Nimesulide Increases the Aldehyde Oxidase Activity of Humans and Rats

Total Page:16

File Type:pdf, Size:1020Kb

Load more

www.nature.com/aps ARTICLE Nimesulide increases the aldehyde oxidase activity of humans and rats Lei Zhou1, Xiao-yan Pang1, Xiang-yu Hou1, Lu Liu1, Zi-tao Guo1 and Xiao-yan Chen1 An increasing number of drugs are metabolized by aldehyde oxidase (AOX), but AOX-mediated drug interactions are seldom reported due to the lack of appropriate inhibitors and inducers. A recent study reported that nimesulide (NIM) could increase the liver injury risk of methotrexate. The latter was mainly metabolized by AOX to form hepatotoxic 7-hydroxymethotrexate (7-OH MTX). Thus, we speculated that NIM could induce AOX. In this study, we investigated the potential induction of AOX activity by NIM using methotrexate as the probe substrate. Treatment of primary human and rat hepatocytes with NIM (20 μM) for 24 h caused a 2.0- and 3.1-fold, respectively, increase in 7-OH MTX formation. Oral administration of NIM (100 mg·kg−1·d−1, for 5 days) to rats significantly increased the systematic exposure (6.5-fold), liver distribution (2.5-fold), and excretion (5.2-fold for urinary excretion and 2.1-fold for fecal excretion) of 7-OH MTX. The 7-OH MTX formation in liver cytosol from rats pretreated with 20, 50, and 100 mg·kg−1·d−1 NIM for 5 days increased by 1.9-, 3.2-, and 3.7-fold, respectively, compared with that of rats pretreated with the vehicle. We revealed that the elevation of AOX activity was accompanied by an increase in AOX1 protein levels but not the corresponding mRNA levels. Collectively, our results demonstrate for the first time that NIM can increase the AOX activity of humans and rats, and may raise concerns regarding the risk of drug interactions between NIM and AOX substrates in clinical practice. 1234567890();,: Keywords: nimesulide; aldehyde oxidase; induction; methotrexate; hepatocytes; pharmacokinetics; drug interaction Acta Pharmacologica Sinica (2020) 41:843–851; https://doi.org/10.1038/s41401-019-0336-3 INTRODUCTION [15]. MTX was mainly metabolized by AOX to form 7- Aldehyde oxidase (AOX) is a member of the molybdo-flavoprotein hydroxymethotrexate (7-OH MTX), which displayed higher toxicity enzyme family that is mainly localized in the cytosolic subcellular than the parent drug [16–18]. Thus, we speculated that NIM could fraction. It plays an important role in the oxidation of aromatic increase the formation of the toxic metabolite 7-OH MTX by azaheterocycles. The common substrates for this reaction type inducing AOX. include methotrexate (MTX) [1–3], SGX523 [4], JNJ-38877605 [5], In the present study, we examined the effect of NIM on AOX and phthalazine [6–8] (Fig. 1). To date, the significance of AOX as a activity in primary human and rat hepatocytes using MTX as a drug-metabolizing enzyme is increasing because of the trend in probe substrate. NIM was extensively metabolized in humans and the medicinal chemistry strategy of introducing N-heterocycle rats. The main metabolic pathways included phenoxy ring moieties, which can reduce or remove cytochrome P450 meta- hydroxylation to generate 4′-hydroxynimesulide (M1), reduction bolic liability and achieve increased solubility and low lipophilicity, of the nitro group (M2), and subsequent acetylation (M4) (Fig. 2) into candidate drugs. The proportion of potential AOX substrates [19]. The role of NIM metabolites in modulating AOX activity was among compounds that have already progressed to the drug also evaluated. Furthermore, we investigated the influence of NIM market is 13%, whereas that for compounds under development on the disposition of MTX and 7-OH MTX in rats and explored the at Pfizer is 45% [9]. changes in the protein and mRNA levels of AOX after NIM The number of drugs metabolized by AOX is increasing, but treatment. studies on AOX inhibition and induction are limited. AOX is induced by environmental pollutants and toxic agents, such as phthalazine [10], N-methyl-N′-nitrosoguanidine [11], and dioxin MATERIALS AND METHODS [12, 13]. To the best of our knowledge, no reports are available on Chemicals and reagents AOX induction by commonly used clinical drugs. MTX, 7-OH MTX, and d3-MTX were purchased from Dalian Meilun MTX is an antifolate agent that is widely used in treating Biotech Co. (Dalian, China). NIM, phthalazine, and protease rheumatoid arthritis. Nimesulide (NIM) is a commonly prescribed inhibitor cocktail were obtained from Sigma-Aldrich (St. Louis, nonsteroidal anti-inflammatory drug that can improve the MO, USA). The 4′-hydroxynimesulide (M1), nitro-reduced nimesu- therapeutic effect of MTX in the symptomatic alleviation of lide (M2), and acetylated metabolite of nitro-reduced nimesulide rheumatoid arthritis [14]. However, a recent study revealed that (M4) were synthesized as previously described [19]. SGX523 and the combination of MTX with NIM increased the risk of liver injury JNJ-38877606 were purchased from Selleck Chemicals (Houston, 1Shanghai Institute of