www.nature.com/aps ARTICLE Nimesulide increases the aldehyde oxidase activity of humans and rats Lei Zhou1, Xiao-yan Pang1, Xiang-yu Hou1, Lu Liu1, Zi-tao Guo1 and Xiao-yan Chen1 An increasing number of drugs are metabolized by aldehyde oxidase (AOX), but AOX-mediated drug interactions are seldom reported due to the lack of appropriate inhibitors and inducers. A recent study reported that nimesulide (NIM) could increase the liver injury risk of methotrexate. The latter was mainly metabolized by AOX to form hepatotoxic 7-hydroxymethotrexate (7-OH MTX). Thus, we speculated that NIM could induce AOX. In this study, we investigated the potential induction of AOX activity by NIM using methotrexate as the probe substrate. Treatment of primary human and rat hepatocytes with NIM (20 μM) for 24 h caused a 2.0- and 3.1-fold, respectively, increase in 7-OH MTX formation. Oral administration of NIM (100 mg·kg−1·d−1, for 5 days) to rats significantly increased the systematic exposure (6.5-fold), liver distribution (2.5-fold), and excretion (5.2-fold for urinary excretion and 2.1-fold for fecal excretion) of 7-OH MTX. The 7-OH MTX formation in liver cytosol from rats pretreated with 20, 50, and 100 mg·kg−1·d−1 NIM for 5 days increased by 1.9-, 3.2-, and 3.7-fold, respectively, compared with that of rats pretreated with the vehicle. We revealed that the elevation of AOX activity was accompanied by an increase in AOX1 protein levels but not the corresponding mRNA levels. Collectively, our results demonstrate for the first time that NIM can increase the AOX activity of humans and rats, and may raise concerns regarding the risk of drug interactions between NIM and AOX substrates in clinical practice. 1234567890();,: Keywords: nimesulide; aldehyde oxidase; induction; methotrexate; hepatocytes; pharmacokinetics; drug interaction Acta Pharmacologica Sinica (2020) 41:843–851; https://doi.org/10.1038/s41401-019-0336-3 INTRODUCTION [15]. MTX was mainly metabolized by AOX to form 7- Aldehyde oxidase (AOX) is a member of the molybdo-flavoprotein hydroxymethotrexate (7-OH MTX), which displayed higher toxicity enzyme family that is mainly localized in the cytosolic subcellular than the parent drug [16–18]. Thus, we speculated that NIM could fraction. It plays an important role in the oxidation of aromatic increase the formation of the toxic metabolite 7-OH MTX by azaheterocycles. The common substrates for this reaction type inducing AOX. include methotrexate (MTX) [1–3], SGX523 [4], JNJ-38877605 [5], In the present study, we examined the effect of NIM on AOX and phthalazine [6–8] (Fig. 1). To date, the significance of AOX as a activity in primary human and rat hepatocytes using MTX as a drug-metabolizing enzyme is increasing because of the trend in probe substrate. NIM was extensively metabolized in humans and the medicinal chemistry strategy of introducing N-heterocycle rats. The main metabolic pathways included phenoxy ring moieties, which can reduce or remove cytochrome P450 meta- hydroxylation to generate 4′-hydroxynimesulide (M1), reduction bolic liability and achieve increased solubility and low lipophilicity, of the nitro group (M2), and subsequent acetylation (M4) (Fig. 2) into candidate drugs. The proportion of potential AOX substrates [19]. The role of NIM metabolites in modulating AOX activity was among compounds that have already progressed to the drug also evaluated. Furthermore, we investigated the influence of NIM market is 13%, whereas that for compounds under development on the disposition of MTX and 7-OH MTX in rats and explored the at Pfizer is 45% [9]. changes in the protein and mRNA levels of AOX after NIM The number of drugs metabolized by AOX is increasing, but treatment. studies on AOX inhibition and induction are limited. AOX is induced by environmental pollutants and toxic agents, such as phthalazine [10], N-methyl-N′-nitrosoguanidine [11], and dioxin MATERIALS AND METHODS [12, 13]. To the best of our knowledge, no reports are available on Chemicals and reagents AOX induction by commonly used clinical drugs. MTX, 7-OH MTX, and d3-MTX were purchased from Dalian Meilun MTX is an antifolate agent that is widely used in treating Biotech Co. (Dalian, China). NIM, phthalazine, and protease rheumatoid arthritis. Nimesulide (NIM) is a commonly prescribed inhibitor cocktail were obtained from Sigma-Aldrich (St. Louis, nonsteroidal anti-inflammatory drug that can improve the MO, USA). The 4′-hydroxynimesulide (M1), nitro-reduced nimesu- therapeutic effect of MTX in the symptomatic alleviation of lide (M2), and acetylated metabolite of nitro-reduced nimesulide rheumatoid arthritis [14]. However, a recent study revealed that (M4) were synthesized as previously described [19]. SGX523 and the combination of MTX with NIM increased the risk of liver injury JNJ-38877606 were purchased from Selleck Chemicals (Houston, 1Shanghai Institute of Materia Medica, Chinese