RATIONALE FOR THE EVOLUTIONARY RETENTION OF TWO
UNRELATED LYSYL-tRNA SYNTHETASES
DISSERTATION
Presented in Partial Fulfillment of the Requirements for
The Degree Doctor of Philosophy in the Graduate School of
The Ohio State University
By
Sandro Fernandes Ataide, M.S.
*****
The Ohio State University
2006
Dissertation Committee:
Professor Michael Ibba, Adviser
Professor Juan Alfonzo Approved by
Professor Irina Artsimovitch
Professor Mark Foster ______Adviser Graduate Program in Microbiology
ABSTRACT
Lysine insertion during coded protein synthesis requires lysyl-tRNALys, which is synthesized by lysyl-tRNA synthetase (LysRS). Two unrelated forms of LysRS are known: LysRS2, which is found in eukaryotes, most bacteria and a few archaea, and
LysRS1, which is found in most archaea and a few bacteria. A detailed comparison of the amino acid recognition strategies of LysRS1 (Borrelia burgdorferi) and LysRS2
(Escherichia coli) was undertaken by studying the effects of lysine analogues on the aminoacylation reaction in vitro and in vivo. Also, based on comparisons of crystal structures and discrimination of lysine analogues by both LysRSs, the roles of the key residues in the active site of LysRS2 (lysS encoded) from E. coli were determined in vitro and in vivo. The differences in resistance to naturally occurring non-cognate amino acids
suggest the distribution of LysRS1 and LysRS2 contributes to quality control during
protein synthesis.
LysRS1 and LysRS2 are not normally found together within one organism. From
more than 250 publicly available genome sequences, the only instances where both
LysRS1 and LysRS2 are found together are the Methanocarcineae in the archaea and
certain Bacilli among the bacteria. It was shown that Methanosarcina barkeri LysRS1
and LysRS2 can together aminoacylate the rare tRNAPyl species, although the role of this
ii in vitro activity remains unclear in vivo. In the pathogen Bacillus cereus, both forms of
LysRS are also encoded, but genome sequence analysis does not identify tRNAPyl or any other components of the pyrrolysine insertion pathway. To investigate what role the two
LysRSs might play in B. cereus, their RNA substrate specificities were investigated. It was found that in B. cereus the two different LysRSs together aminoacylate a small RNA of unknown function named tRNAOther, and that the aminoacylated product stably binds
translation elongation factor Tu. In vivo analyses revealed that the class 2 LysRS was
present both during and after exponential growth, while the class I enzyme and tRNAOther
Other were predominantly produced during stationary phase. Aminoacylation of tRNA was
also found to be confined to stationary phase, suggesting a role for this non-canonical
tRNA in growth phase-specific protein synthesis. Analysis of the non-canonical Watson-
Crick base pairs and a bulge in the acceptor stem of tRNAOther, present in the predicted
secondary structure of tRNAOther, indicate the importance of these identity elements in
recognition by the LysRS1:LysRS2 complex.
The role of tRNAOther in B. cereus 14579 was investigated by the construction of a
deletion strain. Comparison of the deletion strain with B. cereus wild type (wt) indicates
that tRNAOther is not an essential gene but its absence de-regulates both the production of
a Bactericin-Like Inhibitory Substance (BLIS) and the macrolide efflux protein
conferring resistance against other bacterial macrolides. Also, other secondary metabolic
effects were observed such as loss of resistance against certain compounds in the deletion
strain. These results implicate tRNAOther in multiple regulatory functions that remain, as yet, uncharacterized.
iii
Dedicated to my family, especially my wife, Daniele, and my parents, Luiz and
Maria Helena
iv ACKNOWLEDGMENTS
I wish to express my sincere gratitude to my advisor, Dr. Michael Ibba, for his
superb guidance, generous support, encouragement and endless patience in correcting my
stylist errors throughout the years. It has been an honor to work with such a talented scientist and excellent mentor.
I would like to thank my committee members, Dr. Juan Alfonzo, Dr. Irina
Artsimovitch, and Dr. Mark Foster, for their insight, support and time over the years.
I would like to thank Corinne Hausmann for providing me with her support, valuable feedback, and most importantly her friendship throughout the years.
I thank Jiqiang Ling for the insightful discussions and valuable feedback throughout the years.
I thank the past and present members of the Ibba laboratory who I have worked with for providing a comfortable and intellectually stimulating environment: Mette
Prætorius-Ibba, Jeffrey Levengood and Hervé Roy for all the support and insightful discussions; Sandy Dang for her patience to work with me and Theresa Rogers for her insightful comments and critical review.
I thank my wonderful wife Daniele who has helped me throughout this entire process providing me with endless support.
v This work was supported by a Pre-doctoral Fellowship from the American Heart
Association and a grant from the National Institutes of Health.
vi VITA
December 14, 1976………………………Born – Mirandopolis, Brazil
1999………………………………………B.S. Chemistry, University of Campinas
1999 - 2001……………………………….M.S. Biochemistry, University of Sao Paulo
2002 – present…………………………….Graduate Teaching and Research Associate,
The Ohio State University
PUBLICATIONS
1. Ataide, S. F. and Ibba, M. (2006) Small Molecules – Big Players in the Evolution of Protein Synthesis. ACS Chem. Biol. 1:285-297.
2. Wang, S., Prætorius-Ibba, M., Ataide,S.F., Roy, H., and Ibba, M. (2006), Discrimination of cognate and non-cognate substrates at the active site of class I lysyl- tRNA synthetase. Biochemistry 45:3646-3552.
3. Prætorius-Ibba, M., Ataide, S.F., Hausmann, C., Levengood, J.D., Ling, J., Wang, S., Roy, H., and Ibba, M. (2006) Quality Control during aminoacyl-tRNA synthesis. Kem. Ind. 55:129-134
4. Ataide,S. F., Jester, B.C., Devine, K.M., Ibba, M. (2005) Stationary-phase expression and aminoacylation of tranfer-RNA-like small RNA. EMBO Reports 6:742- 747.
5. Ataide, S. F. and Ibba, M. (2004) Discrimination of cognate and noncognate substrates at the active site of class II lysyl-tRNA synthetase. Biochemistry 43:11836- 11841.
vii 6. Levengood, J., Ataide, S. F.*, Roy, H., Ibba, M. (2004) Divergence in noncognate amino acid recognition between class I and class II lysyl-tRNA synthetases. J.Biol.Chem. 279:17707-17714. (* joint first author)
7. Polycarpo, C., Ambrogelly, A., Ruan, B., Tumbula-Hansen, D., Ataide, S. F., Ishitani, R., Yokoyama, S., Nureki, O., Ibba, M., Söll, D. (2003) Activation of the pyrrolysine suppressor tRNA requires formation of a ternary complex with class I and class II lysyl-tRNA synthetases. Mol. Cell 12:287-294.
FIELDS OF STUDY
Major Field: Microbiology
viii TABLE OF CONTENTS
Page
Abstract……………………………………………………………………………………ii
Dedication...………………………………………………………………………………iv
Acknowledgments…………………………………………………………………………v
Vita……………………………………………………………………………………....vii
List of Tables…………………………………………………………………………….xii
List of Figures…………………………………………………………………………...xiii
List of Symbols/Abbreviations………………………………………………………….xvi
Chapters:
1. Introduction………………………………………………………………………..1
1.1. Aminoacyl-tRNA synthetases and translation………………………………..4 1.2. Amino acid discrimination in aaRS active sites……………………………...7 1.3. Amino acid discrimination in editing sites………………………………….17 1.4. Heterogeneity in alternative aa-tRNA synthesis…………………………….21 1.5. Discrimination of small molecules through aaRS duplication……………...24 1.6. Class I Lysyl-tRNA synthetase……………………………………………...26 1.7. Class II Lysyl-tRNA synthetase……………………………………………..29 1.8. tRNALys……………………………………………………………………...32
2. Divergence in noncognate amino acid recognition between class I and class II lysyl-tRNA synthetases………………………………………………….36
2.1. Introduction………………………………………………………………….36 2.2. Materials and methods………………………………………………………38 2.2.1. Lysyl-tRNA synthetase purification………………………………38 2.2.2. Aminoacylation assays…………………………………………….39 2.2.3. Ki Determination…………………………………………………..40
ix 2.2.4. ATP-PPi exchange reaction……………………………………….40 2.2.5. In vivo growth inhibition…………………………………………..41 2.2.6. In vivo analysis of LysRS2 variants……………………………….41 2.2.7. Random mutagenesis of LysRS2 variants………………………...43 2.2.8. Detection of LysRS2 variants by immunoblotting………………..44 2.3. Results……………………………………………………………………….44 2.3.1. Inhibition of LysRS1 and LysRS2 catalyzed in vitro aminoacylation…………………………………………………….44 2.3.2. Active site homology plots………………………………………..49 2.3.3. Growth inhibition by L-lysine analogues…………………………51 2.3.4. Selection and characterization of LysRS2 variants……………….52 2.3.5. Discrimination of L-lysine analogues by LysRS2 variants……….56 2.3.6. Activation of AEC………………………………………………...58 2.3.7. Cell viability with LysRS2 variants……………………………….60 2.3.8. In vivo AEC resistance by LysRS2 variants………………………64 2.3.9. Screening for enhanced AEC resistance in LysRS2 variants……..68 2.3.10. Characterization of the protein level of LysRS2 variants in E. coli PAL∆S∆UTR ……………………………………………69 2.4. Discussion…………………………………………………………………...72 2.4.1. Comparison of amino acid discrimination by LysRS1 and LysRS2…………………………………………………………….72 2.4.2. LysRS1 displays a narrower substrate spectrum than LysRS2……76 2.4.3. Functional consequences of divergent recognition of non-cognate amino acids…………………………………………..78 2.4.4. Specific recognition of L-lysine in the LysRS2 active site………..79 2.4.5. Substrate specificity determinants in LysRS2…………………….83 2.4.6. In vivo analysis of LysRS2 variants……………………………….83 2.4.7. The AEC resistance mechanism achieved by LysRS2 variants…...86 2.4.8. Divergent mechanisms of substrate discrimination in LysRS1 and LysRS2………………………………………………………..90
3. The biological role for the co-existence of LysRS1 and LysRS2………………..94
3.1. Introduction………………………………………………………………….94 3.2. Materials and methods………………………………………………………96 3.2.1. Lysyl-tRNA synthetase purification………………………………96 3.2.2. Tryptophanyl-tRNA synthetase purification………………………99 3.2.3. Preparation of unfractionated small RNAs………………………100 3.2.4. In vitro transcription of the tRNAOther, tRNALys, and tRNATrp genes……………………………………………………………..101 3.2.5. Immunoblotting analysis…………………………………………101 3.2.6. Aminoacylation inhibition in archaea……………………………102 3.2.7. Aminoacylation assays with B. cereus LysRSs………………….102 3.2.8. Aminoacylation assays with TrpRSs…………………………….103
x 3.2.9. Isolation and characterization of chargeable tRNA species by EF-Tu affinity chromatography………………………………….103 3.2.10. Acid urea gel electrophoresis of RNA and aminoacyl-tRNA…..104 3.2.11. Gel electrophoresis of RNA after oxidation with periodate……105 3.2.12. RNA extraction and RT-PCR…………………………………..105 3.2.13. In vitro and in vivo transcription of tRNAOther variants………...106 3.2.14. Aminoacylation and detection of tRNAOther variants…………...108 3.3. Results……………………………………………………………………...108 3.3.1. LysRS2 catalyzes tRNAPyl aminoacylation in a ternary complex with LysRS1 in Methanosarcina barkeri Fusaro………108 3.3.2. Occurrence of LysRS1 and LysRS2 in B. cereus 14579………...110 3.3.3. B. cereus LysRS1 and LysRS2 steady–state kinetics……………112 3.3.4. Identification of LysRS1:LysRS2 RNA substrates………………115 3.3.5. Expression and aminoacylation of tRNAOther……………………117 3.3.6. LysRS1 and LysRS2 act together to charge tRNAOther…………..119 3.3.7. Aminoacylation recognition elements of tRNAOther……………..121 3.3.8. The existence of two tryptophanyl-tRNA syntheses in B. cereus………………………………………………………….128 3.4. Discussion………………………………………………………………….132 3.4.1. The role of LysRS1 and LysRS2 in the archaeal system………...132 3.4.2. The role of LysRS1 and LysRS2 in the bacterial system………..132 3.4.3. The role of TrpRS1 and TrpRS2 in the bacterial system………...134
4. Investigation of the role of tRNAOther in Bacillus cereus 14579………………..136
4.1. Introduction………………………………………………………………...136 4.2. Materials and methods……………………………………………………..137 4.2.1. Construction of pMUTIN4-∆other………………………………137 4.2.2. Transformation of B. cereus……………………………………..138 4.2.3. Deletion of tRNAOther gene……………………………………….139 4.2.4. Characterization of B. cereus ∆other strain……………………...140 4.2.5. Acid urea gel electrophoresis of RNA and aminoacyl-RNA…….140 4.2.6. Growth inhibition of B. subtilis………………………………….141 4.2.7. BIOLOG analysis of B. cereus ∆other strain…………………….142 4.3. Results……………………………………………………………………...142 4.3.1. tRNAOther is not essential in B. cereus……………………………142 4.3.2. Differential phenotype of B. cereus ∆other……………………...148 4.4. Discussion………………………………………………………………….157
5. Conclusions……………………………………………………………………..159
References………………………………………………………………………………165
xi LIST OF TABLES
Table Page
1.1 Classes of aminoacyl-tRNA synthetases and their oligomers…………………….6
1.2. AaRS known to possess editing activity and their non-cognate substrates……...18
1.3. Non-canonical aminoacyl-tRNA synthesis in translation………………………..23
2.1. Kinetic parameters for the inhibition of steady-state aminoacylation by B. burgdorferi LysRS1 and E. coli LysRS2 (lysS encoded)……………………..48
2.2. Steady-state aminoacylation kinetics of E. coli LysRS2 (lysS encoded) with Lys and ATP……………………………………………………………………..55
2.3. Kinetic parameters for the inhibition of steady-state aminoacylation by E. coli LysRS2 (lysS encoded) in the presence of SA or AEC…………………..57
2.4. Steady-state ATP-PPI exchange kinetics of E. coli LysRS2 (lysS encoded) with Lys and AEC………………………………………………………………..59
2.5. Doubling time of E. coli PAL∆S∆UTR containing pXKS2 vector with LysRS2 in liquid media………………………………………………………….63
3.1. Analysis of the role of tRNAOther sequence elements in aminoacylation………127
3.2. Aminoacylation kinetic parameters of B. cereus TrpRSs for tryptophan………129
4.1. Growth rate of B. cereus wt and ∆other in liquid culture………………………149
4.2. BIOLOG report from gained and lost phenotypes of B. cereus ∆other in comparison with B. cereus wt…………………………………………………..155
xii LIST OF FIGURES
Figure Page
1.1. Scheme for the co-translational insertion of an aa in response to a particular codon………………………………………………………………………………3
1.2. The fate of near-cognate substrates in protein synthesis………………………….4
1.3. Cognate aa recognition by two closely related aaRSs…………………………...10
1.4. Chemical structures of cognate substrates and inhibitors of aaRSs……………...13
1.5. IleRS structure with Ile-AMP analogue and inhibitor in the active site………....15
1.6. LeuRS structure with Leu-AMP analogue and inhibitor………………………...21
1.7. Structure of LysRS1 in complex with L-lysine………………………………….27
1.8. Structure of LysRS2 in complex with L-lysine………………………………….31
1.9. Secondary structure of the tRNALys from bacteria, archaea and eukaryote……...35
2.1. Structures of L-lysine and analogues…………………………………………….47
2.2. L-lysine recognition by LysRS1 and LysRS2…………………………………...50
2.3. In vivo growth inhibition of B. subtilis strains 168 and 157.1…………………...52
2.4. Growth curves of E. coli PAL∆S∆UTR containing pXKS2 vector with LysRS2 variants………………………………………………………………….62
2.5. Growth inhibition of E. coli PAL∆S∆UTR containing LysRS2 variants………..65
2.6. Growth inhibition of E. coli PAL∆S∆UTR containing Y280F and F426W in different concentrations of AEC………………………………………………67
2.7. Growth inhibition of E. coli PAL∆S∆UTR containing Y280F and F426W mutants in 5 mM AEC…………………………………………………………...69
xiii 2.8. LysRS2 wild type and variants in E. coli PAL∆S∆UTR in different liquid media……………………………………………………………………………..71
2.9. LysRS2 variants that confer resitance to AEC in E. coli PAL∆S∆UTR in different liquid media…………………………………………………………….72
2.10. Models of AEC recognition by LysRS1 and LysRS2…………………………...76
2.11. L-lysine recognition by wild-type and variant forms of LysRS2………………..82
2.12. Model of L-lysine recognition by LysRS2 variants Y280F and F426W………...87
2.13. Model of AEC resistance conferred by LysRS2 variants………………………..89
3.1. Inhibition of aminoacylation of in vitro transcribed tRNAPyl…………………..109
3.2. LysRS1 and LysRS2 in B. cereus………………………………………………110
3.3. Predicted secondary structure of the postulated T-box leader region preceding the B. cereus strain 14579 lysK gene………………………………..111
3.4. Lysylation of total tRNA from B. cereus……………………………………….114
3.5. Secondary structure of B. cereus tRNAs……………………………………….116
3.6. Growth-phase dependent expression and aminoacylation of tRNAOther………..118
Other 3.7. Aminoacylation of tRNA requires both LysRS1and LysRS2………………120
3.8. tRNAOther variants………………………………………………………………122
3.9. Charging levels of tRNAOther variants and tRNALys……………………………124
3.10. Aminoacylation of tRNATrp and tRNAOther with TrpRSs………………………131
4.1. Scheme of integration of pBC∆other into the B. cereus chromosome…………143
4.2. Characterization of strain BCpBC∆other by PCR and restriction digestion………………………………………………………………………...144
4.3. Scheme of removal of pBC∆other from the B. cereus chromosome…………...146
4.4. Characterization of B. cereus ∆other strain by PCR and restriction digestion………………………………………………………………………...147
xiv 4.5 Characterization of the RNA content of B. cereus ∆other strain……………….148
4.6. Growth curves of B. cereus ∆other and wt……………………………………..150
4.7. Germination of spores from B. cereus ∆other and wt in different germinants………………………………………………………………………152
4.8. Growth inhibiton of B. subtilis by CFS of B. cereus ∆other and wt……………153
xv LIST OF SYMBOLS/ABBREVIATIONS
5OHW 5-hydroxy-L-tryptophan
A ampere (unit)
Å angstrom (unit) aa amino acid aaRS aminoacyl-tRNA synthetase (three letter amino acid code followed by suffix RS) aa-tRNAaa aminoacyl-tRNA
AEC S-(2-aminoethyl)-L-cysteine
AMP adenosine 5'-monophosphate
ATP adenosine 5'-triphosphate
BLIS Bacteriocin-Like Inhibitory Substance
°C degree Celsius (centigrade)
CFS Cell Free Supernatant
Ci curie
CTP cytidine 5'-triphosphate
∆ delta (deletion)
DMSO dimethyl sulfoxide
DNA deoxyribonucleic acid
xvi DNase deoxyribonuclease dNTP deoxynucleotide 5’-triphosphate
DTT dithiothreitol
EDTA ethylenediaminetetraacetic acid
EF-Tu elongation factor-TU g gram xg times gravitational constant
GMP guanosine 5'-monophosphate
GTP guanosine 5'-triphosphate h hour (unit)
HEPES (N-[2-hydroxyethyl]piperazine-N'-[2-ethanesulfonic acid])
IPTG isopropyl-β-D-thiogalactoside
LB Luria-Bertani
Lys L-lysine m mili
M molar
µ micro min minute
MM minimal medium mRNA messenger RNA
MW molecular weight nt nucleotide
Ω ohm
xvii OAc acetate
OD optical density
ORF open reading frame p pico
PAGE polyacrylamide gel electrophoresis
PBS phosphate buffer saline
PCR polymerase chain reaction
PEG polyethylene glycol
PPi inorganic pyrophosphate
RNA ribonucleic acid
RNase ribonuclease
RT reverse transcriptase
RT-PCR reverse transcriptase polymerase chain reaction s second
SDS sodium dodecyl sulfate
Tris-HCl tris-(hydroxylmethyl) aminomethane hydrochloride
Tris-OAc tris-(hydroxylmethyl) aminomethane acetate tRNA transfer RNA
Trp L-tryptophan
UV ultraviolet
V volt v volume w weight
xviii CHAPTER 1
INTRODUCTION
The amino acids (aa) required for translation of messenger RNA (mRNA) are delivered to the ribosome esterified to the 3′-ends of transfer RNAs (tRNAs) (Fig. 1.1).
The aminoacylation of tRNAs is catalyzed by aminoacyl-tRNA synthetases (aaRSs), which must discriminate their unique cognate pair of aa and tRNA from among the vast number of similar molecules that exist in the cell (1). Cell survival is totally dependent on the correct functioning of aaRSs, and several different strategies have evolved to ensure the accurate recruitment of aa during protein synthesis (2-4). In addition to accurate aa recognition, other approaches adopted by aaRSs to maintain fidelity include editing (also known as proofreading), gene duplication, and the use of alternative biosynthetic pathways (5). In-depth studies of the aaRS family have demonstrated how the chemistry of particular aa influenced the evolution of these enzymes in the different kingdoms of life. The requirement for strict aa discrimination during protein synthesis to ensure accurate translation of the genetic code plays a role in forging enzymes with
1 dedicated active sites and additional functions required to prevent degeneracy during decoding (summarized in Fig. 1.2). This work investigates how the discrimination of lysine and its analogues are achieved by lysyl-tRNA synthetase (LysRS) and the advantages conferred to the cell by the presence of the two forms of LysRS, class I
(LysRS1) and class II (LysRS2).
2
Figure 1.1. Scheme for the co-translational insertion of an aa in response to a particular codon. tRNA is first aminoacylated with cognate aa. Elongation factor EF-Tu binds aa-tRNAaa forming the aa-tRNAaa:EF-Tu:GTP ternary complex, which delivers the aa-tRNAaa to the ribosomal A site when it is occupied by the corresponding codon on the mRNA.
3
Figure 1.2. The fate of near-cognate substrates in protein synthesis. Pathways in green lead to translation, while those in red indicate mechanisms by which near-cognate substrates can be excluded. * denotes differences between bacteria and eukaryotes. Exclusion indicates substrates unable to bind the active site productively, activation indicates substrates able to enter the aminoacylation pathway.
1.1. Aminoacyl-tRNA synthetases and translation
The formation of aa-tRNA is a two step reaction: after binding to the active site, the α-carboxylate of the aa attacks the α-phosphate of ATP leading to the formation of an enzyme-bound mixed anhydride (aminoacyl-adenylate [aa-AMP]) and an inorganic pyrophosphate leaving group; in the second step, the 2′ or 3′ hydroxyl of the terminal ribose of the corresponding tRNA performs a nucleophilic attack on the aminoacyl- adenylate leading to formation of aa-tRNA and an AMP leaving group (1). The overall two-step reaction is certainly common to all synthetases, but whether a common mechanism exists for all aaRS is currently unknown (5;6). The 20 canonical aaRSs, as
4 found in Escherichia coli and eukaryotes, form two highly conserved structural groups
with 10 members each, classes I and II (7;8). The class rule defines that a particular aa is
ligated to its cognate tRNA by a member of only one of the two structurally unrelated aaRS classes. The class assignments of aaRSs with particular aa specificities have been almost completely conserved through evolution, the only known exception being the representation of lysyl-tRNA synthetase (LysRS) in both groups (see below) (9;10).
Specific structural and mechanistic elements define the members of a class (7;11).
AaRSs from class I possess a Rossman dinucleotide binding domain flanked by two signature motifs, HIGH and KMSKS, while class II contains an active site formed by an
extended anti-parallel β-sheet structure characterized by three degenerate sequence
motifs (Table 1.1).
The aaRSs are believed to have evolved from two common ancestors, one from
each class, which diverged according to the necessity to discriminate particular cognate
tRNAs and aa (11-13). The essential role of the aaRSs in translation places a strong
selective pressure on the evolution of these enzymes to prevent mistakes during cognate
aa-tRNA formation. The recognition of a tRNA requires the identification of a unique set
of elements, nucleotides or modified nucleotides at particular positions (14). These so-
called identity elements of a tRNA are often placed in the acceptor and anticodon
5 Class Oligomerizationb Class I – Motifs: HIGH, KMSKS; Rossman Fold; tRNA approach: Minor groove side Subclass Ia ArgRS α CysRS α IleRS α LeuRS α MetRS α,α2 ValRS α Subclass Ib GluRS α GlnRS α LysRS1 α Subclass Ic TrpRS α2 TyrRS α2 Class II – Motifs: 1 – GФxxФxxPФФa; 2 – FRxE-H/ RxxxFxxx(D/E); 3 - GФGФGФ(D/E)RФФФФФ tRNA approach: Major groove side Subclass IIa GlyRS α2 HisRS α2 ProRS α2 ThrRS α2 SerRS α2 Subclass IIb AsnRS α2 AspRS α2 LysRS2 α2 Subclass IIc AlaRS α, α4 GlyRS (αβ)2 PheRS (αβ)2, α PylRS ND SepRS ND
Table 1.1. Classes of aminoacyl-tRNA synthetases and their oligomers. a X denotes any amino acid, Ф denotes hydrophobic amino acid.
6 stems, the anticodon loop and the variable arm of the tRNA (see below in Figure 1.9 for more detail). Due to their size and complexity, tRNAs offer sufficiently diverse recognition elements to allow their specific selection by the corresponding aaRS.
Distinguishing between structurally related aa and other small molecules is considerably more problematic and occasional errors in substrate selection are unavoidable (15). Consequently, during evolution certain aaRSs have acquired appended domains that serve to proofread non-cognate aa (16). Other strategies to enhance the specificity of small molecule discrimination have also appeared during aaRS evolution such as gene duplication, trans-editing factors, and pre-translational modification. Both cognate recognition and non-cognate aa discrimination have had major roles in shaping aaRSs at the levels of individual residues, modules and subunit recruitment. These changes are still evident as a major source of heterogeneity in aaRS structures, presenting the potential for specific anti-microbial targeting (17).
1.2. Amino acid discrimination in aaRS active sites
The existence of heterogeneity in active site discrimination of the cognate aa among aaRSs in the different kingdoms of life mainly consists of variation in aa composition of the active site and its surroundings. An example of active site divergence is seen in a seryl-tRNA synthetase (SerRS) from the archaeon Methanosarcina barkeri, which displays zinc-dependent aa discrimination. The bacterial SerRS, present in all kingdoms of life, does not require a zinc for aa discrimination (18).
AaRSs must specifically recognize their cognate aa from among the vast number of small molecules in the cell with similar physical and chemical properties (15). The
7 presence of both D- and L- enantiomers for each aa, precursors for aa biosynthesis, and
products of aa degradation, together impose a strong selective pressure for a very specific
active site since all have the potential to disrupt translation (19). Initial selection of certain aa and analogues is dependent on significant differences in size, such as between
Gly and Trp, or charge when comparing for example Arg and Glu.
The discrimination of aa with smaller differences, for example Asp and Asn, is achieved through a network of highly specific interactions during substrate binding
(20;21). Aspartyl-tRNA synthetase (AspRS) takes advantage of the negative charge of
Asp and uses mainly electrostatic interactions with two Arg, one Lys and one His residues to specifically interact with the two carboxylate groups of Asp. The His residue is important in preventing the binding of Asn as shown by structural, biochemical and theoretical studies (20). In the closely related asparaginyl-tRNA synthetase (AsnRS), the
Lys conserved in the active site of AspRS is replaced by a Gly or Leu and the critical His is absent, allowing preferential binding of Asn rather than Asp (21) (Fig. 1.3).
Interestingly, asparagine synthase B shares the same binding residues as yeast AspRS; however, Asp binds to the active site in a reverse orientation in order to activate the β- carboxylate with AMP instead of the α-carboxylate as in AspRS (22). The AspRS/AsnRS discrimination mode illustrates how the expansion of the genetic code to accommodate both Asp and Asn was facilitated by divergent evolution from an ancestral enzyme to generate two aaRSs with high substrate specificities.
The discrimination between Glu and Gln relies on the same principle. The aa specificity was demonstrated by replacing the residues required for Gln binding for the residues required for Glu binding in human glutaminyl-tRNA synthetase (GlnRS). The
8 new enzyme was able to activate and attach Glu to tRNAGln, demonstrating how active
site specificity could be modified among related aaRSs (23).
In most cases the fidelity of aa selection is achieved by a network of H-bond and
hydrophobic interactions between the aa and the cognate aaRS. Tyrosyl-tRNA synthetase
(TyrRS) is the best characterized example of how aaRSs achieve fidelity in aa
discrimination (reviewed in (24)). TyrRS uses an extensive H-bonding network to
discriminate Tyr from Phe, and the Y34F replacement disrupts the H-bond network within the active site reducing substrate discrimination (25). However, the substitution
W126L enhances the discrimination of Tyr over Phe even with a disruption of an H-bond
network with Asp176 (26). The fidelity of aa recognition is dependent on the plasticity of
the active site of each aaRS to accommodate the side chains without steric clashes
between the substrate and the active site residues of the synthetase (27). Generally each
aaRS has evolved to achieve a useful level of specificity without necessarily maximizing
discrimination between the cognate aa and cognate analogues (26-29). This was strikingly illustrated in a recent study that detected substrate analogues for 17 aaRSs that could be aminoacylated to cognate tRNA by the wild type aaRSs (19). Most of the 92 aa analogues found to be substrates were synthetic compounds and likely never exerted a selective pressure on the aaRS to discriminate against them.
9 Arg223 A HN Lys204 Asp239 H + N __ +__ NH2 O
N__ H H H -O O H O H N Gln237 Glu241 O- H O- O H + H + O N O H N H O Glu177 H H
NNH2 H O OH OH Arg483 NH OH N Ser199 H2N Gln201 Ser481 His442
B Arg208 Ala190 HN
Glu225 H + CH3 N NH2 H HO O O
H N Glu227 2 O- + O O H N H O O Glu164 H + H H H N
O OH OH Arg368 N NH2 H Ser185 Gln187 NH2 OH
Ser366
Figure 1.3. Cognate aa recognition by two closely related aaRSs. A- Interaction of AspRS with Asp. B- Interaction of AsnRS with Asn. The cognate aa is indicated in dark blue, and conserved residues of the same chemical nature in both aaRSs are in black. Replaced or absent residues in AsnRS involved in recognition of cognate Asp in AspRS are indicated in red. Positively charged residues used for discrimination of non-cognate aa are indicated in cyan.
10 In addition to aa binding by specific interactions in the active site, aaRSs also
increase specificity in recognition by induced fit (30). AaRSs that use this mechanism
(GlnRS, TyrRS, arginyl-[ArgRS], glutamyl- [GluRS], histidyl- [HisRS], lysyl- [LysRS1] and threonyl-tRNA synthetase [ThrRS]) rely on communication between distal regions of
the protein to sense the binding of the correct substrate in order to recruit the appropriate
catalytic residues into a productive position in the active site. ArgRS, GluRS, GlnRS and
LysRS1 share much of the same induced fit mechanism in which the binding of the
cognate tRNA is required in order to form a productive active site conformation and
trigger aa activation (20;31-36). In these examples, ATP and cognate aa binding are
enhanced upon recognition of the correct tRNA by the anticodon binding region.
Furthermore, GlnRS binding of cognate tRNA is enhanced if the cognate aa (Gln) is
bound to the active site, while the near cognate aa (Glu) reduces tRNA binding 60-fold
(32). In ThrRS and TyrRS induced fit upon binding of the correct substrate leads directly
to formation of a productive active site (37;38). The indication that induced fit serves as
an extra discrimination factor in binding of both cognate aa and cognate tRNA
demonstrates how aaRSs have evolved different mechanisms for selection of the correct
substrate.
A number of known inhibitors of aaRSs act by interfering with recognition of the
cognate aa at the active site. The search for aaRS inhibitors has identified many natural
products such as indolmycin (inhibitor of tryptophanyl-tRNA synthetase [TrpRS]) (39),
borrelidin (inhibitor of ThrRS) (40) and mupirocin (inhibitor of IleRS) (41;42).
Borrelidin is available for research only and used strictly as a eukaryotic ThrRS inhibitor in clinical studies against malaria, and anti-angiogenesis (43;44). The mode of borrelidin
11 inhibition is by binding to a hydrophobic non-catalytic domain, cluster A, which impairs catalytic conformational changes in ThrRS, resulting in reduced binding of ATP and Thr
(45). The anti-angiogenesis action of borrelidin is due to inhibition of ThrRS and activation of caspases 3 and 8 to induce apoptosis (43).
Indolmycin is a potent bacterial TrpRS inhibitor that acts as a competitive inhibitor due to a differential binding to the enzyme compared to Trp (Fig. 1.4) (39;46).
Since indolmycin is a biosynthetic derivative of Trp, it has other mechanisms of action inside the cell which cumulatively effect viability (47;48). Unfortunately, the inhibitory action is not widespread among pathogens, probably due to its hydrophobicity that impairs uptake by certain organisms. Although indolmycin is commercially available for research only, it is not FDA approved. Indolmycin acts as a bacteriostatic agent against
Staphylococcus aureus, which can acquire elevated resistance against indolmycin via a point mutation that causes the H43N replacement in TrpRS (49). A bacteriocidal effect of indolmycin was observed against Helicobacter pylori which was unable to develop resistance (50). Also, in vitro and in vivo studies in Strpetomyces griseus, which produces indolmycin, revealed a second copy of TrpRS that confers resistance to indolmycin (46).
12
Figure 1.4. Chemical structures of cognate substrates and inhibitors of aaRSs.
13 Of the numerous aaRS inhibitors, only mupirocin (pseudomonic acid), which
strongly inhibits bacterial IleRS, is commercially available and FDA approved (51).
Structural and biochemical studies indicate the same overall mode of binding by
mupirocin as the Ile-AMP intermediate (Fig. 1.5), the difference being that the inhibitor
contains a non-anionic acid moiety, which fits into an unoccupied hydrophobic pocket in
IleRS. The binding of mupirocin in the hydrophobic pocket of IleRS then blocks the
subsequent binding of isoleucine and ATP, as confirmed by substitution of the non-
anionic acid moiety by a shorter alkyl group that resulted in loss of inhibition
(41;42;51;52). Due to the competitive inhibition of IleRS and the bacteriostatic effect,
several mupirocin resistant S. aureus strains were isolated with point mutations in IleRS
(17;42). Most of the resistance against mupirocin derives from the V588F replacement which was shown to interact with the non-anionic acid moiety. The mode of action of mupirocin illustrates how exploiting non-catalytic motifs and hydrophobic regions around the active sites can effectively inhibit function and may be exploitable for other aaRSs.
14 Ile-AMS Mupirocin
Figure 1.5. IleRS structure with Ile-AMP analogue and inhibitor in the active site.Visualization of the IleRS structure from Thermus thermophilus with inhibitor (Mupirocin) or non-hydrolyzable adenylated analogue (Ile-AMS, 5’-O-[N-(L- isoleucyl)sulphamoyl]adenosine) bound to the active site. Insets indicate the location of the active site on the IleRS structure (51). The surface representation is transparent blue in order to provide a realistic view of the active site. Color code for stick structures: carbon, yellow; oxygen, red; nitrogen, blue; sulfur, orange.
