Impact of Bone Marrow Mir-21 Expression on Acute Myeloid Leukemia T Lymphocyte Fragility and Dysfunction
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Multistage Analysis of Variants in the Inflammation Pathway and Lung Cancer Risk in Smokers
Published OnlineFirst May 9, 2012; DOI: 10.1158/1055-9965.EPI-12-0352-T Cancer Epidemiology, Research Article Biomarkers & Prevention Multistage Analysis of Variants in the Inflammation Pathway and Lung Cancer Risk in Smokers Margaret R. Spitz1, Ivan P. Gorlov2, Qiong Dong3, Xifeng Wu3, Wei Chen4, David W. Chang3, Carol J. Etzel3, Neil E. Caporaso5, Yang Zhao8, David C. Christiani8, Paul Brennan9, Demetrius Albanes7, Jianxin Shi6, Michael Thun10, Maria Teresa Landi5, and Christopher I. Amos4 Abstract Background: Tobacco-induced lung cancer is characterized by a deregulated inflammatory microenviron- ment. Variants in multiple genes in inflammation pathways may contribute to risk of lung cancer. Methods: We therefore conducted a three-stage comprehensive pathway analysis (discovery, replication, and meta-analysis) of inflammation gene variants in ever-smoking lung cancer cases and controls. A discovery set (1,096 cases and 727 controls) and an independent and nonoverlapping internal replication set (1,154 cases and 1,137 controls) were derived from an ongoing case–control study. For discovery, we used an iSelect BeadChip to interrogate a comprehensive panel of 11,737 inflammation pathway single-nucleotide poly- morphisms (SNP) and selected nominally significant (P < 0.05) SNPs for internal replication. Results: There were six SNPs that achieved statistical significance (P < 0.05) in the internal replication data set with concordant risk estimates for former smokers and five concordant and replicated SNPs in current smokers. Replicated hits were further tested in a subsequent meta-analysis using external data derived from two published genome-wide association studies (GWAS) and a case–control study. Two of these variants (a BCL2L14 SNP in former smokers and an SNP in IL2RB in current smokers) were further validated. -
Contribution of IL9, IL2RA and IL2RB Genetic Polymorphisms in Coronary Heart Disease in Chinese Han Population
Contribution of IL9, IL2RA and IL2RB genetic polymorphisms in coronary heart disease in Chinese Han population Xianghong Chen The Second Aliated Hospital of Hainan Medical University Xingfan Wang The Second Aliated Hospital of Hainan Medical University Zaozhang q Zhang The second Aliated Hospital of Hainan Medical University Yuewu Chen The Second Aliated Hospital of Hainan Medical University Chao Wang ( [email protected] ) The Second Aliated Hospital of Hainan Medical Universiy https://orcid.org/0000-0001-5632-9778 Research article Keywords: Posted Date: December 9th, 2019 DOI: https://doi.org/10.21203/rs.2.18401/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/11 Abstract Background: Coronary heart disease (CHD) is one of the leading causes of disability and death worldwide. In the pathogenesis of CHD, inammatory cytokines take an essential part. This study was designed to detect the potential association between IL-9, IL-2RA and IL-2RB variants and CHD in Chinese Han population. Methods: This case-control study conducted 499 CHD patients and 496 healthy controls. Seven selected SNPs were genotyped to investigate the possible association between the polymorphisms and the CHD risk. The interaction of SNP-SNP in the CHD risk was analyzed by Multifactor dimensionality reduction (MDR). Results: We observed an association between IL-9 rs55692658 (OR = 1.72, p = 0.003) and the increased CHD risk. The stratication analysis by age indicated that no matter participants who were older or younger than 61 years, IL-9 rs55692658 and IL-2RB rs1573673 contributed to the CHD susceptibility signicantly (p < 0.05, respectively). -
The Interleukin 22 Pathway Interacts with Mutant KRAS to Promote Poor Prognosis in Colon Cancer