Materia Medica, Chinese Academy of Sciences, Shanghai 201203, China Correspondence: Xiao-yan Chen ([email protected]) Received: 3 July 2019 Accepted: 18 November 2019 Published online: 8 January 2020 © CPS and SIMM 2019 Induction of aldehyde oxidase activity by nimesulide L Zhou et al. 844 Fig. 1 AOX-mediated oxidation of aromatic azaheterocyclic compounds. incubations were performed in triplicate and maintained at 37 °C in a humidified incubator containing 95% O2/5% CO2. To evaluate the effect of the induction time on the induction response, the rat hepatocytes were treated with either 0.1% dimethyl sulfoxide (DMSO) (control) or 20 μM NIM for 12, 24, 48, or 72 h. At the end of the induction period, the hepatocytes were treated with MTX (50 μM) for 24 h to determine the AOX activity. To evaluate the concentration-dependent induction of AOX by NIM, the rat and human hepatocytes were treated with various concentrations of NIM (0–20 μM for rat hepatocytes and 0–100 μM for human hepatocytes) for 24 h. At the end of the incubation, the hepatocytes were treated with MTX (50 μM) to determine the AOX activity or harvested for Western blot and quantitative real-time polymerase chain reaction (qRT-PCR) analysis. To investigate whether the increase in AOX activity was due to NIM itself or its Fig. 2 Major metabolic pathways of NIM. metabolites, rat and human hepatocytes were treated with the main metabolites (20 μM M1, M2, or M4) instead of NIM. TX, USA). All reagents used in the cell culture were supplied by Animal experiments Invitrogen (Carlsbad, CA, USA). A bicinchoninic acid assay (BCA) All procedures in animal studies were performed in accordance protein assay kit and radioimmunoprecipitation assay (RIPA) buffer with the Guide for the Care and Use of Laboratory Animals of were purchased from Beyotime (Shanghai, China). The rabbit anti- Shanghai Institute of Materia Medica, Chinese Academy of AOX1 polyclonal antibody and goat anti-AOX3 polyclonal anti- Sciences. body were obtained from Santa Cruz (Dallas, CA, USA). The rabbit Male Wistar rats weighing 200–250 g were randomized into two anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mono- groups (n = 4/group) and treated with 100 mg·kg−1·d−1 NIM or clonal antibody was purchased from CST (Danvers, MA, USA). All 0.5% sodium carboxymethyl cellulose (CMC-Na) as a control for other reagents and solvents were either of analytical or high- 5 successive days. At 24 h after the last dose, all rats were orally performance liquid chromatography grade. administered 50 mg/kg MTX and reared in metabolic cages with one rat in each cage. Blood samples were collected before and at Hepatocyte isolation and culture 0.25, 0.5, 1, 2, 4, 6, 8, and 24 h after MTX administration. Plasma Fresh rat hepatocytes were isolated from male Wistar rats samples were obtained by centrifugation of blood samples at (6–8 weeks) according to a previously reported method by our 11,000 × g for 5 min. Urine and fecal samples were collected group [19, 20]. Cryopreserved primary human hepatocytes from during the 0–24 h period after MTX administration. In addition, three individual donors (Lots: RMH, NHI, and DJJ; Caucasian male) two other groups of rats (n = 4/group) were treated with the same were obtained from BioreclamationIVT (Baltimore, MD, USA) and dosage regimen mentioned above. At 4 h after the MTX dosage, were revived according to the protocol. All hepatocytes were the rats were sacrificed, and rat livers were collected. seeded at a density of 6.0 × 105 cells/mL in 48-well plates Two independent experiments were carried out to investigate precoated with rat tail collagen and cultured in William’sE the dose- and time-dependent induction of AOX in rat livers by medium supplemented with 0.1 μM dexamethasone, 100 U/mL NIM. First, male Wistar rats were randomized into four groups (n = penicillin, 100 μg/mL streptomycin, 2 mM glutamine, and 1% 5/group) and orally administered 20, 50, and 100 mg·kg−1·d−1 NIM insulin–transferrin–selenium. The hepatocytes were cultured for or 0.5% CMC-Na as a control for 5 successive days. Second, male 4 h prior to the addition of the test compounds. All cell Wistar rats were randomized into six groups (n = 5/group) and Acta Pharmacologica Sinica (2020) 41:843 – 851 Induction of aldehyde oxidase activity by nimesulide L Zhou et al. 845 Table 1. List of primers for qRT-PCR analysis. Species Gene Accession Sequence Rat AOX1 NM_019363 Forward 5′-GATGCTTGCCAGACCCTTCT-3′ Reverse 5′-ATTCGACTCGTAGCCCCTGA-3′ Rat AOX3 NM_001008527 Forward 5′-AGCCTCTGCAAGACCAGTCG-3′ Reverse 5′-AGGCATCGAGGGAGATGATTC-3′ Rat GAPDH NM_017008 Forward 5′- CTCATGACCACAGTCCATGC -3′ Reverse 5′-TTCAGCTCTGGGATGACCTT-3′ Human AOX1 NM_001159 Forward 5′-TGTCGATCCTGAAACAATGCTG-3′ Reverse 5′-GGTGATGGGGTTGTATCGTGA-3′ Human PPIA NM_021130 Forward 5′-CACCGTGTTCTTCGACATTG-3′ Reverse 5′-TCCTTTCTCTCCAGTGCTCAG-3′ treated with 100 mg·kg−1·d−1 NIM or the vehicle for 1, 3, or 5 days.
Recommended publications
  • Corning® Supersomes™ Ultra Human Aldehyde Oxidase