The most potent competitive inhibitors targeted against any of the aaRSs are variants of the aa-AMP, which is the key intermediate in the aminoacylation reaction
(53). All the aminoacyl-adenylates present a Ki in the low nM range. Several aa-AMP variants have been synthesized in a non-hydrolyzable form with a sulfamoyl- or an aryl-
replacement of the α-phosphate group of the adenine (54-56). The non-hydrolyzable analogues are potent inhibitors, but the selectivity of these compounds is not restricted to the bacterial aaRSs and they can potentially also inhibit the host enzymes. Adenylate analogues are widely used in mechanistic studies to understand the interactions of the active site with substrates and to determine X-ray structures of aaRSs (53). Several compounds that mimic the aa-AMP intermediate have been characterized in screenings of
15 natural products and in larger synthetic library screenings. Of the identified aa-AMP
analogues, Agrocin 84 is known to be a biocontrol of plant tumors caused by
Agrobacterium tumefaciens and mimics leucyl-adenylate (Fig. 1.4) (57). Agrocin 84 possesses a D-glucofuranosyloxyphosphoryl group linked to the adenine moiety, which is important for the uptake of the compound by the pathogen but must be cleaved to release the toxic moiety that can act as a competitive inhibitor of LeuRS. The toxic moiety has a stable phosphoroamidate bond instead of the labile phosphoroanhydride of the genuine aa-AMP, which makes it a better inhibitor (57). A similar strategy is used by the AspRS inhibitor microcin C, a pentapeptide processed by the cell to generate an Asp-AMP analogue with an N-acyl phosphoroamidate linkage (58).
The idiosyncrasies displayed by bacterial and eukaryotic aaRSs such as aa insertions and variations around the active site are the key features exploited to date when
using these enzymes as potential drug targets. Protein sequence alignments and modeling
based on 3D X-ray structures are not, however, sufficient to predict such sites (18).
Details of these variations will only come from a combination of biochemical and
structural studies of different aaRS candidates for drug targeting. Also, understanding the
different mechanisms of compound uptake by pathogens can lead to a better design of
compounds such as Agrocin 84 and microcin C, which have the potential to be used as
the basis for the design of highly selective targeted aaRS inhibitors. The design of these
compounds will require a better understanding of the physiology of pathogens and their
hosts allied with genomics, proteomics and the screening of compound libraries.
Unfortunately, much still remains to be characterized to provide a comprehensive starting
16 point for the rational design of drugs with the same, targeted, characteristics of Agrocin
84 and microcin C.
1.3. Amino acid discrimination in editing sites
As in the case of Asp/AsnRS and Glu/GlnRS, another subgroup of aaRSs also
clearly shares common origins, but the degree of similarity between their aa substrates
imposes additional constraints on accurate recognition. Discrimination between the
aliphatic Val, Ile and Leu (59-62) poses an obvious problem as the small differences in
their potential binding energies preclude the high level of specificity observed for Asp
and Asn. The corresponding aaRSs have evolved a proofreading mechanism, named
editing, which consists of a secondary site that is able to recognize and hydrolyze aa-
AMP and misacylated tRNAs (Table 1.2). The requirement for an editing site is
conserved among the different kingdoms of life and strictly required to maintain cell
viability (63). In a few cases, when the editing domain is absent or inactive in the aaRS, a trans-acting factor with editing activity may come into play. Editing is not, however, ubiquitous; for example, both phenylalanyl-tRNA synthetase (PheRS) and LeuRS from
mitochondria have lost their respective editing activities (64;65). Several editing
activities of aaRSs are presented below together with examples of cases in which the
editing function was lost and a trans-acting factor rescues the activity.
17 aaRS Edited non-cognate substrates
Class I IleRS Ala, α-aminobutyrate, Cys, homocysteine, homoserine, Thr, Val, LeuRS Homocysteine, γ-, δ-hydroxyisoleucine, γ-, δ-hydroxyleucine, Ile, Met, norleucine, norvaline MetRS Homocysteine ValRS Ala, α-aminobutyrate, Cys, Ser, Thr
Class II AlaRS Gly, Ser LysRS2 Homocysteine, ornithine PheRS Ile, Tyr ProRS Ala, Cys ThrRS Ser
Table 1.2. AaRS known to possess editing activity and their non-cognate substrates
IleRS activates non-cognate Val only ~200-fold less efficiently than cognate Ile
creating a potentially high level of misincorporation of non-cognate Val by the ribosome during protein synthesis (66). IleRS corrects this potentially catastrophic misactivation of
Val by using an editing mechanism that allows hydrolysis at a secondary active site, named the editing site (67-70). This leads to a substantially lower error rate of <1:3000 compatible with the overall level of fidelity observed in translation. Many aaRSs, such as
LeuRS (62;71), valyl- (ValRS) (60), methionyl- (MetRS) (72;73), prolyl- (ProRS) (74),
alanyl-tRNA synthetase (AlaRS) (75), ThrRS (76) and PheRS (77;78) all possess comparable editing activities that minimize the degeneracy of the genetic code by clearing misactivated aa and misacylated tRNAs.
18 The domains responsible for the hydrolysis of misacylated tRNA differ between class I and class II and even within the same class of aaRS (16). Usually the proofreading domain excludes binding of the cognate aa-tRNA and binds only the misacylated tRNA.
The mechanism by which the connective peptide 1 (CP1) domains of IleRS, ValRS and
LeuRS proofread the misacylated tRNA is by accepting the small non-cognate aa in the editing site, while excluding the large cognate aa. Subsequently, the amino group of the non-cognate aa interacts with a conserved aspartic acid residue present in the editing site, which is responsible for the correct positioning of the substrate for hydrolysis of the ester bond (71;79;80). CP1 is a globular domain positioned ~40 Å away from the catalytic site and can be easily accessed by the movement of the CCA end of the tRNA to reposition the misacylated 3′ end into the proofreading site (62). The editing sites of ValRS, LeuRS and IleRS are present in all kingdoms of life, although LeuRS from human mitochondria has lost editing function (64).
ThrRSs possesses another proofreading motif, which is believed to hydrolyze the misacylated tRNA using an H2O molecule that is deprotonated by a conserved histidine residue present in the proofreading domain (81). The proofreading domains in ThrRS
(76) and AlaRS (75) are distinct modules present at the N-terminal, and inserted in the C- terminal portion of the enzymes, respectively, while in PheRS the active and editing sites are in different subunits (65;77;78). ProRS can be found in two versions, one
“prokaryotic-like”, which contains the editing domain, while the “eukaryotic-like” version present in human cells does not edit. This feature is not conserved among all
“eukaryotic-like” ProRSs since the archaeal Methanococcus jannaschii enzyme has editing activity (82).
19 In other instances, additional proteins are recruited in trans to edit misacylated tRNAs, such as YbaK and D-Tyr-tRNA deacylase. YbaK specifically hydrolyzes
Cys-tRNAPro upon interaction with ProRS, but in a free form is unable to compete with
EF-Tu for the misacylated tRNA or even discriminate the correct substrate for
deacylation (83-86). Two other forms of deacylases are also known: in bacteria and
eukaryotes; D-Tyr-tRNA deacylase hydrolyzes D-Tyr-tRNATyr, D-Asp-tRNAAsp and
D-Trp-tRNATrp (87-89); in some archaea, a paralog of D-Tyr-tRNA deacylase hydrolyzes
misacylated Ser-tRNAThr, compensating for the lack of an N-terminal proofreading
domain in certain ThrRSs (90;91).
Inhibitory metabolites, or precursors of the cognate aa, which can bypass active
and editing site discrimination by aaRSs are good candidates for drug design. A series of
new synthetic compounds, which can be aminoacylated onto the cognate tRNA by aaRSs
was reported recently (19), and the different chemical functionalities present in those
compounds can be useful to investigate candidates for inhibition of both active and
editing sites. A potential class of inhibitors that has yet to be investigated are compounds
that mimic the non-cognate aminoacyl-tRNA forms, such as 2’-(L-norvalyl)amino-2’-
deoxyadenosine (Nva2AA) that inhibits LeuRS (71) (Fig. 1.6), thereby targeting the
proofreading domain of a specific aaRS (17). While evolutionary divergence of editing
sites confirms these as promising drug targets, difficulties exist in synthesizing the
equivalent of misacylated tRNA in a stable form, and analysis of the specific inhibitory
mode and its cellular consequences still need to be investigated. Nevertheless, this class
of compounds targeting aaRS proofreading domains (63;92), thereby reducing cellular
viability, are promising new candidates for drug target development (93).
20 Nva2AA Leu-AMS
Figure 1.6. LeuRS structure with Leu-AMP analogue and inhibitor. Visualization of the LeuRS structure from Thermus thermophilus with editing site inhibitor (Nva2AA) and non hydrolyzable adenylated analogue (Leu-AMS, 5’-O-[N-(L-leucyl)sulphamoyl]adenosine) bound to the editing and active site, respectively. Insets indicate the location of the editing site at the left and active site at the right side of the LeuRS structure (71). The surface representation is transparent blue in order to provide a realistic view of the editing and active sites. Color code for stick structures: carbon, yellow; oxygen, red; nitrogen, blue; sulfur, orange.
1.4. Heterogeneity in alternative aa-tRNA synthesis
Some bacteria and archaea lack one or more aaRS and a tRNA-dependent pathway is used in these organisms to synthesize the cognate aa. The heterogeneity of these pathways and their obligate activity to sustain life suggest that understanding their mechanism of action is a promising source for developing drug targets.
Many prokaryotes lack AsnRS and/or GlnRS and in those organisms the AspRS and/or GluRS are able to mischarge tRNAAsn or tRNAGln with Asp or Glu, respectively.
An amidotransferase then converts the Asp-tRNAAsn or Glu-tRNAGln into Asn-tRNAAsn or Gln-tRNAGln, respectively (Table 1.3) (94-98). While these enzymes are
21 predominantly microbial, the Glu-tRNAGln amidotransferase is found in chloroplasts and was thought to be present in mitochondria (99). However, it was recently shown that mitochondria instead use GlnRS, and the amidotransferases have become strong candidates to be exploited as bacterial drug targets (100). The synthesis of initiator
fMet-tRNAfMet is also dependent on a similar mechanism in bacteria and organelles
(101;102). Initially tRNAfMet is aminoacylated with Met by MetRS and further converted
by Met-tRNA formylase into fMet-tRNAfMet, which is then used in translation initiation
(Table 1.3) (103).
A related method used to ensure the correct charging of the cognate tRNA is the exclusive biosynthesis of a certain aa on the 3’end of the tRNA. The best known example is the synthesis of selenocysteine-tRNASec, which starts with seryl-tRNA synthetase
(SerRS) misacylating tRNASec with serine. Selenocysteine synthase (SelA) then catalyzes
the conversion of serine to selenocysteine on tRNASec (104-106). Another recently
described example of the synthesis of an aa directly on tRNA involves Cys biosynthesis
in certain archaea. In these organisms a new aaRS named ortho-phosphoseryl-tRNA
synthetase (SepRS) first catalyses the attachment of ortho-phosphoserine to tRNACys
which is further converted into Cys-tRNACys by the Sep-tRNACys-tRNA synthase
(SepCysS) enzyme (107).
22 Final product for Aminoacyl-tRNA aaRS Substrate for translation gatCAB Asp-tRNAAsn AspRS Asn-tRNAAsn (amidotransferase) SepCysS Sep-tRNACys SepRS Cys-tRNACys
Met-tRNA formylase Met-tRNAfMet MetRS fMet-tRNAfMet
gatCAB/gatDE Glu-tRNAGln GluRS Gln-tRNAGln (amidotransferase) PylRS Pyl-tRNAPyl Translation Pyl-tRNAPyl
SelA Ser-tRNASec SerRS Sec-tRNASec
Table 1.3. Non-canonical aminoacyl-tRNA synthesis in translation
The overall Sec pathway is universally conserved including the synthesis of Sec-
tRNASec, the decoding of a UGA codon as a Sec, the presence of a Selenocysteine
Insertion Sequence (SECIS) element, and the presence of a dedicated EF-Tu homolog
(SelB) for delivery of Sec-tRNASec (106). However, among the kingdoms of life, the
differences in the Sec pathway can potentially be exploited as drug targets; for example,
no homolog of bacterial SelA has yet been found in eukaryotes, and the pathway is believed to be substantially different (108). Also, the SECIS elements of bacterial mRNA are often placed downstream of the AUG site in a coding region, while in eukaryotes and archaea, they are always located in the 3’ untranslated region (109). The differences in
SelB lie in the fact that the bacterial version recognizes and interacts with SECIS through its C-terminal region, while the eukaryal and archaeal forms lack the C-terminal domain
23 and instead interact with SECIS binding protein 2 (SBP2) (110;111). These differences in
the Sec synthesis and insertion pathways have the potential to be exploited as
antimicrobial drug targets.
The heterogeneity of tRNA-dependent aa synthesis provides many promising
targets; however, structural and functional studies must still be performed to understand
the potential for inhibition and the cellular consequences of inhibiting these pathways.
Compounds targeting the different enzymes involved in amidotransferase, formylase and
selenocysteine synthesis are promising candidates for drug development. In addition to
these post-aminoacylation pathways, orthologous and non-orthologous duplications of
aaRSs provides another new opening both for drug design and studies of potential
antibiotic resistance.
1.5. Discrimination of small molecules through aaRS duplication
In addition to the various mechanisms described above some organisms posses a
second ortholog of the same aaRS, which often confers resistance to certain conditions or
inhibitors by discriminating against small molecules. The existence of such duplicates
occurs in organisms exposed to certain inhibitory compounds that, in order to survive,
evolved a resistant version of the same aaRS.
TyrRS, ThrRS, IleRS, MetRS and TrpRS have all been found in certain genomes as apparent duplicates, and the expression of the second copy is often dependent upon the
presence of inhibitors for the housekeeping version or changes in cellular physiology
(46;112-116). TrpRS can be found in duplicate in Streptomycetes that produce
indolmycin. Only the constitutively expressed TrpRS copy is sensitive to indolmycin,
24 while the second is expressed to rescue the cell when the inhibitor is synthesized (46).
TrpRS is also found in Deinococcus radiodurans as two less similar variants, TrpRS1
and TrpRS2. In this case, the housekeeping TrpRS1 is resistant to inhibition and
misacylation of tRNATrp with Trp analogues while TrpRS2 is able to charge tRNATrp with 4-nitro-tryptophan and 5-hydroxy-tryptophan (117;118). The most intriguing case of functional duplication involves LysRS, which can be present either as two versions of class-II type LysRS (LysRS2) with a housekeeping version lysS and a heat-shock inducible version lysU, or as the structurally unrelated class-I type LysRS (LysRS1) and
LysRS2.
The extensive duplication seen among aaRSs also has important practical implications. Clinical treatment with mupirocin has resulted in the emergence of two resistance mechanisms: high level resistance which derives from acquisition of a plasmid borne IleRS ortholog, or low level resistance resulting from point mutations at two sites in the gene encoding IleRS (42;119-121). Studies have demonstrated that the low level of resistance can be reverted by compensatory mutations acquired when the organism is not under antimicrobial pressure (42;119).
Screening of new potent synthetic drugs targeting bacterial MetRS has identified resistant organisms harboring two copies of MetRS. The second copy, which is resistant to the synthetic compounds, possesses an insertion of 27 aa around the active site and is present in several organisms (113). Bioinformatics studies have identified the origin of the second copy of MetRS as deriving from soil-dwelling bacteria that have never been exposed to these synthetic inhibitors (112). These examples summarize how aaRSs can readily adapt and evolve to gain specific functions and avoid degeneracy during
25 decoding. The robust scaffold on which aaRSs are built allows adaptations to different
conditions to which an organism might be exposed, such as the presence of potent inhibitors. While a drawback in some instances, gene duplication can be exploited to understand the extent of plasticity of aaRSs and characterize the weaknesses of both copies, thereby using this feature of aaRSs to develop new drugs potentially less susceptible to resistance.
1.6. Class I Lysyl-tRNA synthetase
Among aaRSs, LysRS is unique because it violates the class exclusion rule and exists in both structural forms, class I (LysRS1) and class II (LysRS2). Experimental approaches first identified a gene encoding LysRS1 (lysK) in the archeon
Methanococcus maripaludis, explaining the absence of LysRS2 in some sequenced
genomes (9). LysRS1 is found in most archaea and in some α-proteobacteria and
spirochetes, while LysRS2 is found in all eukaryotes, most of the bacteria and some
archaea. One class of LysRS is normally found at the exlusion of the other; the co-
existance of LysRS1 and LysRS2 is restricted to the Methanosarcinae sp. in archaea and
Bacillus cereus sp. in bacteria (122;123).
Functional and structural characterizations indicate that LysRS1 and LysRS2 are
functionally equivalent but structurally unrelated (10;36). The crystal structure of
LysRS1 from Pyrococcus horikoshii has been solved alone and in a complex with Lys
(10) (Fig. 1.7). The sequence and structural similarities with GluRS from
Thermus thermophilus indicate that LysRS1 belongs to subclass 1b (13;122). The shared
structural similarity between LysRS1 and GluRS includes the binding position of the
26 cognate aa in both enzymes where Lys and Glu bind in the pocket formed on the
Rossman fold domain. Also, the stem-contact domains (SC-domains), α-helical domains responsible for anticodon binding in the C-terminal regions, are shared structural similarities unique to LysRS1 and GluRS (10;13) (Fig. 1.7)
Catalytic domain
SC-Domain
Figure 1.7. Structure of LysRS1 in complex with L-lysine. The structure of P. horikoshii LysRS1in complex with Lys is represented in a cartoon form. The catalytic domain comprised of an α-helix cage and the Rossman domain and signature motifs HIGH and KMSKS contain the Lys bound represented in ball form. The anticodon binding domain (SC-domain) is indicated in the figure. Lys is represented in a ball form with atoms colored as: carbon in cyan, oxygen in red and nitrogen in blue. Red represents α-helices, yellow represents β-strands and green represents loop-regions. Figure was visualized in Pymol (124).
27 The tRNA approach an aaRS from opposite sides depending on the aaRS class,
with class I approaching from the minor grove side of the tRNA acceptor stem and class
II approaching from the major groove of the tRNA acceptor stem (125). While opposite
sides of tRNALys approach LysRS1 and LysRS2, the recognition elements are the same
for both proteins, namely the discriminator base, anticodon loop and acceptor stem
(10;36). Although the recognition elements are the same for both LysRSs, the importance
of a particular nucleotide varies for each LysRS (126). LysRS1 requires tRNALys binding prior to aminoacyl-adenylate synthesis; which is a feature shared by GluRS, GlnRS,
ArgRS, and all class I aaRSs (36). The docking model of LysRS1 and tRNALys from
P. horikoshii was built using the structure of GluRS and tRNAGlu from T. thermophilus.
The docking model and biochemical evidence indicated that U35 and U36 are recognized
by the C-terminal domain of LysRS1 with U35 being the most important element, with
no base-specific recognition of U34 (10). The discriminator base (N73) is implicated to
interact with the conserved Arg72 of P. horickoshii LysRS1, while Lys238 and Asp239
are in close proximity to the 5’strand of the tRNA acceptor stem, and Lys274 is in close
proximity to nucleotide 25 (10).
LysRS1 is more selective and less prone to inhibition when compared to LysRS2
(127). The different versions of LysRS take advantage of different networks of
interactions in their active sites to discriminate the correct substrate; LysRS1 employs a
minimal H-bond interaction in a specific part of the active site. The class I version of
LysRS is always less active when compared to the class II version, which seems to be more robust with respect to cognate aminoacylation (28;29;127). Interestingly, LysRS1 is not significantly inhibited by S-(2-aminoethyl)-L-cysteine (AEC) either in vitro or
28 in vivo, indicating different mechanisms of recognition and discrimination of Lys and
analogues compared to LysRS2 (Fig. 1.4) (127;128).
1.7. Class II Lysyl-tRNA synthetase
The first identified form of LysRS belongs to aaRS class II (LysRS2), which
belongs to subclass IIb with AspRS and AsnRS due to numerous structural features and
sequence similarities shared by these aaRSs(20;21). Phylogenetic distribution indicates
that LysRS2 is present in all eukaryotes, most bacteria and a few archaea (125). One of
the features of class IIb aaRSs is the presence of an N-terminal oligonucleotide binding
domain (OB-fold domain) as the anticodon binding site (21). The active form of class II
LysRS exists as a dimer and displays a catalytic domain common to aaRS class II,
containing three degenerate sequence motifs (129). In some bacteria, LysRS2 is present
in two isoforms with different gene expression profiles. Under normal growth conditions
lysS is constitutively expressed, while lysU is overexpressed under specific conditions
such as heat shock, anaerobisis, low external pH or in the presence of Leu (130-133). lysS
and lysU share 88 % sequence identity in E. coli and have similar enzymatic properties;
Lys however, LysS is twice as active as LysU in ATP-PPi exhange reactions and tRNA
aminoacylation (129). The inducible lysU has an 8-fold lower Lys dissociation constant
than lysS and is resistant to inhibition by Lys analogues such as cadaverine, indicating that this duplication of activity is important to avoid misincorporation of Lys analogues under stress conditions (129;134;135).
Discrimination against near cognate analogues, which are natural metabolites
such as AEC, homocysteine and ornithine, can be a serious problem for LysRS2, which
29 does not possess post-transfer editing activity (127;134). LysRS2 can activate homocysteine and ornithine with ATP, but before they can be transferred to tRNALys,
they are further cyclized into homocysteinethiolactone and ornithine lactone,
respectively, and released (134).
AEC is potentially more problematic since, once activated by LysRS2, it can be
transferred to tRNALys and used in protein synthesis by the ribosome, inhibiting cell
growth (127). The fact that AEC is a naturally occurring metabolite (discussed in (128)),
which might have exerted a selective pressure in the evolution of two distinct LysRSs
with different discrimination of Lys analogues, makes LysRS1 a good candidate to be
exploited as an antimicrobial drug target. The requirements of an organism to retain
either LysRS1 or LysRS2 are likely based on the necessity for a more selective enzyme
versus a more active one, possibly depending on growth physiology and the presence of
inhibitors in the environment (28;29).
Several crystal structures of LysRS2 have been solved, providing different
insights about the various interactions and mechanism of action of this enzyme.
Structures of the apo form and complexes with Lys (Fig. 1.8), ATP, a non-hydrolyzable
ATP analogue and a lysine-adenylate analogue provide information on how
conformational changes in the entire LysRS2 protein are triggered upon recognition of
Lys and ATP (135;136).
30 Catalytic domain
OB-Fold
Figure 1.8. Structure of LysRS2 in complex with L-lysine. The structure of E. coli LysRS2 compexed with Lys is represented in a cartoon form. The catalytic domain comprised of anti-parallel β-strands and signature motifs 1, 2 and 3 contains the Lys bound. The anticodon binding domain (OB-fold) is indicated in the figure. Lys is represented in a ball form with atoms colored as: carbon in cyan, oxygen in red and nitrogen in blue. Red represents α-helices, yellow represents β-strands and green represents loop-regions. Figure was visualized in Pymol (124).
The eukaryotic LysRS2 has an extension of ~70 aa in the N-terminal domain that
shares sequence similarity with the other members of subclass IIb, and is known to
participate in tRNA binding (137-139). The appended domain decreases the dissociation
constant and KM for the cognate tRNA thereby facilitating aminoacylation under
suboptimal conditions. LysRS2 in mammalian cells is found associated with a high-
molecular weight complex containing nine aaRSs and three auxiliary proteins (140;141).
31 In human cells cytoplasmic and mitochondrial LysRS2 are encoded by a single gene
whose transcript undergoes alternative splicing. Human LysRS is also involved in
Lys tRNA 3 packaging in HIV viral particles with the Gag protein (142).
1.8. tRNALys
The identity elements of a tRNA are the nucleotides or specific structure present
in the anticodon loop, acceptor stem and discriminator base (N73) that are recognized by
the aaRS allowing a specific discrimination of the cognate tRNA among all the other
tRNAs present in the cell (Fig. 1.9). In vitro studies have identified the G2:U71 wobble
pair found in B.burgdorferi tRNALys to be an identity element for LysRS1 while acting as an anti-determinant for E. coli LysRS2 (9;126). Modifications of the bases U34 and A37
are not important for class I LysRS discrimination, in contrast with GluRS, which requires the presence of the modified U34 for recognition (143-145). U36 is the only
nucleotide of the anticodon loop to be recognized by all known LysRS1 proteins, while
U35 recognition is confined to Borrelia and Pyrococcus species (122). The docking model of the anticodon binding domain of LysRS1 with tRNALys, based on the structure
of GluRS with tRNAGlu, has identified residues that may be involved in anticodon recognition (10). The transplantation of the anticodon sequence (U34U35U36) and the second (G2-U71) and third (G3-C70) base pairs of the acceptor stem into E. coli tRNAPhe
and tRNAAsp promote the lysylation of the chimeric tRNAs by B. burgdorferii LysRS1
but not E. coli LysRS2 since the second base pair act as a negative determinant for recognition by E. coli LysRS2 (146). Further biochemical characterization of LysRS1
32 residues involved in anticodon interaction remains under investigation (Jeffrey
Levengood and Michael Ibba, unpublished).
In E. coli, the major identity elements are the anticodon, with U35 playing the most crucial role, and the discriminator base A73 (Fig. 1.9) (147-149).The identity elements of the human cytoplasmic tRNALys are mainly the anticodon sequence, since the
discriminator base N73 and modifications in the tRNA are relatively insensitive for
human LysRS2 recognition (150). In human mitochondrial tRNALys the presence of a
single modification at m1A9 stabilizes the cloverleaf structure of the tRNA indicating the
necessity of tRNA modifications for folding (151). tRNALys isoacceptors in organisms
that harbor LysRS1 and/or LysRS2 are hypermodified in specific positions such as mnm5s2U34 and t6A37. These modifications play a crucial role in tRNA activity by
promoting the correct conformation of the anticodon loop and consequently recognition
by LysRS but more critically allowing the correct decoding in the ribosome. The
modifications at U34, such as mnm5s2U34, promote the formation of the U-turn loop of the anticodon. The modifications at A37, such as t6A37, prevent the stacking interaction with U36 forcing it to bulge and form a cross-stand stacking interaction with the first base of the codon in the ribosome (145;152).The OB-fold domain is responsible for binding the anticodon of tRNALys and for the specific interactions with U35 by the
residues Arg77, Phe84 and Gln95 in E. coli, which are conserved among other LysRS2
and subclass IIb. The accommodation and binding of U34 and U36 involves
conformational changes of the seven residues present in the loop between strands 4 and 5
of the anticodon binding domain (148).
33 Several retroviruses use tRNAs as primers for initiating reverse transcription, and
Lys Lys HIV-1 selectively packages tRNA 1,2 and tRNA 3 during assembly but only uses
Lys Lys tRNA 3 as a primer. tRNA 3 is packaged with LysRS2 from the cell as a complex in a
1:1 stoicheometry by interacting with the Gag/Gag-Pol/viral RNA complex. LysRS2 is
incorporated into the virion upon interaction with Gag in a tRNALys independent manner;
however tRNALys incorporation strictly dependents upon its interaction with LysRS but
not aminoacylation (reviewed in (142)).
34 Acceptor stem
TCΨ loop
D loop Variable loop
E.coli tRNA Lys B.burgdorferi tRNA Lys Lys H.sapiens tRNA 3
35 Anticodon loop Figure 1.9. Secondary structure of the tRNALys from bacteria, archaea and eukaryote. The structural elements of the tRNA are indicated in the E. coli tRNALys, with the acceptor stem which includes the discriminator base N73, the D loop and stem, the anticodon loop, the variable loop and the TψC loop. Identity elements are marked in red, secondary identity elements or anti- determinats elements are indicated in blue. The modifications identified in tRNALys : D, dihydrouridine; ψ, pseudouridine; m7G, 7- methylguanosine; acp3U, 3-(3-amino-3-caboxypropyl)uridine; T, 5-methyluridine; mnm5s2U, 5-methylaminomethyl-2-thiouridine; t6S, N-6-threonylcarbamoyladenosine; m2G, 2-methylguanosine, m5G, 5-methylguanosine; mcm5S2U, 5-methoxycarbonyl-methyl-2-thiouridine; ms2t6A, 2-methylthio-N-6-threonylcarbamoyladenosine, mT, 5,2’-O-dimethyluridine.
35 CHAPTER 2
DIVERGENCE IN NONCOGNATE AMINO ACID RECOGNITION BETWEEN
CLASS I AND CLASS II LYSYL-tRNA SYNTHETASES
2.1. Introduction
The genetic code is based on the correct translation of each codon to its cognate
amino acid. One key step in assuring accuracy during the translation of genetic
information is the correct attachment of an amino acid to its cognate tRNA by aaRSs. The
process of forming a correctly paired aa-tRNA requires that each aaRS selectively bind
its respective amino acid, ATP and the cognate tRNA (125;153). While aminoacylation is
generally highly accurate, some aaRSs must also proofread and edit misacylated tRNAs
to maintain the accuracy of aa-tRNA synthesis (154).
The aaRS family is divided into two structurally unrelated classes, I and II, with
10 members in each (155). The divergent structures lead to functional differences with respect to ATP and tRNA binding in each class (1;13). An aaRS from either class I or class II is designated to each amino acid with only one exception known to date,
36 lysyl-tRNA synthetase (LysRS) (9), for which examples from both class I (LysRS1) and class II (LysRS2) are known. Although structurally different, LysRS1 and LysRS2 are
able to recognize Lys and tRNALys in vivo and in vitro in much the same way
(10;36;126). For example, the tRNALys elements recognized by both LysRS1 and
LysRS2 are the same, namely the anticodon, acceptor stem and discriminator bases (36).
Recognition of the same elements illustrates how the unrelated forms of LysRS perform
the same cellular function using different molecular mechanisms for tRNALys recognition
(128).
Variation between LysRS1 and LysRS2 has also been observed for Lys activation. LysRS2 initiates lysyl-tRNALys synthesis using only Lys and ATP to generate
an enzyme-bound aminoacyl-adenylate, as do all class II and the majority of class I
aaRSs. LysRS1 requires tRNALys binding prior to aminoacyl-adenylate synthesis, a feature shared by only a small sub-group of class I aaRSs (31;34-36). Crystal structures of LysRS1 and LysRS2 complexed with Lys reveal that while their active site architectures are fundamentally different, the strategies for recognition of the R-group of
Lys (but not the remainder of the molecule) are quite similar (10). A detailed comparison of the amino acid recognition strategies of LysRS1 (Borrelia burgdorferi) and LysRS2
(Escherichia coli) was investigated in this chapter by studying the effects of Lys analogues on the aminoacylation reaction in vitro and in vivo. Also, based on comparisons of crystal structures and discrimination of Lys analogues by both LysRSs, the roles of the key residues in the active site of LysRS2 (lysS encoded) from E. coli were
investigated in vitro and in vivo.
37 2.2. Materials and methods
2.2.1. Lysyl-tRNA synthetase purification
Plasmid pKS-lysS (156) was used as the template for amplification of the E. coli
lysS gene, with primers designed to generate a product flanked by NdeI and SapI sites.
PCR was carried out using Platinum Pfx DNA polymerase (Stratagene) and the product
was cloned into TOPO-TA blunt end (Invitrogen). The gene was sequenced with two
times coverage. Subsequently, the gene was excised and inserted into the pTYB1 vector to allow production of a LysRS2-intein fusion protein (IMPACT System, New England
Biolabs).
E. coli lysS encoded LysRS2 cloned into the pTYB1 vector was used as a template for development of LysRS2 variants. Sets of two complementary primers, of 27
nucleotides each, were designed to encode each desired point mutation. The resulting
LysRS2 variants are: G216A, E240D, E240Q, E278D, E278Q, Y280F, Y280S, N424E,
N424Q, F426H, F426W, E428D and E428Q. PCR reactions using Pfu turbo DNA
polymerase (Stratagene) were performed according to the manufacturer’s procedure. PCR
products were digested with DpnI (New England BioLabs) and transformed into DH5α
cells. Point mutations were confirmed by sequencing each gene completely.
The E. coli lysS encoded LysRS2 and variants cloned into the pTYB1 vector were
expressed in E. coli BL21 (DE3) cells. Transformants were grown at room temperature in
LB supplemented with ampicillin (100 µg/ml) to cell density OD600=0.6. Expression of
lysS was induced by IPTG (1 mM) for 16 h at room temperature. Subsequent steps were
performed at 4 oC. Cells were harvested by centrifugation and washed in column buffer
(20 mM Tris-HCl [pH 7.4], 500 mM NaCl, 1 mM MgCl2, 10 % Glycerol). Cells were
38 resuspended in column buffer supplemented with protease inhibitor (Hoffman-La Roche),
passed through a french pressure cell, and then centrifuged at 20,000 xg for 30 min. The
resulting supernatant was loaded onto a chitin affinity beads column (New England
Biolabs) according to the manufacturer’s instructions. Protein was eluted from the chitin
affinity column in a buffer of 50 mM Tris-HCl (pH 8.0), 1 mM MgCl2, 50 mM NaCl,
10 % Glycerol and 10 mM 2-mercaptoethanol. The fractions containing LysRS2 (judged to be >99 % pure by Coomassie blue staining after SDS/PAGE) were pooled, concentrated by ultrafiltration using an Amicon Ultra-15 column (Millipore), dialyzed against storage buffer (50 mM Tris-HCl [pH 8.0], 1 mM MgCl2, 10 % Glycerol, 10 mM
2-mercaptoethanol), and stored at –80 oC. The concentration of LysRS2 was determined
by active site-titration as previously described (157), except that [14C]-Tyr was replaced
with [14C]-Lys and reactions were performed for 10 min. Calculations were based upon
half-of-the-sites reactivity for E. coli LysRS (158)
2.2.2. Aminoacylation assays
Aminoacylation was performed at 37 °C in 100 mM HEPES (pH 7.2), 25 mM
Lys 3 KCl, 10 mM MgCl2, 4 mM DTT, 5 mM ATP, 5 µM tRNA , 2 mM [ H]-Lys and
10-250 nM LysRS2. For Lys KM determinations, all concentrations were fixed but
[14C]-Lys (310 mCi/mmol) or [3H]-Lys (85.2 Ci/mmol), which were added at concentrations varying between 0.2 and 5 times KM. The same procedure was followed for ATP KM determinations, in which ATP was added at concentrations varying between
0.2 and 5 times the KM. Aliquots of 10 µl were taken every 15-60 s and spotted onto
3MM filter disks presoaked in 5 % TCA (w/v) containing 0.5 % (w/v) [12C]-Lys. Sample
39 disks were washed 3 times for 10 min at room temperature in 5 % TCA (w/v) containing
0.5 % (w/v) [12C]-Lys, dried at 80 °C for 30 min, and the level of [14C]- Lys-tRNALys was quantified by addition of liquid scintillant (Ultima Gold, Packard Corporation) and scintillation counting.
2.2.3. Ki Determination
In order to determine Kis for Lys analogues, at least five different concentrations
of analogues were first screened in the aminoacylation reaction under standard conditions
with 4.5 µM of [14C]-Lys for LysRS2. Analogue concentrations were then established at
which the initial rate of aminoacylation was decreased by 20-50 % when compared with
the reaction lacking analogue, and these levels were then used for Ki determinations.
Concentrations of analogues used to determine the Ki for LysRS2 were: 100 µM L-lysine hydroxamate; 25 µM S-(2-aminoethyl)-L-cysteine (AEC); 50 µM L-lysinamide; 250 µM
L-lysine methyl ester; 250 µM L-lysine ethyl ester; 1 mM DL-5-hydroxylysine; 5 mM L-
ornithine; 40 mM D-lysine; 500 µM L-cadaverine; 25 nM lysyl-sulfamoyl adenosine; 40
mM L-α-amino butyric acid; 200 mM L-γ-amino butyric acid; 30 mM L-arginine; 50
mM L-glutamic acid. In all cases, stock solutions of inhibitors were maintained at neutral
pH. The Kis presented represent the average of at least three independent experiments for
LysRS2 where values deviated by no more than 10 % between individual determinations.
2.2.4. ATP-PPi exchange reaction
The ATP-PPi exchange reaction was performed in 100 mM HEPES (pH 7.2),
32 15 mM MgCl2, 5 mM ATP, 5 mM [ P]-PPi (2.33 Ci/mmol), 10-300 nM LysRS2 and 40 AEC or Lys concentrations varying from 0.2-5 times the KM for each LysRS2 variant.
The reaction mixture was pre-incubated for 2 min at 37 oC before enzyme was added.
