DNA Barcoding Identifies Argentine Fishes from Marine and Brackish Waters

Ezequiel Mabragan˜ a1,2*, Juan MartıńDıáz de Astarloa1,2, Robert Hanner3, Junbin Zhang4, Mariano Gonza´lez Castro1,2 1 Laboratorio de Biotaxonomıá Morfolo´gica y Molecular de Peces, Instituto de Investigaciones Marinas y Costeras, Facultad de Ciencias Exactas y Naturales, Universidad Nacional de Mar del Plata, Mar del Plata, Argentina, 2 Consejo Nacional de Investigaciones Cientı´ficas y Tećnicas, Argentina, 3 Biodiversity Institute of Ontario and Department of Integrative Biology, University of Guelph, Ontario Canada, 4 College of Fisheries and Life Science, Shanghai Ocean University, Shanghai

Abstract

Background: DNA barcoding has been advanced as a promising tool to aid species identification and discovery through the use of short, standardized gene targets. Despite extensive taxonomic studies, for a variety of reasons the identification of fishes can be problematic, even for experts. DNA barcoding is proving to be a useful tool in this context. However, its broad application is impeded by the need to construct a comprehensive reference sequence library for all fish species. Here, we make a regional contribution to this grand challenge by calibrating the species discrimination efficiency of barcoding among 125 Argentine fish species, representing nearly one third of the known fauna, and examine the utility of these data to address several key taxonomic uncertainties pertaining to species in this region.

Methodology/Principal Findings: Specimens were collected and morphologically identified during crusies conducted between 2005 and 2008. The standard BARCODE fragment of COI was amplified and bi-directionally sequenced from 577 specimens (mean of 5 specimens/species), and all specimens and sequence data were archived and interrogated using analytical tools available on the Barcode of Life Data System (BOLD; www.barcodinglife.org). Nearly all species exhibited discrete clusters of closely related haplogroups which permitted the discrimination of 95% of the species (i.e. 119/125) examined while cases of shared haplotypes were detected among just three species-pairs. Notably, barcoding aided the identification of a new species of skate, Dipturus argentinensis, permitted the recognition of Genypterus brasiliensis as a valid species and questions the generic assignment of Paralichthys isosceles.

Conclusions/Significance: This study constitutes a significant contribution to the global barcode reference sequence library for fishes and demonstrates the utility of barcoding for regional species identification. As an independent assessment of alpha taxonomy, barcodes provide robust support for most morphologically based taxon concepts and also highlight key areas of taxonomic uncertainty worthy of reappraisal.

Citation: MabraganãE,Dıáz de Astarloa JM, Hanner R, Zhang J, Gonza´lez Castro M (2011) DNA Barcoding Identifies Argentine Fishes from Marine and Brackish Waters. PLoS ONE 6(12): e28655. doi:10.1371/journal.pone.0028655 Editor: Vincent Laudet, Ecole Normale Supe´rieure de Lyon, France Received March 9, 2011; Accepted November 12, 2011; Published December 9, 2011 Copyright: ß 2011 Mabraganã et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This research was supported through funding to Consejo Nacional de Investigaciones Cientı´ficas y Tećnicas, under the Argentina iBOL funds, Comisioń de Investigaciones Cientı´ficas and Universidad Nacional de Mardel Plata funds (Argentina), and through funding to the Canadian Barcode of Life Network from Genome (through the Ontario Genomics Institute) and Natural Sciences and Engineering Research Council of Canada. The funders have no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected]