Author Manuscript Published OnlineFirst on May 19, 2020; DOI: 10.1158/1078-0432.CCR-19-1086 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. The interleukin 22 pathway interacts with mutant KRAS to promote poor prognosis in colon cancer Authors: Sarah McCuaig1, David Barras,2, Elizabeth Mann1, Matthias Friedrich1, Samuel Bullers1, Alina Janney1, Lucy C. Garner1, Enric Domingo3, Viktor Hendrik Koelzer3,4,5, Mauro Delorenzi2,6,7, Sabine Tejpar8, Timothy Maughan9, Nathaniel R. West1, Fiona Powrie1 Affiliations: 1 Kennedy Institute of Rheumatology, University of Oxford, Oxford UK. 2 SIB Swiss Institute of Bioinformatics, Bioinformatics Core Facility, Lausanne, Switzerland. 3Department of Oncology, University of Oxford, Oxford UK. 4Nuffield Department of Medicine, University of Oxford, Oxford UK. 5Department of Pathology and Molecular Pathology, University and University Hospital Zurich, Zurich Switzerland. 6 Ludwig Center for Cancer Research, University of Lausanne, Lausanne, Switzerland. 7 Department of Oncology, Faculty of Biology and Medicine, University of Lausanne, Lausanne Switzerland. 8 Molecular Digestive Oncology, KU Leuven, Belgium. 9 CRUK/MRC Oxford Institute for Radiation Oncology, University of Oxford, Oxford, UK. Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on May 19, 2020; DOI: 10.1158/1078-0432.CCR-19-1086 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Correspondence to: Professor Fiona Powrie; Kennedy Institute of Rheumatology, University of Oxford, Roosevelt Drive, Headington, Oxford, OX3 7YF, UK. Email: [email protected] Conflicts of Interest: S.M., N.R.W., and F.P. -
Tethering IL2 to Its Receptor Il2rb Enhances Antitumor Activity and Expansion of Natural Killer NK92 Cells Youssef Jounaidi, Joseph F
Published OnlineFirst September 15, 2017; DOI: 10.1158/0008-5472.CAN-17-1007 Cancer Therapeutics, Targets, and Chemical Biology Research Tethering IL2 to Its Receptor IL2Rb Enhances Antitumor Activity and Expansion of Natural Killer NK92 Cells Youssef Jounaidi, Joseph F. Cotten, Keith W. Miller, and Stuart A. Forman Abstract IL2 is an immunostimulatory cytokine for key immune cells of IL2 and its receptor IL2Rb joined via a peptide linker (CIRB). including T cells and natural killer (NK) cells. Systemic IL2 NK92 cells expressing CIRB (NK92CIRB) were highly activated and supplementation could enhance NK-mediated immunity in a expanded indefinitely without exogenous IL2. When compared variety of diseases ranging from neoplasms to viral infection. with an IL2-secreting NK92 cell line, NK92CIRB were more acti- However, its systemic use is restricted by its serious side effects and vated, cytotoxic, and resistant to growth inhibition. Direct contact limited efficacy due to activation of T regulatory cells (Tregs). IL2 with cancer cells enhanced the cytotoxic character of NK92CIRB signaling is mediated through interactions with a multi-subunit cells, which displayed superior in vivo antitumor effects in mice. receptor complex containing IL2Ra, IL2Rb, and IL2Rg. Adult Overall, our results showed how tethering IL2 to its receptor natural killer (NK) cells express only IL2Rb and IL2Rg subunits IL2Rb eliminates the need for IL2Ra and IL2Rb, offering a and are therefore relatively insensitive to IL2. To overcome these new tool to selectively activate and empower immune therapy. limitations, we created a novel chimeric IL2-IL2Rb fusion protein Cancer Res; 77(21); 5938–51. Ó2017 AACR. Introduction in order for allogeneic NK cells to be effective, pretransfer lymphodepletion is required to reduce competition for growth Natural killer (NK) cells are lymphocytes endowed with the factors and cytokines (14, 15). -
A Low Interleukin-2 Receptor Signaling Threshold Supports the Development and Homeostasis of T Regulatory Cells