Aliquots of 25 µl of reaction were added to 970 µl of quenching solution (5.6 % v/v
perchloric acid, 1 % Norit A and 75 mM PPi) at different time points. ATP adsorbed on
charcoal was filtered over Whatman GF/C filter disks, washed, dried and the level of
[32P]-ATP quantified by addition of liquid scintillant (Ultima Gold, Packard Corporation)
and scintillation counting.
2.2.5. In vivo growth inhibition
Bacillus subtilis strains 168 (encoding endogenous LysRS2) and 157.1 (encoding
B. burgdorferi LysRS1 in replacement of the B. subtilis LysRS2) (128) were grown
aerobically in LB media until OD600=1,0 and 1 ml of this culture was spun down, washed and resuspended in 1 ml Spizizen’s minimal media (159). Aliquots of 250 µl of these
cells were then inoculated in 25 ml of Spizizen’s minimal media supplemented with 2
mM Lys, 5 µM of AEC or 400 mM L-γ-amino butyric acid at 37 oC and growth
monitored at OD600 with 1 h intervals.
2.2.6. In vivo analysis of LysRS2 variants
The PXLysSK1 vector (132), here named PXKS2, containing the E. coli lysS
gene under both its endogenous promoter and the T7 inducible promoter, was used as a
template for development of LysRS2 variants. Sets of two complementary primers, of 27
nucleotides each, were designed to encode each desired point mutation as described in
section 2.2.1. Point mutations were confirmed by sequencing each gene completely. The
41 empty vector, with no lysS gene, was prepared by digestion of PXKS2 plasmid with
EcoRI and ligation of the resulting empty vector fragment with T4 DNA ligase.
The E. coli strain PAL∆S∆UTR (F-∆(lac-pro) gyrA rpoB metB argE(Am) ara
supF ∆lysS::kan ∆lysU srl-300::Tn10 recA56 (pMAK705 lysU)) (160) was transformed with 100 ng of plasmid containing either a LysRS2 variant, wild type LysRS2 as positive control, or empty plasmid as a negative control. Cells were retrieved on LB-plates supplemented with 100 µg/ml of ampicillin at 43 oC, a prohibitive temperature for pMAK705 lysU replication. Single colonies were counted and then replica-plated and grown on LB supplemented with 100 µg/ml ampicillin at 43 oC for two subsequent
rounds. After the second replica-plating, plates were replicated both on LB supplemented
with100 µg/ml ampicilin and LB supplemented with 100 µg/ml ampicillin and 30 µg/ml
chloramphenicol and grown at 30 oC for 24 h. Colonies able to grow on both plates were
excluded from further analysis. Plates were then replicated on minimal medium (MM)
plates supplemented with 5 µM AEC and 100 µg/ml ampicilin and grown at 37 oC.
Colonies were selected from LB plates grown at 30 oC and inoculated into liquid LB
supplemented with 100 µg/ml of ampicilin and grown to saturation at 37 oC, washed, and
diluted into LB or MM supplemented with 2 mM Lys or 5 µM AEC and incubated in a
microplate reader for growth rate determination at 37 oC. Each growth curve was
determined in triplicate and averaged. Colonies able to grow on MM supplemented with
5 µM AEC were subjected to growth in increasing concentrations of AEC up to 500 µM.
LysRS2 variants able to grow on concentrations higher than 5 µM AEC were isolated,
sequenced and retransformed into the PAL∆S∆UTR strain and screened again.
42 2.2.7. Random mutagenesis of LysRS2 variants
Plasmids PXK-YF, coding for the LysRS2 Y280F variant, and PXK-FW, coding
for LyRS2 F426W, were isolated and transformed into DH5α for large scale plasmid
DNA isolation. Aliquot containing 10 µg of plasmid was incubated with 500 µl of 1 M hydroxylamine solution, prepared just before reaction, for 20 h at 37 oC. After incubation
DNA, was recovered by extraction with DNA-prep kit (Qiagen). A total of 1 µg of
recovered plasmid DNA was transformed into strain CJ236, an ung- strain unable to
correct chemical modification on U caused by hydroxylamine (161;162), and approximately 50,000 transformants were selected. Cells were grown to saturation, re- inoculated in 500 ml of LB and grown for 16 h and plasmid DNA was isolated. The resulting plasmid preparations of FWmut and YFmut were retransformed into the
PAL∆S∆UTR strain and approximately 50,000 transformants were obtained. Cells were replica-plated in LB and after the second replica-plating at 43 oC, colonies were
replicated on MM supplemented with 1 mM AEC and grownat 37 oC. Colonies able to
grow at this AEC concentration were isolated and grown to saturation on liquid LB,
washed and diluted on MM supplemented with increasing concentrations of AEC, up to
10 mM, and incubated in a microplate reader. All colonies were incubated in triplicate.
New mutants able to grow at concentrations higher than 2 mM AEC were isolated and
the lysS gene sequenced entirely to identify additional mutations. The isolated plasmids
were retransformed into E. coli PAL∆S∆UTR and screened a second time to confirm
their phenotypes.
43 2.2.8. Detection of LysRS2 variants by immunoblotting
E. coli PAL∆S∆UTR containing LysRS2 wild type or Y280F, F426W, Y280F4 or
F426W6 variants were grown in 250 ml of LB, MM supplemented with 2 mM Lys or
o MM supplemented with 500 µM AEC at 37 C, and 100 ml samples taken at OD600 = 1.0
(late log phase). Cells were centrifuged at 6,000 xg at 4 oC for 15 min and suspended in 5
ml of sample buffer (100 mM Tris-HCl [pH 7.5], 20 mM MgCl2, 1 mM EDTA and
protease inhibitor cocktail [Hoffmann-La Roche Inc.]). Cells were then passed twice
through a French Press cell and centrifuged at 30,000 xg for 30 min at 4 oC. Cell extracts
were concentrated in dialysis bags covered with PEG 20,000 MW overnight at 4 oC.
Protein concentration was determined by the Bradford method. Cell extract with varying
amounts of protein were separated on 10 % SDS/PAGE gels and then blotted onto
nitrocellulose membranes. LysRS2 was detected using primary rabbit antibodies (raised
against LysRS2 from E. coli) and horseradish peroxidase conjugated secondary
antibodies visualized by chemiluminescence.
2.3. Results
2.3.1. Inhibition of LysRS1 and LysRS2 catalyzed in vitro aminoacylation
The aaRS catalyzed aminoacylation of tRNA is a two-step reaction. In the first
step, an amino acid is activated to form an enzyme-bound aminoacyl adenylate. The
second step of the reaction involves binding of this complex by tRNA, whose 3’-end is
then esterified with the aminoacyl moiety followed by release of the resulting aminoacyl-
tRNA. While LysRS1 and LysRS2 both utilize this overall reaction mechanism, they
show a key difference at the first step; lysyl-adenylate synthesis by LysRS1 requires the
44 presence of tRNA whereas LysRS2 can perform the reaction in the absence of tRNA.
Given this difference between LysRS1 and LysRS2, we chose to compare their ability to
recognize Lys and lysyl-adenylate analogues by determining the kinetics of inhibition of
steady-state aminoacylation. This approach, rather than measurement of the inhibition of
amino acid activation, would then allow more direct comparisons to be made between the
two systems.
All compounds tested (Fig. 2.1) were found to act as competitive inhibitors of
both LysRS1 and LysRS2, as judged by the observation of significant changes in KM but
not kcat when comparing steady-state aminoacylation kinetic parameters with and without
the addition of analogues (Table 2.1). The most potent inhibitor of both LysRS1 and
LysRS2 was the lysyl-adenylate analogue lysylsulfamoyl-adenosine, which inhibited
both enzymes equally well (Table 2.1). Analogues of Lys, rather than the adenylate
derivative, were less potent inhibitors with Kis ranging from low µM (3.9 µM for AEC with LysRS2) to low mM (12 mM for D-lysine with LysRS2). The least effective inhibitors were the non-cognate amino acids, whose Kis varied from 5 mM (L-arginine
with LysRS1) to 470 mM (L-γ-amino butyric acid with LysRS2).
For LysRS2, the KM for Lys (129) and Kis for competitors determined in this
study generally correlated well with previously determined values where comparable data
exists. For AEC (163), lysinamide (164), lysine methyl ester (164), lysine ethyl ester
(164), ornithine (165) and cadaverine (129), previously determined Kis for aminoacylation by LysRS2 are all within one to five fold of values reported here. The only exception is D-lysine, where the previously reported value of 220 µM (164) is over
50-fold lower than the Ki determined here due to contamination with L-lysine in older 45 commercial preparations of D-lysine. For other compounds tested, either kinetic parameters were only previously determined in the amino acid activation reaction
(5-hydroxylysine, lysine hydroxamate (166)]) or no other data is, to the best of our knowledge, currently available. For LysRS1, while we recently reported that AEC acts a competitive inhibitor with a nearly identical Ki to that described here ((128) and accompanying inhibition plots) no other kinetic parameters for the inhibition of aminoacylation have been reported for comparison.
46 47
Figure 2.1. Structures of L-lysine and analogues. Geometries of structures were optimized using ArgusLab 3.1 (Planaria Software). Carbon, nitrogen, oxygen, sulfur and hydrogen atoms are represented in gray, blue, red, yellow and white, respectively.
47 a a b b Ki Ki Ki LysRS1/ Ki kcat (R) kcat (R) Analogue LysRS1 LysRS2 (µM) LysRS2 LysRS1 LysRS2 (µM)* L-lysine 360±70 86±7 4 1.1±0.06 0.7±0.02 hydroxamate S-(2-aminoethyl)- 1140±230 3.9±0.4 290 1±0.09 0.8±0.02 L-cysteine L-lysinamide 2120±450 17±2 180 1±0.07 1.1±0.01 L-lysine methyl 478±100 74±7 6 1±0.07 0.8±0.03 ester L-lysine ethyl 303±45 55±6 6 1.1±0.05 0.8±0.02 ester DL-5- 1200±140 500±52 2 1.2±0.03 0.8±0.02 hydroxylysine L-ornithine 8800±1300 6300±600 1 1.1±0.02 0.9±0.02 D-lysine 6900±2500 12000±1400 1 1.1±0.1 0.7±0.04 L-cadaverine 320±45 260±28 1 0.9±0.03 1±0.03 Lysyl-sulfamoyl 0.025±0.004 0.028±0.003 1 1±0.05 0.9±0.03 adenosine L-α-amino butyric 21200±5300 14200±1700 1 1.1±0.09 1.2±0.02 acid L-γ-amino butyric 8040±2200 470000±51000 0.02 1±0.07 1±0.02 acid L-arginine 5060±860 64000±5000 0.08 1.1±0.04 0.9±0.03 L-glutamic acid 37000±78000 130000±13000 0.3 0.9±0.06 1.2±0.03
KM KM KM LysRS1/KM kcat kcat LysRS1 (µM) LysRS2 (µM) LysRS2 LysRS1 LysRS2 (s-1) (s-1) L-lysine 34±3 2.6±0.2 13 0.06±0.002 1.84±0.02
Table 2.1. Kinetic parameters for the inhibition of steady-state aminoacylation by B. burgdorferi LysRS1 and E. coli LysRS2 (lysS encoded). a Kis were determined from the following formula KMapp = KMreal (1 + [inhibitor]/Ki), using the KM values shown and inhibitor concentrations indicated in the text. b kcat determined in the presence of inhibitor relative to kcat in the absence of inhibitor. * - values determined by Jeffrey.Levengood.
48 2.3.2. Active site homology plots
The ability of certain compounds to selectively inhibit B. burgdorferi LysRS1 or
E. coli LysRS2 in vitro and B. burgdorferi LysRS1 or B. subtilis LysRS2 in vivo suggests differences between the active site architectures of the two enzymes. In order to estimate the degree to which this divergent substrate discrimination might be conserved, sequence alignments were constructed from 44 LysRS1 and 137 representative LysRS2 predicted protein sequences using Clustal X (167). Conservation of amino acids (identity) was then scored for each position in the two LysRS alignments. This data was mapped onto the three dimensional structures of E. coli LysRS2 (lysS) (136) and Pyrococcus horikoshii
LysRS1 (10) (Figs. 2.2.A and B). Examination of three-dimensional identity plots for both LysRS1 and LysRS2 showed a strikingly high degree of conservation throughout the
Lys binding sites of both proteins (Figs. 2.2.A and B). This conservation of residues was seen in regions binding both the R-groups and the remainder of the Lys molecules, suggesting that the patterns of non-cognate amino acid discrimination observed above might be conserved throughout the LysRS1 and LysRS2 protein families.
49 A B
Figure 2.2. L-lysine recognition by LysRS1 and LysRS2. A, Lys in the active site of Pyrococcus horikoshii LysRS1. B, Lys in the active site of E. coli LysRS2. Residues are colored according to their conservation in corresponding sequence alignments: gold, 100 % identity; red, 81-99 %; pink, 61-80 %; white, 41-60 %. For the substrate Lys the carbon backbone is shown in gray, and oxygen and nitrogen are colored red and blue respectively (168).
50 2.3.3. Growth inhibition by L-lysine analogues
Comparison of the kinetics of inhibition of in vitro aminoacylation by LysRS1
and LysRS2 indicated that several compounds preferentially inhibit one form of LysRS
rather than the other. Lysine analogues with the strongest preferences were lysinamide
and AEC, which showed 180 and 290-fold, respectively, lower Kis for LysRS2 than
LysRS1, and γ-amino butyric acid, which had a 60-fold lower Ki for LysRS1 than
LysRS2 (Table 2.1). To investigate whether these in vitro differences could be correlated with specific in vivo growth phenotypes, two related strains of B. subtilis were employed.
168 is a wild-type strain that employs LysRS2 for lysyl-tRNA synthesis, and 157.1 is a derivative of 168 where the endogenous LysRS2-encoding gene has been replaced by a gene encoding B. burgdorferi LysRS1 (128). The growth of these strains in minimal media was monitored with and without the addition of varying concentrations of AEC, lysinamide and γ-amino butyric acid. Addition of lysinamide at concentrations up to
46 mM had no detectable effect on the growth rates of either strain 168 or 157.1 (data not
shown). Growth in the presence of 5 µM AEC completely prevented growth of 168 but
only resulted in an approximately 50 % reduction in the growth rate of 157.1 (Fig. 2.3.A).
Conversely, addition of 400 mM γ-amino butyric acid completely inhibited growth of
157.1 but only lowered the growth rate of 168 by about 50 % (Fig. 2.3.B). These results
are consistent with data from in vitro steady-state kinetics, confirming the selectivity of
AEC and γ-amino butyric acid as preferential inhibitors of LysRS2 and LysRS1,
respectively.
51
Figure 2.3. In vivo growth inhibition of B. subtilis strains 168 (A) and 157.1 (B). Spizizen's MM supplemented with 2 mM Lys ({), 5 µM AEC ( ) or 400 mM L-γ- amino butyric acid () were inoculated with B. subtilis strain 168 or 157.1 and growth monitored by absorbance at 600 nm. Each curve represents the average of at least three independent experiments with standard deviation indicated at each time point.
2.3.4. Selection and characterization of LysRS2 variants
Based on comparisons between the crystal structures of the LysRS1 and LysRS2 active sites complexed with Lys (10;136), several residues were replaced in LysRS2 from
E. coli (lysS encoded). Substitutions were made with the general aims of assigning specific roles for each position and comparing the roles of synonymous residues in the active sites of LysRS1 and LysRS2 ((127); Fig. 2.1). The G216A substitution was designed to disrupt the interaction of the main chain carboxylic group of glycine with the 52 α-NH2 group from Lys. All the glutamic acid residues in the active site (E240, E278, and
E428), were mutated to aspartic acid to evaluate the role of the correct positioning of the
carboxylate in the active site, and to glutamine to evaluate the effect of a neutral residue.
N424 was replaced by aspartic acid, which has the ability to develop a negative charge,
and by glutamine, which allowed evaluation of the role of the correct positioning of this
H-bond interaction with the α-carboxyl of Lys. Y280 was evaluated by replacing it with
serine, in which the OH group was still present but the aromatic ring was missing, which
allows the evaluation of the correct positioning of the OH group at this position. The H-
bond interaction between the OH group from Y280 and the ε-NH2 from Lys was
investigated by replacing Y280 with phenylalanine. The main hydrophobic residue F426 was replaced by tryptophan to investigate the effect that a larger hydrophobic molecule will cause in the active site, and by histidine to evaluate the effect of introducing a possible positive charge in the hydrophobic side of the active site of LysRS2. The replacements of F426 were also intended to make the active site of LysRS2 more similar to LysRS1 (127), which contains both a tryptophan and a histidine at the corresponding side relative to Lys.
The effect of each replacement in the active site of LysRS2 on the steady-state kinetics of the aminoacylation reaction was determined. Comparison of the catalytic efficiency (kcat/KM) of the LysRS2 variants with the wild type indicated that all are less
efficient than wild type (Table 2.2). The KM for Lys and ATP increased from 1.2 up to
95-fold for most of the LysRS2 variants when compared to wild type. Only E278Q and
E428Q showed decreases of about 2-fold in the KM values for Lys and ATP. In most cases the increase in KM was always more significant for Lys than for ATP, particularly 53 for G216A, E278D and F426H, which showed increases of 75, 98 and 78-fold,
respectively. N424Q was the only mutant to have a significantly higher KM for ATP, with
a 69-fold increase. The kcat values for Lys and ATP were lower than wild type for all
mutants except G216A and F426H, which showed increases of 1.8 and 1.3-fold for Lys
and decreases of 4 and 5-fold for ATP, respectively. Severe losses in kcat were found for
E240Q and E278Q, with decreases of 125 and 212-fold for Lys and 200 and 277-fold for
ATP, respectively. Overall, the kinetic parameters for Lys and ATP during aminoacylation are in agreement with predictions based on the crystal structure, showing that certain replacements interfere with Lys and/or ATP binding and catalysis.
54 -1 a LysRS KM (µM) kcat (s ) kcat / KM (R)
Lys Wild-type 2.6 ± 0.2 1.8 ± 0.02 1 G216A 196 ± 16 3.4 ± 0.1 33 E240D 3.3 ± 0.3 0.086 ± 0.002 33 E240Q 3.6 ± 0.4 0.0087 ± 0.0004 330 E278D 254 ± 21 0.16 ± 0.006 1100 E278Q 1.4 ± 0.1 0.015 ± 0.003 50 Y280F 24 ± 2 0.031 ± 0.001 500 Y280S 114 ± 16 1.6 ± 0.07 50 N424D 5.2 ± 0.6 1.6 ± 0.07 2.5 N424Q 52 ± 4 0.65 ± 0.01 50 F426H 203 ± 17 2.4 ± 0.08 50 F426W 16 ± 2 0.60 ± 0.01 20 E428D 22 ± 2 1 ± 0.03 14 E428Q 1.3 ± 0.1 0.0200 ± 0.0006 50
ATP Wild-type 12 ± 1.1 3.4 ± 0.2 1 G216A 195 ± 21 0.800 ± 0.02 100 E240D 11 ± 1 0.14 ± 0.003 25 E240Q 14 ± 1 0.013 ± 0.0004 330 E278D 16 ± 2 0.054 ± 0.004 100 E278Q 7.8 ± 0.9 0.017 ± 0.0007 130 Y280F 62 ± 6 0.17 ± 0.005 100 Y280S 147 ± 14 0.35 ± 0.008 130 N424D 21 ± 2 1 ± 0.04 5 N424Q 830 ± 120 2.2 ± 0.09 110 F426H 19 ± 1 0.67 ± 0.01 10 F426W 110 ± 8 2.4 ± 0.08 13 E428D 20 ± 2 1 ± 0.05 5 E428Q 7.8 ± 0.9 0.017 ± 0.0002 130
Table 2.2. Steady-state aminoacylation kinetics of E. coli LysRS2 (lysS encoded) with Lys and ATP. a Relative decrease compared to wild-type
55 2.3.5. Discrimination of L-lysine analogues by LysRS2 variants
We previously found that LysRS1 and LysRS2 discriminate cognate and non-
cognate Lys analogues differently (127). The strongest inhibitor of both enzymes was
5’-O-[N-(L-lysyl)-sulfamoyl] adenosine (SA), a non-hydrolyzable analogue of lysyl-
adenylate equally effective against both LysRS1 and LysRS2. In contrast, the Lys
analogue S-(2-aminoethyl)-L-cysteine (AEC) showed a marked difference in apparent
affinity, the Ki being approximately 300-fold lower for LysRS2 than LysRS1. To test the
possibility that some of the LysRS2 variants developed in this study transformed the
active site of LysRS2 into a form mimicking the LysRS1 active site, the Kis for AEC and
SA were determined for the variants and compared to wild type (Table 2.3). The
inhibition patterns displayed by all the LysRS2 mutants (with one exception) clearly
suggest competitive inhibition by SA and AEC, since KM but not kcat values changed
significantly on addition of analog. The most significant changes in Ki for SA were
observed with Y280F and F426H, which showed 10 and 50-fold increases, respectively.
For AEC, the variants showing the most pronounced change in Ki to values similar to
wild type LysRS1 were G216A, E278D and F426H, with increases of 317, 331 and 335-
fold, respectively. Interestingly, Y280S was the only variant to present a mixed pattern of
inhibition, with kcat decreases of 7 and 5.3-fold for SA and AEC, respectively, and Ki increases of 8 and 90-fold for SA and AEC, repectively. Only N424Q had moderate decreases in Ki, 2.5-fold for both SA and AEC.
56 a LysRS Ki (µM) kcat (R ) Ki variant/ Ki wild-type
SA Wild-type 0.028 ± 0.003 0.90 ± 0.03 1 G216A 0.059 ± 0.007 0.29 ± 0.02 2 E240D 0.029 ± 0.003 0.60 ± 0.03 1 E240Q 0.010 ± 0.001 1.5 ± 0.01 0.4 E278D 0.041 ± 0.009 2.3 ± 0.04 1.5 E278Q 0.023 ± 0.004 0.50 ± 0.02 0.8 Y280F 0.27 ± 0.04 1.9 ± 0.02 10 Y280S 0.22 ± 0.03 0.13 ± 0.01 8 N424D 0.039 ± 0.005 0.77 ± 0.04 1 N424Q 0.055 ± 0.006 1.2 ± 0.03 2 F426H 1.3 ± 0.15 0.50 ± 0.01 50 F426W 0.050 ± 0.007 0.82 ± 0.06 2 E428D 0.061 ± 0.009 0.83 ± 0.03 2 E428Q 0.011 ± 0.001 1.1±0.05 0.4
AEC Wild-type 3.9 ± 0.4 0.80 ± 0.02 1 G216A 1240 ± 140 0.39 ± 0.01 300 E240D 3.1 ± 0.7 0.84 ± 0.03 0.8 E240Q 5.4 ± 0.7 1.5 ± 0.02 1 E278D 1290 ± 160 1.8±0.01 300 E278Q 5.0 ± 0.9 0.48±0.03 1 Y280F 72 ± 8 2.1 ± 0.06 20 Y280S 340 ± 60 0.15 ± 0.01 90 N424D 4.0 ± 0.5 0.72 ± 0.04 1 N424Q 76 ± 8 1.2 ± 0.03 20 F426H 1310 ± 170 0.46 ± 0.01 300 F426W 25 ± 3 0.74 ± 0.01 6 E428D 34 ± 7 0.79 ± 0.04 9 E428Q 1.5 ± 0.2 1.1 ± 0.07 0.4
Table 2.3. Kinetic parameters for the inhibition of steady-state aminoacylation by E. coli LysRS2 (lysS encoded) in the presence of SA or AEC. a Relative to kcat values determined in the absence of inhibitor (Table 2.2).
57 2.3.6. Activation of AEC
In order to evaluate changes in substrate specificity associated with perturbed
binding and activation of AEC and Lys in the active site of each variant, steady-state
kinetic parameters were measured for the ATP-PPi exchange reaction (Table 2.4).
G216A, E278D and Y280S showed the most significant increases in the KM values, 142,
48 and 384-fold for AEC, respectively, and 106, 239 and 75-fold for Lys, respectively,
compared to wild type. The kcat for AEC and Lys activation was reduced for all
replacements and consequently the catalytic efficiency of the LysRS2 variants in
activating AEC was consistently lower than wild type. Thus G216A, E278D and Y280S
are the least active enzymes with 476, 1754 and 1010-fold decreases, respectively, in
kcat/KM for AEC activation (Table 2.4). In the case of Lys activation, the least active enzymes are G216A, E278D, Y280F and F426H with 413, 1000, 667 and 923-fold decreases in kcat/KM, respectively. Comparison of the differences in catalytic efficiency
for AEC and Lys displayed by the LysRS2 variants showed that none have acquired a
significant improvement in their ability to discriminate Lys from AEC. For most LysRS
Lys AEC variants, Lys specificity (defined as kcat/KM / kcat/KM ) remained comparable to
wild-type (Table 2.4). A 4-fold increase in specificity for Lys was displayed by Y280S
relative to wild-type, while N424D, F426H and F426W showed 7, 19 and 4-fold
decreases compared to AEC, repsectively. Thus, while inhibitor data clearly showed
decreases in apparent affinities for AEC, these were accompanied by decreased
efficiencies in Lys utilization and consequently little change in substrate specificity.
58 (kcat / Lys -1 Lys AEC -1 AEC Lys LysRS K Lys (µM) kcat (s ) kcat/KM K AEC (µM) kcat (s ) kcat/KM KM )/ M -1 -1 M -1 -1 (s µM ) (s µM ) (kcat / AEC KM ) Wild Type 43 ± 4 50 ± 0.6 1.2 14 ± 1.8 7.7 ± 0.02 0.55 2.1 G216A 4580 ± 530 14 ± 0.7 0.0029 1980 ± 290 2.2 ± 0.1 0.0011 2.7 E240D 12 ± 1.4 1.6 ± 0.05 0.13 7.2 ± 1 0.44 ± 0.01 0.061 2.2 E240Q 22 ± 3 0.210 ± 0.001 0.0097 7.4 ± 0.7 0.057 ± 0.0001 0.0077 1.3 E278D 10300 ± 990 2.1 ± 0.5 0.0012 665 ± 95 0.21 ± 0.001 0.00031 3.8 E278Q 25 ± 2 0.36 ± 0.01 0.014 5.3 ± 0.6 0.051 ± 0.0001 0.0096 1.5 Y280F 2980 ± 310 5.3 ± 0.2 0.0018 82 ± 12 0.08 ± 0.0003 0.00098 1.8 Y280S 3250 ± 460 15 ± 0.7 0.0047 5350 ± 760 2.9 ± 0.01 0.00055 8.5 N424D 137 ± 20 7.8 ± 0.2 0.057 9.3 ± 1.8 1.7 ± 0.1 0.18 0.31 N424Q 326 ± 42 1.3 ± 0.06 0.041 49 ± 8 0.37 ± 0.001 0.0076 5.4 F426H 1950 ± 320 2.6 ± 0.01 0.0013 261 ± 33 3.2 ± 0.1 0.012 0.11 F426W 80 ± 7 4.6 ± 0.1 0.058 11 ± 1.6 1.2 ± 0.03 0.11 0.53 E428D 215 ± 17 14 ± 0.4 0.065 160 ± 19 5.5 ± 0.1 0.034 1.9 E428Q 12 ± 1.6 0.99 ± 0.04 0.079 12 ± 1.2 0.24 ± 0.008 0.021 3.9 59
Table 2.4. Steady-state ATP-PPI exchange kinetics of E. coli LysRS2 (lysS encoded) with Lys and AEC.
59 2.3.7. Cell viability with LysRS2 variants
Following the same principle applied with B.subtilis strains 168 and 157.1, which
allowed the in vitro results from LysRS1 kinetics to be tested in vivo, the effect of
LysRS2 variants were analyzed in vivo. Using the E. coli strain PAL∆S∆UTR, which has
both genomic lysS and lysU genes knocked-out, the functionality of each LysRS2 variant
was determined in vivo (132). The PAL∆S∆UTR strain contains a temperature sensitive
plasmid pMAK705 lysU that encodes the lysU protein and chloramphenicol resistance
but is unable to replicate at 43 oC, allowing a temperature dependent screening for LysRS
activity. Upon cloning each LysRS2 variant into the vector PXKS2, which contains the
ampicilin resistance gene, the new plasmids were transformed into PAL∆S∆UTR using
100 ng of plasmid DNA and the cells were recovered at 43 oC in LB media containing
only ampicilin in order to remove the pMAK705 plasmid. The transformation efficiency
of the PAL∆S∆UTR strain upon chemical transformation and recovery at high
temperature varied from 104 to 105 cells/µg of DNA depending on the mutation. After two replica-plating passages, the cells were replicated back onto LB media supplemented
with chloramphenical and ampicilin and grown at 30 oC to confirm the elimination of the
pMAK705 plasmid. During the replica cycles, the number of colonies for mutations that severely impaired aminoacylation activity was drastically reduced. The empty plasmid
PXKS2-EcoRI resulted in no colonies after the second replica-plating, indicating the
efficient loss of the pMAK705 plasmid at a non-permissive temperature. E278D and
E240Q were the LysRS2 variants with the highest loss in in vitro activity, and they
produced only a few colonies and were never able to grow in liquid culture or on MM
plates, indicating a direct correlation between in vitro and in vivo activities. 60 To confirm that the other LysRS2 variants were able to sustain cell growth and did not drastically impair cell survival, isolated colonies from each variant were grown on
LB and MM media supplemented with 2 mM Lys. The growth curves were measured in triplicate on a microplate reader and the growth rates were determined (Fig. 2.4 and
Table 2.4)
61 0.6
1 LysRS2 WT LysRS2 WT G216A G216A E240D 0.5 E240D E278Q E278Q Y280F Y280F 0.8 Y280S Y280S N424D 0.4 N424D N424Q N424Q F426H F426H F426W 0.6 F426W E428D E428D 0.3 600nm E428Q 600nm E428Q A A
0.4 0.2
0.2 62 0.1
0 0 0 100 200 300 400 500 600 700 0 100 200 300 400 500 600 700
Time (min) Time (min)
Figure 2.4. Growth curves of E. coli PAL∆S∆UTR containing pXKS2 vector with LysRS2 variants. A. Growth curve in LB media. B Growth curve in MM media supplemented with 2 mM Lysine. Each time point represents the average of a triplicate reading.
62 a a Lys LysRS2 LB (min) LB (R) MM (min) MM (R) kcat / KM (R)b Wild Type 43±2 1 100±5 1 1 G216A 91±4 2.1 115±6 1.2 33 E240D 83±4 1.9 100±6 1 33 E240Q ND ND ND ND 330 E278D ND ND ND ND 1100 E278Q 37±3 0.86 107±5 1.2 50 Y280F 90±5 2.0 93±4 0.9 500 Y280S 91±4 2.1 115±5 1.2 50 N424D 76±3 1.7 125±5 1.3 2.5 N424Q 83±4 1.93 150±4 1.5 50 F426H 58±3 1.3 187±6 1.9 50 F426W 111±5 2.5 121±5 1.2 20 E428D 90±5 2.0 115±4 1.2 14 E428Q 55±3 1.2 150±5 1.5 50
Table 2.5. Doubling time of E. coli PAL∆S∆UTR containing pXKS2 vector with LysRS2 in liquid media– not determined. a Relative increase and decrease in growth rate compared to wild type. b Relative decrease compared to wild-type in aminoacylation (Table 2.1)
The growth rates in LB were significantly different between the LysRS2 variants,
indicating that in rich media the activity of LysRS2 was a determinant for cell viability
and fitness. G216A, Y280F, Y280S, F426W and E428D displayed a reduced doubling
time corresponding to twice the wild type doubling time (Table 2.4). Only E240Q
presented a faster doubling time than the wild type; however, the difference was not
significant. The growth curves in LB also indicate a delay in growth between the mutants
with Y280F, F426W and E428D, taking around 350 min after inoculation to reach log
phase, while all the other LySRS2 variants entered log phase approximately 100 min after inoculation.
63 The difference between the growth rates of LysRS2 variants in MM supplemented with Lys was less pronounced than in LB, with an increase in the doubling time for
LysRS2 wild type and variants to around 100 min. Variants G216A, Y280F, Y280S,
F426W and E428D were less affected by the different media and their doubling time did not change significantly. The fact that the doubling time of these LysRS2 variants did not change significantly compared to the LysRS2 wild type, which increased 2-fold, indicates that the limiting step for growth of cells harboring such mutations was probably LysRS2 activity. E. coli PAL∆S∆UTR harboring LysRS2 variants acquired phenotypes corresponding to the observed in vitro activity of these enzymes. Broadly speaking, most of the LysRS2 variants were able to promote cell growth at a rate that correlates with their activity in vitro. Based on these results, the search for AEC resistant LysRS2 in vivo became feasible since the in vivo and in vitro results generally correlate with cell viability.
2.3.8. In vivo AEC resistance by LysRS2 variants
To study the gain of resistance against AEC in vivo resulting from point mutations in lysS, colonies that were able to grow on LB and MM supplemented with Lys were selected for further study. Growth curves for all LysRS2 variants were measured on a microplate reader at 37 oC on MM supplemented with 5 µM AEC, as previously described for B.subtilis strains (Fig. 2.5). Cells that acquired AEC resistance were considered as those able to grow at 5 µM, which inhibits wild type LysRS2 dependent growth.
64 0.7
LysRS2 WT 0.6 G216A E240D E278Q Y280F 0.5 Y280S N424D N424Q F426H 0.4 F426W E428D 600nm E428Q A 0.3
0.2
0.1
0 0 200 400 600 800 1000 1200
Time (min)
Figure 2.5. Growth inhibition of E. coli PAL∆S∆UTR containing LysRS2 variants. Growth curve in MM media supplemented with 5 µM AEC. Each time point represents the average of a triplicate reading.
The inhibition pattern for E. coli PAL∆S∆UTR containing LysRS2 wild type was as expected from in vitro and in vivo studies. G216A, Y280F, Y280S, F426H, F426W and E428D were able to grow on MM containing 5 µM AEC, which inhibits growth of cells harboring wild type LysRS2. Interestingly, each LysRS2 mutant presented a different cell growth delay on media containing AEC.
65 In order to determine the level of in vivo AEC resistance conferred by LysRS2 variants to the E. coli PAL∆S∆UTR, cells able to grow on 5 µM AEC were grown in different AEC concentrations. Only Y280F and F426W were able to grow on MM containing concentrations above 5 µM AEC, while G216A, Y280S, F426H and E428D could not confer resistance to higher concentrations of AEC. Indeed, the different levels of resistance conferred by LysRS2 variants are interesting because they correlate with the overall aminoacylation abilities of theses mutants. Y280F was able to grow on MM containing AEC concentrations up to 100 µM with a differential growth delay between each increment of AEC concentration indicating that a certain cumulative effect is sensed
by the LysRS2 variant (Fig. 2.6.A). F426W was able to grow on MM with AEC
concentrations up to 500 µM showing the same delay of growth for all concentrations
when compared to the growth on MM without AEC (Fig. 2.6.B). The different
phenotypes of AEC resistance caused by Y280F and F426W suggest that the resistance
mechanism or even cell phenotype caused by the point mutations are different. The
possibility that LysRS2 acquired in vivo resistance to AEC led us to attempt to further
extend the AEC resistance range for the Y280F and F426W variants.
66 0.6 0.6 LysRS2 WT F426W 0 LysRS2 WT F426W 5 0.5 0.5 Y280F 0 F426W 10 Y280F 5 F426W 50 Y280F 10 F426W 100 Y280F 50 F426W 500 0.4 Y280F 100 0.4 Y280F 500
0.3 0.3 600nm 600nm A A
0.2 0.2
0.1 67 0.1
0 0 0 200 400 600 800 1000 1200 0 200 400 600 800 1000 1200
Time (min) Time (min)
Figure 2.6. Growth inhibition of E. coli PAL∆S∆UTR containing Y280F and F426W in different concentrations of AEC. Growth in MM supplemented with different concentrations of AEC varying between 0 and 500 µM. Each time point represents the average of triplicate readings. LysRS2 WT was inoculated in 5 µM AEC. Y280F and 426W were inoculated in the concentrations indicated in the inset.