Introduction [6], although it is not intended to replace classical taxonomy [1]. Its purpose is to facilitate species identifications by non-experts and to Despite ongoing scientific debate concerning the role of molecular do so in a rapid and cost-effective manner [7]. The effectiveness of methods in taxonomy DNA barcoding has emerged as a widely barcoding has been demonstrated in diverse taxa, including accepted tool for species identification because of its enhanced focus springtails [8], spiders [9], butterflies [2,3,10–12], flies [13], bivalves on standardization and data validation [1]. Barcoding [2–4] seeks to [14], fishes [15], birds [16,17] and mammals [18–20], with extend species identification capabilities by using short, standardized barcoding systems also now being established for plants [21], gene regions for the efficient and cost-effective identification of macroalgae [22], and bacteria [23]. eukaryotes. Advocating the use of an easily characterized 648 bP The Fish Barcode of Life campaign (FISH-BOL) [24] seeks to fragment from the mitochondrial 59 region of the cytochrome c establish a standard reference sequence library for the molecular oxidase subunit I (COI) gene for animal identification, the primary identification of fishes worldwide [25]. The identification process goal of barcoding focuses on the assembly of reference sequence using COI sequence data for fishes is promising, as supported by libraries derived from expert-identified voucher specimens in order recent examples of its application. DNA barcoding surveys of 207 to develop reliable molecular tools for species identification in nature Australian marine fish species [15] and 210 Australasian shark and [5]. Barcoding has been mischaracterized as molecular taxonomy ray species [26] have concluded that DNA barcoding can be used

PLoS ONE | www.plosone.org 1 December 2011 | Volume 6 | Issue 12 | e28655 DNA Barcoding of Argentine Fishes for both teleost and chondricthyan species identification. Hubert et specimens are generally recalcitrant to DNA analyses due to of al. [5] were able to distinguish 93% of 190 Canadian freshwaters their fixation in formalin, a dedicated collecting effort of fresh fishes using the mitochondrial DNA COI gene. Steinke et al. [27] material was required from Argentinean waters. We examined demonstrated that sequence variability in the barcode region the patterns of barcode sequence divergence among 577 permitted discrimination of 98% of 201 fish species from the specimens identified as belonging to 125 fish species, representing Canadian Pacific. Ward and Holmes [28] analysed the DNA nearly one third of the known fauna [33,35,43]. The investigation barcode region in 388 species of fishes, including 4 holocephali not only provides the potential use of DNA barcoding as a tool to and 61 elasmobranchs showing the discrimination of 98–99% of aid traditional taxonomy in the identification of Argentinean fish species examined thus far. In addition, barcodes were marine fish species, but also explores the application of DNA subsequently used to identify marine fish larvae from Australian barcodes to flag overlooked species and discusses the potential [29,30] and Antarctic [31] waters. limitations inherent to the existing morphologically-based taxo- The ichthyofauna of the Argentine continental shelf is well nomic system. known due to information obtained by large foreign expeditions and local research cruises since the early twentieth Century [32– Materials and Methods 35, 36 and references therein]. However, taxonomic resolution remains elusive for some challenging groups, and new species Ethics Statement remain to be discovered as evidenced by the ongoing description All tissue samples were extracted from specimens that were of new species [35,37–42]. collected as part of other biological studies carried out with The aim of this study is to extend barcode coverage to appropriate permissions from local authorities: Comisio´n de Argentine marine and brackish water fishes. Because museum Investigaciones Cientı´ficas de la Provincia de Buenos Aires,

Figure 1. Collection sites for specimens examined in this study. Black triangles correspond to northern samples, shelf of Buenos Aires province; green circle correspond to samples collected in Mar Chiquita coastal lagoon; red triangles correspond to samples of inner shelf of Patagonian waters, and blue circles, samples of outer shelf of Patagonian waters. Numbers are provided to facilitate species collection sites of table 2. doi:10.1371/journal.pone.0028655.g001

PLoS ONE | www.plosone.org 2 December 2011 | Volume 6 | Issue 12 | e28655 DNA Barcoding of Argentine Fishes