Immunity Article A Low Interleukin-2 Receptor Signaling Threshold Supports the Development and Homeostasis of T Regulatory Cells Aixin Yu,1 Linjian Zhu,1 Norman H. Altman,2 and Thomas R. Malek1,3,* 1Department of Microbiology and Immunology 2Department of Pathology 3Diabetes Research Institute Miller School of Medicine, University of Miami, P.O. Box 01960, Miami, FL 33101, USA *Correspondence: [email protected] DOI 10.1016/j.immuni.2008.11.014 SUMMARY of the genetic factors rendering nonobese diabetic (NOD) mice susceptible to autoimmune disease that leads to impaired Treg Interleukin-2 receptor (IL-2R) signaling is essential cells (Yamanouchi et al., 2007). IL-2 is also necessary for the for T regulatory (Treg) cell development and homeo- generation of Foxp3+ induced-Treg (iTreg) cells from naive stasis. Here, we show that expression of IL-2Rb conventional peripheral T lymphocytes (Davidson et al., 2007; chains that lack tyrosine residues important for the Zheng et al., 2007). association of the adaptor Shc and the transcription IL-2R signaling mechanisms have been most extensively factor STAT5 in IL-2Rb-deficient mice resulted in studied in various IL-2-responsive cell lines that approximate activated effector T cells (Gaffen, 2001; Nelson and Willerford, production of a normal proportion of natural Treg 1998). IL-2 signal transduction is initiated upon ligand-induced cells that suppressed severe autoimmunity related oligomerization of the IL-2R, consisting of IL-2Ra, IL-2Rb, and with deficiency in IL-2 or IL-2R. These mutant IL- gc (CD132). This event brings the cytoplasmic tail of IL-2Rb and 2Rb chains supported suboptimal and transient gc in close proximity with their associated Jak-1 and Jak-3 STAT5 activation that upregulate the transcription kinases, respectively, allowing phosphorylation of three key factor Foxp3 to normal amounts in natural, but not tyrosines (Y) residues of IL-2Rb. -
Multiple QTL Underlie Milk Phenotypes at the CSF2RB Locus Thomas J
Lopdell et al. Genet Sel Evol (2019) 51:3 https://doi.org/10.1186/s12711-019-0446-x Genetics Selection Evolution RESEARCH ARTICLE Open Access Multiple QTL underlie milk phenotypes at the CSF2RB locus Thomas J. Lopdell1,2*, Kathryn Tiplady1, Christine Couldrey1, Thomas J. J. Johnson1, Michael Keehan1, Stephen R. Davis1, Bevin L. Harris1, Richard J. Spelman1, Russell G. Snell2 and Mathew D. Littlejohn1 Abstract Background: Over many years, artifcial selection has substantially improved milk production by cows. However, the genes that underlie milk production quantitative trait loci (QTL) remain relatively poorly characterised. Here, we investigate a previously reported QTL located at the CSF2RB locus on chromosome 5, for several milk production phe- notypes, to better understand its underlying genetic and molecular causes. Results: Using a population of 29,350 taurine dairy cows, we conducted association analyses for milk yield and composition traits, and identifed highly signifcant QTL for milk yield, milk fat concentration, and milk protein con- centration. Strikingly, protein concentration and milk yield appear to show co-located yet genetically distinct QTL. To attempt to understand the molecular mechanisms that might be mediating these efects, gene expression data were used to investigate eQTL for 11 genes in the broader interval. This analysis highlighted genetic impacts on CSF2RB and NCF4 expression that share similar association signatures to those observed for lactation QTL, strongly implicating one or both of these genes as responsible for these efects. Using the same gene expression dataset representing 357 lactating cows, we also identifed 38 novel RNA editing sites in the 3′ UTR of CSF2RB transcripts. -
IL-25-Induced Activities IL-17RB and IL-17RA in Mediating Identification of Functional Roles for Both
Identification of Functional Roles for Both IL-17RB and IL-17RA in Mediating IL-25-Induced Activities This information is current as Erika A. Rickel, Lori A. Siegel, Bo-Rin Park Yoon, James B. of September 29, 2021. Rottman, David G. Kugler, David A. Swart, Penny M. Anders, Joel E. Tocker, Michael R. Comeau and Alison L. Budelsky J Immunol 2008; 181:4299-4310; ; doi: 10.4049/jimmunol.181.6.4299 Downloaded from http://www.jimmunol.org/content/181/6/4299 References This article cites 30 articles, 16 of which you can access for free at: http://www.jimmunol.org/content/181/6/4299.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 29, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Identification of Functional Roles for Both IL-17RB and IL-17RA in Mediating IL-25-Induced Activities Erika A. -