67 2.3.9. Screening for enhanced AEC resistance in LysRS2 variants
To further investigate the extent of AEC resistance that LysRS2 could potentially
acquire, the Y280F and F426W plasmids were isolated, sequenced and subjected to
chemical random mutagenesis using hydroxylamine. After mutagenesis, the plasmids
were transformed into strain CJ236 in order to prepare a large amount of plasmids and
perform a selection against mutations that might lead to a loss of antibiotic resistance or
origin of replication in the plasmid. Also, since strain PAL∆S∆UTR is only transformed
with an efficiency of up to 105, a large preparation of plasmid DNA was generated from approximately 50,000 colonies of CJ236 transformants. Y280F and F426W mutants were screened as described in section 2.3.6, however the final screen was to replica plate on
MM supplemented with 1 mM rather than 5 µM AEC. The higher AEC concentration was chosen for screening in order to select ne LysRS2 variants with elevated resistance
compared with the original variants. After 5 rounds of transformation and screening, a
few colonies were identified to have higher resistance to AEC than the original Y280F
and F426W. After isolating the plasmid and retransforming into E. coli PAL∆S∆UTR
and additional screening, only one isolate for each variant was confirmed to grow at
1 mM AEC. The new mutants were then subjected to a screen to determine the AEC
concentrations at which they grow. Both Y280F4 and F426W6 were able to grow on
concentrations up to 5 mM (Fig. 2.7). Sequencing of the lysS gene in the corresponding
plasmids with two times coverage found no extra mutations in the coding region of the
LysRS2 gene. The lack of mutations in the LysRS2 ORFs associated with increased
resistance led us to investigate the level of protein expression and modification in vivo.
68 0.4
0.35 LysRS2 WT F426W F426W6 0.3 Y280F Y280F4
0.25
0.2 600nm A
0.15
0.1
0.05
0 0 200 400 600 800 1000 1200
Time (min)
Figure 2.7. Growth inhibition of E. coli PAL∆S∆UTR containing Y280F and F426W mutants in 5 mM AEC. Growth curve in MM supplemented with 5 mM AEC. Each time point represents the average of triplicate readings.
2.3.10. Characterization of the protein level of LysRS2 variants in E. coli
PAL∆S∆UTR
Resistance to antibiotics can potentially be achieved by aaRSs over production in
the cell (46). In order to investigate if the elevated AEC resistance achieved after chemical random mutagenesis of Y280F4 and F426W6 could be attributed to changes in protein levels, LysRS2 levels were monitored by immunoblotting. E. coli PAL∆S∆UTR
69 harboring LysRS2 wild type, Y280F, F426W, Y280F4 or F426W6 were collected at the end of log phase at OD600 ~0.8 in LB or MM supplemented with Lys or AEC. Different amounts of the resulting total protein extract were separated by SDS-PAGE and subjected to immunoblotting (Fig. 2.8).
LysRS2 was detected in cell free extracts from strains expressing the wild type
LysRS2 in LB or MM only with at least 10 µg of total protein extract. The cross reaction observed is possibly due to modifications of LysRS2 within the cell (Fig. 2.8).
Interestingly, Y280F and F426W presented different protein level profiles in the different media. Y280 was detected in LB and MM supplemented with Lys from 1µg of protein extract but only from 10 µg of protein extract in MM supplemented with AEC. F426W presented the opposite profile with a strong detection in 1 µg of protein extract in MM supplemented with AEC but only in 10 µg of protein extract in LB and MM with Lys.
The difference in LysRS2 levels between the two variants with AEC resistance again suggests different mechanisms of resistance are conferred by the Y280F and F426W replacements.
70 LysRS2 WTLysRS2 Y280F LysRS2 F426W
LB
MM
AEC
123 45 123 45 1 2 3 45
Figure 2.8. LysRS2 wild type and variants in E. coli PAL∆S∆UTR in different liquid media. E. coli PAL∆S∆UTR harboring LysRS2 wild type (LysRS2 WT), Y280F (LysRS2 Y280F) and F426W (LysRS2 F426W) were grown in different liquid media. Total cell protein from late log phase (OD600= 0.8) LB, MM supplemented with 2 mM Lys (MM) and MM supplemented with 5 µM AEC (AEC) were separated by SDS- PAGE, transferred to membranes and detected by using anti-LysRS2 polyclonal antibodies. The different total protein concentrations loaded are: 20 µg (lane 2), 10 µg (lane 3), 1 µg (lane 4), 0.1 µg (lane 5), and 0.01 µg of purified LysRS2 (lane 1) was loaded as control.
The protein level of Y280F and Y280F4 in the different media can be considered the same with the Y280F4 being detected at 1µg with a fainter band (Fig. 2.9). The same result was observed for F426W6, which was detected with the same profile as the
F426W, but with a less intense band at 1µg of total protein. This indicates that the extra resistance conferred by the uncharacterized mutation in the plasmid, but not in the
LysRS2 gene, does not interfere with the protein level of each individual LysRS.
71 F426W F426W6 Y280F Y280F4
LB
MM
AEC
1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9
Figure 2.9. LysRS2 variants that confer resitance to AEC in E. coli PAL∆S∆UTR in different liquid media. E. coli PAL∆S∆UTR harboring LysRS2 Y280F (Y280F), Y280F variant (Y280F4), F426W (F426W) and F426W variant (F426W6) were grown in different liquid media. Total cell protein from late log phase (OD600= 0.8) LB, MM supplemented with 2 mM Lys (MM) and MM supplemented with 5 µM AEC (AEC) were separated by SDS-PAGE, transferred to membranes and detected by using anti- LysRS2 polyclonal antibodies. The different concentrations loaded are: 20 µg (lanes 2 and 6), 10 µg (lanes 3 and 7), 1 µg (lanes 4 and 8), 0.1 µg (lanes 5 and 9), and 0.01 µg of purified LysRS2 (lane 1) was loaded as control.
2.4. Discussion
2.4.1. Comparison of amino acid discrimination by LysRS1 and LysRS2.
The inhibition of aminoacylation by Lys analogues suggests several key similarities and differences between the two forms of LysRS. Both LysRSs demosntrated a comparably strong enantiomeric selectivity for L-lysine over D-lysine, consistent with the general observation that L-amino acids are strongly favored throughout protein synthesis ((89)
and references therein). While LysRS2 was able to aminoacylate tRNALys with D-lysine
72 more readly than LysRS1, the level of D-lysine required in vitro was significantly higher than would be expected in vivo given estimates of microbial total Lys pools under normal growth conditions (169). Similarly, the levels of arginine and ornithine required for inhibition of aminoacylation by both LysRS1 and LysRS2 in vitro are significantly higher than have been observed in vivo (170), indicating an adequate level of discrimination by both enzymes. Estimates of cellular concentrations of cadaverine are comparable to the
Kis determined here, indicating specific protection exists against cadaverine inhibition at
normal Lys levels as previously proposed (129). While the Kis are significantly higher for
L-glutamic acid than most of the other compounds tested, they are in fact not far removed
from microbial glutamate concentrations, which may typically reach up to 80 mM or higher under certain growth conditions (e.g. (171)). Taken together, our data confirm that
LysRS1 and LysRS2 are equally adept at discriminating against both the more common
Lys analogues and the non-cognate canonical amino acids.
The ability to discriminate Lys from several of the analogues tested here was also
recently described for the L box of B. subtilis, a Lys-responsive leader RNA that directly
binds Lys, indicating that RNA and protein based systems offer equally effective mechanisms for specific recognition of Lys (172;173). Amongst the other amino acids tested, all but one showed higher Kis for LysRS1 than for LysRS2, in agreement with the
more compact binding pocket for the Lys backbone predicted from the structure of the
class I enzyme (Fig. 2.10.A). L-lysine hydroxamate, L-lysine methyl ester, L-lysine ethyl ester and DL-5-hydroxylysine all show a marginal preference for inhibition of LysRS2
over LysRS1, with the Kis 2-6-fold higher for the class I enzyme, while L-α-amino
butyric acid inhibits both enzymes to a similar degree. In contrast, L-γ-amino butyric
73 acid, AEC and L-lysinamide were all found to be highly specific for a particular form of
LysRS.
Of all the compounds compared as inhibitors of LysRS1 and LysRS2, only L-γ-
amino butyric acid was a significantly better inhibitor of the class I enzyme. Examination
of LysRS1 and LysRS2 active sites offers no obvious structural basis for this difference,
although the relatively high Kis compared to most of the other analogues may be
indicative of poor binding in both cases. While the kinetics of inhibition by L-γ-amino
butyric acid suggest that neither form of LysRS binds this analogue well, in vivo data
(discussed below) indicates that the difference in discrimination may be functionally
significant.
AEC and lysinamide both show preferential inhibition of LysRS2 over LysRS1,
with the Kis being 290 and 180-fold lower for the class II enzyme, respectively. The differences in AEC and lysinamide recognition reflect the more closed structure of
LysRS1 around the amino acid backbone, where two conserved aromatic residues make hydrophobic interactions with the side chain as opposed to a single residue in LysRS2
(Figs. 2.10.A and B). The role of these residues is illustrated from modeling the binding of AEC at both active sites. In LysRS1, which binds AEC relatively poorly, there is some steric exclusion of the sulfur atom by His240 (Fig. 2.10.A). In contrast, the orientation of bound AEC and the absence of a second “packing” residue in LysRS2 allow inhibitor binding without a potential steric clash (Fig. 2.10.B), in agreement with the relatively strong binding of AEC. The importance of Trp218 and His240 in LysRS1 may be even more pronounced than is initially apparent from the existing tRNA-free structure. In a docking model of P. horikoshii LysRS1 and tRNA (10), Trp218 and His240 (Trp 220 and
74 His242 in B. burgdorferi) make stacking interactions with the terminal adenosine of tRNA suggesting that they may be more closely packed in the active site during aminoacylation. Such tRNA-mediated re-arrangements of active site residues have previously been observed in other class I aaRSs that, like LysRS1, require tRNA for amino acid activation (31;34;35;174).
75 A B
Figure 2.10. Models of AEC recognition by LysRS1 and LysRS2. A. Model for the binding of AEC to the active site of P. horikoshii LysRS1. B. Model for the binding of AEC to the active site of E. coli LysRS2. The lysine ligand was modified to present an S instead of the γC, and the resulting structures energy minimized using Swiss-Pdb Viewer v 3.7. The resulting models were visualized in stick and van der Waals surface for active site residues and ball and stick for AEC in MOLMOL v 2k.2. Residues are colored according to their conservation in corresponding sequence alignments: gold, 100 % identity; red, 81-99 %; pink, 61-80 %; white, 41-60 %. For the substrate Lys, the backbone is shown in white, and oxygen, nitrogen and sulfur are colored red, blue and yellow, respectively (168).
2.4.2. LysRS1 displays a narrower substrate spectrum than LysRS2
The high degree of conservation of both LysRS1 and LysRS2 active site residues
(Figs. 2.10.A and B) suggests that their marked differences in sensitivity to numerous
76 inhibitors may be of functional significance. This was strongly supported by
aminoacylation data, which showed a far wider range of analogues could be stably
attached to tRNALys by LysRS2 than by LysRS1. This difference could reflect the
existence of a more proficient proofreading activity in LysRS1 or a more promiscuous
active site in LysRS2. The possibility that proofreading prevents accumulation of
mischarged tRNAs was not supported by initial studies with LysRS1 (Hervé Roy and
Michael Ibba, unpublished results) and would not be expected given that the closely
related class 1b aaRSs glutaminyl- and glutamyl-tRNA synthetases have not been shown
to catalyze such activities (reviewed in (175)]). Thus, the difference in substrate profiles
between LysRS1 and LysRS2 can be attributed to a higher degree of substrate
discrimination in the class I enzyme. This is in agreement with our recent study
employing AEC, which suggested inefficient analogue recognition by LysRS1 could
prevent miscoding of Lys codons during protein synthesis (128). The data presented here
support this finding and suggest that this function in translation might also extend to other
analogues, given that LysRS1 generally has a narrower substrate specificity. One
important exception is L-γ-amino butyric acid, whose ability to preferentially inhibits
LysRS1 indicates that LysRS2 can also function in translational quality control by
excluding particular non-cognate amino acids. This was confirmed by the observation
that production of LysRS2 allows growth of bacterial cells at L-γ-amino butyric acid
concentrations inhibitory to cells producing solely LysRS1. It is worth noting, however,
that any practical application of this difference in analogue recognition is dependent on
the discovery of specific inhibitors of LysRS1 with Kis several orders of magnitude lower than L-γ-amino butyric acid. 77 2.4.3. Functional consequences of divergent recognition of non-cognate amino acids
The finding that LysRS1 and LysRS2 have substantially different non-cognate
amino acid substrate profiles has functional, evolutionary and practical implications.
Earlier work indicated that LysRS1 could prevent infiltration of the genetic code by AEC,
but that now appears to simply be an example of a more general phenomenon whereby
both forms of LysRS can provide translational quality control under appropriate
conditions. The exact nature of the physiological conditions when such quality control
might be critical awaits determination of Lys analogue pools in archaeal and bacterial
metabolomes. LysRS-mediated quality control relies on the presence of one LysRS or the
other but not both together, in agreement with the phylogenetic distributions observed for
the majority of LysRS1 and LysRS2 sequences for which the corresponding complete
genome sequences are known. Of the over 240 complete genome sequences publicly
available only a few encode both LysRS1 and LysRS2. The archaeal example is the
family Methanosarcinaceae, which LysRS1 and LysRS2 apparently function together in
suppressor tRNA charging (176), and the bacterial Bacillus cereus 14579 where both
LysRSs act together to charge and unusual tRNAOther (discussed in Chapter 3). In
addition to providing a rationale for the existence and distribution of the two LysRSs, the
divergence in substrate recognition confirms earlier proposals that LysRS1 may be a
suitable target for the development of novel anti-microbials (177). LysRS1 is found alone
in a number of bacterial pathogens (e.g. B. burgdorferi, various Brucella and Rickettsia
species, Treponema pallidum and Tropheryma whippelii) and our findings indicate that it may be practical to target Lys-tRNALys synthesis in these organisms without disrupting
the LysRS2-mediated pathway of the human host.
78 2.4.4. Specific recognition of L-lysine in the LysRS2 active site.
Structural studies indicate that the active site of E. coli LysRS2 undergoes a large
conformational change that stabilizes and promotes effective binding of Lys with the
positions of several residues modified significantly (136). Interpretations of the effect of
mutations on kinetic parameters assume that the mutations only affect local structure and
not overall structure of the binding pocket, an assumption generally dereived from the
kinetic parameters determined here. For example G216, whose carboxyl group forms an
H-bond with the α-amino group of Lys, is proposed to be part of a loop stabilized by
substrate binding. Steady-state kinetic parameters indicate that replacement of G216 does
indeed disrupt the H-bond between the α-carboxyl group of residue 216 and the α-amino group of Lys (Fig. 2.11). The perturbation of ATP binding suggests that the G216A replacement also disrupts correct repositioning of the corresponding loop (136). F426 is
also repositioned after Lys binding, with the aromatic ring rotated to presumably promote hydrophobic interaction with the R-group of Lys. The substitution F426H disrupted Lys binding, due to insertion of a positively charged residue in the hydrophobic side of the active site. F426W had considerably less impact on Lys binding, and instead predominantly affected ATP kinetics. Given that neither substitution of F426 would be expected to disrupt the active site H-bond network (Fig. 2.11.A-C), it is reasonable to
assume that residue 426 contributes to substrate specificity by promoting hydrophobic
interactions with the R-group of Lys and determining the size of the amino acid binding
pocket.
The LysRS2 active site contains three glutamate residues with different proposed
roles in substrate recognition. E240 is not directly implicated in Lys binding, but is
79 believed to be involved in stabilizing and/or delocalizing the H-bond network by acting
as a H-bond donor in the active site. Replacements of E240 with aspartic acid or glutamine had no effect on Lys or ATP binding, but the kcat during the aminoacylation
reaction decreased for both mutations, supporting the proposed indirect role of this residue. In contrast, replacement of E278 by aspartic acid or glutamine had more widespread effects on the kinetics of aminoacylation. The shortening of the side chain in
E278D LysRS2 reduced the apparent affinity for Lys, indicating that E278 is directly involved in Lys binding through H-bonding between its carboxyl group and the α-NH2 of
Lys. E278 is in β-strand B3 and does not have the flexibility to be reoriented in the active
site when replaced by aspartate (Fig. 2.11 D), indicating that this position is devoted to
direct H-bonding with the α-NH2 of Lys. The E278D replacement was the most
detrimental to Lys binding as measured in both the activation and aminoacylation
reactions, identifying this as a critical residue in substrate recognition. In contrast, the
E278Q replacement had little effect on Lys binding but dramatically reduced kcat. E428 is the final glutamic acid residue in the active site of LysRS2 implicated in the H-bonding network, and it is believed to specifically interact with the ε-NH2 group of Lys. While
less dramatic than the changes observed for E278, replacements of E428 followed a similar pattern indicating that H-bonds mediated by this residue are important for catalysis. The general pattern presented by these replacements is that at any position in the active site of LysRS2 occupied by glutamic acid, a change to a neutral residue of similar size and H-bonding capacity leads to a reduction in kcat. Amino acid binding is
most severely disrupted in E278D, indicating that this residue is essential for binding and
positioning of Lys in the active site. This is in agreement with earlier studies of the
80 closely related subclass IIb enzyme aspartyl-tRNA synthetase (AspRS), in which the analogous motif 2 residue (D342 in the yeast cytoplasmic enzyme) forms essential interactions with the α-NH2 group of the substrate aspartic acid (20).
Kinetic analyses showed that other active site residues also contribute directly to
Lys binding. Substitutions of Y280 indicated that the H-bond between the side chain OH
group and the ε-NH2 of Lys is important to promote both substrate binding and catalysis.
Replacements at N424 showed that this residue contributes to both Lys and ATP binding,
and that it is the precise placement, rather than the exact nature, of the H-bonding partner
that is critical.
81 A B Tyr 280 Glu 428
His 426 Phe 426
Glu 240 *
Glu 278
Asn 424 Gly 216
Wild-type F426H
C D
Trp 426
Asp 278
F426W E278D
Figure 2.11. L-lysine recognition by wild-type and variant forms of LysRS2. A Lys in the active site of wild-type E. coli LysRS2. * indicates the ε-amino group of the substrate Lys molecule, and H-bonds are shown as dashed lines. B-D, models for the binding of Lys to the LysRS2 variants F426H (B), F426W (C) and E278D (D). Residues were modified appropriately, and the resulting structures energy minimized using Swiss- Pdb Viewer v 3.7. The resulting models were visualized in ball and stick using MOLMOL v 2k.2 (168).
82 2.4.5. Substrate specificity determinants in LysRS2
The availability of numerous variants with changes in cognate amino acid binding
provided a basis to probe substrate specificity and discrimination in LysRS2. The
effectiveness of inhibition by AEC closely correlated with the efficiency of Lys utilization in all the LysRS2 variants studied, providing further support for the roles of
various residues as described above. Inhibition kinetics for the reaction intermediate
analogue SA revealed surprisingly little effect for most of the replacements, suggesting
that the majority of the residues studied here are primarily involved in initial substrate
recognition and activation (Table 2.3). While many of the LysRS2 variants displayed
significant losses in apparent affinity for the non-cognate AEC, in only three cases did
this result in a significant change in substrate specificity compared with the cognate
substrate Lys (Table 2.3). N424D and F426H, both of which are expected to be in close
proximity to the sulfur moiety of AEC, displayed reduced discrimination of Lys versus
AEC, while Y280S showed a four-fold increase in specificity. The increase in specificity
shown by Y280S compared to wild type indicates that removal of the aromatic ring can
cause substantial disruption of the active site, as also suggested by the observation of
mixed inhibition kinetics exclusively for this variant.
2.4.6. In vivo analysis of LysRS2 variants
The in vitro analysis of the LysRS2 variants demonstrated the different roles of
each aa residue in the active site during recognition of Lys and discrimination of AEC.
The in vivo characterization of each LysRS2 variant was necessary to identify the impact
of each mutation on amino acid discrimination and resistance against LysRS2 inhibitors.
83 Each variant was tested using the E. coli strain PAL∆S∆UTR, which contains deletions
of the two LysRS2 encoding genes, lysS and lysU, in order to determine their ability to sustain cell survival. If the change in LysRS2 is so deleterious that the level of Lys- tRNALys synthesis is compromised the cell does not survive or at best grows slowly. The most deleterious effect of the active site variants was observed with E240Q and E278D, for which complementation was not observed. The mutation E278D was detrimental for aminoacylation activity in vitro, with a kcat/KM for Lys 3 orders of magnitude lower than
the wild type LysRS2. The severe loss in catalytic efficiency was reflected in impaired
cell growth, presumably because Lys-tRNALys was not produced at adequate levels to
support translation. E240Q displayed the lowest kcat in aminoacylation and activation,
again impacting viability via inadequate Lys-tRNALys synthesis.
The other LysRS2 variants were able to grow in rich media liquid culture (LB)
and in MM supplemented with 2 mM Lys. The doubling time of cells in rich media
varied according to the effect of the replacements on the LysRS2, while in MM the
doubling time of the cells did not differ significantly. Y280F and F426W presented the
longest delay in cell growth compared to wild type on LB. F426W also displayed the
slowest doubling time in rich media (111 min), a little more than double that of wild type
(Table 2.4). In MM, most of the LysRS2 variants showed an increase in their doubling
time and also presented a delay in growth (Fig. 2.5.B and Table 2.4). However, Y280F
and F426W behaved similarly on rich and MM, clearly indicating that these
corresponding enzymes’ activities were the limiting step in cell growth. The same
principle is not true for the cells harboring the other LysRS2 variants, which had different
responses with the various media. In MM, glucose was the limiting carbon and energy
84 source, causing the cells to turn on biosynthetic pathways for precursors (amino acids,
nucleosides etc.) as well as regulators of cell processes and stress regulons, which in
return slower cell growth. In rich media, the presence of glucose and precursors
guaranteed a good source of carbon and energy, allowing the cells to down regulate many
biosynthetic pathways and increase the level of protein synthesis allowing rapid cell
growth (178). The observed delay in cell growth in MM compared to growth in LB for
the LysRS2 variants correspond to their enhanced inability of procude Lys-tRNALys.
Growth rates with the inhibitor AEC, which should inhibit LysRS2 unless the variant confers some resistance to the cell, were tested for 6 viable variants with elevated
Kis for AEC (G216A, Y280F, Y280S, F426H, F426W and E428D). However, only
Y280F and F426W were able to confer resistance to AEC concentrations higher than
5 µM. According to the in vitro studies, AEC resistance in activation step increased four-
fold for Y280S variant, while F426H was 20-fold more susceptible to AEC inhibition
than wild type. In vivo, these two variants presented some mild resistance to AEC at up to
5 µM, while cells harboring Y280F and F426W were able to grow in AEC concentrations
up to 100 and 500 µM, respectively. The resistance acquired by these two point mutations surpasses the concentration required to inhibit wild type LysRS2 and the other variants by 20-100-fold. The lack of correlation between the in vitro and in vivo characterizations suggest different mechanisms of AEC resistance may account for the behavior of Y280F and F426W in the cell.
85 2.4.7. The AEC resistance mechanism achieved by LysRS2 variants
Determining the possible AEC resistance mechanisms conferred by Y280F and
F426W required attempting to further enhance resistance in the corresponding
backgrounds. Despite random mutagenesis of the plasmids that encode the resistant
variants and selection at a higher concentration of AEC (2 mM), none of the isolated
colonies presented any extra mutations within the LysRS2 coding region. A possible
explanation for this result is that the level of protein production had been altered for the
new mutants. The immunobloting analysis indicated a decrease in expression for Y280F
in the presence of AEC, while the mutant Y280F4 showed almost the same level of expression in all the media. F426W immunobloting indicated an increase in expression on media with AEC when compared to the other media; however, the level of expression for mutant F426W6 was almost the same in all media.
Although down regulation of LysRS2 variant expression could potenally confer further resistance against AEC, the mechanism of resistance achieved by Y280F and
F426W appears to be different. The possible resistance mechanism achieved by Y280F stems from loss of a H-bond interaction in the back of the active site between the ε-NH2
from Lys and Glu240, resulting in a slower enzyme, which required a longer time to
accommodate the substrate (Fig. 2.12). AEC is likely excluded from the active site during
these slower conformational changes and the accompanying H-bond interactions,
86
A B
Phe280 Tyr280 Glu428 Glu428
Phe426 Trp426
Glu240 Glu240
Glu278 Glu278 Asn424 Asn424 Gly216 Gly216
Figure 2.12. Model of L-lysine recognition by LysRS2 variants Y280F and F426W. A. Model for the binding of Lys to the LysRS2 variant Y280F. B. Model for the binding of Lys to the LysRS2 variant F426W. Residues were modified appropriately, and the resulting structures energy minimized using Swiss-Pdb Viewer v 3.7. The resulting models were visualized using PyMOL (124). H-bonds are shown as dashed lines. For the substrate Lys the carbon backbone is cyan, while the LysRS2 active site residues carbon backbone is in gold. Oxygen and nitrogen are colored red and blue, respectively, for enzyme and substrate.
which need to occur in Y280F in order to allow correct positioning of the substrate for the activation step. The slow discrimination of the substrate as a limiting step is supported by the lack of difference in doubling time when grown in LB and MM. The limiting step for cell growth is the activity of Y280F, thus in media without AEC,
LysRS2 overproduction is observed as an attempt to maintain sufficient Lys-tRNALys synthesis. However, when the media contains the inhibitor AEC, the down-regulation of
Y280F is important to promote quality control and avoid the infiltration of the genetic code. The constitutive down-regulation of Y280F obtained in Y280F4 variant
87 corroborates the idea that slower activity can promote better Lys discrimination (Fig.
2.13.A). There is, however, a threshold of how much slower the enzyme can perform
without compromising cell viability to a level where cell growth cannot be sustained, as observed for E278D and E240Q, which were not able to complements the deletion strain
PAL∆S∆UTR.
The possible resistance mechanism achieved by F426W involves the
accommodation of ATP in the active site. The insertion of a bulky hydrophobic residue in
the active site of LysRS2 probably expanded the size of the Lys binding site to an extent
that disrupted ATP binding, which is consistent with the in vitro data (Tabel 2.1).
Reduced ATP binding may slow enzyme activity enough to allow the correct selection of
Lys instead of AEC due to constrains in geometry, which would require further active
site rearrangement. The size and geometry of Lys and AEC are slightly different due to
the sulfur atom replacement of the γ-carbon in AEC. The resistance mechanism achieved
by F426W against AEC consists of a slower activation and aminoacylation reactions in
an ATP-dependent manner, which can be observed in the growth curves with different
concentrations of AEC (Fig. 2.6). Once the concentrations of ATP and LysRS2 reach a
certain level, the cells enter log phase independent of AEC concentration. This effect may
also be achieved by giving enough time for the cell to become resistant to AEC by a
different mechanism, such as reduced AEC or Lys over procution. The up-regulation of
F426W is observed by the immunobloting of total cell protein extract, which indicated an
increased concentration of LysRS2 on MM supplemented with AEC compared to MM
alone.
88 A * Lys + ATP + AMP + PiP
Y280F Lys Slow Cell growth Accommodation limiting step X
AEC + ATP X
B * Lys + ATP + AMP + PiP
Lys F426W Slow Accommodation Cell growth limiting step X X AEC + ATP
Figure 2.13. Model of AEC resistance conferred by LysRS2 variants. A. Mechanism of AEC resistance conferred by LysRS2 Y280F variant. The slow accommodation of the active site to bind Lys allows the rejection of AEC from the active site. The limiting step in cell growth is generation of Lys-tRNALys by Y280F, which can be ehnhanced by increasing the concentration of Y280F but causes the loss of AEC resitance. B. Mechanism of AEC resistance conferred by LysRS2 F426W variant. The slow accommodation of the active site to bind ATP allows the rejection of AEC from the active site. The limiting step in cell growth is generation of Lys-tRNALys by F426W, which can be ehnhanced by increasing the concentration of ATP and F426W without loss of AEC resitance. * denotes the substrate which requires slow accommodation by LysRS2 variants.
89 The mutant F426W6 down-regulates the expression of F426W in AEC containing
media, leading to an increase in AEC resistance. Once again, the fine tuning that slows the enzyme activity, promotes quality control by giving the active site time to
discriminate the correct substrate. The F426W resistance mechanism involves ATP
accommodation in the active site, and no other LysRS2 variant had interfered with ATP
binding (Fig. 2.13.B). The slower accommodation mechanism may also contribute to
LysRS1 resistance against AEC, since this enzyme shows a reduced activity compared to
LysRS2.
2.4.8. Divergent mechanisms of substrate discrimination in LysRS1 and LysRS2
The evolution of two unrelated structures known to perform the same reaction is
so far limited to LysRS among the aaRSs. We previously proposed that the active site of
LysRS2 is more open and therefore, able to accommodate Lys analogues more easily
than LysRS1. Our present findings support this suggestion and indicate in more detail
how this impacts the potential for LysRS2 to discriminate certain non-cognate amino
acids. For example, replacements of F426 were designed with the intention of mimicking
analogous residues in the LysRS1 active site, and were initially expected to improve
rather than lessen specificity, as was in fact observed. The F426H replacement had
significant effects on cognate and non-cognate amino acids binding, indicating that
introduction of the imidazole ring may have resulted in electrostatic repulsion of
substrates. More generally, our data indicate how insertion of a positive charge in the
active site of LysRS2 disrupts substrate binding and similarly how the removal of
negative charge (as in the E→Q replacements) diminishes catalytic capacity. A similar
90 pattern was also observed during evaluation of the closely related AspRS active site (20),
where insertion of a negatively charged residue disrupts interactions with the substrate
aspartic acid. In the case of yeast AspRS, the key residue is Arg485, which corresponds
to E428 in E. coli LysRS2. To achieve its selectivity and specificity, AspRS relies on a
positively charged active site to interact with aspartic acid and we can now conclude that
the active site architecture of LysRS2 is also reliant on electrostatic interactions for
function.
The kinetic data for LysRS1 W220 and Y269 variants indicated these two
residues do not play important roles in Lys binding, but rather form the active site
scaffold for interactions with ATP and tRNA. In the LysRS2 structure, Lys binding is
mainly based on a complex hydrogen-bonding network and is much more robust (127), as also indicated by biochemical studies (28). The use of electrostatic interactions and hydrogen-bonds in LysRS2 leads to tight Lys binding when compared to LysRS1, and
since the Lys binding network is more extensive, any single mutation in the LysRS2
active site does not cause as dramatic a change in the catalytic efficiency, as is observed
in LysRS1 variants. There is only one LysRS2 replacement (E278D) that causes a
reduction of over 1000-fold in kcat/KM for Lys compared to wild-type, and changes in the
active site at the other 7 residues interacting directly with Lys lower catalytic efficiency
considerably less. The crystal structure of P. horikoshii LysRS1 implicates only 4
residues (E43, H241, T31, G29) that could play important roles in Lys binding. Since
fewer residues in the active site of LysRS1 are directly involved in binding and
discrimination of Lys, any non-conservative replacement of these residues can cause
severe decreases in catalytic efficiency. The Lys binding network in LysRS1 takes
91 advantage of the specific size and positioning of the substrate in the active site with two
distinct sides; polar hydrogen-bond interactions with the functional groups of Lys
positioned on one side and hydrophobic interactions with the Lys backbone on the other.
This dual interaction contributes to the difference in discrimination sensitivity of Lys
analogues by excluding larger analogues such as AEC. The same mechanism is not
observed in LysRS2, which efficiently screens for hydrogen-bond interactions within a
larger active site, thereby allowing inhibition by AEC.
Finding the balance between activity and selectivity allowed the discovery of
LysRS2 variants that can sustain cell survival and confer resistance to AEC. Noticeably,
the level of resistance achieved by the Y280F and F426W variants was further extended
to concentrations higher than the AEC Ki for LysRS1 upon down-regulation of protein
expression levels. However, cell growth was compromised to a point where Lys-tRNALys product formation became the rate limiting step.
Attempts to explain the evolutionary role of two unrelated LysRSs belonging to class I and class II initially focused on identity elements of the tRNA since this is the largest and potentially most diverse molecule that the two LysRSs have to discriminate.
However, the subtle differences in tRNALys discrimination in vitro between LysRS1 and
LysRS2, with a G-U wobble in the second base pair of the acceptor stem being an anti-
determinant for LysRS2, were not significant in vivo. Subsequent analyses of Lys
analogues demonstrated in vivo and in vitro that the evolutionary pressure to retain two
forms of LysRS likely arose to avoid infiltration of the genetic code by these near-
cognate amino acids. The mechanisms of Lys recognition and discrimination by both
enzymes are sufficiently different that to convert the active site of LysRS2, which is more
92 catalytically efficient, into a more selective site, as found in LysRS1, required lowering the catalytic efficiency to make Lys-tRNALys synthesis one of the limiting steps in cell growth rate. These findings clearly indicate that the continued evolutionary retention of the less efficient class I form of LysRS is a result of the higher substrate specificity, offered by the class I active site, compared to LysRS2.
93 CHAPTER 3
THE BIOLOGICAL ROLE FOR THE CO-EXISTENCE OF LYSRS1 AND
LYSRS2
3.1. Introduction
The fidelity of ribosomal protein synthesis depends on two key events: the
matching of mRNA codons with the corresponding tRNA anticodons and the
aminoacylation of these tRNAs with the correct amino acid. The aminoacylation of
tRNAs with their cognate amino acids is catalyzed by the aaRS protein family, whose
accuracy is critical in defining the genetic code (5). Among the aaRSs, there exist two
structurally unrelated groups known as class I and class II (7;8;13). Structural, functional
and genomic analyses have shown that aaRSs of particular specificity are consistently found as members of one or the other of these classes, regardless of their source organism. It was initially assumed that the essential function of aaRSs would lead to their conservation as a family with little evolutionary variation. Comparative genomics has instead shown widespread divergence in aminoacyl-tRNA synthesis (179).
94 This includes the replacement of certain aaRSs by indirect pathways (125), aaRS
specificities for non-canonical amino acids such as pyrrolysine and phosphoserine
(107;180), highly diverged aaRS orthologs (112), and paralogs that may function outside
of protein synthesis (181;182).
Two pathways synthesize lysyl-tRNALys, each of which employs an unrelated
LysRS. LysRS1 is a class I aaRS found in archaea and bacteria, while LysRS2 is a member of the class II aaRSs and present mainly in bacteria and eukaryotes (122).
LysRS1 and LysRS2 are not normally found together within one organism, and each form of the enzyme is resistant to inhibition by particular Lys analogues (127;128) (see
Chapter 2). From the more than 250 publicly available genome sequences, the only instances where both LysRS1 and LysRS2 are found together are the Methanocarcineae in the archaea and certain Bacilli among the bacteria. Methanosarcina barkeri LysRS1 and LysRS2 can together aminoacylate the rare tRNAPyl species, although the role of this
activity remains unclear (176;183). In the pathogen Bacillus cereus, both forms of LysRS
are also encoded, but genome sequence analysis does not identify tRNAPyl or any other
components of the pyrrolysine insertion pathway (184;185). To investigate what role the
two LysRSs might play in B. cereus, we investigated their RNA substrate specificities.
This revealed that they are able to act together, but not separately, to aminoacylate a
previously uncharacterized species named tRNAOther.
95 3.2. Materials and methods
3.2.1. Lysyl-tRNA synthetase purification
The lysK (encoding LysRS1) and lysS (encoding LysRS2) genes previously cloned into the pET15b vector (Novagen, Madison, WI) were used for this work (122).