Table 1. Polymorphic nucleotide sites in the COI, haplotype presently studying or has reviewed the group in the region in designation (Hd) and absolute haplotype frequency (n), for question’’ and Level 2: ‘‘identification made with high degree of specimens of Psammobatis normani and P. rudis. confidence at all levels—specimen identified by a trained identifier who had prior knowledge of the group in the region or used available literature to identify the specimen’’. Some of the specimens were deposited in the fish collection of INIDEP; the Hd n Position other specimens studied were kept only as e-voucher (See Table 133 160 457 493 501 S1). All sequence assemblies, electropherogram (trace) files, P. normani 3T T T G T primer sequences and specimen provenance data were deposited P. rudis A 8..... in the publicly accessible ‘‘Fishes of Argentina’’ Project (code FARG) on the Barcode of Life Database (BOLD, [44]). This P. rudis B5..C.. included digital images of morphological voucher specimens, sex P. rudis C 3...A. and ontogenetic stage (post larval, juvenile or adult), total and P. rudis D1.GC.. standard length as well as GPS coordinates for all specimen P. rudis E1A.... collection localities. P. rudis F 1....G P. rudis G 1TTTGT DNA Analysis Muscle tissue samples were taken from whole specimens and doi:10.1371/journal.pone.0028655.t001 genomic DNA extracted according to the protocol of Ivanova et al. [45]. Amplification of the 59 barcode region of COI was first Argentina. (CIC, Ref. Leg. 56/S06); Consejo Nacional de attempted using FF2d_t1/FR1d_t1 primer combination and Investigaciones Cientı´ficas y Te´cnicas (CONICET, Fdo iBOL C_FishF1t1/C_FishR1t1 primer cocktails [46]. The primer Argentina/2008) and Universidad Nacional de Mar del Plata, combination C_FishF1t1 contained two primers (FishF2_t1/ Argentina (UNMdP, EXA 407/08). VF2_t1), and C_FishR1t1 also contained two primers (FishR2_ t1/FR1d_t1) (Table 1). All primers were appended with M13 tails Sampling and Taxonomic Coverage to facilitate sequencing. PCR reactions were performed in 96-well A total of 577 specimens of fishes collected in Argentine waters, plates. The reaction master mix consisted of 825 ml water, 125 ml representing 125 species, 98 genera, and 63 families were 106 buffer, 62.5 ml MgCl2 (25 mM), 6.25 ml dNTP (10 mM), analyzed. 77 of these species were collected during research 6.25 ml each primer (0.01 mM) and 6.25 ml Taq DNA polymerase cruises conducted by the National Institute for Fisheries Research (5 U/ml) was prepared for each plate, and each well contained and Development (INIDEP) in the Argentine Sea, whereas the 10.5 ml mixture and 2 ml genomic DNA. The PCR reaction profile other 49 species came from researches conducted by the was comprised of an initial step of 2 min at 95uC and 35 cycles of Laboratorio de Ictiologı´a of Universidad Nacional de Mar del 30 sec at 94uC, 40 sec at 52uC, and 1 min at 72uC, with a final Plata in Mar Chiquita coastal lagoon and off Mar del Plata coast extension at 72uC for 10 min. Amplicons were visualized on 2% (Figure 1, Table S1). Methods followed recommendations of agarose E-GelH 96-well system (Invitrogen). Sequencing reactions FISH-BOL [24]. Vouchers were morphologically identified used M13 forward and reverse primers using the BigDyeH following the identification reliability levels 1 and 2 according Terminator v.3.1 Cycle Sequencing Kit (Applied Biosystems, to the Fish-BOL collaborator’s protocol [25]; Level 1: ‘‘highly Inc.), and the reaction profile was comprised of an initial step of reliable identification—specimen identified by (1) an internation- 2 min at 96uC and 35 cycles of 30 sec at 96uC, 15 sec at 55uC, ally recognized authority of the group, or (2) a specialist that is and 4 min at 60uC. Products were directly sequenced using an

Table 2. Primers used for amplification of fishes from Argentine.