    Corning® Supersomes™ Ultra Human Aldehyde Oxidase

    Corning® Supersomes™ Ultra Human Aldehyde Oxidase Aldehyde Oxidase (AO) is a cytosolic enzyme that plays an important role in non-CYP mediated drug metabolism and pharmacokinetics. AO has garnered significant attention in the pharmaceutical industry due to multiple drug failures during clinical trials that were associated with the AO pathway and an increase in the number of aromatic aza-heterocycle moieties found in drug leads that have been identified as substrates for AO. Traditionally, recombinant AO (rAO) is expressed in bacteria. However, this approach has disadvantages such as different protein post-translation modifications that lead to different function as compared to mammalian cells. Corning has developed Corning Supersomes Ultra Aldehyde Oxidase, a recombinant human AO enzyme utilizing a mammalian cell-based expression system to address these issues. This product will enable early assessment of the liability of AO for drug metabolism and clearance. Corning Supersomes Ultra Human Aldehyde Oxidase has been over-expressed in HEK-293 cells and exhibited a significantly higher activity as compared to AO expressed in E. coli. Time- dependent enzyme kinetics, using known substrates and inhibitors, between the rAO and the native form found in human liver cytosol produced a good correlation. Features and Benefits of Corning Supersomes Ultra Aldehyde Oxidase Mammalian cell expression system Corning Supersomes Ultra Human Aldehyde Oxidase Performance Corning Supersomes Ultra AO have been engineered in HEK-293 mammalian cells, thereby eliminating the biosafety concerns Activity Comparison Utilizing Probe Substrate (Zaleplon, 250 µM) associated with baculovirus. Stable and reliable in vitro tool 25 Corning Supersomes Ultra AO are a stable and reliable in vitro tool for the study of AO-mediated metabolism, which provides a 20 quantitative contribution of drug clearance.
  • RT² Profiler PCR Array (Rotor-Gene® Format) Human Amino Acid Metabolism I