Epicurian coli BL21-CodonPlus (DE3)-RIL (Stratagene, La Jolla, CA) transformants were grown at 37 °C in LB supplemented with ampicillin (100 µg/ml) and chloramphenicol (34 µg/ml) to a cell density of OD600 = 0.6. The expression of the
recombinant proteins was then induced by IPTG (isopropyl-β-D-thiogalactopyranoside,
final concentration of 1 mM) for 3 h at 37 °C. The cells were harvested by centrifugation
and washed with phosphate-buffered saline; this and subsequent steps were performed at
4 °C. The cell paste for each overexpressed protein was resuspended in lysis buffer
(50 mM Na2H2PO4 [pH 7.4], 300 mM NaCl, 5 mM 2-mercaptoethanol and protease
inhibitor [Hoffmann-La Roche Inc., Nutley, NJ]) and sonicated for 10 cycles of 30 s. The
cell extracts were obtained by ultracentrifugation at 40,000 xg for 1 h and subsequently
loaded onto a Ni-NTA agarose column (Qiagen, Valencia, CA) according to the standard
procedure. The proteins were eluted with lysis buffer containing 750 mM imidazole. The
fractions containing the proteins were pooled and the elution buffer was exchanged on a
PD-10 column (Amersham Biosciences, Piscataway, NJ) for 20 mM Hepes (pH 7.2),
1 mM MgCl2, 10 mM NaCl, 5 mM DTT and 20 mM Tris-HCl (pH 7.5), 1 mM MgCl2,
10 mM NaCl, 5 mM DTT for LysRS1 and LysRS2, respectively. The proteins were then
separately applied to a 6 ml UnoS column (BIO-RAD, Hercules, CA), developed in a 0-
500 mM NaCl gradient and the fractions containing solely His6-LysRS1 or His6-LysRS2
(as judged by Coomassie blue staining after SDS/PAGE) were pooled, concentrated by
96 ultrafiltration, and stored in 100 mM HEPES (pH 7.2), 10 mM MgCl2, 30 mM KCl and
5 mM DTT at –80 °C.
Genomic DNA from B. cereus strain 14579 was used as template for amplification of lysK (encoding LysRS1), lysS (encoding LysRS2) and trpS-1 and trpS-2
(encoding TrpRS1 and TrpRS2 respectively), genes. Primers were designed to generate a product flanked by NdeI and SapI sites for lysS, NdeI and BamHI sites for lysK, and NdeI and EcoRI sites for trpS genes. PCR was carried out using Pfu DNA polymerase
(Stratagene) and the product cloned into TOPO-TA blunt end (Invitrogen). The genes were sequenced with two times coverage. Subsequently, the lysS gene was excised and inserted into the pTYB1 vector to allow production of a LysRS2-intein fusion protein
(IMPACT System, New England Biolabs). The lysK gene was excised and inserted into the pET-15b vector (Novagen, Madison, WI) to allow production of His6-tagged LysRS1.
The B. cereus lysS encoded LysRS2 cloned into the pTYB1 vector was produced in E. coli BL21 cells. Transformants were grown at room temperature in LB supplemented with ampicillin (100 µg/ml) to cell density OD600=0.6. Expression of lysS was induced by IPTG (1 mM) for 16 h at room temperature. Subsequent steps were performed at 4 oC. Cells were harvested by centrifugation and washed in column buffer
(20 mM Tris-HCl [pH 8.0], 500 mM NaCl, 1 mM MgCl2, 10 % glycerol). Cells were suspended in column buffer supplemented with protease inhibitor cocktail (Hoffman-La
Roche), passed through a french pressure cell, and then centrifuged at 20,000 xg for
30 min. The resulting supernatant was loaded onto a chitin affinity column (New England
Biolabs) according to the manufacturer’s instructions. Protein was eluted from the chitin affinity column in a buffer of 50 mM Tris-HCl (pH 8.0), 1 mM MgCl2, 50 mM NaCl,
97 10 % glycerol and 10 mM 2-mercaptoethanol. The fractions containing LysRS2 (judged
to be >99 % pure by Coomassie blue staining after SDS/PAGE) were pooled,
concentrated by ultrafiltration using Amicon Ultra-15 (30,000 MW) (Millipore), dialyzed against storage buffer (50 mM Tris-HCl [pH8.0], 1 mM MgCl2, 10 % glycerol, 10 mM
2-mercaptoethanol), and stored at -80 oC. The B. cereus lysK encoded LysRS1 cloned
into the pET-15b vector was produced in E. coli BL21 (Stratagene, La Jolla, CA).
Transformants were grown at 37 °C in LB supplemented with kanamycin (40 µg/ml) to a
cell density of OD600 = 0.6. The expression of the recombinant proteins was then induced
by IPTG (1 mM) for 3 h at 37 °C. The cells were harvested by centrifugation and washed with phosphate-buffered saline; this and subsequent steps were performed at 4 °C. The cells were suspended in lysis buffer (50 mM Na2H2PO4 [pH 7.4], 300 mM NaCl, 5 mM
2-mercaptoethanol and protease inhibitor cocktail [Hoffmann- La Roche]), passed
through a french pressure cell and centrifuged at 20,000 xg for 30 min. The cell extract
was loaded onto a Ni-NTA agarose column (Qiagen), according to the standard
procedure. The proteins were eluted with lysis buffer containing 250 mM imidazole. The
fractions containing the proteins were pooled and the elution buffer was exchanged on a
PD-10 column (Amersham Biosciences) for 20 mM HEPES (pH 7.2), 20 mM MgCl2,
50 mM KCl and 5 mM DTT. The LysRS1 protein (judged to be >99 % pure by
Coomassie blue staining after SDS/PAGE) was pooled and concentrated by ultra filtration using Amicon Ultra-15 (30,000 MW) (Millipore) and stored at -80 oC. The
protein concentrations of LysRS1 and LysRS2 were determined using the Bradford
procedure (BioRad, Hercules, CA).
98 3.2.2. Tryptophanyl-tRNA synthetase purification
Genomic DNA from Bacillus cereus strain 14579 was used as template for
amplification of the trpS-1 (encoding TrpRS1) and trpS-2 (encoding TrpRS2) genes.
Primers were designed to generate products flanked by NdeI and EcoRI sites for trpS-1
and trpS-2. PCR was carried out using Pfu DNA polymerase (Stratagene) and the product
was cloned into TOPO-TA blunt end (Invitrogen). The gene was sequenced with two
times coverage. The trpS genes were excised and inserted into the pTYB12 vector to
allow production of a TrpRS-intein fusion protein (IMPACT System, New England
Biolabs).
B. cereus trpS-1 and trpS-2 cloned into the pTYB12 vector were over expressed
in E. coli BL21 cells. Transformants were grown at room temperature in LB
supplemented with ampicillin (100 µg/ml) to cell density OD600 =0.6. Expression of
trpS-1 and trpS-2 were induced by IPTG (1 mM) for 16 h at room temperature.
Subsequent steps were performed at 4 oC. Cells were harvested by centrifugation and
washed in column buffer (20 mM Tris-HCl [pH 8.0], 500 mM NaCl, 1 mM MgCl2 and
10 % glycerol). Cells were resuspended in column buffer supplemented with protease inhibitor cocktail (Hoffman-La Roche), passed through a french pressure cell, and then centrifuged at 20,000 xg for 30 min. The resulting supernatant was loaded onto a chitin affinity column (New England Biolabs) according to the manufacturer’s instructions.
Protein was eluted from the chitin affinity column in a buffer of 50 mM Tris-HCl (pH
8.0), 1 mM MgCl2, 150 mM NaCl, 10 % glycerol and 20 mM 2-mercaptoethanol. The
fractions containing TrpRS (judged to be >99 % pure by Coomassie blue staining after
SDS/PAGE) were pooled, concentrated by ultrafiltration using Amicon Ultra-15
99 (Millipore), dialyzed against storage buffer (50 mM Tris-HCl [pH 8.0], 1 mM MgCl2,
150 mM NaCl, 10 % glycerol and 10 mM 2-mercaptoethanol), and stored at -80 oC. The protein concentrations of TrpRS1 and TrpRS2 were determined using the Bradford procedure (BioRad, Hercules, CA).
3.2.3. Preparation of unfractionated small RNAs
B. cereus strain 14579 was grown overnight in 4 l of LB at 30 oC, the cells were
centrifuged at 10,000 xg for 10 min at 4 oC and resuspended in 40 ml of extraction buffer
(20 mM Tris-HCl [pH 7.5], 20 mM MgOAc2) at 4 °C (all further purification steps were
performed at 4 oC), passed through a french pressure cell 3 times and extracted with
40 ml of phenol (pH 6.6). After agitation (2 h) and centrifugation for 10 min at 5,000 ×g,
the aqueous phase was removed. The aqueous phase was extracted twice with phenol and
once with chloroform. DNA was removed from aqueous solution by addition of 1 M
NaCl and precipitation with 20 % (v/v) 2-propanol overnight at 4 oC and centrifugation for 15 min at 5,000 ×g. The supernatant was adjusted to 60 % (v/v) 2-propanol and after a
15 min incubation at room temperature, the total nucleic acids were harvested by centrifugation for 20 min at 5,000 ×g. The pellet was washed with 70 % ethanol, resuspended in 6 ml 0.2 M Tris-OAc (pH 9.0) and incubated at 37 oC for 30 min. The
total tRNA extracted was then precipitated with 100 % ethanol, and washed with 70 %
ethanol and resuspended in 2 ml water. The final nucleic acid concentration was then
determined spectrophotometrically (A260 nm).
100 3.2.4. In vitro transcription of the tRNAOther, tRNALys, and tRNATrp genes
tRNAOther, tRNALys and tRNATrp were cloned into pUC18 using BamHI and
HindIII restriction sites. The transcription templates were digested for 5 h with BstNI at
60 °C. In vitro T7 RNA polymerase run-off transcription was conducted according to
standard procedures (186). tRNAOther, tRNALys, and tRNATrp transcripts were purified on
a Q Superdex column using a NaCl gradient in 10 mM HEPES (pH 7.3) and 7 M urea.
The fractions containing transcripts (determined by electrophoresis on a 12 % denaturing
polyacrylamide gel) were pooled and the buffer exchanged in a PD-10 column
(Amersham) to 10 mM HEPES (pH 7.3). Transcripts were ethanol precipitated and
suspended in 10 mM HEPES (pH 7.3) and then refolded (186).
3.2.5. Immunoblotting analysis
B. cereus strain 14579 was grown in 500 ml of LB at 30 oC, and 50 ml samples
were taken at different time points during growth. Cells were centrifuged at 6,000 xg at
4 oC for 15 min and resuspended in 5 ml of sample buffer (100 mM Tris HCl [pH 7.5],
20 mM MgCl2, 1 mM EDTA and protease inhibitor cocktail [Hoffmann-La Roche Inc.] ).
Cells were then sonicated for 5 cycles of 15 s and centrifuged at 30,000 xg for 30 min at
4 oC. Cell extracts were concentrated in dialysis bags covered with PEG 20,000 MW
overnight at 4 oC. Protein concentration was determined by the Bradford method. Cell
extract (20 µg of protein) was separated on 10 % SDS/PAGE gels and then blotted onto
nitrocellulose membranes. LysRS1 and LysRS2 were visualized by chemiluminescence
using primary rabbit antibodies (raised against LysRS1 from B. cereus and against
LysRS2 from E. coli) and horseradish peroxidase conjugated secondary antibodies.
101 3.2.6. Aminoacylation inhibition in archaea
Aminoacylation assays were performed at 37 °C in 100 mM HEPES (pH 7.2),
14 50 mM KCl, 10 mM MgCl2, 5 mM ATP, 5 mM DTT, 30 µM [ C]-Lys (310 µCi/µmol;
Perkin Elmer Life Sciences, Boston, MA), 1 mg/ml of unfractionated tRNA or 2 µM of transcript or native tRNAPyl and 1.6 µM of each enzyme. For the reactions performed
with both enzymes together, the reactions were incubated for 5 min on ice with LysRS1 and then for 5 min with LysRS2 without amino acid. For reactions performed with only one of the enzymes, the reactions without the amino acid were incubated for 5 min on ice with the respective enzyme. All reactions were started by addition of the amino acid and
AEC.
3.2.7. Aminoacylation assays with B. cereus LysRSs
Aminoacylation assays were performed at 37 °C in 100 mM HEPES (pH 7.2), 50
14 mM KCl, 20 mM MgCl2, 5 mM ATP, 5 mM DTT, 30 µM [ C]-Lys, 1 mg/ml of
unfractionated RNA or 5 µM of in vitro transcribed tRNAOther, and 1 µM LysRS1 and/or
50 nM LysRS2. The reactions were first incubated for 5 min on ice with LysRS1 and/or
LysRS2 without amino acid. All reactions were started by addition of the amino acid and
10 µl aliquots were spotted onto 3MM filter disks presoaked in 5 % TCA (w/v) containing 0.5 % (w/v) [12C]-Lys. Sample disks were washed three times in 5 % TCA
(w/v), dried and radioactivity counted. For Lys KM determination, all the concentrations
were fixed but [3H]- Lys was added at concentrations varying between 0.2 and 5 times
KM. Aliquots of 10 µl were taken every 15-60 s and spotted onto 3MM filter disks
presoaked in 5 % TCA (w/v) containing 0.5 % (w/v) [12C]- Lys. 102 3.2.8. Aminoacylation assays with TrpRSs
Aminoacylation assays were performed at 37 °C in 100 mM HEPES (pH 7.2), 25
3 mM KCl, 20 mM MgCl2, 5 mM ATP, 5 mM DTT, 50 µM [5- H]-Trp (27 Ci/mol;
Amersham Biosciences UK Limited), 10 µM of in vitro transcribed tRNATrp or
tRNAOther, and 50 nM TrpRS. The reactions were first incubated for 5 min on ice with
TrpRS and without amino acid. All reactions were started by addition of the amino acid
and aliquots spotted onto 3MM filter disks presoaked in 5 % TCA (w/v) containing
0.05 % (w/v) [12C]-Trp. Sample disks were washed three times in 5 % TCA (w/v), dried
and radioactivity counted. For Trp KM determination, all the concentrations were fixed
3 but [ H] -Trp was added at concentrations varying between 0.2 and 5 times KM. Aliquots
of 10 µl were taken every 15-60 s and spotted onto 3MM filter disks presoaked in 5 %
TCA (w/v) containing 0.5 % (w/v) [12C]-Trp.
3.2.9. Isolation and characterization of chargeable tRNA species by EF-Tu affinity
chromatography
Total tRNA (10 mg) from B. cereus was charged with 2 mM Lys in the presence
of LysRS1 and LysRS2 for 20 min. Aminoacylated RNA species were purified using a
Thermus thermophilus EF-Tu column as described (187). The eluate was deacylated and
separated by 2D denaturing gel electrophoresis. Five bands were extracted and ethanol
precipitated. RNA species (300 ng) were ligated with 40 pmol of oligonucleotide O1 (5′
AGGATCCTGCAGGCTCTTCC 3′, 5′ phosphorylated and 3′ blocked with dideoxy cytosine) using 20 u of T4 RNA ligase (New England BioLabs). Anchored tRNAs were reverse transcribed (RT) using oligonucleotide O1(-), (complementary to O1) and
103 Superscript Reverse Transcriptase II (Invitrogen) as described before (188). The product was digested with RNase H and RNase A (Invitrogen), phenol and chloroform extracted and ethanol precipitated. Single stranded cDNA was ligated with 40 pmol of oligonucleotide O2 (5′ GTAAGCTTAATACGACTCACTATAG 3′, 5′ phosphorylated and 3′ blocked with dideoxy cytosine) using 20 u of T4 RNA ligase. After phenol and chloroform extraction, the DNA was ethanol precipitated and PCR was performed using oligonucleotides O1 (-) and O2 (-) (complementary to O2). The PCR product was separated in a 2.5 % agarose gel and fragments between 60 and 180 nucleotides were gel extracted, cloned into TOPO-TA blunt end (Invitrogen) and sequenced.
3.2.10. Acid urea gel electrophoresis of RNA and aminoacyl-tRNA
Unfractionated B. cereus small RNAs and tRNAOther transcript were aminoacylated with Lys (by B. cereus LysRS1, LysRS2, or both enzymes together) or with Trp (by TrpRS1 and TrpRS2 separately) as described above. The reaction was stopped with 1 volume of 0.3 M NaOAc (pH 4.5), 10 mM EDTA. After phenol (pH 4.3) and chloroform extraction followed by ethanol precipitation, the aminoacyl-tRNAs were dissolved in 2 × loading buffer (7 M urea, 0.3 M NAOAc [pH 4.5], 10 mM EDTA, 0.1 % bromophenol blue, 0.1 % xylene cyanol) and loaded on a 6.5 % polyacrylamide gel (50 ×
32 cm, 0.4 mm thick) containing 7 M urea, 0.1 M NaOAc (pH 5.0), and run at 4 °C, 16 watts in 0.1 M NaOAc (pH 5.0) for 16 h. Detection of the RNAs was performed by blotting and hybridization. The portion of the gel containing the tRNAs was electroblotted onto a Hybond N+ membrane (Amersham Biosciences) using a Hoefer electroblot apparatus (Amersham Biosciences) at 20 V for 20 min and then at 40 V for
104 2 h with 10 mM Tris-OAc (pH 8.0), 5 mM sodium acetate, and 0.5 mM Na-EDTA as transfer buffer. The membranes were baked at 80 °C for 2 h. The tRNAs were detected by hybridization with 5′ [32P]-labeled oligonucleotide probes. The probes were
complementary to nucleotides 56-76 of tRNAOther, 26–46 of tRNALys and 30-50 of
tRNATrp.
3.2.11. Gel electrophoresis of RNA after oxidation with periodate
Unfractionated B. cereus small RNAs and in vitro transcribed tRNAOther were
aminoacylated with Lys (by B. cereus LysRS1, LysRS2, or both enzymes together) as
described above. The reaction was stopped by the addition of sodium periodate at a final
concentration of 40 mM. The tubes were kept on ice in the dark for 1 h and the oxidation reaction was terminated by addition of glucose (330 mM final concentration) followed by
30 min on ice in the dark. The RNA was then ethanol precipitated and suspended in
200 µL of 1 M Lys and incubated at 45 oC for 1 h. After ethanol precipitation, the RNA
was dissolved in 2 × loading buffer and loaded on an 8 % polyacrylamide gel (50 × 32
cm, 0.4 mm thick) containing 7 M urea, 1 x TBE and run at 80 watts in 1 x TBE for 2 h.
Detection of the tRNAs was performed by blotting and hybridization as described above.
3.2.12. RNA extraction and RT-PCR
Different growth phase cells at OD600=0.5 (1 h), OD600= 1.6 (2 h), OD600=6.0
(10 h), OD600= 6.7 (13 h) were harvested, the cell pellet was suspended in 0.5 ml 10 mM
Tris-HCl [pH 7.5], 1 mM EDTA, mixed with 0.3 ml glass beads and snap frozen in an
ethanol/dry ice bath. Phenol (0.5 ml, pH 6.6) was added to each tube and the cells were
105 disrupted by vortexing (4 x 30 s pulses), centrifuged at 10,000 xg for 5 min and the
aqueous layer was collected. This extraction was repeated once with phenol and once
with chloroform. The RNA was then ethanol precipitated, and the pellet was suspended
in 50 µl water. The DNA was digested with 10 u of DNase I (Invitrogen) and incubated
at room temperature for 30 min. The reaction was stopped with the addition of 2.5 mM
EDTA, DNase I was heat inactivated. The RNA was phenol:chloroform extracted,
ethanol precipitated, resuspended in 70 µl of water and quantitated spectrophometrically.
RT-PCR was performed with 15 µg of total tRNA extract from each growth phase. Total
tRNA was annealed with 1 µM of oligonucleotide complementary to the 3’ end of
tRNAOther and 1 mM of dNTPs. The mixture was heated at 80 oC for 2 min followed by
incubation at 50 oC for 15 min. To the mixture were added 10 mM DTT, first strand
buffer, 200 u Superscript Reverse Transcriptase II (Invitrogen) and 20 u of RNAsin
(Promega). The tRNAOther was reverse-transcribed at 50 oC for 35 min. The PCR was
performed upon addition of another 1 µM of 3’ end oligonucleotide, 2 µM of 5’ end oligonucleotide, Pfu buffer, 0.3 mM dNTPs and 5 u of Pfu, final concentrations, to the
RT mixture. The PCR reaction was 25 cycles of 94 oC for 30 s, 55 oC for 1 min and 72 oC
for 1 min, and 1 cycle at 72 oC for 10 min. The product of RT-PCR was visualized on a
2.5 % agarose gel stained with ethidium bromide.
3.2.13. In vitro and in vivo transcription of tRNAOther variants
tRNAOther mutants were cloned into pUC18 using BamHI and HindIII restriction
sites and contained a BstNI site for run-off in vitro transcription. The tRNAOther mutants
were generated by the oligonucleotide annealing techinique with specific pairs of
106 oligonucleotides for each mutation inserted. Mutations are numbered as tRNAOther1
(C66U), tRNAOther2 (A7G), tRNAOther3 (A10G), tRNAOther4 (C25U), tRNAOther5 (C31U), tRNAOther6 (A39G), tRNAOther7 (G2U), tRNAOther8 (A71C), tRNAOther9 (A71U),
tRNAOther10 (C34U), tRNAOther11 (G37A), and tRNAOther12 (G16A) indicated in Fig. 3.8.
In vitro transcription of tRNAOther mutants was performed as described in section 3.2.4.
For in vivo transcription of tRNAOther and mutants, the tRNAOther was cloned into vector
pKK223-3 (ptac promoter) (189) into NdeI and HindIII site after reconstruction with oligonucleotides pKK-bcother3 (5’TATGGATGGGGGTATAATTTAAGGGT3’) at the
5’end and pKK-bcother10 (5’AGCTTTTGAATTTGGAGTGGATGGC3’) at the 3’end of the gene and their complementary primers. After transforming into DH5α cell, plasmids were sequenced and a PCR using the primers pKK-S (5'-
TCTAGACCGGCGTAGAGGATCCGGGC-3') and pKK-SA (5'-
TCTAGAAACGCAAAAAGGCCATCCGTCA-3') was used to amplify the tRNAOther
sequence together with the promoter, terminator and tRNA processing sequence. The
amplified product was digested with XbaI and cloned into the vector pSU2719 (190). The
resulting plasmid pSU-bcotherWT was sequenced and transformed into DH5α cells for
over expression. The tRNAOther mutants were made by mutagenic PCR with the plasmid
pSU-bcotherWT using pairs of complementary oligonucleotides with the desired
changes. Plasmids were sequenced and transformed into DH5α cells for overexpression.
The overexpression of tRNAOther and mutants was performed by growing DH5α cells containing the plasmids in 1 l of LB supplemented with chloramphenicol (34 µg/ml) to a
o Other cell density of OD600 = 0.6 at 37 C. The expression of tRNA was then induced by
IPTG to a final concentration of 1 mM for 16 h at 37 °C. The cells were harvested by
107 centrifugation and washed with phosphate-buffered saline; this and subsequent steps were
performed at 4 °C. The extraction of unfractionated tRNA from the cells with
overexpressed tRNAOther was performed as described in section 3.3.4.
3.2.14. Aminoacylation and detection of tRNAOther variants
The aminoacylation of the in vitro and in vivo transcribed tRNAOther mutants was
performed as described in section 3.2.7. Time points were taken for each reaction and
spotted on a 3MM filter paper pre-soaked with 5 % TCA and 0.05 % [12C]-Lys, washed
and counted. Unfractionated small RNAs containing in vivo transcribed tRNAOther mutants were aminoacylated with Lys and separated on an acid urea gel for detection of aminoacylated tRNAOther and E. coli tRNALys. As a control, unfractionated small RNAs
from B. cereus 14579 and DH5α harboring empty PSU vector were charged with Lys and
separated on the same gel used for detection of tRNAOther and tRNALys. Each reaction
was performed in triplicate and the northern analysis was performed as described in
section 3.2.10. The tRNAs were detected by hybridization with 5′ 32P-labeled
oligonucleotide probes. The probes were complementary to nucleotides 56-76 of
tRNAOther and 30–50 of E. coli tRNALys.
3.3.Results
3.3.1. LysRS2 catalyzes tRNAPyl aminoacylation in a ternary complex with LysRS1
in Methanosarcina barkeri Fusaro
The roles of Methanosarcina barkeri Fusaro LysRS1 and LysRS2 in the
aminoacylation of tRNAPyl upon formation of the ternary complex was investigated by
108 inhibition of charging. To determine the site of catalysis in the ternary complex, we employed the Lys analogue AEC, which is a selective competitor of Lys during aminoacylation by class II but not class I bacterial LysRSs. In vitro aminoacylation of
M. barkeri Fusaro total tRNA in the presence of 0.25 mM AEC led to an 83 % reduction in LysRS2-catalyzed activity and a 19 % reduction of LysRS1 activity, showing the difference in class-selectivity of the inhibitor for the archaeal aaRSs. When these conditions were then employed to investigate the effect of AEC on the aminoacylation of tRNAPyl, an 82 % reduction in the rate of product formation was observed, which was consistent with catalysis by LysRS2 (Fig.3.1).
10
8 oles)
m 6 (p A
N 4 R 2 Lys-t
0 0 1020304050 Time (min)
Figure 3.1. Inhibition of aminoacylation of in vitro transcribed tRNAPyl. Aminoacylation reactions were performed as described (20 µl samples) by LysRS1 and LysRS2 together in the presence of 0.25 mM AEC (). In control reactions either AEC (●) or tRNAPyl (?) were omitted.
109 3.3.2. Occurrence of LysRS1 and LysRS2 in B. cereus 14579
B. cereus strain 14579, the first sequenced bacterial genome to encode LysRS1 and LysRS2, was the subject of this study, which investigates the possibility that LysRS1 and LysRS2 may function together as in he above archaeal system. To detect if LysRS1 and LysRS2 are present at the same time, an immunoblot analysis was performed on cell extracts from different stages of growth (Fig. 3.2). LysRS1 and LysRS2 were observed during and after exponential growth, but at very different levels. LysRS2 predominated during exponential growth, but its level declined during stationary phase. The appearance of additional cross-reacting species suggests that LysRS2 is modified in stationary phase, although the nature of such modifications is unclear. LysRS1 has the reciprocal profile with a low level during exponential growth that increased substantially during the later
stages of the growth cycle.
anti-LysRS2
anti-LysRS1
12345 6
Figure 3.2. LysRS1 and LysRS2 in B. cereus. Total cell protein (20 µg) was separated by SDS-PAGE, transferred to membranes and detected by using either anti-LysRS1 or anti-LysRS2 polyclonal antibodies. The different growth stages are: OD600=0.5 (1 h, lane 3), OD600= 1.6 (2 h, lane 4), OD600=6.0 (10 h, lane 5), OD600= 6.7 (13 h, lane 6). LysRS1 (0.1 µg, lane 2) and LysRS2 (0.1 µg, lane 1) were loaded as controls.
110
Figure 3.3. Predicted secondary structure of the postulated T-box leader region preceding the B. cereus strain 14579 lysK gene. The leader RNA can be folded into the three stem-loops. * are highly conserved residues flanking Stem I, residues marked in blue, are highly conserved among B. subtilis leaders. Marked in red is the specifier codon (AAA for Lys). Purple and green sequence can form an alternative Stem-loop structure, called anti-terminator (AT) upon the interaction of uncharged tRNALys with specifier codon (in red) and AT bulge (in purple). 111 The genomic contexts of the genes encoding LysRS1 (lysK) and LysRS2 (lysS)
indicate differences in their regulation. lysK is preceded by a canonical T-box with a Lys
specifier codon (Fig. 3.3), a form of regulation found in 14 of the 24 Bacillus subtilis
aaRS genes. The B. cereus lysS gene, instead of a T-box regulon, has the same genomic
context as seen in B. subtilis, being the distal gene in the nine-cistron folate biosynthetic
operon. In B. subtilis expression of this operon is complex with multiple promoters, RNA
processing and RNA stability, contributing to the cellular level of LysRS2 ((191); Brian
C. Jester, and Kevin M. Devine, unpublished results). These differences both in
regulation and production led to a more detailed investigation of the in vitro activities of
the two B. cereus LysRSs.
3.3.3. B. cereus LysRS1 and LysRS2 steady–state kinetics
To investigate possible differences in substrate binding and turnover between the
two enzymes, LysRS1 and LysRS2 (B. cereus 14579) were produced heterologously and
used to lysylate total small RNA extracted from early stationary phase B. cereus cells.
LysRS2 was considerably more active than LysRS1, as 10-fold less enzyme was required
to achieve full aminoacylation under the conditions employed (Fig. 3.4.A). When both
enzymes were used together, the plateau charging level was consistently higher than for
either LysRS alone. Nevertheless, tRNALys was being aminoacylated in all cases (Fig.
3.4.B). This suggested that RNA species in addition to tRNALys may have been aminoacylated in the presence of both enzymes. The LysRS2 kinetic parameters for Lys in aminoacylation of unfractionated small RNA from B. cereus were determined, but the kinetic parameters for LysRS1 could not be obtained due to the high enzyme
112 concentration enzyme needed to charge small RNA from B. cereus. The KM for Lys is
-1 26 ± 2 µM and kcat 0.238 ± 0.006 s . The KM value for B. cereus LysRS2 is 10-fold higher than for E. coli LysRS2, while the kcat is 7-fold lower, indicating that B. cereus
LysRS2 is less active than the E. coli enzyme.
113 A 12
10
8
6
s 4 Ly -tRNA (pmol)
2
0 0 1020304050
Time (min)
B LysRS1 + +++---- LysRS2 ++-- ++--
- OH +++- - - + -
Lys Lys-tRNA UUU
Lys tRNA UUU
Figure 3.4. Lysylation of total tRNA from B. cereus. A. Aminoacylation of total tRNA with [14C]-Lys and 1 µM LysRS1 (■), or 50 nM LysRS2 (•) or both LysRS1 and LysRS2 together (♦). Values shown are the means of three independent experiments, with error Lys bars representing +/- one standard deviation. B. Analysis of tRNA UUU aminoacylation by hybridization against a tRNALys-specific probe. OH- -, no treatment after aminoacylation; OH- +, deacylation with 100 mM Tris-OAc (pH 9.0), at 37 °C for 30 min. Slight reductions in tRNA abundance were routinely observed after deacylation due to the additional sample processing involved compared to untreated samples.
114 3.3.4. Identification of LysRS1:LysRS2 RNA substrates
To identify the RNAs aminoacylated by LysRS1:LysRS2, two separation
procedures were used. After charging RNA from a total pool using the same conditions
as described above (Fig. 3.4.A), aminoacylated species were purified by binding to
immobilized T. thermophilus elongation factor-Tu (187). Aminoacylated species were
eluted and fractionated by 2D-gel electrophoresis, individual species were extracted and finally reverse transcribed to cDNA using the oligonucleotide anchoring technique (188).
The cDNAs were sequenced, and the data was used to search the B. cereus genome. This
identified one species as tRNALys, and the other as the product of a gene of unknown
function, previously annotated as tRNAOther. The secondary fold of tRNAOther, which
contains a Trp anticodon, is unusual and requires non-canonical base pairings to adopt a
canonical fold, perhaps indicating the presence of nucleotide modifications in the native molecule (Fig. 3.5). One other striking feature is the G2:A71 bulge, reminiscent of the
G2:U71 wobble position previously implicated in tRNALys substrate differentiation by
LysRS1 and LysRS2 (36). The aminoacylation of tRNAOther was further investigated in
vivo and in vitro.
115 A
tRNAOther tRNAOther
B C
tRNALys tRNATrp
Figure 3.5. Secondary structure of B. cereus tRNAs. A. The non-canonical structure of tRNAOther as predicted by tRNAScan is shown on the left and an alternative canonical fold on the right. See text for details. Dashed lines indicate putative interactions that may depend on nucleotide modifications. B. Predicted secondary structure of tRNALys. C. Predicted secondary structure of tRNATrp.
116 3.3.5. Expression and aminoacylation of tRNAOther
The presence of tRNAOther during different phases of B. cereus growth was assessed by RT-PCR using RNA extracted at various times. tRNAOther was first detected in early stationary phase and continued to increase into late stationary phase (Fig. 3.6.A).
We then determined whether this correlated with the aminoacylation of tRNAOther in stationary phase. Acidic extraction and separation differentiates aminoacylated tRNA from deacylated tRNAs, with the caveat that aminoacylation at the 3′-end cannot be assumed (see for example (192)). NaIO4 treatment and analysis of aminoacylated samples
confirmed that aminoacylation was indeed occurring at the 3′-end in this case (data not
shown). tRNAOther was aminoacylated throughout stationary phase, but was not produced or charged during exponential phase (Figs. 3.6), mirroring the change in the
LysRS1:LysRS2 ratio from exponential to late stationary phase (Fig. 3.2). Although the amino acid attached to tRNAOther in vivo has yet to be determined, these data are
consistent with aminoacylation with Lys by the concerted action of LysRS1 and LysRS2.
To test this hypothesis, we reconstituted tRNAOther aminoacylation in vitro.
117 A 123 45 150bp -RT +DNAse
50bp
150bp +RT +DNAse 50bp
150bp +RT -DNAse 50bp
B 2 34
OH- ---+++ - +
Lys aa-tRNA UUU
Lys tRNA UUU
aa-tRNAOther tRNAOther
Figure 3.6. Growth-phase dependent expression and aminoacylation of tRNAOther. RNA samples were extracted at OD600= 0.5 (1 h, lane 1), OD600= 1.6 (2 h, lane 2), OD600= 6.0 (10 h, lane 3), OD600= 6.7 (13 h, lane 4). A. RT-PCR from total RNA extracts using primers specific for tRNAOther. Top, negative control; middle, amplification of tRNAOther; bottom, amplification of tRNAOther and the gene that encodes it (lane 5, Lys Other markers). B. Analysis of tRNA UUU and tRNA aminoacylation by hybridization against specific probes. OH- treatments as for Fig. 3.4.
118 3.3.6. LysRS1 and LysRS2 act together to charge tRNAOther
In vitro transcribed tRNAOther was used for lysylation with combinations of
LysRS1 and LysRS2, and aminoacylation was monitored by hybridization (Fig. 3.7.A). tRNAOther was charged with Lys when both LysRSs were present, but not by either
enzyme alone. To further test the specificity of this reaction, in vitro transcribed
tRNAOther was also used as the RNA substrate in aminoacylation time course assays with
LysRS1, LysRS2 and both together (Fig. 3.7.B). In vitro transcribed tRNAOther was a
relatively poor substrate (10 % of the product was aminoacylated), perhaps reflecting the
need for nucleotide modifications to stabilize the unusual secondary structure of this non-
canonical tRNA (Fig. 3.5). Nevertheless, charging of tRNAOther was clearly observed
when LysRS1 and LysRS2 were present, but not with either LysRS alone, supporting the
proposal that both enzymes act together. While the complete lack of activity of in vitro
transcribed B. cereus tRNALys prevents direct comparisons, estimation of the rates of
tRNALys charging by LysRS2 (Fig. 3.4.A) and tRNAOther by LysRS1:LysRS2 (Fig. 3.7.B)
suggests that the canonical tRNALys is by far the more active of the two tRNAs. A similar
pattern was reported for the charging by seryl-tRNA synthetase of tRNASec, which is
about 100-fold less active than the canonical substrate tRNASer (193).
119 A LysRS1 + + --++-- LysRS2 ++++ ---- OH- ---+ + + - +
Lys-tRNAOther tRNAOther
B (pmol) Other Lys-tRNA
Other Figure 3.7. Aminoacylation of tRNA requires both LysRS1and LysRS2. A. In vitro transcribed tRNAOther aminoacylation analyses by hybridization against a specific probe for tRNAOther. OH- treatments are as for Fig. 3.4. B. Aminoacylation of in vitro transcribed tRNAOther with [14C]-Lys with 1 µM of LysRS1 (■), 50 nM of LysRS2 (•) or both LysRS1 and LysRS2 together (♦). The background level of [14C]-Lys detected in the absence of enzyme was ~0.2 pmol.
120 3.3.7. Aminoacylation recognition elements of tRNAOther
The presence of several non-canonical Watson-Crick base pairs in the predicted
secondary strucrure of tRNAOther indicated that editing or modification could play a crucial role in the folding and recognition of tRNAOther. To investigate the possibility of
editing of tRNAOther in B. cereus, RNA samples used for RT-PCR from late stationary phase (OD600 = 6.0) were amplified by RT-PCR and cloned into TOPO-vector.