Primer combination Primer designation Nucleotide

FF2d_t1 59TGTAAAACGACGGCCAGTTTCTCCACCAACCACAARGAYATYGG 39 C_FishF1t1 FishF2_t1 59TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC 39 VF2_t1 59TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC 39 C_FishR1t1 FishR2_t1 59CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA 39 FR1d_t1 59CAGGAAACAGCTATGACACCTCAGGGTGTCCGAARAAYCARAA 39 C_VF1LFt1 VF1_t1 59TGTAAAACGACGGCCAGTTCTCAACCAACCACAAAGACATTGG 39 VF1d_t1 59TGTAAAACGACGGCCAGTTCTCAACCAACCACAARGAYATYGG39 LepF1_t1 59TGTAAAACGACGGCCAGTATTCAACCAATCATAAAGATATTGG39 VFli_t1 59TGTAAAACGACGGCCAGTTCTCAACCAACCAIAAIGAIATIGG39 C_VR1LRt1 VR1_t1 59CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCRAARAAYCA39 VR1d_t1 59CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCAAAGAATCA 39 LepR1_t1 59CAGGAAACAGCTATGACTAAACTTCTGGATGTCCAAAAAATCA39 VRli_t1 59CAGGAAACAGCTATGACTAGACTTCTGGGTGICCIAAIAAICA39

M13 tails are underlined. Some of the primers were already published by [46]. doi:10.1371/journal.pone.0028655.t002

PLoS ONE | www.plosone.org 3 December 2011 | Volume 6 | Issue 12 | e28655 DNA Barcoding of Argentine Fishes

ABI 3730 capillary sequencer according to manufacturer’s comprised four primers (VR1_t1/VR1d_t1/LepR1_t1/VRli_t1) instructions. For specimens that failed to amplify using the primer (Table 2). The PCR reaction profile consisted of 1 min at 95uC combinations above, C_VF1LFt1/C_ VR1LRt1 primer combi- and 35 cycles of 30 sec at 94uC, 40 sec at 50uC, and 1 min at nations [46] were tried. C_VF1LFt1 consisted of four primers 72uC, with a final extension at 72uC for 10 min. All other (VF1_t1/VF1d_t1/LepF1_t1/VFli_t1), and C_VR1LRt1 also procedures followed those above. DNA sequences were aligned

Figure 2. Distribution of K2P distances (%) for COI within species (a), genera (b), families (c), orders (e) and classes (f). References: n = number of comparison, Min = minimum K2P distance, Mean = mean K2P distance, Max = maximum K2P distance expressed as percentage. doi:10.1371/journal.pone.0028655.g002

PLoS ONE | www.plosone.org 4 December 2011 | Volume 6 | Issue 12 | e28655 DNA Barcoding of Argentine Fishes with SeqScape v.2.1.1 software (Applied Biosystems, Inc.). and commonest model used for describing differentiation among Sequence divergences were calculated using the Kimura two species using COI. On the other hand, being K2P the standard parameter (K2P) distance model [47], and unrooted NJ pheno- model used in barcode studies allows a better comparison with grams based on K2P distances were created using BOLD. K2P other barcode studies. Other NJ trees analysing individual genera model was used because data set covers a large range of taxa were constructed using MEGA 4.1 [48] and were bootstrapped spanning many orders and mtDNA is subject to mutational 500 times to provide percentage bootstrap values for branch saturation at this level. Eventhough there are several distance points. Sequence data are available on both BOLD and GenBank models that take into account this issue, K2P is one of the simplest (Table S2).