    RT² Profiler PCR Array (Rotor-Gene® Format) Human Amino Acid Metabolism I

    RT² Profiler PCR Array (Rotor-Gene® Format) Human Amino Acid Metabolism I Cat. no. 330231 PAHS-129ZR For pathway expression analysis Format For use with the following real-time cyclers RT² Profiler PCR Array, Rotor-Gene Q, other Rotor-Gene cyclers Format R Description The Human Amino Acid Metabolism I RT² Profiler PCR Array profiles the expression of 84 key genes important in biosynthesis and degradation of functional amino acids. Of the 20 amino acids required for protein synthesis, six of them (arginine, cysteine, glutamine, leucine, proline, and tryptophan), collectively known as the functional amino acids, regulate key metabolic pathways involved in cellular growth, and development, as well as other important biological processes such as immunity and reproduction. For example, leucine activates mTOR signaling and increases protein synthesis, leading to lymphocyte proliferation. Therefore, a lack of leucine can compromise immune function. Metabolic pathways interrelated with the biosynthesis and degradation of these amino acids include vitamin and cofactor biosynthesis (such as SAM or S-Adenosyl Methionine) as well as neurotransmitter metabolism (such as glutamate). This array includes genes for mammalian functional amino acid metabolism as well as genes involved in methionine metabolism, important also for nutrient sensing and sulfur metabolism. Using realtime PCR, you can easily and reliably analyze the expression of a focused panel of genes involved in functional amino acid metabolism with this array. For further details, consult the RT² Profiler PCR Array Handbook. Shipping and storage RT² Profiler PCR Arrays in the Rotor-Gene format are shipped at ambient temperature, on dry ice, or blue ice packs depending on destination and accompanying products.
  • Cytochrome P450 Oxidative Metabolism: Contributions to the Pharmacokinetics, Safety, and Efficacy of Xenobiotics

    Cytochrome P450 Oxidative Metabolism: Contributions to the Pharmacokinetics, Safety, and Efficacy of Xenobiotics

    1521-009X/44/8/1229–1245$25.00 http://dx.doi.org/10.1124/dmd.116.071753 DRUG METABOLISM AND DISPOSITION Drug Metab Dispos 44:1229–1245, August 2016 Copyright ª 2016 by The American Society for Pharmacology and Experimental Therapeutics Special Section on Emerging Novel Enzyme Pathways in Drug Metabolism—Commentary Cytochrome P450 and Non–Cytochrome P450 Oxidative Metabolism: Contributions to the Pharmacokinetics, Safety, and Efficacy of Xenobiotics Robert S. Foti and Deepak K. Dalvie Pharmacokinetics and Drug Metabolism, Amgen, Cambridge, Massachusetts (R.S.F.); and Pharmacokinetics, Dynamics, and Metabolism, Pfizer, La Jolla, California (D.K.D.) Downloaded from Received May 24, 2016; accepted June 10, 2016 ABSTRACT The drug-metabolizing enzymes that contribute to the metabolism this end, this Special Section on Emerging Novel Enzyme Pathways or bioactivation of a drug play a crucial role in defining the in Drug Metabolism will highlight a number of advancements that dmd.aspetjournals.org absorption, distribution, metabolism, and excretion properties of have recently been reported. The included articles support the that drug. Although the overall effect of the cytochrome P450 (P450) important role of non-P450 enzymes in the clearance pathways of family of drug-metabolizing enzymes in this capacity cannot be U.S. Food and Drug Administration–approved drugs over the past understated, advancements in the field of non-P450–mediated me- 10 years. Specific examples will detail recent reports of aldehyde tabolism have garnered increasing attention in recent years. This is oxidase, flavin-containing monooxygenase, and other non-P450 perhaps a direct result of our ability to systematically avoid P450 pathways that contribute to the metabolic, pharmacokinetic, or liabilities by introducing chemical moieties that are not susceptible pharmacodynamic properties of xenobiotic compounds.
  • Amino Acid Disorders

