Molecular Identification of Blow Flies Recovered from Human Cadavers

Malaysian J Pathol 2012; 34(2) : 127 – 132 ORIGINAL ARTICLE Molecular identifi cation of blow fl ies recovered from human cadavers during crime scene investigations in Malaysia Rajagopal KAVITHA BSc, MSc, *Wasi Ahmad NAZNI PhD, **Tian Chye TAN PhD, *Han Lim LEE PhD, ***Mohd Noor MAT ISA PhD and Mohd SOFIAN AZIRUN PhD. Institute of Biological Sciences, Faculty of Science, University of Malaya *Medical Entomology Unit, Institute for Medical Research, Kuala Lumpur, **Department of Parasitology, Faculty of Medicine, University of Malaya and ***Malaysia Genome Institute, Selangor, Malaysia Abstract Forensic entomology applies knowledge about insects associated with decedent in crime scene investigation. It is possible to calculate a minimum postmortem interval (PMI) by determining the age and species of the oldest blow fl y larvae feeding on decedent. This study was conducted in Malaysia to identify maggot specimens collected during crime scene investigations. The usefulness of the molecular and morphological approach in species identifi cations was evaluated in 10 morphologically identifi ed blow fl y larvae sampled from 10 different crime scenes in Malaysia. The molecular identifi cation method involved the sequencing of a total length of 2.2 kilo base pairs encompassing the ‘barcode’ fragments of the mitochondrial cytochrome oxidase I (COI), cytochrome oxidase II (COII) and t-RNA leucine genes. Phylogenetic analyses confi rmed the presence of Chrysomya megacephala, Chrysomya rufi facies and Chrysomya nigripes. In addition, one unidentifi ed blow fl y species was found based on phylogenetic tree analysis. Keywords: Forensic entomology, blowfl y, molecular identifi cation. INTRODUCTION subfamilies of Calliphoridae.5,6 mtDNA offers several advantages over nuclear DNA. The Entomological evidence can be applied in criminal latter undergoes relatively slow mutation rates investigation. In particular, the calculation of larva compared to mtDNA, so identifi cation would age allows the determination of a minimum require a much longer nucleotide sequence postmortem interval (PMI) which is often than is necessary with mtDNA. This makes important information for police investigation. mtDNA a better tool to determine differences Species identifi cation is needed and very important in sequences of closely related species,7 for for the entomological evidence to be useful in molecular identifi cation. the crime scene investigation. Thus, it is crucial A review of the literature showed that in to correctly identify the larva species feeding Malaysia, most studies on forensic entomology on decedent to calculate the PMI.1 At present, a were based on collection of larvae from animal major challenge in forensic entomology is that carcasses. This is attributed mainly to limited immature larvae have to be collected, preserved access to human corpses in Malaysia. Hence data and reared until emergence for identifi cation. on the occurrence of the larvae of forensically Calliphorine fl ies are one of the earliest visitors important blow fl y in decedent is limited. This infesting a decedent with their larvae.2 To study aims to evaluate the usefulness of the ensure correct species identifi cation, established molecular identification of blow fly larvae molecular methods are now increasingly used in recovered from human corpses and to compare the fi eld of forensic investigation.3,4 Analysis of the fi ndings with the morphological identifi cation mitochondrial DNA (mtDNA) appeared to be a of blow fl y larvae. useful tool in species identifi cation among the Address for correspondence and reprint requests: Dr Lee Han Lim, Medical Entomology Unit, Institute for Medical Research, Jalan Pahang, 50588 Kuala Lumpur, Malaysia. Tel: 03-2616-2688; Fax: 03-2616-2688. Email: [email protected] 127 Malaysian J Pathol December 2012 MATERIALS AND METHODS to 50ng/µl prior to PCR amplifi cation step. The amplifi ed mtDNA region spans a total of 2.2 kb Specimen collection and includes the cytochrome oxidase I and II Maggot specimens were collected from genes (COI and COII) and t-RNA leucine gene. decedents during crime scene investigations. PCR amplifi cation mixtures were prepared to Maggot samples from 10 different crime scenes contain the following: 100ng of template DNA, were each collected directly into two bottles 1 unit of Taq polymerase (Promega®, USA), containing 70% ethanol and stored at room 1 x PCR reaction buffer (Promega®), 1.5 temperature. mM MgCl2 (Promega®) and 200 µM of each dNTPs (Promega®) and 0.4 µM of each forward Processing of larvae for morphological and reverse primers (1st Base). Amplifi cation identifi cation reactions were performed in a T1 Thermocycler Specimens in 70% ethanol were transferred into (Biometra®). Three sets