Figure 3. Neighbour-joining tree of COI sequences from species of the family Rajidae. Solid triangles represent clusters of multiple specimens, with the vertical dimension proportional to the number of specimens, and the horizontal depth proportional to the genetic variation within that cluster. Blue indicates clusters of specimens that include more than one species that could not be resolved. Green indicates taxa with deep intra-specific divergence that represents distinct species. Number at nodes represent bootstrap values, (only values greater than 50 are given). Due to lower variability between some species, the Genus Bathyraja were separated to facilitate observation. doi:10.1371/journal.pone.0028655.g003

PLoS ONE | www.plosone.org 5 December 2011 | Volume 6 | Issue 12 | e28655 DNA Barcoding of Argentine Fishes

Results and Discussion (17.97%). Nearly all species exhibited unique barcode haplotypes or cohesive clusters of very closely related haplotypes, which Overall results permitted the discrimination of at least 95.2% of species (Appendix No stop codon, insertions or deletions were found in any of the S1). The K2P genetic distances averaged just 0.23% within amplified sequences, showing that all of them constitute functional species, but averaged 4.04% within genera, 16.99% within mitochondrial COI sequences. Of the 651 bases, 354 nucleotid families, 24.07% within orders and 25.21% within classes, sites were variable and most substitutions occurred in the third increasing value with taxonomic level (Figure 2). Hence, overall, nucleotide position within codons (61.3%). All the amplified there was a 17-fold more pronounced difference among sequences were larger than 600-bp, the limit typically observed for congeneric species than among conspecific individuals. NUMTs (nuclear DNA sequences originating from mtDNA) [49]. Cases of shared haplotypes were detected in six of the species As reported by Ward et al [24], in FISHBOL review, NUMTs do analyzed, including the following pairs: the skates Psammobatis rudis not appear to be a concern for fish barcoding. and P. normani, the anchovies Engraulis anchoita and Anchoa marinii, A total of 577 specimens, representing 125 species, 98 genera and between the oreos Allocyttus verrucosus and Pseudocyttus maculatus and 63 families were barcoded (Table S1). Average nucleotide (Figures 3, 4). Results observed within the genus Psammobatis will frequency were C (27.25%), T (30.74%), A (24.04%) and G be discuss later. The anchovies Engraulis anchoita (n = 3) and Anchoa

Figure 4. Neighbour-joining tree of COI sequences from species of the orders Clupeiformes and Zeiformes and family Nototheniidae (Perciformes). Solid triangles represent clusters of multiple specimens, with the vertical dimension proportional to the number of specimens, and the horizontal depth proportional to the genetic variation within that cluster. Blue indicates clusters of specimens that include more than one species that could not be resolved. Red indicates taxa with deep intra-specific divergence that potentially represents distinct species (see text for details). Number at nodes represent bootstrap values, (only values greater than 50 are given). doi:10.1371/journal.pone.0028655.g004