Academy of Sciences, Shanghai 201203, China Correspondence: Xiao-yan Chen ([email protected]) Received: 3 July 2019 Accepted: 18 November 2019 Published online: 8 January 2020 © CPS and SIMM 2019 Induction of aldehyde oxidase activity by nimesulide L Zhou et al. 844 Fig. 1 AOX-mediated oxidation of aromatic azaheterocyclic compounds. incubations were performed in triplicate and maintained at 37 °C in a humidified incubator containing 95% O2/5% CO2. To evaluate the effect of the induction time on the induction response, the rat hepatocytes were treated with either 0.1% dimethyl sulfoxide (DMSO) (control) or 20 μM NIM for 12, 24, 48, or 72 h. At the end of the induction period, the hepatocytes were treated with MTX (50 μM) for 24 h to determine the AOX activity. To evaluate the concentration-dependent induction of AOX by NIM, the rat and human hepatocytes were treated with various concentrations of NIM (0–20 μM for rat hepatocytes and 0–100 μM for human hepatocytes) for 24 h. At the end of the incubation, the hepatocytes were treated with MTX (50 μM) to determine the AOX activity or harvested for Western blot and quantitative real-time polymerase chain reaction (qRT-PCR) analysis. To investigate whether the increase in AOX activity was due to NIM itself or its Fig. 2 Major metabolic pathways of NIM. metabolites, rat and human hepatocytes were treated with the main metabolites (20 μM M1, M2, or M4) instead of NIM. TX, USA). All reagents used in the cell culture were supplied by Animal experiments Invitrogen (Carlsbad, CA, USA). A bicinchoninic acid assay (BCA) All procedures in animal studies were performed in accordance protein assay kit and radioimmunoprecipitation assay (RIPA) buffer with the Guide for the Care and Use of Laboratory Animals of were purchased from Beyotime (Shanghai, China). The rabbit anti- Shanghai Institute of Materia Medica, Chinese Academy of AOX1 polyclonal antibody and goat anti-AOX3 polyclonal anti- Sciences. body were obtained from Santa Cruz (Dallas, CA, USA). The rabbit Male Wistar rats weighing 200–250 g were randomized into two anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mono- groups (n = 4/group) and treated with 100 mg·kg−1·d−1 NIM or clonal antibody was purchased from CST (Danvers, MA, USA). All 0.5% sodium carboxymethyl cellulose (CMC-Na) as a control for other reagents and solvents were either of analytical or high- 5 successive days. At 24 h after the last dose, all rats were orally performance liquid chromatography grade. administered 50 mg/kg MTX and reared in metabolic cages with one rat in each cage. Blood samples were collected before and at Hepatocyte isolation and culture 0.25, 0.5, 1, 2, 4, 6, 8, and 24 h after MTX administration. Plasma Fresh rat hepatocytes were isolated from male Wistar rats samples were obtained by centrifugation of blood samples at (6–8 weeks) according to a previously reported method by our 11,000 × g for 5 min. Urine and fecal samples were collected group [19, 20]. Cryopreserved primary human hepatocytes from during the 0–24 h period after MTX administration. In addition, three individual donors (Lots: RMH, NHI, and DJJ; Caucasian male) two other groups of rats (n = 4/group) were treated with the same were obtained from BioreclamationIVT (Baltimore, MD, USA) and dosage regimen mentioned above. At 4 h after the MTX dosage, were revived according to the protocol. All hepatocytes were the rats were sacrificed, and rat livers were collected. seeded at a density of 6.0 × 105 cells/mL in 48-well plates Two independent experiments were carried out to investigate precoated with rat tail collagen and cultured in William’sE the dose- and time-dependent induction of AOX in rat livers by medium supplemented with 0.1 μM dexamethasone, 100 U/mL NIM. First, male Wistar rats were randomized into four groups (n = penicillin, 100 μg/mL streptomycin, 2 mM glutamine, and 1% 5/group) and orally administered 20, 50, and 100 mg·kg−1·d−1 NIM insulin–transferrin–selenium. The hepatocytes were cultured for or 0.5% CMC-Na as a control for 5 successive days. Second, male 4 h prior to the addition of the test compounds. All cell Wistar rats were randomized into six groups (n = 5/group) and Acta Pharmacologica Sinica (2020) 41:843 – 851 Induction of aldehyde oxidase activity by nimesulide L Zhou et al. 845 Table 1. List of primers for qRT-PCR analysis. Species Gene Accession Sequence Rat AOX1 NM_019363 Forward 5′-GATGCTTGCCAGACCCTTCT-3′ Reverse 5′-ATTCGACTCGTAGCCCCTGA-3′ Rat AOX3 NM_001008527 Forward 5′-AGCCTCTGCAAGACCAGTCG-3′ Reverse 5′-AGGCATCGAGGGAGATGATTC-3′ Rat GAPDH NM_017008 Forward 5′- CTCATGACCACAGTCCATGC -3′ Reverse 5′-TTCAGCTCTGGGATGACCTT-3′ Human AOX1 NM_001159 Forward 5′-TGTCGATCCTGAAACAATGCTG-3′ Reverse 5′-GGTGATGGGGTTGTATCGTGA-3′ Human PPIA NM_021130 Forward 5′-CACCGTGTTCTTCGACATTG-3′ Reverse 5′-TCCTTTCTCTCCAGTGCTCAG-3′ treated with 100 mg·kg−1·d−1 NIM or the vehicle for 1, 3, or 5 days.