Calcium-Mediated Shaping of Naive CD4 T-Cell Phenotype and Function
RESEARCH ARTICLE Calcium-mediated shaping of naive CD4 T-cell phenotype and function Vincent Guichard1,2, Nelly Bonilla1, Aure´ lie Durand1, Alexandra Audemard-Verger1, Thomas Guilbert1, Bruno Martin1, Bruno Lucas1†, Ce´ dric Auffray1†* 1Institut Cochin, Paris Descartes Universite´, CNRS UMR8104, INSERM U1016, Paris, France; 2Paris Diderot Universite´, Paris, France Abstract Continuous contact with self-major histocompatibility complex ligands is essential for the survival of naive CD4 T cells. We have previously shown that the resulting tonic TCR signaling also influences their fate upon activation by increasing their ability to differentiate into induced/ peripheral regulatory T cells. To decipher the molecular mechanisms governing this process, we here focus on the TCR signaling cascade and demonstrate that a rise in intracellular calcium levels is sufficient to modulate the phenotype of mouse naive CD4 T cells and to increase their sensitivity to regulatory T-cell polarization signals, both processes relying on calcineurin activation. Accordingly, in vivo calcineurin inhibition leads the most self-reactive naive CD4 T cells to adopt the phenotype of their less self-reactive cell-counterparts. Collectively, our findings demonstrate that calcium- mediated activation of the calcineurin pathway acts as a rheostat to shape both the phenotype and effector potential of naive CD4 T cells in the steady-state. DOI: https://doi.org/10.7554/eLife.27215.001 *For correspondence: Introduction [email protected] T-cell precursors originate in the bone-marrow and are educated in the thymus through processes † called positive and negative selections, which result in MHC-restriction and self-tolerance, respec- These authors contributed equally to this work tively (Stritesky et al., 2012). -
The Interleukin 22 Pathway Interacts with Mutant KRAS to Promote Poor Prognosis in Colon Cancer
Author Manuscript Published OnlineFirst on May 19, 2020; DOI: 10.1158/1078-0432.CCR-19-1086 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. The interleukin 22 pathway interacts with mutant KRAS to promote poor prognosis in colon cancer Authors: Sarah McCuaig1, David Barras,2, Elizabeth Mann1, Matthias Friedrich1, Samuel Bullers1, Alina Janney1, Lucy C. Garner1, Enric Domingo3, Viktor Hendrik Koelzer3,4,5, Mauro Delorenzi2,6,7, Sabine Tejpar8, Timothy Maughan9, Nathaniel R. West1, Fiona Powrie1 Affiliations: 1 Kennedy Institute of Rheumatology, University of Oxford, Oxford UK. 2 SIB Swiss Institute of Bioinformatics, Bioinformatics Core Facility, Lausanne, Switzerland. 3Department of Oncology, University of Oxford, Oxford UK. 4Nuffield Department of Medicine, University of Oxford, Oxford UK. 5Department of Pathology and Molecular Pathology, University and University Hospital Zurich, Zurich Switzerland. 6 Ludwig Center for Cancer Research, University of Lausanne, Lausanne, Switzerland. 7 Department of Oncology, Faculty of Biology and Medicine, University of Lausanne, Lausanne Switzerland. 8 Molecular Digestive Oncology, KU Leuven, Belgium. 9 CRUK/MRC Oxford Institute for Radiation Oncology, University of Oxford, Oxford, UK. Downloaded from clincancerres.aacrjournals.org on September 30, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on May 19, 2020; DOI: 10.1158/1078-0432.CCR-19-1086 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Correspondence to: Professor Fiona Powrie; Kennedy Institute of Rheumatology, University of Oxford, Roosevelt Drive, Headington, Oxford, OX3 7YF, UK. Email: [email protected] Conflicts of Interest: S.M., N.R.W., and F.P. -
ABD-Derived Protein Blockers of Human IL-17 Receptor a As Non-Igg Alternatives for Modulation of IL-17-Dependent Pro-Inflammatory Axis