PLoS ONE | www.plosone.org 6 December 2011 | Volume 6 | Issue 12 | e28655 DNA Barcoding of Argentine Fishes marinii (n = 3), could not be separated by COI even though they Cynoscion guatucupa (1.72%, n = 5), Squalus acanthias (1.71%, n = 11), are two valid species of Engraulidae. These species have external Helicolenus lahillei (1.24%, n = 13), Parona signata (1.09%, n = 6), morphological features that allow differentiating each other; Iluocoetes fimbriatus (1.09%, n = 11) and Prionotus nudigula (1.09%, however when specimens are not well preserved it is more difficult n = 4). In addition, deep intraspecific divergences were found to identify them from images. Unfortunately these specimens were between individuals of Prepilus paru (12.3%, n = 2), this result will not retained and only the e-vouchers (digital images) have been be discuss later. As observed by Hebert et al. [3], species recorded to reliable re-checked the identification. From images it congeneric K2P distances were much higher than 2%, except can be seen that specimens identified as Engraulis anchoita clearly between some species of the genus Bathyraja, but each of these represent this species because of the broad silver stripe along flank, species formed cohesive units and were separated from each other the large size of the specimens (.14 cm TL), and the large eye size in the NJ tree (Figure 3). From the nine species of Bathyraja in relation to snout. However those specimens identified as Anchoa barcoded, only three of them presented divergent values .2%, marini are not well preserved (most lateral scales are missing, and whereas in the remain six, values were relatively lower, being the both dorsal and anal fins can not be recognized), so it is difficult lowest within B. albomaculata and B. macloviana (D = 0.61%) from images to identify them properly. Therefore, the lack of (Figure 3). The relatively low divergence found among species of discrimination at molecular level between these pairs of species is Bathyraja was also found by Spies et al. [54] studying the genetic likely a problem of misidentification. Regarding the zero variability in 15 species of skates from Alaska. From the 12 species divergence between Oreosomatid species from Argentina, this of the genus Bathyraja, four presented distances values relatively case is likely to be a misidentification. Allocyttus verrucosus and low (D,1%), even though all are morphologically different Pseudocyttus maculatus are the Oreosomatid species recorded in the species. southwest Atlantic [33,50,51]. Re-examination of e-vouchers allow identifying both specimens as Allocyttus verrucosus, because in both the first dorsal spine is much shorter than the second spine (the Comments on some individual genera opposite occurred in P. maculatus). On the other hand, Ward, [52] Chondrichthyes. The use of barcodes within an integrative in a general analysis of DNA barcoding divergence among fishes taxonomic framework confirmed the identification of a new worldwide, showed that specimens of Allocyttus verrucosus, Allocyttus species of longnose skate (Dipturus argentinensis) from the Argentine niger and Pseudocyttus maculatus from the Indian Ocean and Sea [40]. This work included, besides typical morphological Tasmanian waters were clearly identified using COI sequences features, the COI sequence as part of the description of the new and were separated from each other in the NJ tree. However, species. The seven specimens of D. argentinensis examined possess a specimens of A. verrucosus and P. maculatus from Argentina clustered unique haplotype that was substantially divergent from all other together and near those of A. niger from Indian Ocean. Therefore it Dipturus species represented in Barcode of Life Data Systems is possible that both individuals from Argentina are actually A. (n = 15 described+5 undescribed species). Individuals of the other niger, a species that had never been reported for the southwest two species that inhabit the Argentinean waters (D. chilensis and D. Atlantic Ocean [33,50,51] although Yearsley et al [53] in a book trachyderma) were attempted to be sequenced, but only the former of Australian seafood shows a point in the southwest Atlantic as amplified, even though protocols used were the same. The failure part of the distribution of this species. Further morphological and of COI to amplify in D. trachyderma could be the result of molecular studies are needed to clarify the actual taxonomic mutational differences in the primer sites, indicating that D. identification of these nominal species. trachyderma possesses a significantly divergent COI haplotype of its The maximum intraspecific genetic variation was below 1% in own [40]. Resulting NJ tree for the two species sequenced are 93.6% of the species analysed except for the following species: shown in Figure 3.

Figure 5. Neighbour-joining tree of COI sequences from species of Bathyraja from Argentina sea. Species in red indicates those assigned by Compagno [56] to the genus Bathyraja, where those in blue represent species assigned to the genus Rhinoraja (see text for details) Number at nodes represent bootstrap values, (only values greater than 50 are given). doi:10.1371/journal.pone.0028655.g005

PLoS ONE | www.plosone.org 7 December 2011 | Volume 6 | Issue 12 | e28655 DNA Barcoding of Argentine Fishes

The genus Bathyraja is represented in the southwestern Atlantic Within the skates of the genus Psammobatis, specimens belonging to by 10 species [55], eight of which are endemic on the Argentinean three different species were barcoded: P. lentiginosa, P. rudis and P. continental shelf [34;38]. Compagno [56], based on osteological normani. Figure 6 showed the NJ tree for species of this genus. Only P. characteristics of rostral cartilage, assigned some species, situated lentiginosa formed a cohesive cluster and presented a deep divergence in the genus Bathyraja by several authors [33,55,57,58] to Rhinoraja with the other species (D = 3.62%), whereas the other two species Ishiyama. Analysis of COI sequences of ‘‘Bathyraja-like’’ species were clustered together. All the individuals of P. normani (n = 3) from Argentina permitted the discrimination of all them. shared the same haplotype, whereas the 18 specimens of P. rudis However, species of the genus Bathyraja and those assigned to presented six different haplotypes. Six individuals possessed the same the genus Rhinoraja were clustered together, mixed and not formed haplotype of P. normani and the remaining had other haplotypes with two distinct groups (Figure 5). This result are not congruent to the one or two different changes in nucleotides (Table 1). These two proposal of Compagno [56], but need to be clarified trough skate species are very similar in their external morphological molecular and taxonomic phylogenetic analysis that are beyond features, especially coloration, so they are very difficult to identify. the aim of this study. Nevertheless, both are regarded valid nominal species and could be