    Amino Acid Disorders

    471 Review Article on Inborn Errors of Metabolism Page 1 of 10 Amino acid disorders Ermal Aliu1, Shibani Kanungo2, Georgianne L. Arnold1 1Children’s Hospital of Pittsburgh, University of Pittsburgh School of Medicine, Pittsburgh, PA, USA; 2Western Michigan University Homer Stryker MD School of Medicine, Kalamazoo, MI, USA Contributions: (I) Conception and design: S Kanungo, GL Arnold; (II) Administrative support: S Kanungo; (III) Provision of study materials or patients: None; (IV) Collection and assembly of data: E Aliu, GL Arnold; (V) Data analysis and interpretation: None; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. Correspondence to: Georgianne L. Arnold, MD. UPMC Children’s Hospital of Pittsburgh, 4401 Penn Avenue, Suite 1200, Pittsburgh, PA 15224, USA. Email: [email protected]. Abstract: Amino acids serve as key building blocks and as an energy source for cell repair, survival, regeneration and growth. Each amino acid has an amino group, a carboxylic acid, and a unique carbon structure. Human utilize 21 different amino acids; most of these can be synthesized endogenously, but 9 are “essential” in that they must be ingested in the diet. In addition to their role as building blocks of protein, amino acids are key energy source (ketogenic, glucogenic or both), are building blocks of Kreb’s (aka TCA) cycle intermediates and other metabolites, and recycled as needed. A metabolic defect in the metabolism of tyrosine (homogentisic acid oxidase deficiency) historically defined Archibald Garrod as key architect in linking biochemistry, genetics and medicine and creation of the term ‘Inborn Error of Metabolism’ (IEM). The key concept of a single gene defect leading to a single enzyme dysfunction, leading to “intoxication” with a precursor in the metabolic pathway was vital to linking genetics and metabolic disorders and developing screening and treatment approaches as described in other chapters in this issue.
  • Supplementary Materials

    Supplementary Materials

    Supplementary Materials COMPARATIVE ANALYSIS OF THE TRANSCRIPTOME, PROTEOME AND miRNA PROFILE OF KUPFFER CELLS AND MONOCYTES Andrey Elchaninov1,3*, Anastasiya Lokhonina1,3, Maria Nikitina2, Polina Vishnyakova1,3, Andrey Makarov1, Irina Arutyunyan1, Anastasiya Poltavets1, Evgeniya Kananykhina2, Sergey Kovalchuk4, Evgeny Karpulevich5,6, Galina Bolshakova2, Gennady Sukhikh1, Timur Fatkhudinov2,3 1 Laboratory of Regenerative Medicine, National Medical Research Center for Obstetrics, Gynecology and Perinatology Named after Academician V.I. Kulakov of Ministry of Healthcare of Russian Federation, Moscow, Russia 2 Laboratory of Growth and Development, Scientific Research Institute of Human Morphology, Moscow, Russia 3 Histology Department, Medical Institute, Peoples' Friendship University of Russia, Moscow, Russia 4 Laboratory of Bioinformatic methods for Combinatorial Chemistry and Biology, Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry of the Russian Academy of Sciences, Moscow, Russia 5 Information Systems Department, Ivannikov Institute for System Programming of the Russian Academy of Sciences, Moscow, Russia 6 Genome Engineering Laboratory, Moscow Institute of Physics and Technology, Dolgoprudny, Moscow Region, Russia Figure S1. Flow cytometry analysis of unsorted blood sample. Representative forward, side scattering and histogram are shown. The proportions of negative cells were determined in relation to the isotype controls. The percentages of positive cells are indicated. The blue curve corresponds to the isotype control. Figure S2. Flow cytometry analysis of unsorted liver stromal cells. Representative forward, side scattering and histogram are shown. The proportions of negative cells were determined in relation to the isotype controls. The percentages of positive cells are indicated. The blue curve corresponds to the isotype control. Figure S3. MiRNAs expression analysis in monocytes and Kupffer cells. Full-length of heatmaps are presented.
  • DROSOPHILA INFORMATION SERVICE March 1981

