmerich, P. CREB- binding protein (CBP)/p300 and RNA polymerase II colocalize in transcriptionally active domains in the nucleus. J Cell Biol 150, 265-73 (2000). 133. Ogryzko, V. V., Schiltz, R. L., Russanova, V., Howard, B. H. & Nakatani, Y. The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87, 953- 9 (1996). 134. Bannister, A. J. & Kouzarides, T. The CBP co-activator is a histone acetyltransferase. Nature 384, 641-3 (1996). 135. Bochar, D. A. et al. BRCA1 is associated with a human SWI/SNF-related complex: linking chromatin remodeling to breast cancer. Cell 102, 257-65 (2000). 136. Ganesan, S. et al. BRCA1 supports XIST RNA concentration on the inactive X chromosome. Cell 111, 393-405 (2002). 137. Scully, R. et al. Association of BRCA1 with Rad51 in mitotic and meiotic cells. Cell 88, 265-75 (1997). 138. Kleiman, F. E. & Manley, J. L. Functional interaction of BRCA1-associated BARD1 with polyadenylation factor CstF-50. Science 285, 1576-9 (1999). 139. Takagaki, Y., Manley, J. L., MacDonald, C. C., Wilusz, J. & Shenk, T. A multisubunit factor, CstF, is required for polyadenylation of mammalian pre-mRNAs. Genes Dev 4, 2112-20 (1990). 140. Takagaki, Y. & Manley, J. L. RNA recognition by the human polyadenylation factor CstF. Mol Cell Biol 17, 3907-14 (1997). 141. Kleiman, F. E. & Manley, J. L. The BARD1-CstF-50 interaction links mRNA 3' end formation to DNA damage and tumor suppression. Cell 104, 743-53 (2001). 142. Colgan, D. F. & Manley, J. L. Mechanism and regulation of mRNA polyadenylation. Genes Dev 11, 2755-66 (1997). 143. Zhao, W. & Manley, J. L. Deregulation of poly(A) polymerase interferes with cell growth. Mol Cell Biol 18, 5010-20 (1998). 144. Spahn, L. et al. Interaction of the EWS NH2 terminus with BARD1 links the Ewing's sarcoma gene to a common tumor suppressor pathway. Cancer Res 62, 4583-7 (2002). 145. Bruun, D. et al. siRNA depletion of BRCA1, but not BRCA2, causes increased genome instability in Fanconi anemia cells. DNA Repair (Amst) 2, 1007-13 (2003). 146. Irminger-Finger, I. et al. Identification of BARD1 as mediator between proapoptotic stress and p53-dependent apoptosis. Mol Cell 8, 1255-66 (2001). 147. Meek, D. W. Post-translational modification of p53. Semin Cancer Biol 5, 203-10 (1994). 148. Milczarek, G. J., Martinez, J. & Bowden, G. T. p53 Phosphorylation: biochemical and functional consequences. Life Sci 60, 1-11 (1997). 149. Fabbro, M. et al. BRCA1-BARD1 complexes are required for p53Ser-15 phosphorylation and a G1/S arrest following ionizing radiation-induced DNA damage. J Biol Chem 279, 31251-8 (2004).