International Journal of Molecular Sciences Article ABD-Derived Protein Blockers of Human IL-17 Receptor A as Non-IgG Alternatives for Modulation of IL-17-Dependent Pro-Inflammatory Axis Marie Hlavniˇcková 1, Milan Kuchaˇr 1, Radim Osiˇcka 2, Lucie Vaˇnková 1, Hana Petroková 1, Michal Malý 1, Jiˇrí Cernˇ ý 3 , Petr Arenberger 4 and Petr Malý 1,* 1 Laboratory of Ligand Engineering, Institute of Biotechnology of the Czech Academy of Sciences, v. v. i., BIOCEV Research Center, Pru˚myslová 595, 252 50 Vestec, Czech Republic; [email protected] (M.H.); [email protected] (M.K.); [email protected] (L.V.); [email protected] (H.P.); [email protected] (M.M.) 2 Laboratory of Molecular Biology of the Bacterial Pathogens, Institute of Microbiology, Czech Academy of Sciences, v. v. i., Vídeˇnská 1083, 142 20 Prague, Czech Republic; [email protected] 3 Laboratory of Structural Bioinformatics of Proteins, Institute of Biotechnology of the Czech Academy of Sciences, v. v. i., BIOCEV Research Center, Pru˚myslová 595, 252 50 Vestec, Czech Republic; [email protected] 4 Department of Dermatology and Venereology, Faculty Hospital of Královské Vinohrady, Šrobárova 50, 100 34 Prague, Czech Republic; [email protected] * Correspondence: [email protected]; Tel.: +420-325-873-763 Received: 10 September 2018; Accepted: 6 October 2018; Published: 9 October 2018 Abstract: Interleukin 17 (IL-17) and its cognate receptor A (IL-17RA) play a crucial role in Th17 cells-mediated pro-inflammatory pathway and pathogenesis of several autoimmune disorders including psoriasis. -
IL-17RA-Signaling Modulates CD8+ T Cell Survival and Exhaustion During 2 Trypanosoma Cruzi Infection
bioRxiv preprint doi: https://doi.org/10.1101/314336; this version posted May 11, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 1 IL-17RA-signaling modulates CD8+ T cell survival and exhaustion during 2 Trypanosoma cruzi infection 3 Jimena Tosello Boari1,2, Cintia L. Araujo Furlan1,2, Facundo Fiocca Vernengo1,2, Constanza 4 Rodriguez1,2, María C. Ramello1,2, María C. Amezcua Vesely1,2, Melisa Gorosito Serrán1,2, 5 Nicolás G. Nuñez3,4, Wilfrid Richer3,4, Eliane Piaggio3,4, Carolina L. Montes1,2, Adriana 6 Gruppi1,2, Eva V. Acosta Rodríguez1,2*. 7 1 Departamento de Bioquímica Clínica. Facultad de Ciencias Químicas, Universidad 8 Nacional de Córdoba, Córdoba, X5000HUA. Argentina. 9 2 Centro de Investigaciones en Bioquímica Clínica e Inmunología. CONICET. Córdoba, 10 X5000HUA. Argentina. 11 3 SiRIC TransImm «Translational Immunotherapy Team», Translational Research 12 Department, Research Center, PSL Research University, INSERM U932, Institut Curie, 13 Paris, 75005. France. 14 4 Centre d’Investigation Clinique Biothérapie CICBT 1428, Institut Curie, Paris, 75005. 15 France. 16 Running title: IL-17RA signaling regulates CD8+ T cell responses to T. cruzi 17 *Corresponding autor: 18 Eva V. Acosta Rodríguez 19 [email protected] 20 1 bioRxiv preprint doi: https://doi.org/10.1101/314336; this version posted May 11, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. -
IL2 Receptor Alpha (IL2RA) (NM 000417) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG215768 IL2 Receptor alpha (IL2RA) (NM_000417) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: IL2 Receptor alpha (IL2RA) (NM_000417) Human Tagged ORF Clone Tag: TurboGFP Symbol: IL2RA Synonyms: CD25; IDDM10; IL2R; IMD41; p55; TCGFR Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG215768 representing NM_000417 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGATTCATACCTGCTGATGTGGGGACTGCTCACGTTCATCATGGTGCCTGGCTGCCAGGCAGAGCTCT GTGACGATGACCCGCCAGAGATCCCACACGCCACATTCAAAGCCATGGCCTACAAGGAAGGAACCATGTT GAACTGTGAATGCAAGAGAGGTTTCCGCAGAATAAAAAGCGGGTCACTCTATATGCTCTGTACAGGAAAC TCTAGCCACTCGTCCTGGGACAACCAATGTCAATGCACAAGCTCTGCCACTCGGAACACAACGAAACAAG TGACACCTCAACCTGAAGAACAGAAAGAAAGGAAAACCACAGAAATGCAAAGTCCAATGCAGCCAGTGGA CCAAGCGAGCCTTCCAGGTCACTGCAGGGAACCTCCACCATGGGAAAATGAAGCCACAGAGAGAATTTAT CATTTCGTGGTGGGGCAGATGGTTTATTATCAGTGCGTCCAGGGATACAGGGCTCTACACAGAGGTCCTG CTGAGAGCGTCTGCAAAATGACCCACGGGAAGACAAGGTGGACCCAGCCCCAGCTCATATGCACAGGTGA AATGGAGACCAGTCAGTTTCCAGGTGAAGAGAAGCCTCAGGCAAGCCCCGAAGGCCGTCCTGAGAGTGAG ACTTCCTGCCTCGTCACAACAACAGATTTTCAAATACAGACAGAAATGGCTGCAACCATGGAGACGTCCA TATTTACAACAGAGTACCAGGTAGCAGTGGCCGGCTGTGTTTTCCTGCTGATCAGCGTCCTCCTCCTGAG TGGGCTCACCTGGCAGCGGAGACAGAGGAAGAGTAGAAGAACAATC