    DROSOPHILA INFORMATION SERVICE March 1981

    DROSOPHILA INFORMATION SERVICE 56 March 1981 Material contributed by DROSOPHILA WORKERS and arranged by P. W. HEDRICK with bibliography edited by I. H. HERSKOWITZ Material presented here should not be used in publications without the consent of the author. Prepared at the DIVISION OF BIOLOGICAL SCIENCES UNIVERSITY OF KANSAS Lawrence, Kansas 66045 - USA DROSOPHILA INFORMATION SERVICE Number 56 March 1981 Prepared at the Division of Biological Sciences University of Kansas Lawrence, Kansas - USA For information regarding submission of manuscripts or other contributions to Drosophila Information Service, contact P. W. Hedrick, Editor, Division of Biological Sciences, University of Kansas, Lawrence, Kansas 66045 - USA. March 1981 DROSOPHILA INFORMATION SERVICE 56 DIS 56 - I Table of Contents ON THE ORIGIN OF THE DROSOPHILA CONFERENCES L. Sandier ............... 56: vi 1981 DROSOPHILA RESEARCH CONFERENCE .......................... 56: 1 1980 DROSOPHILA RESEARCH CONFERENCE REPORT ...................... 56: 1 ERRATA ........................................ 56: 3 ANNOUNCEMENTS ..................................... 56: 4 HISTORY OF THE HAWAIIAN DROSOPHILA PROJECT. H.T. Spieth ............... 56: 6 RESEARCH NOTES BAND, H.T. Chyniomyza amoena - not a pest . 56: 15 BAND, H.T. Ability of Chymomyza amoena preadults to survive -2 C with no preconditioning . 56: 15 BAND, H.T. Duplication of the delay in emergence by Chymomyza amoena larvae after subzero treatment . 56: 16 BATTERBAM, P. and G.K. CHAMBERS. The molecular weight of a novel phenol oxidase in D. melanogaster . 56: 18 BECK, A.K., R.R. RACINE and F.E. WURGLER. Primary nondisjunction frequencies in seven chromosome substitution stocks of D. melanogaster . 56: 17 BECKENBACH, A.T. Map position of the esterase-5 locus of D. pseudoobscura: a usable marker for "sex-ratio ..
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
  • Download Thesis

    Download Thesis

    This electronic thesis or dissertation has been downloaded from the King’s Research Portal at https://kclpure.kcl.ac.uk/portal/ Optimising the use of Azathioprine in the treatment of Inflammatory Bowel Disease Smith, Melissa Ann Awarding institution: King's College London The copyright of this thesis rests with the author and no quotation from it or information derived from it may be published without proper acknowledgement. END USER LICENCE AGREEMENT Unless another licence is stated on the immediately following page this work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International licence. https://creativecommons.org/licenses/by-nc-nd/4.0/ You are free to copy, distribute and transmit the work Under the following conditions: Attribution: You must attribute the work in the manner specified by the author (but not in any way that suggests that they endorse you or your use of the work). Non Commercial: You may not use this work for commercial purposes. No Derivative Works - You may not alter, transform, or build upon this work. Any of these conditions can be waived if you receive permission from the author. Your fair dealings and other rights are in no way affected by the above. Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 29. Sep. 2021 Optimising the use of Azathioprine in the treatment of Inflammatory Bowel Disease Dr Melissa Ann Smith MD (Res) 2013 MD thesis Azathioprine in IBD Melissa Ann Smith Table of Contents Table of Contents ...........................................................................................................................
  • Conversion of Indole-3-Acetaldehyde to Indole-3-Acetic Acid in Cell-Wall Fraction of Barley {Hordeum Vulgare) Seedlings

    Conversion of Indole-3-Acetaldehyde to Indole-3-Acetic Acid in Cell-Wall Fraction of Barley {Hordeum Vulgare) Seedlings