143 150. Feki, A. et al. BARD1 induces apoptosis by catalysing phosphorylation of p53 by DNA-damage response kinase. Oncogene (2005). 151. Chai, Y. L. et al. The second BRCT domain of BRCA1 proteins interacts with p53 and stimulates transcription from the p21WAF1/CIP1 promoter. Oncogene 18, 263-8 (1999). 152. Ouchi, T., Monteiro, A. N., August, A., Aaronson, S. A. & Hanafusa, H. BRCA1 regulates p53-dependent gene expression. Proc Natl Acad Sci U S A 95, 2302-6 (1998). 153. Arizti, P. et al. Tumor suppressor p53 is required to modulate BRCA1 expression. Mol Cell Biol 20, 7450-9 (2000). 154. Harkin, D. P. et al. Induction of GADD45 and JNK/SAPK-dependent apoptosis following inducible expression of BRCA1. Cell 97, 575-86 (1999). 155. Jensen, R. A. et al. BRCA1 is secreted and exhibits properties of a granin. Nat Genet 12, 303-8 (1996). 156. Rodriguez, J. A. & Henderson, B. R. Identification of a functional nuclear export sequence in BRCA1. J Biol Chem 275, 38589-96 (2000). 157. Fabbro, M., Rodriguez, J. A., Baer, R. & Henderson, B. R. BARD1 induces BRCA1 intranuclear foci formation by increasing RING-dependent BRCA1 nuclear import and inhibiting BRCA1 nuclear export. J Biol Chem 277, 21315-24 (2002). 158. Schuechner, S., Tembe, V., Rodriguez, J. A. & Henderson, B. R. Nuclear targeting and cell cycle regulatory function of human BARD1. J Biol Chem (2005). 159. Rodriguez, J. A., Schuchner, S., Au, W. W., Fabbro, M. & Henderson, B. R. Nuclear- cytoplasmic shuttling of BARD1 contributes to its proapoptotic activity and is regulated by dimerization with BRCA1. Oncogene 23, 1809-20 (2004). 160. Ghimenti, C. et al. Germline mutations of the BRCA1-associated ring domain (BARD1) gene in breast and breast/ovarian families negative for BRCA1 and BRCA2 alterations. Genes Chromosomes Cancer 33, 235-42 (2002). 161. Karppinen, S. M., Heikkinen, K., Rapakko, K. & Winqvist, R. Mutation screening of the BARD1 gene: evidence for involvement of the Cys557Ser allele in hereditary susceptibility to breast cancer. J Med Genet 41, e114 (2004). 162. Gautier, F., Irminger-Finger, I., Gregoire, M., Meflah, K. & Harb, J. Identification of an apoptotic cleavage product of BARD1 as an autoantigen: a potential factor in the antitumoral response mediated by apoptotic bodies. Cancer Res 60, 6895-900 (2000). 163. Daniels, M. J., Wang, Y., Lee, M. & Venkitaraman, A. R. Abnormal cytokinesis in cells deficient in the breast cancer susceptibility protein BRCA2. Science 306, 876-9 (2004). 164. Brzovic, P. S., Meza, J., King, M. C. & Klevit, R. E. The cancer-predisposing mutation C61G disrupts homodimer formation in the NH2-terminal BRCA1 RING finger domain. J Biol Chem 273, 7795-9 (1998). 165. Ishitobi, M. et al. Mutational analysis of BARD1 in familial breast cancer patients in Japan. Cancer Lett 200, 1-7 (2003). 166. Orban, T. I. & Olah, E. Expression profiles of BRCA1 splice variants in asynchronous and in G1/S synchronized tumor cell lines. Biochem Biophys Res Commun 280, 32-8 (2001). 167. McEachern, K. A., Archey, W. B., Douville, K. & Arrick, B. A. BRCA1 splice variants exhibit overlapping and distinct transcriptional transactivation activities. J Cell Biochem 89, 120-32 (2003). 168. Feki, A. & Irminger-Finger, I. Mutational spectrum of p53 mutations in primary breast and ovarian tumors. Crit Rev Oncol Hematol 52, 103-16 (2004).

144 169. Feki, A. et al. BARD1 expression during spermatogenesis is associated with apoptosis and hormonally regulated. Biol Reprod 71, 1614-24 (2004). 170. Thompson, M. E., Jensen, R. A., Obermiller, P. S., Page, D. L. & Holt, J. T. Decreased expression of BRCA1 accelerates growth and is often present during sporadic breast cancer progression. Nat Genet 9, 444-50 (1995). 171. Yoshikawa, K. et al. Abnormal expression of BRCA1 and BRCA1-interactive DNA- repair proteins in breast carcinomas. Int J Cancer 88, 28-36 (2000). 172. Reinholz, M. M. et al. Differential gene expression of TGF beta inducible early gene (TIEG), Smad7, Smad2 and Bard1 in normal and malignant breast tissue. Breast Cancer Res Treat 86, 75-88 (2004). 173. Qiu, Y., Langman, M. J. & Eggo, M. C. Targets of 17beta-oestradiol-induced apoptosis in colon cancer cells: a mechanism for the protective effects of hormone replacement therapy? J Endocrinol 181, 327-37 (2004).

145