Sequencing of 50 independent isolated clones resulted in the original sequence coded by
the gene with only one change, a G16A replacement. The apparent absence of editing, or
presence of modifications that could interefere with RT-PCR, and the poor
aminoacylation of the in vitro transcribed tRNAOther suggest a possible role for non-
canonical base-pairing in correct folding and/or recognition by LysRS1:LysRS2.
In order to investigate the role of the different elements present in tRNAOther,
several mutants were constructed to address substrate recognition by the LysRS1:LysRS2
complex (Fig. 3.8). The importance of the three A-C base pairings at the ends of the
acceptor stem, the D stem and the anticodon stem, were investigated with A to G
replacements to generate canonical Watson-Crick base pairs and evaluate the importance
of the A as an identity element. The same principle was used to generate C to U
replacements, allowing the formation of Watson-Crick base pairs and evaluation of the
effect of a C at each position. The role of the bulge created by the G2:A71 pair in the
acceptor stem of tRNAOther was evaluated by replacing the G with U or the A with C,
which allowed the canonical base pairing at the second base pair of the acceptor stem.
Since G-U at the second base pair is a negative determinant for LysRS2 but a positive secondary identity element for LysRS1 (146), the A to U replacement was also made.
121 Other specific elements were also tested as possible identity elements, such as the
replacement of G37 with A, which is a hypermodified base conserved in tRNALys (t6A).
The replacement of C34 with U generated a potential suppressor tRNA, allowing comparison with the LysRS1:LysRS2 complex of Methanosarcina barkeri, which can charge the suppressor tRNAPyl. Also, the G16 to A substitution evaluated the possibility
of editing at the D loop of tRNAOther.
A C C U G C C 8 7 U G A G C U G C 9 2 G U G U A U 1 3 A C U G U U A A A A C G C C C A A 12 G U U U A G G U G G G U C A U U G A A A C A U A U G G C 4 U G U G C G C 5 U C A G 6 C A U G C A A 11 C
U 10
Figure 3.8. tRNAOther mutants. Substitutions made in tRNAOther are indicated by arrows. The red numbering corresponds to the name of the modified variants. Dashed lines correspond to non-canonical Watson-Crick base pairs, full lines indicate Watson-Crick base pairs.
122 In vitro transcribed tRNAOther wild type and mutants were charged with LysRS1,
LysRS2 and with both enzymes together. The charging level was not sufficient to allow
determination of the effect of mutations on tRNAOther directly, consistent with the poor transcript activity previously observed (Fig. 3.7). Given the poor charging levels
displayed by the in vitro transcribed tRNAOther variants, we attempted to improve the charging level by overexpressing the tRNAOther wild type and variants in E. coli and using
the unfractionated small RNAs from the cell as a source of tRNAOther. The detection of
the charged RNA species was performed by Northern analysis, since the level of
tRNAOther and tRNALys could vary for each preparation, and the results could be difficult
to interpret in a conventional filter binding assay. Each membrane was hybridized with probes specific for tRNAOther and exposed, then stripped and probed against E. coli
tRNALys (Fig. 3.9).
The results of the aminoacylation analysis indicated different levels of charging
depending on the substitution in tRNAOther, and there were also variations in the tRNALys
activity in each sample (Fig. 3.9). The presence of a band in the EC sample corresponds
to cross hybridization with E. coli tRNA, and this value was subtracted from the
uncharged species for each sample. The tRNALys probe was specific for the E. coli
tRNALys and is unable to detect B. cereus tRNALys. To account for variations of sample loading, the percentage of aminoacylated species of tRNAOther was divided by the
percentage of aminoacylation of the corresponding tRNALys. To simplify the comparison
with wild type tRNAOther, an increase or decrease in charging was normalized to wild
type values (Table 3.1).
123
Figure 3.9. Charging levels of tRNAOther variants and tRNALys. A. Northern blot detection of aminoacylated tRNAOther by LysRS1:LysRS2. B. Northern blot detection of aminoacylated tRNALys by LysRS1:LysRS2. The tRNA species numbers correspond to mutations in tRNAOther as indicated in figure 3.8. WT corresponds to tRNAOther with no mutations; BC corresponds to unfractionated small RNA from late stationary phase B. cereus; EC corresponds to unfractionated small RNA from E. coli DH5α cells containing empty PSU vector. Blottings and hybridizations were performed in triplicate as indicated in the figure, and the percentage of charged species is an average of 3 independent experiments. After aminoacylation of 50 µg of unfractionated RNA, half of the sample was deacylated as indicated in the figure by OH- (as in Fig. 3.4), and aminoacylated and deacylated RNA (25 µg each) were loaded on the gel per lane. Aminoacylated tRNAs and deacylated tRNAs are indicated by the arrows. ND, not detected.
124
A
tRNA WT 1 2 3 4 56BCEC
- OH - ++- - + - +- + - + - + - + - +
Lys-tRNAOther
tRNAOther
% charged 88+ - 8 25+ - 4 47+ - 6 68+ - 8 71+ - 7 75+ - 6 82+ - 7 48+ - 6 Nd Repeats n=3n=3 n=3 n=3 n=3 n=3 n=3n=3 n=3
tRNA 7 8 9 10 11 12 BC EC
- OH - ++- - + - +- + - + - + - +
Lys-tRNAOther
tRNAOther
% charged 49 - 6 63+ - 4 62+ - 5 71 - 8 67+ - 8 70+ - 3 48 - 6 nd Repeats n=3n=3 n=3 n=3 n=3 n=3 n=3 n=3
125
B
tRNA WT 1 2 3 4 56BCEC
- OH - ++- - + - +- + - + - + - + - +
Lys-tRNALys
tRNALys
% charged 98+ - 7 93+ - 8 85+ - 7 76+ - 8 85+ - 7 55+ - 3 80+ - 9 nd 89+ - 9 Repeats n=3n=3 n=3 n=3 n=3 n=3 n=3n=3 n=3
tRNA 7 8 9 10 11 12 BC EC
- OH - ++- - + - +- + - + - + - +
Lys-tRNALys
tRNALys
% charged 63 - 7 76+ - 8 100+ - 10 97 - 11 97+ - 10 92+ - 10 nd 89 - 9 Repeats n=3n=3 n=3 n=3 n=3 n=3 n=3 n=3
126 tRNAOther % of charged % of charged Charged tRNAOther/ Normalized R mutation tRNAOther tRNALys Charged tRNALys (R) WT 88 98 0.89 1.0 1 25 93 0.27 0.30 2 47 85 0.54 0.61 3 68 76 0.89 1.0 4 71 85 0.83 0.93 5 75 55 1.37 1.5 6 82 80 1.02 1.1 7 49 63 0.78 0.87 8 63 76 0.83 0.93 9 62 100 0.53 0.59 10 71 97 0.73 0.82 11 67 97 0.68 0.77 12 70 92 0.76 0.85
Table 3.1. Analysis of the role of tRNAOther sequence elements in aminoacylation.
Analysis of the different elements of tRNAOther indicates that some positions are
insensitive to changes such as the C:A in the D stem (mutants 3 and 4) and A39G in the
anticodon stem. However, replacements of the C:A base pair in the acceptor stem
reduced charging levels of tRNAOther, with C66U being the most deleterious
modification, reducing 70 % tRNA aminoacylation. Modifications in the corresponding
base pair A7G led to a 40 % reduction in charging. The decrease in charging caused by modification of the C:A pair at the base of the acceptor stem indicated that this element is important for tRNA recognition. The only significant increase in charging resulted from the C32U replacement, which elevated charging by 50 %, suggesting that a Watson-Crick base pair at the top of the anticodon loop might stabilize the anticodon for recognition by
LysRS1:LysRS2. Modifications to the bulge at the second base pair of the acceptor stem
127 only caused a mild loss in charging, while A71U decreased the charging level by 40 %, indicating that formation of a G-U base pair at this position inhibited charging of
tRNAOther by LysRS1:LysRS2. The mutations G37A and A16G resulted in 15-17 %
decreases in charging levels of tRNAOther, while C34U reduced charging by 23 %,
implicating this position in a more significant role in recognition. This analysis identified several elements of tRNAOther important for recognition by LysRS1:LysRS2.
Interestingly, some of the elements thought to be important, such as the C:A base pairs,
had no effect on charging levels.
The overall results indicate that the non-canonical Watson-Crick base pairs
A7:C66 at the base of the acceptor stem and the bulge G2:A71 are important identity elements of tRNAOther for recognition by the LysRS1:LysRS2 complex. The CCA
anticodon of tRNAOther is also an important element for recognition as shown by the effect of the change in C34. Furthermore, C30 at the base of the anticodon loop is
important if correctly paired with A39.
3.3.8. The existence of two tryptophanyl-tRNA syntheses in B. cereus
As tRNAOther contains a Trp anticodon (CCA), we attempted to charge in vitro
transcribed tRNAOther with Trp using both B. cereus tryptophanyl-tRNA synthetase
(TrpRS1 and TrpRS2). Both TrpRSs were able to efficiently charge cognate tRNA with
Trp but showed no such activity towards tRNAOther, confirming that tRNAOther is specifically aminoacylated by LysRS1:LysRS2 (Fig. 3.10.A). A second analysis of the genome of B. cereus 14579 identified a second copy of TrpRS, named TrpRS2, which displays only 34 % similarity with TrpRS1. The Deinococcus radiodurans TrpRS2
128 homolog was found to interact with the Trp modification enzyme NOS (118), which
produces 4-nitro-tryptophan, and is more adapt at 5-hydroxy-L-tryptophan (5OHW)
usage. In aminoacylation assays the B. cereus TrpRS2 was not inhibited by 5OHW in
concentrations up to 1 mM, while TrpRS1 was inhibited at concentrations higher than
500 µM (data not shown).
aaRS K (µM) k (min-1) k /K (min-1.µM-1) M cat cat M TrpRS1 4.2±0.4 155±2 37±0.6 TrpRS2 7.6±0.7 8.32±0.05 1.09±0.02
Table 3.2. Aminoacylation kinetic parameters of B. cereus TrpRSs for
L-tryptophan.
The KM for Trp for TrpRS1 and TrpRS2 was about the same while the kcat
changed significantly. TrpRS1 was 18-fold more active than TrpRS2 (Table 3.2). The
difference in activity between the two TrpRSs, and the fact that TrpRS1 was unable to
charge in vitro transcribed tRNAOther, led us to investigate whether the TrpRSs could
charge tRNATrp and tRNAOther with Trp or 5OHW, separetely. Small unfractionated
RNAs from B. cereus were charged and separated on an acidic urea gel and subjected to
northern analysis with probes against tRNATrp and tRNAOther (Fig. 3.10.B and C).
129 Both TrpRS1 and TrpRS2 are able to charge the cognate tRNATrp with Trp and
5OHW. TrpRS1 was able to achieve almost 100 % charging of tRNATrp with Trp but
only about 50 % with 5OHW, while TrpRS2 only reached 75 and 70 % charging with
Trp and 5OHW, respectively. Upon analysis of the possibility of charging tRNAOther from unfractionated small RNA samples with Trp and 5OHW, neither enzyme appeared able to aminoacylate tRNAOther with either amino acid. Also, both TrpRSs failed to charge in
vitro transcribed tRNAOther in filter binding assay. These results suggested that the
presence of each TrpRS in B. cereus, is not related to the presence of tRNAOther.
130 A 30
25 ol )
m 20
15 -tRNA(p
p 10 r T 5
0 0 5 10 15 20 Time (min) B TrpRS1 TrpRS2
Trp ++- - ++- - 5OHW - - + + - - + +
OH- --+ + - + - +
Aa-tRNATrp
tRNATrp
Figure 3.10. Aminoacylation of tRNATrp and tRNAOther with TrpRSs. A. Aminoacylation of in vitro transcribed tRNATrp with [3H]-Trp by 50 nm TrpRS1 (■), 50 nM of TrpRS2 (•) and tRNAOther with [3H]-Trp by 50 nm TrpRS1 (□), or 50 nM of TrpRS2 (○). The background level of aminoacylation determined in the absence of enzyme was ~0.2 pmol. B. Analysis of tRNATrp aminoacylation with 2 mM Trp or 2 mM 5OHW by 50 nM TrpRS1 or 50 nM TrpRS2. OH- -, no treatment after aminoacylation; OH- +, deacylation with 100 mM Tris-OAc (pH 9.0) at 37 °C for 30 min.
131 3.4. Discussion
3.4.1. The role of LysRS1 and LysRS2 in the archaeal system
The inhibition profile observed for the Methanosarcina barkeri LysRS1:LysRS2
aminoacylation of tRNAPyl cannot completely rule out catalysis by LysRS1 in the ternary
complex, but strongly suggests that LysRS2 predominantly catalyzes the aminoacylation
of tRNAPyl. This result, in turn, suggests that the role of LysRS1 may be to stabilize
and/or refold tRNAPyl into an active conformation suitable for aminoacylation by
LysRS2. While such a role for LysRS1 in tRNA folding is purely speculative in the
context of this study, ongoing investigations of other archaeal LysRS1s strongly support
the involvement of these proteins in tRNA maturation and folding. In the archaeal scenario, there is always the presence of tRNAPyl when both LysRSs are present, which can be aminoacylated by the complex of both enzymes with Lys only but not with Pyl
(176;180;183). In M. barkeri, the non-canonical tRNA is primarily aminoacylated with pyrrolysine by its own aaRS, pyrrolysyl-tRNA synthetase (PylRS), and the role of the
LysRS1:LysRS2 pathway may be to prevent ribosomal stalling when pyrrolysine is scarce.
3.4.2. The role of LysRS1 and LysRS2 in the bacterial system
Many aaRSs have been found as duplicated orthologs in the same organism, a phenomenon associated with resistance to amino acid analogues and responses to changes in cellular physiology (112;129). In contrast, the non-orthologous duplication of
LysRS is still unique among aaRSs, and only a small minority of characterized organisms harbor both classes of the protein. In M. barkeri and B. cereus, LysRS2 is a housekeeping
132 enzyme, while LysRS1 and a non-canonical tRNA are expressed only under certain
conditions during stationary phase of the cell cycle.
Analysis of the non-canonical elements of tRNAOther in aminoacylation by both
LysRSs, since only the complex is active in aminoacylation of tRNAOther, suggest that the
C:A pair at the base of the acceptor stem is important either in folding of the tRNA or in
the direct presentation of recognition elements. The opposite effect was observed for the
C32U mutation in the anticodon stem, which increased charging by the complex, perhaps due to a rearrangement of the anticodon loop. The specific conformational change of the anticodon loop is an important factor for LysRS2 recognition of tRNALys, with the
hypermodified bases promoting the correct conformational changes both for LysRS2
recognition and correct decoding in the ribosome (145;148;152).
The bulge in the second base pair of the acceptor stem is apparently a secondary
identity element since restoring the G-U pair, a secondary element for LysRS1
recognition of tRNALys and a negative determinant for LysRS2, considerably decreases
Other the charging of tRNA . These results indicate that LysRS2 might be responsible for
charging tRNAOther with Lys but cannot discard the possibility that LysRS1 might charge
tRNAOther, as was also the case for the archaeal system (see section 3.4.1). Mutation of
the anticodon from CCA to UCA decreased the charging level of tRNAOther, suggesting
that the anticodon CCA, is also a recognition element. The recognition of a CCA
anticodon by LysRS1:LysRS2 is clearly unusual, especially since the mutation C34U
reduced the charging of tRNAOther. Normally LysRS1 and LysRS2 are insensitive to
changes of C/U at position 34, as UUU and CUU are both Lys anticodons. The presence
of important elements that may either interact with the LysRS1:LysRS2 complex or
133 modify the fold of tRNAOther corroborate the fact that this non-canonical tRNA is solely
recognizable by the LysRS1:LysRS2 complex and may have an important, yet
uncharacterized, role in B. cereus.
3.4.3. The role of TrpRS1 and TrpRS2 in the bacterial system
Charging of tRNAOther, which contains a Trp anticodon, could fulfill the function
of endogenous tRNATrp by ensuring Trp codons are translated during stationary phase
when Trp may be in short supply. However, analysis of tRNATrp charging indicated that
it is over 80 % aminoacylated throughout exponential and stationary phases, excluding
Trp limitation as a potential stimulus for tRNAOther aminoacylation. On the other hand,
LysRS1:LysRS2 may provide an alternative to charging tRNAOther with an unknown non-
canonical amino acid or aaRS, as is the case for pyrrolysine. One candidate aaRS is the
alternative tryptophanyl-tRNA synthetase (TrpRS2) found in B. cereus, whose equivalent
from D. radiodurans can utilize 4-nitrotryptophan and 5OHW (117).
The kinetic parameters for Trp during aminoacylation with each TrpRS differ,
especially in kcat, suggesting that TrpRS2 is a slower enzyme when using Trp as substrate
for aminoacylation. Northern analysis of tRNATrp indicated that TrpRS2 charges tRNATrp
with Trp and 5OHW at the same level, while TrpRS1 is more active in charging tRNATrp with the cognate amino acid. The fact that neither TrpRS can charge in vitro transcribed tRNAOther, nor the native unfractionatd small RNA that contains tRNAOther suggests that
further analysis will be required to confirm is they could be candidates for charging
tRNAOther in vivo. Determining if TrpRS1 and TRpsRS2 are expressed during the
different growth stages of B. cereus will provide some insight about the possibility of
134 tRNAOther being charged by one of them (Theresa E. Rogers and Michael Ibba, unpublished results). Further investigation of these hypotheses now requires an
Other understanding of whether aminoacyl-tRNA can function in protein synthesis, as indirectly suggested by its ability to bind EF-Tu. If tRNAOther is found to function in protein synthesis, a variety of questions follow, such as what codon does it decode and, ultimately, what amino acid is the real substrate attached to tRNAOther in vivo.
135 CHAPTER 4
INVESTIGATION OF THE ROLE OF tRNAOTHER IN BACILLUS CEREUS 14579
4.1. Introduction
Small non-coding RNAs in bacteria function in controlling gene expression by regulation of transcription and translation (194). Some non-coding RNAs mimic the aminoacylation function of tRNA even though they fold differently, as first identified in plant viruses (reviewed in (195)). Small RNAs with tRNA-like activity are involved in many essential functions such as transcription and translation of genes (196), and also participate in ribosome-independent metabolic pathways (197). Mutations in tRNA genes can impair antibiotic production and cell differentiation in some bacteria (198;199).
Bacillus cereus is a spore-forming, facultative anaerobic, gram-positive rod. It is ubiquituously present in soil and raw unprocessed food, and has multiple adaptation response pathways (185). Taxonomically, B. cereus is closely related to
Bacillus thuringiensis and Bacillus anthracis, forming the B. cereus group along with
Bacillus weihenstephanensis and Bacillus mycoides (200).
136 B. cereus is considered a food-borne pathogen due to the production of a range of
virulence factors such as a heat-stable emetic toxin that causes vomiting, and enterotoxins
that cause diarrhea (201). Virulence factors and bacteriocins, small peptides with
antibimicrobial functions, are produced by B. cereus in a defined response to stress or
growth conditions (202).
Previoulsy, we identified a small RNA, named tRNAOther in B. cereus, that is
expressed in late stationary phase and charged by LysRS1:LysRS2 complex in vitro.
Here we investigate the role of tRNAOther in B. cereus 14579 by the construction of a
deletion strain. Comparison of the deletion strain with wild type (wt) indicates that tRNAOther is not an essential gene, but it has effects in down-regulation of a Bacteriocin-
Like Inhibitory Substance (BLIS) operon and other secondary metabolic effects.
4.2. Materials and methods
4.2.1. Construction of pMUTIN4-∆other
To construct strain BC∆other, 600 nucleotides (nt) from upstream of the 5’ end
and downstream of the 3’ end of tRNAOther were amplified from genomic DNA using Pfu
DNA polymerase to insert NotI and SacII restriction sites in replacement of the tRNAOther
sequence. Oligonucleotides bc∆1
(5’GCTGCTAAGCTTGGTAGAAATCATCCAAATAGTAAAA3’) and bc∆2
(5’TATAGCGGCCGCCGCGGTCGTGGTCGGAATGACAG3’) were used to amplify
the 600 nt upstream of the 5’ end of tRNAOther and bc∆3
(5’ACGACCGCGGCGGCCGCTATACTTGTTCATTAAAAGGTTTCA3’) and bc∆4
(5’GCTGGATCCGATGTTTTAGTAGTAGAGAATCATTAAG3’) were used to
137 amplify the 600 nt downstream of the 3’end of tRNAOther. The two fragments were
rejoined by overlapping PCR using bc∆1 and bc∆4 primers to insert HindIII and BamHI
restrictions sites. The assembled ~1,200 nt ∆other was cloned into HindIII and BamHI
sites of plasmid pMUTIN4 (203) resulting in pBC∆other. The plasmid was sequenced to
cofirm tRNAOther deletion and restriction sites prior to B. cereus transformation.
4.2.2. Transformation of B. cereus
B. cereus electroporations with pBC∆other was performed by a variation of the
protocol described in (204). An overnight, saturated culture of B. cereus was diluted
o 1/100 in 600 ml of LB and grown at 30 C until OD600 = 0.3. Cells were spun at 3,000 xg
at 4 oC and washed with 72 ml ice cold of electroporation buffer (EP consists of 0.1 mM
K2HPO4/KH2PO4, 0.5 mM MgCl2 and 260 mM sucrose). Cells were spun again and
resuspended in 1.2 ml of ice cold EP and kept on ice for 30 min. Plasmid DNA
(pBC∆other, 10 µg) was mixed with 100 µl of B. cereus cells, suspended in EP, placed in
a cuvette, and incubated on ice for 10 min. Cells were elctroporated with a pulse of
1.5 kV, 335 Ω and 15 µF and incubated with 1.5 ml of LB for 5 h at 30 oC. Recovered
cells (500 µl) were spread on LB plates supplemented with 1 µg/ml of erythromycin, 25
µg/ml of lincomycin and 1 mM IPTG, and plates were incubated at 30 oC for 48 h.
Colonies were transferred to LB plates supplemented with the same concentrations of erythromycin, lincomycin and IPTG, grown at 30 oC for 24 h and transferred to a new
plate containing the same media. Plates were than replica-plated on LB containing
10 µg/ml of erythromycin, 25 µg/ml of lincomycin and 1 mM IPTG and grown at 30 oC for 24 h. For the next round of replica-plating the concentration of erythromycin was
138 20 µg/ml and the final replica-plating was on LB supplemented with 20 µg/ml of
erythromycin, 25 µg/ml of lincomycin and grown at 30 oC for 24 h. The plasmid
pBC∆other was inserted in the B. cereus chromosome by a Campbell-type event yelding
the strain BCpBC∆other (205). Genomic DNA was extracted from isolated colonies
inoculated on 5 ml of LB supplemented with 20 µg/ml of erythromycin and 25 µg/ml of
lincomycin. The strain was verified by PCR and Southern analysis.
4.2.3. Deletion of tRNAOther gene
The colonies of strain BCpBC∆other, which contained the insertion of the
plasmid pBC∆other in the chromosome, was subjected to excision of the plasmid from
the chromosome by a Campbell-type event (205). Strains were inoculated in 5 ml of LB and grown at 30 oC for 24 h. The saturated culture was diluted 1/100 times in 5 ml of LB and incubated at 30 oC for 24 h again. After 5 passages of dilutions and growth until
saturation in LB without antibiotics, cells were serially diluted, spread on LB plates and grown at 30 oC for 24 h. Plates were replica-plated on LB supplemented with 10 µg/ml of
erythromycin, 25 µg/ml of lincomycin and LB supplemented with 20 µg/ml of
erythromycin, 25 µg/ml of lincomycin and incubated at 30 oC for 8 h. Colonies that were not able to growth on LB supplemented with antibiotics after 10 h were selected.
Genomic DNA was extracted from isolated colonies inoculated in 5 ml of LB and grown overnight at 30 oC. The strain BC∆other was verified by PCR, restriction digestion,
Southern analysis and RT-PCR analysis of total small RNA preparation as described in
section 3.2.12.
139 4.2.4. Characterization of B. cereus ∆other strain
B. cereus wt and ∆other strain were grown aerobically in LB media until
o saturation at 30 C, washed and diluted to OD600=0.001 into LB, defined (MM) (206) or
sporulation (207) media and incubated in a microplate reader for growth rate
determination at 30 oC. Each growth curve was determined in triplicate and averaged.
For germination assays, spores were prepared by inoculating B. cereus wt and
∆other in 100 ml of sporulation media and incubated at 30 oC with constant agitation for
48 h. Spores were harvested by 10 min of centrifugation at 8,000 xg at 4 oC and washed
five times with 50 ml PBS with 0.1 % Tween 20 according to Stuart et.al (208) and
stored at 4 oC in the dark. Spore content was confirmed upon visualization by contrast
phase microscopy. Germination was performed by washing 1 ml of spore suspension by centrifugation and resuspention in 1 ml of water. The final spore solution was heat activated at 70 oC for 15 min, washed twice with water and suspended in 1 ml of germination solution (10 mM Tris-HCl [pH 7.4] and 10 mM NaCl). The OD600 was
adjusted to 1.0 with the germination solution alone or supplemented with 1, 10 or
100 mM of Ala or Lys. Germination was followed by incubating the activated spores at
30 oC in a microplate reader and measuring the decrease in absorbance at 600 nm every
2 min. Each germination was determined in triplicate and averaged.
4.2.5. Acid urea gel electrophoresis of RNA and aminoacyl-tRNA
Unfractionated small RNAs from different growth phases (OD600=0.5 (1 h),
OD600= 1.6 (2 h), OD600=6.0 (10 h), OD600= 6.7 (13 h)) of B. cereus wt and ∆other were
extracted as described in section 3.2.12 in acidic conditions. Each RNA sample (15 µg) 140 were dissolved in 2 × loading buffer (7 M urea, 0.3 M NaOAc [pH 4.5], 10 mM EDTA,
0.1 % bromophenol blue, 0.1 % xylene cyanol) and loaded on a 6.5 % polyacrylamide gel
(50 × 32 cm, 0.4 mm thick) containing 7 M urea, 0.1 M NaOAc (pH 5.0), and run at 4 °C,
16 watts in 0.1 M NaOAc (pH 5.0) for 16 h. Detection of the RNAs was performed by
blotting and hybridization. The portion of the gel containing the tRNAs was
electroblotted onto a Hybond N+ membrane (Amersham Biosciences) using a Hoefer
electroblot apparatus (Amersham Biosciences) at 20 V for 20 min and then at 40 V for
2 h with 10 mM Tris-OAc (pH 8.0), 5 mM NaOAc, and 0.5 mM Na-EDTA as transfer
buffer. The membranes were baked at 80 °C for 2 h. The tRNAs were detected by
hybridization with 5′ 32P-labeled oligonucleotide probe complementary to nucleotides 56-
76 of tRNAOther.
4.2.6. Growth inhibition of B. subtilis
The inhibitory effect of the antimicrobial activity present in the supernatant of a
B. cereus wt culture was compared to the ∆other strain. B. cereus strains were grown in
5 ml of LB at 30 oC for 16 h with vigorous shaking. The saturated cultures were diluted at
1:100 in 200 ml of LB and incubation continued for 26 h, with 5 ml samples drawn at
various time points. Cell free supernatant (CFS) was obtained by centrifugation at
14,000 xg of 5 ml samples and subsequent sterile filtration. Samples were stored at -
80 oC. Antimicrobial activity from the CFS was determined by using B. subtilis 168 as the indicator strain in a microplate growth inhibition assay. B. subtilis was grown in 5 ml
of LB at 30 oC for 16 h with constant agitation. The saturated culture was re-inoculated in
10 ml of LB and grown until OD600= 0.6. Cells were serialy diluted in LB to an
141 OD600=0.002. To each well, 100 µl of B. subtilis freshly diluted cells were mixed with
100 µl of CFS samples and incubated in a microplate reader for growth rate
determination at 30 oC. Each growth curve was determined in triplicate and averaged.
4.2.7. BIOLOG analysis of B. cereus ∆other strain
The BIOLOG analysis was performed by comparing the changes in cell respiration of B. cereus wt and ∆other in ~2,000 different culture conditions. Each condition was repeated twice and fitted into a threshold of confidence for each strain
(209). The BIOLOG analysis was performed by Biolog, Inc (Hayward,CA).
4.3. Results
4.3.1. tRNAOther is not essential in B. cereus
To determine the function of tRNAOther in B. cereus 14579, we constructed a new
strain of B. cereus (∆other) in which the tRNAOther gene was replaced by two restriction
sites, Not I and Sac II. The new strain was generated in a two-step procedure composed
of a plasmid insertion and a plasmid excision in a Campbel-like event (205). After
integration of pBC∆other into the B. cereus chromosome using a 600 nt flanking sequence around tRNAOther, the new strain BCpBC∆other was confirmed by PCR,
restriction digestion and southern analysis (Figs. 4.1 and 4.2). During the screen, the
media contained IPTG in order to maintain the transcription of downstream genes and
avoid a polar effect from the presence of the plasmid.
142 AmpR Ori LacI
R pBC∆ other Erm LacZ
Not I/Sac II Oid Pspac
B. cereus wt Peptide synthase tRNAOther
Pspac R R BCpBC∆ other LacZ LacI Amp Erm
Other Peptide synthase tRNA Not I/Sac II
Figure 4.1. Scheme of integration of pBC∆other into the B. cereus chromosome. pBC∆other, containing 600 nt flanking both sides of tRNAOther gene (in red) and a NotI and SacII restrictions site (black line), are under control of the Pspac promoter inducible by IPTG. lacZ and lacI genes are indicated in black and dark gray, respectively. AmpR is the ampicilin resistance gene and ori is the origin of replication functional in E. coli. ErmR is the erythromycin resistance gene for selection in B. cereus and Oid is the terminator. The arrows point in the direction of transcription. In B. cereus 14579, tRNAOther is located downstream of a large operon which contains ORFs from a peptide synthase complex (white and red boxes) upstream of tRNAOther (gray box). Integration happens via a single cross-over event.
143 A
1 2 3 4 5 6 7 8 9 10 11 Ladder
B 1 2 8 9 10
Ladder S N S N S N S N S N
Figure 4.2. Characterization of strain BCpBC∆other by PCR and restriction digestion. A. PCR product of genomic DNA from isolated B. cereus colonies, which might contain integration of pBC∆other using oligonucleotides BC∆1 and BC∆4 (amplifies the 600 nt flanking region). Arrow indicates the correst size of the PCR product. Numbers correspond to the number of the isolated colony. B. Restriction digestion of the PCR product from colonies, which presented the correct size fragment in A with SacII (S) and NotI (N). Arrow indicates the correct size of digestion product, which corresponds to half of the size of PCR product. Numbers correspond to the number of the isolated colony.
Strains BCpBC∆other 2, 8 and 10, confirmed to be the correct construction, were
subjected to excision of the plasmid by a single cross-over event as in a Campbell-like
event (Fig. 4.3) (205). In order to revert the insertion, five passages with 1/100 dilution in
LB and growth until saturation in media without erythromycin was performed followed
by serial dilution and plating. Plates were then replica-plated into LB and LB 144 supplemented with 20 µg/ml erythromycin and grown for 10 h. Colonies that were not
present in LB supplemented with 20 µg/ml of erythromycin after 8 h were selected and
screened. Extensive incubation with erythromycin always resulted in growth for all
colonies. However, cells which contained the integrated vector grew faster. To confirm
the excision of tRNAOther, the strain was characterized by PCR, restriction digestion and
Southern analysis of genomic DNA in comparison with wt strain (Fig. 4.4). Only
colonies derived from strain 8 contain the deletion of tRNAOther from the chromosome,
while colonies from strain 2 remained as BCpBC∆other, as confirmed by the PCRs and
restriction digestion (Fig. 4.4). Colony 8.1 was characterized as the deletion strain after
comparison with B. cereus wt and with a BCpBC∆other strain (colony 2.1). The PCR
products of genomic DNA from B. cereus wt, 8.1 and 2.1 clearly indicate their genotype
(Fig. 4.4.C). To further characterize the RNA content of the deletion strain (B. cereus
∆other – 8.1), RT-PCR and northern blot analysis was performed in comparison with B. cereus wt (Fig. 4.5). The RT-PCR also included E. coli as a negative control and in vitro
transcribed tRNAOther as a positive control. The absence of a band corresponding to
tRNAOther in the RT-PCR and in the northern for the B. cereus ∆other confirmed the
deletion from the chromosome. Since the deletion of tRNAOther was not lethal to
B. cereus, and viable strains were obtained, we decided to investigate the phenotype and
possible role of tRNAOther in B. cereus wt.
145 Pspac R R BCpBC∆ other LacZ LacI Amp Erm
Other Peptide synthase tRNA Not I/Sac II
B. cereus ∆other
Peptide synthase
Figure 4.3. Scheme for removal of pBC∆other from the B. cereus chromosome. pBC∆other integrated into the B. cereus chromosome was excised by a single cross-over event with the possibility of restoring the wt strain or with a deletion of tRNAOther. The 600 nt flanking both sides of the tRNAOther gene (in red) and NotI and SacII restrictions site (black line) stays in the chromosome in replacement of the same sequence containing tRNAOther, which is removed form the chromosome. lacZ and lacI genes are indicated as black and dark gray. AmpR is the ampicilin resitance gene. ErmR is the erythromycin resistance gene for selection in B. cereus and Pspac is the inducible promoter. The arrows point in the direction of transcription.
146
A B
r r
r r
e e
e e d
d 2 8 d
d 8 2
d d
d d
a a
a a L
L 1 2 3 1 2 3 L L 1 2 3 1 2 3 S N S N S N S N S N S N BC∆ 1 BC∆ 4
BC∆ 4 BC∆ 24 C
r BC∆ 1 BC∆ 4 BC∆ 1 BCother5’ e
d BC∆ 4 BC∆ 24 Bcother3’ BC∆ 4
d a
L 1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4
Figure 4.4. Characterization of B. cereus ∆other strain by PCR and restriction digestion. A. PCR product of genomic DNA from isolated B. cereus colonies, which might contain excision of pBC∆other using oligonucleotides BC∆1 and BC∆4 (amplifies the 600 nt flanking region), is further digested with NotI and SacII (C). The correct PCR product with BC∆24 and BC∆4 (which amplifies upstream of the 5’ end of tRNAOther and 600 nt downstream of the 3’ end of tRNA Other) corresponds to a single lower band indicating deletion of tRNAOther, while the doublet corresponds to strain BCpBC∆other. Strains 8 and 2 denote the selected strains with integration of plasmid pBC∆other. The numbers 1, 2 and 3 correspond to colonies isolated that might contain the excision of pBC∆other. Arrow indicates the correct size of PCR product. Numbers correspond to the number of the isolated colony. B. Restriction digestion of the PCR product from colonies that presented the correct size fragment in A (BC∆1 and BC∆4) with SacII (S) and NotI (N). Arrow indicates the correct size of the digestion product, which corresponds to half of the size of PCR product. Numbers correspond to the number of the isolated colony. C. PCR product from genomic DNA of different strains to confirm deletion of tRNAOther with several combinations of oligonucletides specific for the region around tRNAOther. Lane 1 is B. cereus wt, lane 2 is B. cereus ∆other (8.1), lane 3 is B. cereus pBC∆other (2.1), lane 4 is H2O as negative control. The first two combinations of oligonucleotides were previously described. BC∆1 and BCother 3’ amplifies the 600 nt upstream of the 5’ end of tRNAOther and the internal portion of the 3’ end of tRNAOther. BCother 5’ and BC∆4 amplifies of the internal portion of the 5’ end of tRNAOther and the 600 nt downstream of the 3’ end of tRNAOther.