    Plant Cell Physiol. 38(3): 268-273 (1997) JSPP © 1997 Conversion of Indole-3-Acetaldehyde to Indole-3-Acetic Acid in Cell-Wall Fraction of Barley {Hordeum vulgare) Seedlings Ken-ichi Tsurusaki1, Kazuyoshi Takeda2 and Naoki Sakurai3 1 Faculty of Liberal Arts, Fukuyama University, Fukuyama, 729-02 Japan 2 Research Institute for Bioresources, Okayama University, Kurashiki, Okayama, 710 Japan 3 Department of Environmental Studies, Faculty of Integrated Arts & Sciences, Hiroshima University, Higashi-Hiroshima, 739 Japan The cell-wall fraction of barley seedlings was able (Trp) has been suggested as a primary precursor of IAA to oxidize indole-3-acetaldehyde (IAAld) to form IAA, (Gordon 1954, Gibson et al. 1972, Monteiro et al. 1988, whereas the fraction did not catalyze the conversion of in- Cooney and Nonhebel 1991, Bialek et al. 1992, Koshiba dole-3-acetonitrile or indole-3-acetamide to IAA. The activ- and Matsuyama 1993, Koshiba et al. 1995), because Trp iDownloaded from https://academic.oup.com/pcp/article/38/3/268/1928462 by guest on 24 September 2021 s ity was lower in a semi-dwarf mutant that had an endog- similar in structure to IAA and is ubiquitous in plant enous IAA level lower than that of the normal isogenic tissues. strain [Inouhe et al. (1982) Plant Cell Physiol. 23: 689]. Two pathways of IAA biosynthesis from L-Trp have The soluble fraction also contained some activity; the activ- been proposed in higher plants: Trp —• indole-3-pyruvic ity was similar in the normal and mutant strains. The op- acid -»indole-3-acetaldehyde (IAAld) ->• IAA; or Trp -> timal pH for the conversion of IAAld to IAA in the cell- tryptamine —• IAAld -* IAA.
  • Metabolic Enzyme Expression Highlights a Key Role for MTHFD2 and the Mitochondrial Folate Pathway in Cancer

    Metabolic Enzyme Expression Highlights a Key Role for MTHFD2 and the Mitochondrial Folate Pathway in Cancer

    ARTICLE Received 1 Nov 2013 | Accepted 17 Dec 2013 | Published 23 Jan 2014 DOI: 10.1038/ncomms4128 Metabolic enzyme expression highlights a key role for MTHFD2 and the mitochondrial folate pathway in cancer Roland Nilsson1,2,*, Mohit Jain3,4,5,6,*,w, Nikhil Madhusudhan3,4,5, Nina Gustafsson Sheppard1,2, Laura Strittmatter3,4,5, Caroline Kampf7, Jenny Huang8, Anna Asplund7 & Vamsi K. Mootha3,4,5 Metabolic remodeling is now widely regarded as a hallmark of cancer, but it is not clear whether individual metabolic strategies are frequently exploited by many tumours. Here we compare messenger RNA profiles of 1,454 metabolic enzymes across 1,981 tumours spanning 19 cancer types to identify enzymes that are consistently differentially expressed. Our meta- analysis recovers established targets of some of the most widely used chemotherapeutics, including dihydrofolate reductase, thymidylate synthase and ribonucleotide reductase, while also spotlighting new enzymes, such as the mitochondrial proline biosynthetic enzyme PYCR1. The highest scoring pathway is mitochondrial one-carbon metabolism and is centred on MTHFD2. MTHFD2 RNA and protein are markedly elevated in many cancers and correlated with poor survival in breast cancer. MTHFD2 is expressed in the developing embryo, but is absent in most healthy adult tissues, even those that are proliferating. Our study highlights the importance of mitochondrial compartmentalization of one-carbon metabolism in cancer and raises important therapeutic hypotheses. 1 Unit of Computational Medicine, Department of Medicine, Karolinska Institutet, 17176 Stockholm, Sweden. 2 Center for Molecular Medicine, Karolinska Institutet, 17176 Stockholm, Sweden. 3 Broad Institute, Cambridge, Massachusetts 02142, USA. 4 Department of Systems Biology, Harvard Medical School, Boston, Massachusetts 02115, USA.
  • Index of Recommended Enzyme Names