of primers were used a petri dish using forceps. Posterior segments of in this study and were designed based on the the maggots were cut vertically with a surgical description of Sperling et al,3 (Table 1). blade. The maggots were then soaked in 10% The PCR cycling conditions were as follow: potassium hydroxide (KOH) overnight for muscle initial denaturation 95°C for 5 min, 35 cycles softening purposes. On the next day, the internal of denaturation 95°C for 1 min, elongation organs of maggots were removed carefully to 72°C for 2 min, fi nal elongation 72°C for 7 avoid damage to the taxonomically important min. It was found that the optimum annealing parts, such as posterior spiracles, spines, anterior temperatures was 47.4°C for COI and t-RNA spiracles and the cephalopharyngeal skeleton. leucine, and 50.2°C for COII. The PCR products The maggots were later soaked in acetic acid for were separated electrophoretically on 1% agarose 10 minutes to neutralize the KOH. The process gel (Promega®) and visualized after ethidium was then continued by soaking the specimens in bromide staining. PCR products were purifi ed ascending series of ethanol at 30%, 50%, 70% prior to cloning or direct sequencing using and 90% for 30 minutes in each concentration either the QIAquick® PCR Purifi cation Kit in order to dehydrate the specimen. The maggots or QIAquick® Gel Extraction Kit (QIAGEN. were then soaked in absolute alcohol for 30 Purifi ed PCR products were then cloned into minutes and cleared in clove oil for 30 minutes. the pGEM®-T Easy vector system (Promega®) Finally the processed specimens were soaked in to facilitate DNA sequencing procedures. xylene for 30 minutes before being mounted on Sequencing was performed using ABI Prism™ glass slides with a few drops of Canada balsam. BigDye™ Terminator Cycle Sequencing Ready The slides were dried in an incubator for 1-2 Reaction Kit (version 3.1, Applied Biosystems®, days. The maggots were identifi ed under a light Foster City). All the samples were sequenced microscope at 100X and 400X magnifi cation for both forward and reverse DNA strands. using taxonomy keys of Zumpt.8 Electrophoresis and detection of the sequencing reaction products was carried out in the capillary Processing of larvae for molecular identifi cation electrophoresis system ABI PRISM™ 3730xl Total DNA was prepared from maggot specimens capillary DNA sequencer with a capillary length using QIAamp DNA Mini Kit (QIAGEN Inc., of 80cm. Valencia, CA) following the manufacturer’s The reference sequence for previously reported instructions. The extracted blow fl y DNA was blow fl ies recovered from cadavers in Malaysia9 eluted in 200µl of elution buffer and kept at namely, Calliphora vicina AJ417702, Chrysomya -20°C. The fraction of extracted DNA was bezziana AF295548, Chrysomya megacephala spectrophotometrically quantitated and diluted TABLE 1. Primer sequences used to amplify overlapping segments of the mitochondrial COI, COII and t-RNA leucine genes. Primer ID Sequence (5’-3’) TY-J-1460 TACAATTTATCGCCTAAACTTCAGCC CI-N-2800 CATTTCAAGCTGTGTAAGCATC CI-J-2495 CAGCTACTTTATGAGCTTTAGG TK-N-3775 GAGACCATTACTTGCTTTCAGTCATCT 128 MOLECULAR IDENTIFICATION OF BLOW FLIES AF295551, Chrysomya nigripes GU174026, oxidase subunit I and II genes (COI and COII) Chrysomya pinguis AY092759, Chrysomya and the t-RNA leucine gene. One individual rufi facies AF083658, Chrysomya villeneuvi per species was sequenced over this region. FJ195382, Hemipyrellia liguriens AY097334, The voucher deposit of all the specimens was Hermatia illucens GQ465783, Lucilia cuprina stored at the Medical Entomology Unit, Institute AJ417707, Megaselia scalaris AF217464, for Medical Research, which is the WHO Ophyra spinigera EU627714, Sarcophaga Collaborator Centre for Vectors since 1985. rufi cornis EF405941, Synthesiomyia nudiseta The details of the origin, collection date of the EU627713 were retrieved from GenBank and data samples, voucher deposit and GenBank used for the phylogenetic analysis. Sequence references numbers are presented in Table 2. alignment and a neighbour-joining tree10 were The sequences have been deposited in GenBank made using MEGA 4 bootstrap support derived under accession numbers from JN 228993 to from 1,000 replicates and values above 50% JN 229003. are shown in the phylogenetic tree.11 All the In this study, the complete 2.2 kilobase sequences obtained from the 10 cases were nucleotide fragment was amplifi ed. Phylogenetic included in the phylogenetic analysis. analysis of the relationships between the blow fl y maggots was shown in Fig 1. C. megacephala RESULTS were found in six cases, C. rufi facies in two cases and C. nigripes in one case. Morphology The mitochondrial DNA (mtDNA) region and molecular identifi cations are in concordance sequenced in this study included the cytochrome

Load more