147
A
r
e
d
d a
L 1 2 3 4 5
B
BC∆ other 8.1 B.cereus wt
1 2 3 4 1 2 3 4
OH- ++--+ - +- ++--+ - +-
aa-tRNAOther
tRNAOther
Figure 4.5. Characterization of the RNA content of B. cereus ∆other strain. A. RT- PCR using primers specific for tRNAOther for total RNA extracts. Lane 1 is B. cereus ∆other, lanes 2 and 3 are B. cereus wt, lane 4 is E. coli, lane 5 is in vitro trasncribed tRNAOther B. Analysis of tRNAOther and aminoacylation by hybridization against specific probes. RNA samples were extracted at OD600= 0.5 (1 h, lane 1), OD600= 1.6 (2 h, lane - 2), OD600= 6.0 (10 h, lane 3), OD600= 6.7 (13 h, lane 4). OH - no treatment after aminoacylation; OH- + deacylation with 100 mM Tris-OAc (pH 9.0) at 37 °C for 30 min.
4.3.2. Differential phenotype of B. cereus ∆other
The cell viability upon deletion of tRNAOther led us to investigate the role it may
play in B. cereus 14579. The growth rate of B. cereus ∆other in LB and sporualtion
media is virtually the same as B. cereus wt (Fig. 4.6 and Table 4.1). In defined media the
148 growth rate of B. cereus ∆other is slower than the wt strain indicating that the deletion of tRNAOther causes a slower growth in MM (Fig. 4.6 and Table 4.1).
Doubling time of Doubling time of B. cereus wt (min) B. cereus ∆other (min) LB 33±3 36±2 Minimal media 87±4 114±7 Sporulation media 50±4 54±3
Table 4.1. Growth rate of B. cereus wt and ∆other in liquid culture.
149 A 1.2 B 0.8 C 0.8
0.7 0.7 1
0.6 0.6
0.8 0.5 0.5 600nm 600nm 600nm
0.6 0.4 0.4 Absorbance Absorbance Absorbance 0.3 0.3 0.4
0.2 0.2
0.2 0.1 0.1
0 0 0 0 100 200 300 400 500 600 700 800 0 200 400 600 800 1000 1200 0 100 200 300 400 500 600 700 800
time (min) time (min) time (min)
150
Figure 4.6. Growth curves of B. cereus ∆other and wt. A. Growth in LB media. B. Growth in MM. C. Growth in sporulation media. B. cereus ∆other (□) and B. cereus wt (○). Each time point represents the average of a triplicate reading.
150 The germination ability was tested in order to identify phenotypes under different growth conditions caused by the deletion of tRNAOther in B. cereus (204;206;210;211).
The different responses of B. cereus to Ala and Lys were tested for spores of wt and
∆other strains (Fig. 4.7). The spores from both strains were obtained after incubation in sporulation media for 48 h and analyses by phase contrast microscopy, indicating that the deletion of tRNAOther can generate spores. Since B. cereus has a different response to
germinants, we decided to challenge spores from wt and ∆other strain with Ala and Lys at two concentrations (Fig. 4.7). tRNAOther was found to be aminoacylated in vitro with
Lys, and in order to evaluate the effect of this aa in germination, we decided to use Lys as
a germinant. Spores from the ∆other strain (8.1) displayed a fast germination with both
germinants (Ala and Lys) with no significant difference between the different
concentrations (10 or 100 mM). The spores from the wt strain had a slower response to germinants when compared to spores from the ∆other strain, especially with Lys. The wt strain only committed to germintation after 1 hour of incubation with Lys (Fig. 4.7). The small change in effect of germinants on B. cereus ∆other compared to wt led us to investigate the possible role of tRNAOther in the production of BLIS.
151 A 1 B 1
0.95 0.95
0.9 600nm 600nm 0.9 0.85
0.8 0.85
0.75 0.8 wt 100 lys wt 10 lys % decrease in Absorbance in % decrease % decrease in Absorbance 0.7 wt 100 ala 8.1 100 lys wt 10 ala 8.1 10 lys 8.1 100 ala 0.75 8.1 10 ala 0.65
0.6 0.7 0 1020304050607080 0 1020304050607080
time (min) time (min)
Figure 4.7. Germination of spores from B. cereus ∆other and wt with different germinants. A. Ala was used as a germinant at two concentrations 10 (filled symbols) and 100 mM (open symbols) with spores from B. cereus wt (circles) and ∆other (8.1) (squares) as indicated in the figure. B. Lys was used as a germinant at two concentrations, 10 (filled symbols) and 100 mM (open symbols) with spores from B. cereus wt (circles) and ∆other (8.1) (squares) as indicated in the figure. Germination is measured as the percentage in decrease of absorbance at 600 nm compared to an initial spore concentration where A600 =1.0.
The location of tRNAOther in the chromosome of B. cereus is located just
downstream of a large peptide synthase operon, which may be responsible for the synthesis of a BLIS, led us to investigate the phenotype of the tRNAOther deletion in
production of this compound. BLIS production can be detected by using the CFS from B.
cereus wt from different time points in a 1:1 dilution with LB to inhibit the growth of an indicator strain, such as B. subtilis. CFS from B. cereus ∆other and wt were used to inhibit growth of B. subtilis (Fig. 4.8).
152 A B
1.4 1.4 1-1.4 1-1.4 0.6-1 0.6-1 0.2-0.6 0.2-0.6 1 1 OD 600 OD 600
0 0.6 0 0.6 sample 6 sample 6 12 12 0.2 0.2 0 45 90 0 135 180 225 270 315 360 405 450 495 540 585 45 90 135 180 225 270 315 360 405 450 495 540 585
time (min) time (min)
153
Figure 4.8. Growth inhibiton of B. subtilis by CFS of B. cereus ∆other or wt. A. The growth inhibition of B. subtilis was measured in CFS withdrawn at several time points of from B. cereus ∆other cell growth in LB (denoted as h in sample axis). B. The growth inhibition of B. subtilis was measured in CFS withdrawn from several time points of B. cereus wt cell growth in LB (denoted as h in sample axis). The data was plotted in a surface mode with a color code for different absorbance ranges as indicated by the insets. Each time point corresponds to the average of a triplicate measurement.
153 The growth inhibition of B. subtilis by the CFS of B. cereus ∆other and wt
indicated a difference in the CFS obtained from 6 to 12 h after inoculation of each
B. cereus strain. The CFS from the wt strain displayed a mild effect in inhibiting the cell
growth of the indicator strain when samples were withdraw between 6 to 12 h, but it was
not sufficient to prevent B. subtilis from reaching saturation. The CFS from B. cereus
∆other had a stronger inhibitory effect on B. subtilis cell growth, especially with samples
withdrawn before 6 h of inoculation. This result indicated that the deletion of the
tRNAOther may have caused a down-regulation of the BLIS production by the peptide
synthase.
In order to further characterize the phenotype caused by the deletion of tRNAOther
from B. cereus, a BIOLOG assay was performed with the deletion strain in comparison
with the wt strain. The BIOLOG assay tested ~2,000 different cell growth conditions by
measuring the rate of cell respiration on various media. The result of the comparison
between B. cereus ∆other and wt indicates a few differences in both gained and lost phenotypes (Table 4.2).
154
Phenotypes Gained: Intensity Compound Effect 173 Oleandomycin protein synthesis, 50S ribosomal subunit, macrolide 188 Spiramycin protein synthesis, macrolide 148 Josamycin protein synthesis, macrolide 132 Troleandomycin protein synthesis, macrolide 185 Erythromycin protein synthesis; 50S ribosomal subunit; macrolide Phenotypes Lost: Intensity Compound Effect -124 Sanguinarine ATPase, Na+/K+ and Mg++ -230 Trifluoperazine cell cycle modulation, DNA synthesis, Ca(2+)/calmodulin dependent protein phosphorylation and lipid -141 Novobiocin DNA topoisomerase -160 Niaproof membrane, detergent, anionic -155 Dodecyltrimethyl Ammonium membrane, detergent, cationic Bromide -148 Benzethonium Chloride membrane, detergent, cationic -166 Domiphen bromide membrane, detergent, cationic, fungiside -126 Lauryl sulfobetaine membrane, detergent, zwitterionic -100 Thr-Met N-source -99 Met-Thr N-source -85 Gly-Cys N-source -75 Leu-Asp N-source -71 Thr-Asp N-source -69 Ala-Thr N-source -68 L-Cysteine N-source -66 Trp-Gly N-source -66 Thr-Ser N-source -65 Thr-Arg N-source -62 Thr-Gly N-source -61 Trp-Asp N-source -58 L-Threonine N-source -56 Thr-Leu N-source -56 Gly-Thr N-source -54 L-Tyrosine N-source -54 Met-Ala N-source
Continued
Table 4.2. BIOLOG report from gained and lost phenotypes of B. cereus ∆other in comparison with B. cereus wt. Intensity values are considered moderate for values between 50 and 100, and strong for values higher than 100. – means loss in phenotype.
155
Table 4.2 continued
-54 Glu-Tyr N-source -53 Thr-Ala N-source -52 Trp-Trp N-source -201 Chelerythrine protein kinase C -270 Vancomycin protein synthesis -158 Puromycin protein synthesis, 30S ribosomal subunit, premature chain termination -108 Tylosin protein synthesis, 50S ribosomal subunit, macrolide -441 Tetrazolium Violet respiration -312 Iodonitro respiration Tetrazolium Violet -146 Pentachlorophenol respiration, ionophore, H+ (PCP) -71 Sodium Caprylate respiration, ionophore, H+ -66 FCCP respiration, ionophore, H+ -62 CCCP respiration, ionophore, H+ -363 Menadione respiration, uncoupler -72 Rifampicin RNA polymerase -105 Nafcillin wall; lactam
The BIOLOG data indicate that B. cereus ∆other gained resistance against
numerous macrolides, which interfere with protein synthesis. The lost phenotypes, when
compared to B. cereus wt, are more significant since the deletion strain lost resistance against several compounds that are detergents, which may target membrane or cell wall, respiration, protein synthesis and even transcription (Table 4.2). Also, a mild effect was seen for the loss in the ability to use some di-peptides as a nitrogen source when compared to the wt strain. The fact that B. cereus ∆other lost resistance to several antibiotics that target the membrane and cell wall, as well as using some di-peptides as a
156 nitrogen source, correlates with the previous data from the difference in phenotype observed in MM and germination. The gained resistance against macrolides correlates
with the BLIS down-regulation, which de-regulates the macrolide efflux protein present in the operon, conferring the resistance observed in BIOLOG. The loss in resistance against compounds that affect respiration, protein synthesis and transcription implies that tRNAOther may play an important yet uncharacterized role in these functions in B. cereus.
These phenotypes are now under investigation and further characterization (Theresa E.
Rogers and Michael Ibba, unpublished).
4.4. Discussion
The existence of a small RNA with a possible tRNA-like structure that has an
expression profile correlated with the endogenous LysRSs, and is recognized by EF-Tu upon aminoacylation with Lys, implicates this small RNA in some specialized function.
In order to investigate the role of tRNAOther in B. cereus, we constructed a deletion strain
in which the tRNAOther gene was replaced by two restriction sites. Indeed, tRNAOther is not an essential gene for B. cereus, since a deletion strain could be constructed, isolated and characterized. The non-lethality and minor reduction of vegetative growth in MM, as is observed in B. cereus ∆tRNAOther mirrors earlier work on Streptomyces coelicolor,
Leu which possesses a rare tRNA UUA encoded by the bldA gene. The deletion of bldA has
no effect on vegetative growth of S. coelicolor; instead it impairs secondary metabolism
and morphological differentiation (198). The morphological differentiation observed in
B. cereus ∆other is the faster germination of the spores and slow growth in defined media
from this strain when compared to spores from the wt strain. The secondary metabolism
157 effect is observed in the down-regulation of the BLIS production, and in the loss of
resistance to several compounds observed from the BIOLOG analysis.
The role of tRNAOther in B. cereus has yet to be fully understood and characterized. The construction of a deletion strain and its primary phenotype screen are the first steps towards the elucidation the function of tRNAOther. As indicated by the
aminoacylation with the LysRS1:LysRS2 complex in vitro and the identity elements
characterized (Chapter 3), the modifications present in tRNAOther and the structural
mapping remain to be completed. The recognition by EF-Tu suggests a possible role in
translation, but the substrate found aminoacylated to tRNAOther in vivo still remains to be
identified. The de-regulation of the peptide synthase operon, as observed in a gain of
resistance against macrolides and the increased BLIS production, suggests a regulatory
role in transcription or translation for tRNAOther. Small non-coding RNAs are known to
control both mRNA stability and to regulate translation in bacteria, and tRNAOther may be
involved in similar processes as indicated by the BIOLOG data (194). A DNA array, as
well as a proteomics analysis comparing the B. cereus ∆other and wt, will shed more
light onto its function in vivo.
158 CHAPTER 5
CONCLUSIONS
In recent years, the discovery of new functions and activities among the aaRSs
has broadened our knowledge of these essential housekeeping enzymes. Proteomic
studies, along with the search for other substrates within the cell, have shown that aaRSs
are more versatile than previously believed. In parallel, efforts to expand the genetic code
to allow the insertion of unnatural aa have focused on modifying aaRS specificity
(15;212). Based on the often severe loss of activity in many of these modified aaRSs and
studies with inhibitors on the mechanism of substrate recognition, it is becoming clearer
how substrate specificity has evolved in these enzymes. Certain aaRSs have apparently evolved to acquire the best balance between activity and specificity depending on how
easily a mistake could be made in misacylating cognate tRNA under particular
physiological conditions.
LysRS is the only example found to break the class exclusion rules among the
aaRS family and is found in both unrelated structural classes. Exploring the mechanism
of discrimination of Lys and analogues by LysRS1 and LysRS2 allowed the
159 identification of distinct mechanisms of Lys discrimination by both enzymes (Chapter 2).
The functional characterization of the active-site residues of both LysRSs indicates that
LysRS2 is a more robust enzyme with a faster activity; however, it is more prone to inhibition by Lys analogues. Meanwhile, LysRS1 is a more selective enzyme, granting more resistance against Lys analogues with reduced activity when compared to LysRS2.
Attempts to convert the more robust LysRS2 into a more selective enzyme with a higher resistance to AEC identified two resistant variants. The resistance of both variants comes from a slow accommodation of the active site in relation to Lys (Y280F) or ATP
(F426W), which reduced the activity of the enzyme allowing for an increase in selectivity
(Chapter 2). Our results demonstrate how each LysRS has evolved in a different way to acquire the best compromise between activity and selectivity, depending on the physiological growth conditions of the organism.
The fact that only a few organisms harbor both LysRS1 and LysRS2 led us to investigate the advantage that the presence of both LysRSs confers to these organisms. In the archaeon Methanosarcina barkeri, the two LysRSs act together to aminoacylate the suppressor tRNAPyl with Lys in vitro, while PylRS specifically aminoacylates this tRNA
with pyrrolysine (180;183). In the bacterium Bacillus cereus 14579, both LysRSs
aminoacylate a small RNA named tRNAOther, which possesses several non-canonical base
pairings which are specifically recognized by the LysRS1:LysRS2 complex in vitro
(Chapter 3). Our findings indicate that the co-existence of both forms of LysRS in the
same organism expand the usage of tRNA substrates to non-canonical forms (Chapter 3).
The differential expression of LysRS and tRNAOther in B. cereus suggests a role for
tRNAOther in stationary phase (Chapter 3). The identity elements for LysRS1:LysRS2
160 complex recognition investigated with in vivo expressed tRNAOther variants reveal some
of the non-canonical Watson-Crick base pairs in tRNAOther as important discrimination elements. Whether these elements, especially the C:A base pairs at the base of the acceptor and anticodon stems, contribute to folding or act as contact elements with the
LysRS1:LysRS2 complex is yet to be investigated.
tRNAOther is dispensable in B. cereus for vegetative growth since a deletion strain
was obtained. Characterization of the deletion strain indicates that tRNAOther may be
involved in regulation of secondary metabolism and cell differentiation. The BIOLOG
data from the comparison of B. cereus ∆other and wt indicates several cases of loss of
resistance in the deletion strain, implicating tRNAOther in multiple secondary functions.
The only gained phenotype correlates with the de-regulation of the peptide synthase
operon that encodes a macrolide efflux protein. Deletion of tRNAOther produces a mixture
of phenotypes reminiscent of those observed with the lack of bldA in S. coelicolor and
the function of small RNAs. The definition of a tRNA implies a specific decoding of a
codon at the ribosome with insertion of a specific aa, both functions remain to be
established for tRNAOther.
The evolutionary retention of two unrelated LysRSs can be attributed to the
different mechanism of substrate selection and accuracy each one possesses in
combination with the necessity to perform a faster reaction within the cell. Each LysRS
evolved its active site to reach the balance between accuracy and activity, and organisms
have generally acquired or retained only the copy that best suits their needs. In fact, only
very few organisms possess both LysRS1 and LysRS2. In those cases, the requirement
for the co-existence of both synthateses is to further expand the usage of a non-canonical
161 tRNA in aminoacylation via a LysRS1:LysRS2 complex. Most likely LysRS1 acts as a
chaperone to present the tRNA to LysRS2 (Chapter 3), which may aminoacylate it with
Lys or an analogue, since the class II enzyme is more susceptible to misincorporation of
Lys analogues. By selecting two distinct forms of an enzyme with different properties in
relation to their substrate recognition and binding, the usage of correct aa and non-
canonical tRNAs are assured for each organism’s requirements.
Perspective
Contrary to the common belief that aaRS evolution was primarily driven by tRNA
recognition, there has been significant selective pressure to discriminate the cognate aa
from other small molecules in the cell. Understanding the mechanisms by which aaRSs
discriminate small molecules provides the opportunity to design drugs that are small molecule inhibitors of specific aaRSs. The present work has identified the discrimination mechanism exploited by the unrelated LysRS1 and LysRS2. The characterization of the
AEC resistance mechanism, originally thought to belong to LysRS1, in LysRS2 variants demonstrate the potential to design drugs specifically targeting LysRS1. A further question to be addressed following this work is the rational design of drugs to selectively inhibit LysRS1, which is present in several bacterial pathogens such as
Borrelia burgdorferi and Treponema pallidum. Several libraries of chemical compounds and software that search for docking sites on structures of LysRS1 and LysRS2 are good starting points in the search for new inhibitors. After initial selection and testing, extra modifications based on the discrimination of Lys by each LysRS should be added to the compounds, and retesting performed. The chemical screen followed by specific
162 modifications to target LysRS1 by using a smaller or more compact portion of the
compound to bind in the Lys pocket, may result in promising inhibitors with the potential
to become drug treatments for bacterial infections resulting from pathogens that harbor
exclusively LysRS1.
The initial work on studying the advantages of the simultaneous existence of both
LysRS1 and LysRS2 in B. cereus led to identification of a non-canonical tRNA, which can be aminoacylated in the presence of both enzymes. Further characterization of tRNAOther will involve the identification of the folding structure of this tRNA and how each one of the identity elements contributes to folding and interaction with the
LysRS1:LysRS2 complex. This characterization will involve attempts to obtain crystals of the LysRS1:LysRS2 complex containing tRNAOther in order to stabilize the structure.
Understanding the molecular mechanism of how the LysRS1:LysRS2 complex is formed
and how the complex contacts tRNAOther will be greatly facilitated by solution of the
crystal structure.
Investigations to identify the amino acid found attached to tRNAOther in vivo will indicate the aaRS to which this tRNA is a substrate, perhaps in addition to the
LysRS1:LysRS2 complex. Following this study, characterization of the possible codon decoded by aa-tRNAOther will help to explain its usage in translation. Using the B. cereus
∆other strain prepared and characterized in this study, the function of tRNAOther will
almost certainly be determined. Upon further characterization of the phenotypes retrieved in the BIOLOG assay and using those conditions to perform proteomics analysis and
DNA transcriptional arrays should provide sufficient data to deconvolute the possible role of tRNAOther.
163 The results obtained in this work indicate that the presence of LysRS1 and
LysRS2 confers advantages to the cell by using tRNAOther as substrate in B. cereus
14579. Bioinformatics analyses of other sequenced bacterial genomes that contain both
LysRSs, such as B. cereus 10897 and B. thuringiensis, did not identify the presence of tRNAOther. Possibly each organism possesses its own non-canonical tRNA which is used for specialized functions such as insertion of a non-canonical aa in response to a certain codon, to regulate transcription or translation of genes, or even to regulate secondary metabolism or cell differentiation. Further comprehensive study of other bacteria that contain LysRS1 and LysRS2 will reveal the purpose of the continued evolutionary retention of both LysRSs by few organism.
164 REFERENCES
1. Arnez, J. G. and Moras, D. (1997) Structural and functional considerations of the aminoacylation reaction. Trends Biochem. Sci. 22, 211-216.
2. O'Donoghue, P. and Luthey-Schulten, Z. (2003) On the evolution of structure in aminoacyl-tRNA synthetases. Microbiol. Mol. Biol. Rev. 67, 550-573.
3. Ibba, M. and Söll, D. (1999) Quality control mechanisms during translation. Science 286, 1893-1897.
4. Dale, T. and Uhlenbeck, O. C. (2005) Amino acid specificity in translation. Trends Biochem. Sci. 30, 659-665.
5. Ibba, M. and Söll, D. (2004) Aminoacyl-tRNAs: setting the limits of the genetic code. Genes Dev. 18, 731-738.
6. Zhang, C. M., Perona, J. J., Ryu, K., Francklyn, C., and Hou, Y. M. (2006) Distinct Kinetic Mechanisms of the Two Classes of Aminoacyl-tRNA Synthetases. J. Mol. Biol. 361, 300-311.
7. Eriani, G., Delarue, M., Poch, O., Gangloff, J., and Moras, D. (1990) Partition of tRNA synthetases into two classes based on mutually exclusive sets of sequence motifs. Nature 347, 203-206.
8. Cusack, S., Berthet-Colominas, C., Hartlein, M., Nassar, N., and Leberman, R. (1990) A second class of synthetase structure revealed by X-ray analysis of Escherichia coli seryl-tRNA synthetase at 2.5 Å. Nature 347, 249-255.
9. Ibba, M., Morgan, S., Curnow, A. W., Pridmore, D. R., Vothknecht, U. C., Gardner, W., Lin, W., Woese, C. R., and Söll, D. (1997) A euryarchaeal lysyl- tRNA synthetase: resemblance to class I synthetases. Science 278, 1119-1122.
10. Terada, T., Nureki, O., Ishitani, R., Ambrogelly, A., Ibba, M., Söll, D., and Yokoyama, S. (2002) Functional convergence of two lysyl-tRNA synthetases with unrelated topologies. Nat. Struct. Biol. 9, 257-262. .
165 11. Cusack, S. (1993) Sequence, structure and evolutionary relationships between class 2 aminoacyl-tRNA synthetases: an update. Biochimie 75, 1077-1081. 12. Nagel, G. M. and Doolittle, R. F. (1995) Phylogenetic analysis of the aminoacyl-tRNA synthetases. J. Mol. Evol. 40, 487-498.
13. Ribas de Pouplana, L. and Schimmel, P. (2001) Two classes of tRNA synthetases suggested by sterically compatible dockings on tRNA acceptor stem. Cell 104, 191-193.
14. Giegé, R., Sissler, M., and Florentz, C. (1998) Universal rules and idiosyncratic features in tRNA identity. Nucleic Acids Res. 26, 5017-5035.
15. Hendrickson, T. L., de Crécy Lagard, V., and Schimmel, P. (2004) Incorporation of nonnatural amino acids into proteins. Annu. Rev. Biochem. 73, 147-176.
16. Geslain, R. and Ribas de Pouplana, L. (2004) Regulation of RNA function by aminoacylation and editing? Trends Genet. 20, 604-610.
17. Hurdle, J. G., O'Neill, A. J., and Chopra, I. (2005) Prospects for aminoacyl-tRNA synthetase inhibitors as new antimicrobial agents. Antimicrob. Agents Chemother. 49, 4821-4833.
18. Bilokapic, S., Maier, T., Ahel, D., Gruic-Sovulj, I., Söll, D., Weygand-Durasevic, I., and Ban, N. (2006) Structure of the unusual seryl-tRNA synthetase reveals a distinct zinc-dependent mode of substrate recognition. EMBO J.
19. Hartman, M. C., Josephson, K., and Szostak, J. W. (2006) Enzymatic aminoacylation of tRNA with unnatural amino acids. Proc. Natl. Acad. Sci. U. S. A 103, 4356-4361.
20. Cavarelli, J., Eriani, G., Rees, B., Ruff, M., Boeglin, M., Mitschler, A., Martin, F., Gangloff, J., Thierry, J. C., and Moras, D. (1994) The active site of yeast aspartyl- tRNA synthetase: structural and functional aspects of the aminoacylation reaction. EMBO J. 13, 327-337.
21. Berthet-Colominas, C., Seignovert, L., Härtlein, M., Grotli, M., Cusack, S., and Leberman, R. (1998) The crystal structure of asparaginyl-tRNA synthetase from Thermus thermophilus and its complexes with ATP and asparaginyl-adenylate: the mechanism of discrimination between asparagine and aspartic acid. EMBO J. 17, 2947-2960.
22. Nakatsu, T., Kato, H., and Oda, J. (1998) Crystal structure of asparagine synthetase reveals a close evolutionary relationship to class II aminoacyl-tRNA synthetase. Nat. Struct. Biol. 5, 15-19.
166 23. Agou, F., Quevillon, S., Kerjan, P., and Mirande, M. (1998) Switching the amino acid specificity of an aminoacyl-tRNA synthetase. Biochemistry 37, 11309- 11314.
24. First, E. A. (1997) in Comprehensive Biological Catalysis: A Mechanistic Reference (Sinnott, M., Garner, C. D., First, E. A., and Davies, G., Eds.) pp 573- 607, Academic Press Limited.
25. Wells, T. N. and Fersht, A. R. (1986) Use of binding energy in catalysis analyzed by mutagenesis of the tyrosyl-tRNA synthetase. Biochemistry 25, 1881-1886.
26. de Prat, G. G., Duckworth, H. W., and Fersht, A. R. (1993) Modification of the amino acid specificity of tyrosyl-tRNA synthetase by protein engineering. FEBS Lett. 318, 167-171.
27. Turner, J. M., Graziano, J., Spraggon, G., and Schultz, P. G. (2006) Structural plasticity of an aminoacyl-tRNA synthetase active site. Proc. Natl. Acad. Sci. U. S. A 103, 6483-6488.
28. Ataide, S. F. and Ibba, M. (2004) Discrimination of cognate and noncognate substrates at the active site of class II lysyl-tRNA synthetase. Biochemistry 43, 11836-11841.
29. Wang, S., Prætorius-Ibba, M., Ataide, S. F., Roy, H., and Ibba, M. (2006) Discrimination of cognate and noncognate substrates at the active site of class I lysyl-tRNA synthetase. Biochemistry 45, 3646-3652.
30. Alexander, R. W. and Schimmel, P. (2001) Domain-domain communication in aminoacyl-tRNA synthetases. Prog. Nucleic Acid Res. Mol. Biol. 69, 317-349.
31. Sherlin, L. D. and Perona, J. J. (2003) tRNA-dependent active site assembly in a class I aminoacyl-tRNA synthetase. Structure. 11, 591-603.
32. Uter, N. T., Gruic-Sovulj, I., and Perona, J. J. (2005) Amino acid-dependent transfer RNA affinity in a class I aminoacyl-tRNA synthetase. J. Biol. Chem. 280, 23966-23977.
33. Cavarelli, J., Delagoutte, B., Eriani, G., Gangloff, J., and Moras, D. (1998) L- arginine recognition by yeast arginyl-tRNA synthetase. EMBO J. 17, 5438-5448.
34. Delagoutte, B., Moras, D., and Cavarelli, J. (2000) tRNA aminoacylation by arginyl-tRNA synthetase: induced conformations during substrates binding. EMBO J. 19, 5599-5610.
35. Sekine, S., Nureki, O., Dubois, D. Y., Bernier, S., Chênevert, R., Lapointe, J., Vassylyev, D. G., and Yokoyama, S. (2003) ATP binding by glutamyl-tRNA
167 synthetase is switched to the productive mode by tRNA binding. EMBO J. 22, 676-688.
36. Ibba, M., Losey, H. C., Kawarabayasi, Y., Kikuchi, H., Bunjun, S., and Söll, D. (1999) Substrate recognition by class I lysyl-tRNA synthetases: a molecular basis for gene displacement. Proc. Natl. Acad. Sci. U. S. A 96, 418-423.
37. Bovee, M. L., Pierce, M. A., and Francklyn, C. S. (2003) Induced fit and kinetic mechanism of adenylation catalyzed by Escherichia coli threonyl-tRNA synthetase. Biochemistry 42, 15102-15113.
38. Kobayashi, T., Takimura, T., Sekine, R., Kelly, V. P., Kamata, K., Sakamoto, K., Nishimura, S., and Yokoyama, S. (2005) Structural snapshots of the KMSKS loop rearrangement for amino acid activation by bacterial tyrosyl-tRNA synthetase. J. Mol. Biol. 346, 105-117.
39. Werner, R. G., Thorpe, L. F., Reuter, W., and Nierhaus, K. H. (1976) Indolmycin inhibits prokaryotic tryptophanyl-tRNA ligase. Eur. J. Biochem. 68, 1-3.
40. Nass, G. and Thomale, J. (1974) Alteration of structure of level of threonyl- tRNA-synthetase in Borrelidin resistant mutants of E. coli. FEBS Lett. 39, 182- 186.
41. Yanagisawa, T., Lee, J. T., Wu, H. C., and Kawakami, M. (1994) Relationship of protein structure of isoleucyl-tRNA synthetase with pseudomonic acid resistance of Escherichia coli. A proposed mode of action of pseudomonic acid as an inhibitor of isoleucyl-tRNA synthetase. J. Biol. Chem. 269, 24304-24309.
42. Hurdle, J. G., O'Neill, A. J., Ingham, E., Fishwick, C., and Chopra, I. (2004) Analysis of mupirocin resistance and fitness in Staphylococcus aureus by molecular genetic and structural modeling techniques. Antimicrob. Agents Chemother. 48, 4366-4376.
43. Kawamura, T., Liu, D., Towle, M. J., Kageyama, R., Tsukahara, N., Wakabayashi, T., and Littlefield, B. A. (2003) Anti-angiogenesis effects of borrelidin are mediated through distinct pathways: threonyl-tRNA synthetase and caspases are independently involved in suppression of proliferation and induction of apoptosis in endothelial cells. J. Antibiot. (Tokyo) 56, 709-715.
44. Otoguro, K., Ui, H., Ishiyama, A., Kobayashi, M., Togashi, H., Takahashi, Y., Masuma, R., Tanaka, H., Tomoda, H., Yamada, H., and Omura, S. (2003) In vitro and in vivo antimalarial activities of a non-glycosidic 18-membered macrolide antibiotic, borrelidin, against drug-resistant strains of Plasmodia. J. Antibiot. (Tokyo) 56, 727-729.
168 45. Ruan, B., Bovee, M. L., Sacher, M., Stathopoulos, C., Poralla, K., Francklyn, C. S., and Söll, D. (2005) A unique hydrophobic cluster near the active site contributes to differences in borrelidin inhibition among threonyl-tRNA synthetases. J. Biol. Chem. 280, 571-577.
46. Kitabatake, M., Ali, K., Demain, A., Sakamoto, K., Yokoyama, S., and Söll, D. (2002) Indolmycin resistance of Streptomyces coelicolor A3(2) by induced expression of one of its two tryptophanyl-tRNA synthetases. J. Biol. Chem. 277, 23882-23887.
47. Werner, R. G. and Reuter, W. (1979) Interaction of indolmycin in the metabolism of tryptophan in rat liver. Arzneimittelforschung. 29, 59-63.
48. Pohlmann, J. and Brotz-Oesterhelt, H. (2004) New aminoacyl-tRNA synthetase inhibitors as antibacterial agents. Curr. Drug Targets. Infect. Disord. 4, 261-272.
49. Hurdle, J. G., O'Neill, A. J., and Chopra, I. (2004) Anti-staphylococcal activity of indolmycin, a potential topical agent for control of staphylococcal infections. J. Antimicrob. Chemother. 54, 549-552.
50. Kanamaru, T., Nakano, Y., Toyoda, Y., Miyagawa, K. I., Tada, M., Kaisho, T., and Nakao, M. (2001) In vitro and in vivo antibacterial activities of TAK-083, an agent for treatment of Helicobacter pylori infection. Antimicrob. Agents Chemother. 45, 2455-2459.
51. Nakama, T., Nureki, O., and Yokoyama, S. (2001) Structural basis for the recognition of isoleucyl-adenylate and an antibiotic, mupirocin, by isoleucyl- tRNA synthetase. J. Biol. Chem. 276, 47387-47393.
52. Silvian, L. F., Wang, J., and Steitz, T. A. (1999) Insights into editing from an Ile- tRNA synthetase structure with tRNAIle and mupirocin. Science 285, 1074-1077.
53. Bernier, S., Dubois, D. Y., Therrien, M., Lapointe, J., and Chênevert, R. (2000) Synthesis of glutaminyl adenylate analogues that are inhibitors of glutaminyl- tRNA synthetase. Bioorg. Med. Chem. Lett. 10, 2441-2444.
54. Brown, M. J., Mensah, L. M., Doyle, M. L., Broom, N. J., Osbourne, N., Forrest, A. K., Richardson, C. M., O'Hanlon, P. J., and Pope, A. J. (2000) Rational design of femtomolar inhibitors of isoleucyl tRNA synthetase from a binding model for pseudomonic acid-A. Biochemistry 39, 6003-6011.
55. Forrest, A. K., Jarvest, R. L., Mensah, L. M., O'Hanlon, P. J., Pope, A. J., and Sheppard, R. J. (2000) Aminoalkyl adenylate and aminoacyl sulfamate intermediate analogues differing greatly in affinity for their cognate Staphylococcus aureus aminoacyl tRNA synthetases. Bioorg. Med. Chem. Lett. 10, 1871-1874.
169 56. Tao, J. and Schimmel, P. (2000) Inhibitors of aminoacyl-tRNA synthetases as novel anti-infectives. Expert. Opin. Investig. Drugs 9, 1767-1775.
57. Reader, J. S., Ordoukhanian, P. T., Kim, J. G., de Crécy Lagard, V., Hwang, I., Farrand, S., and Schimmel, P. (2005) Major biocontrol of plant tumors targets tRNA synthetase. Science 309, 1533.
58. Metlitskaya, A., Kazakov, T., Kommer, A., Pavlova, O., Prætorius-Ibba, M., Ibba, M., Krasheninnikov, I., Kolb, V., Khmel, I., and Severinov, K. (2006) Aspartyl- tRNA synthetase is the target of peptidenucleotide antibiotic microcin C. J. Biol. Chem. In Press.
59. Nureki, O., Vassylyev, D. G., Tateno, M., Shimada, A., Nakama, T., Fukai, S., Konno, M., Hendrickson, T. L., Schimmel, P., and Yokoyama, S. (1998) Enzyme structure with two catalytic sites for double-sieve selection of substrate. Science 280, 578-582.
60. Fukai, S., Nureki, O., Sekine, S., Shimada, A., Tao, J., Vassylyev, D. G., and Yokoyama, S. (2000) Structural basis for double-sieve discrimination of L-valine from L-isoleucine and L-threonine by the complex of tRNAVal and valyl-tRNA synthetase. Cell 103, 793-803.
61. Fukunaga, R. and Yokoyama, S. (2005) Structural basis for non-cognate amino acid discrimination by the valyl-tRNA synthetase editing domain. J. Biol. Chem. 280, 29937-29945.
62. Tukalo, M., Yaremchuk, A., Fukunaga, R., Yokoyama, S., and Cusack, S. (2005) The crystal structure of leucyl-tRNA synthetase complexed with tRNALeu in the post-transfer-editing conformation. Nat. Struct. Mol. Biol. 12, 923-930.
63. Nangle, L. A., de Crécy Lagard, V., Döring, V., and Schimmel, P. (2002) Genetic code ambiguity. Cell viability related to the severity of editing defects in mutant tRNA synthetases. J. Biol. Chem. 277, 45729-45733.
64. Lue, S. W. and Kelley, S. O. (2005) An aminoacyl-tRNA synthetase with a defunct editing site. Biochemistry 44, 3010-3016.
65. Roy, H., Ling, J., Alfonzo, J., and Ibba, M. (2005) Loss of editing activity during the evolution of mitochondrial phenylalanyl-tRNA synthetase. J. Biol. Chem. 280, 38186-38192.