    Index of Recommended Enzyme Names

    Index of Recommended Enzyme Names EC-No. Recommended Name Page 1.2.1.10 acetaldehyde dehydrogenase (acetylating) 115 1.2.1.38 N-acetyl-y-glutamyl-phosphate reductase 289 1.2.1.3 aldehyde dehydrogenase (NAD+) 32 1.2.1.4 aldehyde dehydrogenase (NADP+) 63 1.2.99.3 aldehyde dehydrogenase (pyrroloquinoline-quinone) 578 1.2.1.5 aldehyde dehydrogenase [NAD(P)+] 72 1.2.3.1 aldehyde oxidase 425 1.2.1.31 L-aminoadipate-semialdehyde dehydrogenase 262 1.2.1.19 aminobutyraldehyde dehydrogenase 195 1.2.1.32 aminomuconate-semialdehyde dehydrogenase 271 1.2.1.29 aryl-aldehyde dehydrogenase 255 1.2.1.30 aryl-aldehyde dehydrogenase (NADP+) 257 1.2.3.9 aryl-aldehyde oxidase 471 1.2.1.11 aspartate-semialdehyde dehydrogenase 125 1.2.1.6 benzaldehyde dehydrogenase (deleted) 88 1.2.1.28 benzaldehyde dehydrogenase (NAD+) 246 1.2.1.7 benzaldehyde dehydrogenase (NADP+) 89 1.2.1.8 betaine-aldehyde dehydrogenase 94 1.2.1.57 butanal dehydrogenase 372 1.2.99.2 carbon-monoxide dehydrogenase 564 1.2.3.10 carbon-monoxide oxidase 475 1.2.2.4 carbon-monoxide oxygenase (cytochrome b-561) 422 1.2.1.45 4-carboxy-2-hydroxymuconate-6-semialdehyde dehydrogenase .... 323 1.2.99.6 carboxylate reductase 598 1.2.1.60 5-carboxymethyl-2-hydroxymuconic-semialdehyde dehydrogenase . 383 1.2.1.44 cinnamoyl-CoA reductase 316 1.2.1.68 coniferyl-aldehyde dehydrogenase 405 1.2.1.33 (R)-dehydropantoate dehydrogenase 278 1.2.1.26 2,5-dioxovalerate dehydrogenase 239 1.2.1.69 fluoroacetaldehyde dehydrogenase 408 1.2.1.46 formaldehyde dehydrogenase 328 1.2.1.1 formaldehyde dehydrogenase (glutathione)
  • Developmental Changes of Aldehyde Oxidase Activity and Protein Expression in Human Liver Cytosol

    Developmental Changes of Aldehyde Oxidase Activity and Protein Expression in Human Liver Cytosol

    Drug Metab. Pharmacokinet. 27 (5): 543­547 (2012). Copyright © 2012 by the Japanese Society for the Study of Xenobiotics (JSSX) Note Developmental Changes of Aldehyde Oxidase Activity and Protein Expression in Human Liver Cytosol Yoshitaka TAYAMA1,*,KazumiSUGIHARA1,2,SeigoSANOH2, Katsushi MIYAKE1, Shigeyuki KITAMURA2,3 and Shigeru OHTA2 1Faculty of Pharmaceutical Science, Hiroshima International University, Kure, Japan 2Division of Medicinal Chemistry, Graduate School of Biomedical Sciences, Hiroshima University, Hiroshima, Japan 3Nihon Pharmaceutical University, Saitama, Japan Full text of this paper is available at http://www.jstage.jst.go.jp/browse/dmpk Summary: Aldehyde oxidase (AO) plays a role in metabolizing many drugs, such as methotrexate and 6- mercaptopurine. We previously showed that AO activity in rat liver rapidly increases from birth, reaching a plateau within 4 weeks, and is regulated at the protein expression level. However, developmental changes of AO activity and protein expression in human liver have not been reported. Here, we investigated the developmental changes and variability of AO in 16 human livers (13 children ranging from 13 days to 12 years old and 3 adults, 17, 34 and 45 years old). Young children (13 days to 4 months after birth) showed little liver AO activity, evaluated in terms of the activities for oxidation of N-1-methylnicotinamide to N-1- methyl-2-pyridone-5-carboxamide and N-1-methyl-4-pyridone-3-carboxamide in liver cytosol. However, these oxidase activities were markedly increased after 4 months, reaching the adult level by about 2 years of age. The AO band density in immunoblotting analysis waswellcorrelatedwiththeAOactivityamongall subjects (p < 0.01, r2 = 0.771).