66. Schmidt, E. and Schimmel, P. (1995) Residues in a class I tRNA synthetase which determine selectivity of amino acid recognition in the context of tRNA. Biochemistry 34, 11204-11210.
170 67. Hendrickson, T. L., Nomanbhoy, T. K., and Schimmel, P. (2000) Errors from selective disruption of the editing center in a tRNA synthetase. Biochemistry 39, 8180-8186.
68. Hendrickson, T. L., Nomanbhoy, T. K., de Crécy Lagard, V., Fukai, S., Nureki, O., Yokoyama, S., and Schimmel, P. (2002) Mutational separation of two pathways for editing by a class I tRNA synthetase. Mol. Cell 9, 353-362.
69. Pezo, V., Metzgar, D., Hendrickson, T. L., Waas, W. F., Hazebrouck, S., Döring, V., Marlière, P., Schimmel, P., and de Crécy-Lagard, V. (2004) Artificially ambiguous genetic code confers growth yield advantage. Proc. Natl. Acad. Sci. U. S. A 101, 8593-8597.
70. Nomanbhoy, T. K., Hendrickson, T. L., and Schimmel, P. (1999) Transfer RNA- dependent translocation of misactivated amino acids to prevent errors in protein synthesis. Mol. Cell 4, 519-528.
71. Lincecum, T. L., Jr., Tukalo, M., Yaremchuk, A., Mursinna, R. S., Williams, A. M., Sproat, B. S., Van Den, E. W., Link, A., Van Calenbergh, S., Grotli, M., Martinis, S. A., and Cusack, S. (2003) Structural and mechanistic basis of pre- and posttransfer editing by leucyl-tRNA synthetase. Mol. Cell 11, 951-963.
72. Gao, W., Goldman, E., and Jakubowski, H. (1994) Role of carboxy-terminal region in proofreading function of methionyl-tRNA synthetase in Escherichia coli. Biochemistry 33, 11528-11535.
73. Jakubowski, H. (1996) The synthetic/editing active site of an aminoacyl-tRNA synthetase: evidence for binding of thiols in the editing subsite. Biochemistry 35, 8252-8259.
74. Beuning, P. J. and Musier-Forsyth, K. (2000) Hydrolytic editing by a class II aminoacyl-tRNA synthetase. Proc. Natl. Acad. Sci. U. S. A 97, 8916-8920.
75. Beebe, K., Ribas de Pouplana, L., and Schimmel, P. (2003) Elucidation of tRNA- dependent editing by a class II tRNA synthetase and significance for cell viability. EMBO J. 22, 668-675.
76. Dock-Bregeon, A., Sankaranarayanan, R., Romby, P., Caillet, J., Springer, M., Rees, B., Francklyn, C. S., Ehresmann, C., and Moras, D. (2000) Transfer RNA- mediated editing in threonyl-tRNA synthetase. The class II solution to the double discrimination problem. Cell 103, 877-884.
77. Kotik-Kogan, O., Moor, N., Tworowski, D., and Safro, M. (2005) Structural basis for discrimination of L-phenylalanine from L-tyrosine by phenylalanyl-tRNA synthetase. Structure. 13, 1799-1807.
171 78. Roy, H., Ling, J., Irnov, M., and Ibba, M. (2004) Post-transfer editing in vitro and in vivo by the beta subunit of phenylalanyl-tRNA synthetase. EMBO J. 23, 4639- 4648.
79. Mursinna, R. S., Lee, K. W., Briggs, J. M., and Martinis, S. A. (2004) Molecular dissection of a critical specificity determinant within the amino acid editing domain of leucyl-tRNA synthetase. Biochemistry 43, 155-165.
80. Williams, A. M. and Martinis, S. A. (2006) Mutational unmasking of a tRNA- dependent pathway for preventing genetic code ambiguity. Proc. Natl. Acad. Sci. U. S. A 103, 3586-3591.
81. Dock-Bregeon, A. C., Rees, B., Torres-Larios, A., Bey, G., Caillet, J., and Moras, D. (2004) Achieving error-free translation; the mechanism of proofreading of threonyl-tRNA synthetase at atomic resolution. Mol. Cell 16, 375-386.
82. Beuning, P. J. and Musier-Forsyth, K. (2001) Species-specific differences in amino acid editing by class II prolyl-tRNA synthetase. J. Biol. Chem. 276, 30779- 30785.
83. Zhang, H., Huang, K., Li, Z., Banerjei, L., Fisher, K. E., Grishin, N. V., Eisenstein, E., and Herzberg, O. (2000) Crystal structure of YbaK protein from Haemophilus influenzae (HI1434) at 1.8 Å resolution: functional implications. Proteins 40, 86-97.
84. An, S. and Musier-Forsyth, K. (2004) Trans-editing of Cys-tRNAPro by Haemophilus influenzae YbaK protein. J. Biol. Chem. 279, 42359-42362.
85. Wong, F. C., Beuning, P. J., Silvers, C., and Musier-Forsyth, K. (2003) An isolated class II aminoacyl-tRNA synthetase insertion domain is functional in amino acid editing. J. Biol. Chem. 278, 52857-52864.
86. Ruan, B. and Söll, D. (2005) The bacterial YbaK protein is a Cys-tRNAPro and Cys-tRNACys deacylase. J. Biol. Chem. 280, 25887-25891.
87. Lim, K., Tempczyk, A., Bonander, N., Toedt, J., Howard, A., Eisenstein, E., and Herzberg, O. (2003) A catalytic mechanism for D-Tyr-tRNATyr deacylase based on the crystal structure of Hemophilus influenzae HI0670. J. Biol. Chem. 278, 13496-13502.
88. Soutourina, J., Plateau, P., Delort, F., Peirotes, A., and Blanquet, S. (1999) Functional characterization of the D-Tyr-tRNATyr deacylase from Escherichia coli. J. Biol. Chem. 274, 19109-19114.
89. Ferri-Fioni, M. L., Schmitt, E., Soutourina, J., Plateau, P., Mechulam, Y., and Blanquet, S. (2001) Structure of crystalline D-Tyr-tRNATyr deacylase. A
172 representative of a new class of tRNA-dependent hydrolases. J. Biol. Chem. 276, 47285-47290.
90. Korencic, D., Ahel, I., Schelert, J., Sacher, M., Ruan, B., Stathopoulos, C., Blum, P., Ibba, M., and Söll, D. (2004) A freestanding proofreading domain is required for protein synthesis quality control in Archaea. Proc. Natl. Acad. Sci. U. S. A 101, 10260-10265.
91. Dwivedi, S., Kruparani, S. P., and Sankaranarayanan, R. (2005) A D-amino acid editing module coupled to the translational apparatus in archaea. Nat. Struct. Mol. Biol. 12, 556-557.
92. Döring, V., Mootz, H. D., Nangle, L. A., Hendrickson, T. L., de Crécy-Lagard, V., Schimmel, P., and Marlière, P. (2001) Enlarging the amino acid set of Escherichia coli by infiltration of the valine coding pathway. Science 292, 501- 504.
93. Lee, J. W., Beebe, K., Nangle, L. A., Jang, J., Longo-Guess, C. M., Cook, S. A., Davisson, M. T., Sundberg, J. P., Schimmel, P., and Ackerman, S. L. (2006) Editing-defective tRNA synthetase causes protein misfolding and neurodegeneration. Nature.
94. Curnow, A. W., Ibba, M., and Söll, D. (1996) tRNA-dependent asparagine formation. Nature 382, 589-590.
95. Tumbula, D. L., Becker, H. D., Chang, W. Z., and Soll, D. (2000) Domain- specific recruitment of amide amino acids for protein synthesis. Nature 407, 106- 110.
96. Raczniak, G., Becker, H. D., Min, B., and Söll, D. (2001) A single amidotransferase forms asparaginyl-tRNA and glutaminyl-tRNA in Chlamydia trachomatis. J. Biol. Chem. 276, 45862-45867.
97. Tumbula-Hansen, D., Feng, L., Toogood, H., Stetter, K. O., and Söll, D. (2002) Evolutionary divergence of the archaeal aspartyl-tRNA synthetases into discriminating and nondiscriminating forms. J. Biol. Chem. 277, 37184-37190.
98. Schmitt, E., Panvert, M., Blanquet, S., and Mechulam, Y. (2005) Structural basis for tRNA-dependent amidotransferase function. Structure. 13, 1421-1433.
99. Ibba, M., Curnow, A. W., and Söll, D. (1997) Aminoacyl-tRNA synthesis: divergent routes to a common goal. Trends Biochem. Sci. 22, 39-42.
100. Rinehart, J., Krett, B., Rubio, M. A., Alfonzo, J. D., and Söll, D. (2005) Saccharomyces cerevisiae imports the cytosolic pathway for Gln-tRNA synthesis into the mitochondrion. Genes Dev. 19, 583-592.
173 101. Varshney, U. and RajBhandary, U. L. (1992) Role of methionine and formylation of initiator tRNA in initiation of protein synthesis in Escherichia coli. J. Bacteriol. 174, 7819-7826.
102. Vial, L., Gomez, P., Panvert, M., Schmitt, E., Blanquet, S., and Mechulam, Y. (2003) Mitochondrial methionyl-tRNAfMet formyltransferase from Saccharomyces cerevisiae: gene disruption and tRNA substrate specificity. Biochemistry 42, 932- 939.
103. Guillon, J. M., Heiss, S., Soutourina, J., Mechulam, Y., Laalami, S., Grunberg- Manago, M., and Blanquet, S. (1996) Interplay of methionine tRNAs with translation elongation factor Tu and translation initiation factor 2 in Escherichia coli. J. Biol. Chem. 271, 22321-22325.
104. Low, S. C., Harney, J. W., and Berry, M. J. (1995) Cloning and functional characterization of human selenophosphate synthetase, an essential component of selenoprotein synthesis. J. Biol. Chem. 270, 21659-21664.
105. Low, S. C. and Berry, M. J. (1996) Knowing when not to stop: selenocysteine incorporation in eukaryotes. Trends Biochem. Sci. 21, 203-208.
106. Böck, A., Thanbichler, M., Rother, M., and Resh, A. (2005) in The Aminoacyl- tRNA syntehtase (Ibba, M., Francklyn, C. S., and Cusack, S., Eds.) pp 320-327, Landes Bioscience.
107. Sauerwald, A., Zhu, W., Major, T. A., Roy, H., Palioura, S., Jahn, D., Whitman, W. B., Yates, J. R., III, Ibba, M., and Söll, D. (2005) RNA-dependent cysteine biosynthesis in archaea. Science 307, 1969-1972.
108. Driscoll, D. M. and Copeland, P. R. (2003) Mechanism and regulation of selenoprotein synthesis. Annu. Rev. Nutr. 23, 17-40.
109. Krol, A. (2002) Evolutionarily different RNA motifs and RNA-protein complexes to achieve selenoprotein synthesis. Biochimie 84, 765-774.
110. Low, S. C., Grundner-Culemann, E., Harney, J. W., and Berry, M. J. (2000) SECIS-SBP2 interactions dictate selenocysteine incorporation efficiency and selenoprotein hierarchy. EMBO J. 19, 6882-6890.
111. Leibundgut, M., Frick, C., Thanbichler, M., Böck, A., and Ban, N. (2005) Selenocysteine tRNA-specific elongation factor SelB is a structural chimaera of elongation and initiation factors. EMBO J. 24, 11-22.
112. Brown, J. R., Gentry, D., Becker, J. A., Ingraham, K., Holmes, D. J., and Stanhope, M. J. (2003) Horizontal transfer of drug-resistant aminoacyl-transfer- RNA synthetases of anthrax and Gram-positive pathogens. EMBO Rep. 4, 692- 698. 174 113. Gentry, D. R., Ingraham, K. A., Stanhope, M. J., Rittenhouse, S., Jarvest, R. L., O'Hanlon, P. J., Brown, J. R., and Holmes, D. J. (2003) Variable sensitivity to bacterial methionyl-tRNA synthetase inhibitors reveals subpopulations of Streptococcus pneumoniae with two distinct methionyl-tRNA synthetase genes. Antimicrob. Agents Chemother. 47, 1784-1789.
114. Henkin, T. M., Glass, B. L., and Grundy, F. J. (1992) Analysis of the Bacillus subtilis tyrS gene: conservation of a regulatory sequence in multiple tRNA synthetase genes. J. Bacteriol. 174, 1299-1306.
115. Gendron, N., Putzer, H., and Grunberg-Manago, M. (1994) Expression of both Bacillus subtilis threonyl-tRNA synthetase genes is autogenously regulated. J. Bacteriol. 176, 486-494.
116. Putzer, H., Gendron, N., and Grunberg-Manago, M. (1992) Co-ordinate expression of the two threonyl-tRNA synthetase genes in Bacillus subtilis: control by transcriptional antitermination involving a conserved regulatory sequence. EMBO J. 11, 3117-3127.
117. Buddha, M. R. and Crane, B. R. (2005) Structures of tryptophanyl-tRNA synthetase II from Deinococcus radiodurans bound to ATP and tryptophan. Insight into subunit cooperativity and domain motions linked to catalysis. J. Biol. Chem. 280, 31965-31973.
118. Buddha, M. R., Keery, K. M., and Crane, B. R. (2004) An unusual tryptophanyl tRNA synthetase interacts with nitric oxide synthase in Deinococcus radiodurans. Proc. Natl. Acad. Sci. U. S. A 101, 15881-15886.
119. Fujimura, S., Tokue, Y., and Watanabe, A. (2003) Isoleucyl-tRNA synthetase mutations in Staphylococcus aureus clinical isolates and in vitro selection of low- level mupirocin-resistant strains. Antimicrob. Agents Chemother. 47, 3373-3374.
120. Hodgson, J. E., Curnock, S. P., Dyke, K. G., Morris, R., Sylvester, D. R., and Gross, M. S. (1994) Molecular characterization of the gene encoding high-level mupirocin resistance in Staphylococcus aureus J2870. Antimicrob. Agents Chemother. 38, 1205-1208.
121. Thomas, D. G., Wilson, J. M., Day, M. J., and Russell, A. D. (1999) Mupirocin resistance in staphylococci: development and transfer of isoleucyl-tRNA synthetase-mediated resistance in vitro. J. Appl. Microbiol. 86, 715-722.
122. Ambrogelly, A., Korencic, D., and Ibba, M. (2002) Functional annotation of class I lysyl-tRNA synthetase phylogeny indicates a limited role for gene transfer. J. Bacteriol. 184, 4594-4600.
175 123. Ataide, S. F., Jester, B. C., Devine, K. M., and Ibba, M. (2005) Stationary-phase expression and aminoacylation of a transfer-RNA-like small RNA. EMBO Rep. 6, 742-747.
124. DeLano, W. L. (2002) The PyMOL Molecular Graphics System. http://www. pymol. org.
125. Ibba, M. and Söll, D. (2000) Aminoacyl-tRNA synthesis. Annu. Rev. Biochem. 69, 617-650.
126. Söll, D., Becker, H. D., Plateau, P., Blanquet, S., and Ibba, M. (2000) Context- dependent anticodon recognition by class I lysyl-tRNA synthetases. Proc. Natl. Acad. Sci. U. S. A 97, 14224-14228.
127. Levengood, J., Ataide, S. F., Roy, H., and Ibba, M. (2004) Divergence in noncognate amino acid recognition between class I and class II lysyl-tRNA synthetases. J. Biol. Chem. 279, 17707-17714.
128. Jester, B. C., Levengood, J. D., Roy, H., Ibba, M., and Devine, K. M. (2003) Nonorthologous replacement of lysyl-tRNA synthetase prevents addition of lysine analogues to the genetic code. Proc. Natl. Acad. Sci. U. S. A 100, 14351-14356.
129. Brevet, A., Chen, J., Lévêque, F., Blanquet, S., and Plateau, P. (1995) Comparison of the enzymatic properties of the two Escherichia coli lysyl-tRNA synthetase species. J. Biol. Chem. 270, 14439-14444.
130. Clark, R. L. and Neidhardt, F. C. (1990) Roles of the two lysyl-tRNA synthetases of Escherichia coli: analysis of nucleotide sequences and mutant behavior. J. Bacteriol. 172, 3237-3243.
131. Gazeau, M., Delort, F., Dessen, P., Blanquet, S., and Plateau, P. (1992) Escherichia coli leucine-responsive regulatory protein (Lrp) controls lysyl-tRNA synthetase expression. FEBS Lett. 300, 254-258.
132. Lévêque, F., Plateau, P., Dessen, P., and Blanquet, S. (1990) Homology of lysS and lysU, the two Escherichia coli genes encoding distinct lysyl-tRNA synthetase species. Nucleic Acids Res. 18, 305-312.
133. Lévêque, F., Gazeau, M., Fromant, M., Blanquet, S., and Plateau, P. (1991) Control of Escherichia coli lysyl-tRNA synthetase expression by anaerobiosis. J. Bacteriol. 173, 7903-7910.
134. Jakubowski, H. (1999) Misacylation of tRNALys with noncognate amino acids by lysyl-tRNA synthetase. Biochemistry 38, 8088-8093.
176 135. Desogus, G., Todone, F., Brick, P., and Onesti, S. (2000) Active site of lysyl- tRNA synthetase: structural studies of the adenylation reaction. Biochemistry 39, 8418-8425.
136. Onesti, S., Desogus, G., Brevet, A., Chen, J., Plateau, P., Blanquet, S., and Brick, P. (2000) Structural studies of lysyl-tRNA synthetase: conformational changes induced by substrate binding. Biochemistry 39, 12853-12861.
137. Frugier, M., Moulinier, L., and Giegé, R. (2000) A domain in the N-terminal extension of class IIb eukaryotic aminoacyl-tRNA synthetases is important for tRNA binding. EMBO J. 19, 2371-2380.
138. Francin, M., Kaminska, M., Kerjan, P., and Mirande, M. (2002) The N-terminal domain of mammalian Lysyl-tRNA synthetase is a functional tRNA-binding domain. J. Biol. Chem. 277, 1762-1769.
139. Beaulande, M., Kron, M., Hirakata, M., and Härtlein, M. (2001) Human anti- asparaginyl-tRNA synthetase autoantibodies (anti-KS) increase the affinity of the enzyme for its tRNA substrate. FEBS Lett. 494, 170-174.
140. Cirakoglu, B., Mirande, M., and Waller, J. P. (1985) A model for the structural organization of aminoacyl-tRNA synthetases in mammalian cells. FEBS Lett. 183, 185-190.
141. Mirande, M., Gache, Y., Le Corre, D., and Waller, J. P. (1982) Seven mammalian aminoacyl-tRNA synthetases co-purified as high molecular weight entities are associated within the same complex. EMBO J. 1, 733-736.
142. Kleiman, L. and Cen, S. (2004) The tRNALys packaging complex in HIV-1. Int. J. Biochem. Cell Biol. 36, 1776-1786.
143. Sylvers, L. A., Rogers, K. C., Shimizu, M., Ohtsuka, E., and Söll, D. (1993) A 2- thiouridine derivative in tRNAGlu is a positive determinant for aminoacylation by Escherichia coli glutamyl-tRNA synthetase. Biochemistry 32, 3836-3841.
144. Stuart, J. W., Gdaniec, Z., Guenther, R., Marszalek, M., Sochacka, E., Malkiewicz, A., and Agris, P. F. (2000) Functional anticodon architecture of human tRNALys3 includes disruption of intraloop hydrogen bonding by the naturally occurring amino acid modification, t6A. Biochemistry 39, 13396-13404.
145. Sundaram, M., Durant, P. C., and Davis, D. R. (2000) Hypermodified nucleosides in the anticodon of tRNALys stabilize a canonical U-turn structure. Biochemistry 39, 12575-12584.
146. Ambrogelly, A., Frugier, M., Ibba, M., Söll, D., and Giegé, R. (2005) Transfer RNA recognition by class I lysyl-tRNA synthetase from the Lyme disease pathogen Borrelia burgdorferi. FEBS Lett. 579, 2629-2634. 177 147. Tamura, K., Himeno, H., Asahara, H., Hasegawa, T., and Shimizu, M. (1992) In vitro study of E.coli tRNAArg and tRNALys identity elements. Nucleic Acids Res. 20, 2335-2339.
148. Commans, S., Lazard, M., Delort, F., Blanquet, S., and Plateau, P. (1998) tRNA anticodon recognition and specification within subclass IIb aminoacyl-tRNA synthetases. J. Mol. Biol. 278, 801-813.
149. McClain, W. H., Foss, K., Jenkins, R. A., and Schneider, J. (1990) Nucleotides that determine Escherichia coli tRNAArg and tRNALys acceptor identities revealed by analyses of mutant opal and amber suppressor tRNAs. Proc. Natl. Acad. Sci. U. S. A 87, 9260-9264.
150. Shiba, K., Stello, T., Motegi, H., Noda, T., Musier-Forsyth, K., and Schimmel, P. (1997) Human lysyl-tRNA synthetase accepts nucleotide 73 variants and rescues Escherichia coli double-defective mutant. J. Biol. Chem. 272, 22809-22816.
151. Helm, M., Brule, H., Degoul, F., Cepanec, C., Leroux, J. P., Giegé, R., and Florentz, C. (1998) The presence of modified nucleotides is required for cloverleaf folding of a human mitochondrial tRNA. Nucleic Acids Res. 26, 1636- 1643.
152. Durant, P. C., Bajji, A. C., Sundaram, M., Kumar, R. K., and Davis, D. R. (2005) Structural effects of hypermodified nucleosides in the Escherichia coli and human tRNALys anticodon loop: the effect of nucleosides s2U, mcm5U, mcm5s2U, mnm5s2U, t6A, and ms2t6A. Biochemistry 44, 8078-8089.
153. Francklyn, C., Perona, J. J., Puetz, J., and Hou, Y. M. (2002) Aminoacyl-tRNA synthetases: versatile players in the changing theater of translation. RNA. 8, 1363- 1372.
154. Ibba, M., Becker, H. D., Stathopoulos, C., Tumbula, D. L., and Söll, D. (2000) The adaptor hypothesis revisited. Trends Biochem. Sci. 25, 311-316.
155. Cusack, S. (1997) Aminoacyl-tRNA synthetases. Curr. Opin. Struct. Biol. 7, 881- 889.
156. Chen, J., Brevet, A., Lapadat-Tapolsky, M., Blanquet, S., and Plateau, P. (1994) Properties of the lysyl-tRNA synthetase gene and product from the extreme thermophile Thermus thermophilus. J. Bacteriol. 176, 2699-2705.
157. Wilkinson, A. J., Fersht, A. R., Blow, D. M., and Winter, G. (1983) Site-directed mutagenesis as a probe of enzyme structure and catalysis: tyrosyl-tRNA synthetase cysteine-35 to glycine-35 mutation. Biochemistry 22, 3581-3586.
178 158. Hughes, S. J., Tanner, J. A., Hindley, A. D., Miller, A. D., and Gould, I. R. (2003) Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment. BMC. Struct. Biol. 3, 5.
159. Harwood, C. R. and Cutting, S. M. (1990) Molecular Biological Methods for Bacillus John Wiley & Sons Ltd..
160. Commans, S., Blanquet, S., and Plateau, P. (1995) A single substitution in the motif 1 of Escherichia coli lysyl-tRNA synthetase induces cooperativity toward amino acid binding. Biochemistry 34, 8180-8189.
161. Joyce, C. M. and Grindley, N. D. (1984) Method for determining whether a gene of Escherichia coli is essential: application to the polA gene. J. Bacteriol. 158, 636-643.
162. Kunkel, T. A., Bebenek, K., and McClary, J. (1991) Efficient site-directed mutagenesis using uracil-containing DNA. Methods Enzymol. 204, 125-139.
163. Christner, P., Yankowski, R. L., Benditt, M., and Jimenez, S. A. (1996) Alteration in the conformational stability of collagen caused by the incorporation of the lysine analogue S-2-aminoethylcysteine. Biochim. Biophys. Acta 1294, 37-47.
164. Baturina, I. D., Gnutchev, N. V., Khomutov, R. M., and Kisselev, L. L. (1972) Substrate specificity of lysyl-tRNA synthetase from E. coli B. FEBS Lett. 22, 235- 237.
165. Stern, R. and Mehler, A. H. (1965) Lysyl-sRNA synthetase from Escherichia coli. Biochem. Z. 342, 400-409.
166. Takita, T., Ohkubo, Y., Shima, H., Muto, T., Shimizu, N., Sukata, T., Ito, H., Saito, Y., Inouye, K., Hiromi, K., and Tonomura, B. (1996) Lysyl-tRNA synthetase from Bacillus stearothermophilus. Purification, and fluorometric and kinetic analysis of the binding of substrates, L-lysine and ATP. J. Biochem. (Tokyo) 119, 680-689.
167. Chenna, R., Sugawara, H., Koike, T., Lopez, R., Gibson, T. J., Higgins, D. G., and Thompson, J. D. (2003) Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res. 31, 3497-3500.
168. Koradi, R., Billeter, M., and Wuthrich, K. (1996) MOLMOL: a program for display and analysis of macromolecular structures. J. Mol. Graph. 14, 51-32.
169. Tempest, D. W., Meers, J. L., and Brown, C. M. (1970) Influence of environment on the content and composition of microbial free amino acid pools. J. Gen. Microbiol. 64, 171-185.
179 170. Raunio, R. and Rosenqvist, H. (1970) Amino acid pool of Escherichia coli during the different phases of growth. Acta Chem. Scand. 24, 2737-2744.
171. Roe, A. J., McLaggan, D., Davidson, I., O'Byrne, C., and Booth, I. R. (1998) Perturbation of anion balance during inhibition of growth of Escherichia coli by weak acids. J. Bacteriol. 180, 767-772.
172. Grundy, F. J., Lehman, S. C., and Henkin, T. M. (2003) The L box regulon: lysine sensing by leader RNAs of bacterial lysine biosynthesis genes. Proc. Natl. Acad. Sci. U. S. A 100, 12057-12062.
173. Sudarsan, N., Wickiser, J. K., Nakamura, S., Ebert, M. S., and Breaker, R. R. (2003) An mRNA structure in bacteria that controls gene expression by binding lysine. Genes Dev. 17, 2688-2697.
174. Liu, J., Ibba, M., Hong, K. W., and Söll, D. (1998) The terminal adenosine of tRNAGln mediates tRNA-dependent amino acid recognition by glutaminyl-tRNA synthetase. Biochemistry 37, 9836-9842.
175. Hendrickson, T. L. and Schimmel, P. (2003) in Translation Mechanisms (Lapointe, J. and Brakier-Gingras, L., Eds.) pp 34-64, Kluwer Academic/Plenum Publishers.
176. Polycarpo, C., Ambrogelly, A., Ruan, B., Tumbula-Hansen, D., Ataide, S. F., Ishitani, R., Yokoyama, S., Nureki, O., Ibba, M., and Söll, D. (2003) Activation of the pyrrolysine suppressor tRNA requires formation of a ternary complex with class I and class II lysyl-tRNA synthetases. Mol. Cell 12, 287-294.
177. Raczniak, G., Ibba, M., and Söll, D. (2001) Genomics-based identification of targets in pathogenic bacteria for potential therapeutic and diagnostic use. Toxicology 160, 181-189.
178. Tao, H., Bausch, C., Richmond, C., Blattner, F. R., and Conway, T. (1999) Functional genomics: expression analysis of Escherichia coli growing on minimal and rich media. J. Bacteriol. 181, 6425-6440.
179. Woese, C. R., Olsen, G. J., Ibba, M., and Söll, D. (2000) Aminoacyl-tRNA synthetases, the genetic code, and the evolutionary process. Microbiol. Mol. Biol. Rev. 64, 202-236.
180. Blight, S. K., Larue, R. C., Mahapatra, A., Longstaff, D. G., Chang, E., Zhao, G., Kang, P. T., Green-Church, K. B., Chan, M. K., and Krzycki, J. A. (2004) Direct charging of tRNACUA with pyrrolysine in vitro and in vivo. Nature 431, 333-335.
181. Roy, H., Becker, H. D., Reinbolt, J., and Kern, D. (2003) When contemporary aminoacyl-tRNA synthetases invent their cognate amino acid metabolism. Proc. Natl. Acad. Sci. U. S. A 100, 9837-9842. 180 182. Sissler, M., Delorme, C., Bond, J., Ehrlich, S. D., Renault, P., and Francklyn, C. (1999) An aminoacyl-tRNA synthetase paralog with a catalytic role in histidine biosynthesis. Proc. Natl. Acad. Sci. U. S. A 96, 8985-8990.
183. Polycarpo, C., Ambrogelly, A., Berube, A., Winbush, S. M., McCloskey, J. A., Crain, P. F., Wood, J. L., and Söll, D. (2004) An aminoacyl-tRNA synthetase that specifically activates pyrrolysine. Proc. Natl. Acad. Sci. U. S. A 101, 12450- 12454.
184. Rasko, D. A., Ravel, J., Økstad, O. A., Helgason, E., Cer, R. Z., Jiang, L., Shores, K. A., Fouts, D. E., Tourasse, N. J., Angiuoli, S. V., Kolonay, J., Nelson, W. C., Kolstø, A. B., Fraser, C. M., and Read, T. D. (2004) The genome sequence of Bacillus cereus ATCC 10987 reveals metabolic adaptations and a large plasmid related to Bacillus anthracis pXO1. Nucleic Acids Res. 32, 977-988.
185. Ivanova, N., Sorokin, A., Anderson, I., Galleron, N., Candelon, B., Kapatral, V., Bhattacharyya, A., Reznik, G., Mikhailova, N., Lapidus, A., Chu, L., Mazur, M., Goltsman, E., Larsen, N., D'Souza, M., Walunas, T., Grechkin, Y., Pusch, G., Haselkorn, R., Fonstein, M., Ehrlich, S. D., Overbeek, R., and Kyrpides, N. (2003) Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature 423, 87-91.
186. Sampson, J. R. and Uhlenbeck, O. C. (1988) Biochemical and physical characterization of an unmodified yeast phenylalanine transfer RNA transcribed in vitro. Proc. Natl. Acad. Sci. U. S. A 85, 1033-1037.
187. Ribeiro, S., Nock, S., and Sprinzl, M. (1995) Purification of aminoacyl-tRNA by affinity chromatography on immobilized Thermus thermophilus EF-Tu.GTP. Anal. Biochem. 228, 330-335.
188. Kapushoc, S. T., Alfonzo, J. D., and Simpson, L. (2002) Differential localization of nuclear-encoded tRNAs between the cytosol and mitochondrion in Leishmania tarentolae. RNA. 8, 57-68.
189. Brosius, J. and Holy, A. (1984) Regulation of ribosomal RNA promoters with a synthetic lac operator. Proc. Natl. Acad. Sci. U. S. A 81, 6929-6933.
190. Martinez, E., Bartolome, B., and de la, C. F. (1988) pACYC184-derived cloning vectors containing the multiple cloning site and lacZ alpha reporter gene of pUC8/9 and pUC18/19 plasmids. Gene 68, 159-162.
191. de Saizieu, A., Vankan, P., Vockler, C., and van Loon, A. P. (1997) The trp RNA- binding attenuation protein (TRAP) regulates the steady-state levels of transcripts of the Bacillus subtilis folate operon. Microbiology 143 (3), 979-989.
181 192. Salazar, J. C., Ambrogelly, A., Crain, P. F., McCloskey, J. A., and Söll, D. (2004) A truncated aminoacyl-tRNA synthetase modifies RNA. Proc. Natl. Acad. Sci. U. S. A 101, 7536-7541.
193. Baron, C. and Böck, A. (1991) The length of the aminoacyl-acceptor stem of the selenocysteine- specific tRNASec of Escherichia coli is the determinant for binding to elongation factors SELB or Tu. J. Biol. Chem. 266, 20375-20379.
194. Storz, G., Opdyke, J. A., and Zhang, A. (2004) Controlling mRNA stability and translation with small, noncoding RNAs. Curr. Opin. Microbiol. 7, 140-144.
195. Fechter, P., Rudinger-Thirion, J., Florentz, C., and Giegé, R. (2001) Novel features in the tRNA-like world of plant viral RNAs. Cell Mol. Life Sci. 58, 1547- 1561.
196. Graffe, M., Dondon, J., Caillet, J., Romby, P., Ehresmann, C., Ehresmann, B., and Springer, M. (1992) The specificity of translational control switched with transfer RNA identity rules. Science 255, 994-996.
197. Giegé, R., Frugier, M., and Rudinger, J. (1998) tRNA mimics. Curr. Opin. Struct. Biol. 8, 286-293.
198. Kim, D. W., Chater, K. F., Lee, K. J., and Hesketh, A. (2005) Effects of growth phase and the developmentally significant bldA-specified tRNA on the membrane-associated proteome of Streptomyces coelicolor. Microbiology 151, 2707-2720.
199. Kim, D. W., Chater, K., Lee, K. J., and Hesketh, A. (2005) Changes in the extracellular proteome caused by the absence of the bldA gene product, a developmentally significant tRNA, reveal a new target for the pleiotropic regulator AdpA in Streptomyces coelicolor. J. Bacteriol. 187, 2957-2966.
200. Helgason, E., Økstad, O. A., Caugant, D. A., Johansen, H. A., Fouet, A., Mock, M., Hegna, I., and Kolstø (2000) Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis--one species on the basis of genetic evidence. Appl. Environ. Microbiol. 66, 2627-2630.
201. van Schaik, W., Tempelaars, M. H., Wouters, J. A., de Vos, W. M., and Abee, T. (2004) The alternative sigma factor sigmaB of Bacillus cereus: response to stress and role in heat adaptation. J. Bacteriol. 186, 316-325.
202. Risoen, P. A., Ronning, P., Hegna, I. K., and Kolstø, A. B. (2004) Characterization of a broad range antimicrobial substance from Bacillus cereus. J. Appl. Microbiol. 96, 648-655.
203. Vagner, V., Dervyn, E., and Ehrlich, S. D. (1998) A vector for systematic gene inactivation in Bacillus subtilis. Microbiology 144 (11), 3097-3104. 182 204. Hornstra, L. M., de Vries, Y. P., de Vos, W. M., Abee, T., and Wells-Bennik, M. H. (2005) gerR, a novel ger operon involved in L-alanine- and inosine-initiated germination of Bacillus cereus ATCC 14579. Appl. Environ. Microbiol. 71, 774- 781.
205. Baker, J., Limberger, R., Schneider, S. J., and Campbell, A. (1991) Recombination and modular exchange in the genesis of new lambdoid phages. New Biol. 3, 297-308.
206. de Vries, Y. P., Atmadja, R. D., Hornstra, L. M., de Vos, W. M., and Abee, T. (2005) Influence of glutamate on growth, sporulation, and spore properties of Bacillus cereus ATCC 14579 in defined medium. Appl. Environ. Microbiol. 71, 3248-3254.
207. NAKATA, H. M. and HALVORSON, H. O. (1960) Biochemical changes occurring during growth and sporulation of Bacillus cereus. J. Bacteriol. 80, 801- 810.
208. Stewart, G. S., Johnstone, K., Hagelberg, E., and Ellar, D. J. (1981) Commitment of bacterial spores to germinate. A measure of the trigger reaction. Biochem. J. 198, 101-106.
209. Bochner, B. R. (2003) New technologies to assess genotype-phenotype relationships. Nat. Rev. Genet. 4, 309-314.
210. de Vries, Y. P., Hornstra, L. M., Atmadja, R. D., Schaik, W., de Vos, W. M., and Abee, T. (2005) Deletion of sigB in Bacillus cereus affects spore properties. FEMS Microbiol. Lett. 252, 169-173.
211. de Vries, Y. P., Hornstra, L. M., de Vos, W. M., and Abee, T. (2004) Growth and sporulation of Bacillus cereus ATCC 14579 under defined conditions: temporal expression of genes for key sigma factors. Appl. Environ. Microbiol. 70, 2514- 2519.
212. Wang, L., Xie, J., and Schultz, P. G. (2006) Expanding the genetic code. Annu. Rev. Biophys. Biomol. Struct. 35, 225-249.
183