Figure 6. Neighbour-joining tree of Psammobatis COI sequences from Argentine sea. Number at nodes represent bootstrap values, (only values greater than 50 are given). Reexamination of e-voucher allow to identify clearly some specimens as P. normani (*) and others as P. rudis (**). The remaining could be either one or another. doi:10.1371/journal.pone.0028655.g006

PLoS ONE | www.plosone.org 8 December 2011 | Volume 6 | Issue 12 | e28655 DNA Barcoding of Argentine Fishes differentiated each other by skeletal structures, such as clasper, The inability of barcoding to discriminate P. rudis and P. normani neurocranium and scapulocoracoid [59], by egg cases produced by females could be a problem of mislabeling, misidentification or could [60] and by pattern of spinulaton [59–60]. Reexamination of e- represent recent speciation. Very recently radiated species can not vouchers made by the senior author, specialist in Psammobatis species, be separated using COI and others more rapidly evolving markers who did not participate in the research cruises in which specimens of are required to identify these species [24]. Psammobatis were collected, allows to clearly identify some specimens Within the skates of the genus Amblyraja, some specimens appear as P. normani and P. rudis (Figure 6), but unfortunately, neither of the as Amblyraja sp. because they have different color pattern from the analyzed specimens were kept to reliable re-check the identification typical A. doellojuradoi (Appendix S1). However, the analysis of COI of those in which photographs do not show sharply distinctive revealed a random grouping of individuals and the genetic features (i. e claspers, spinulation in tail etc). distance values are small enough to consider (conclude) that they

Figure 7. Neighbour-joining tree of COI sequences from species of the orders Pleuronectiformes and Ophidiiformes, and from the family Stromateidae (Perciformes). Solid triangles represent clusters of multiple specimens, with the vertical dimension proportional to the number of specimens, and the horizontal depth proportional to the genetic variation within that cluster. Green indicates taxa with deep intra-specific divergence that represents distinct species. Red indicates taxa with deep intra-specific divergence that potentially represents distinct speciesor genera (see text for details). Number at nodes represent bootstrap values, (only values greater than 50 are given). doi:10.1371/journal.pone.0028655.g007

PLoS ONE | www.plosone.org 9 December 2011 | Volume 6 | Issue 12 | e28655 DNA Barcoding of Argentine Fishes are distinct species. Further morphological and molecular studies and two new individuals were sampled. Results corroborate are needed to corroborate the statement mentioned above. previous findings, so further morphological (e.g. meristics, Actinopterygii. Figure 4 shows the neighbour-joining tree of traditional/landmarks-based morphometry and osteology) and Nototheniid species barcoded. All specimens of Dissostichus molecular examination is needed to support this hypothesis. eleginoides and that of Patagonotothem tesselata formed cohesive units Although some groups are highlighted for further taxonomic and were separated from each other in the NJ tree. However, analysis and several species remain to be barcoded, these results within Patagonotothen ramsayi two clusters were observed. The first support the utility of DNA barcodes for regional species group is composed by eight specimens with 0 to 0.46% identification of fishes. When comparing these results to other divergences, and the second group is composed by a single projects on BOLD, standardizing the application of names across individual. Genetic divergence between this specimen and those of collections/regions emerges as a significant challenge for FISH- the first group ranged from 2.5 to 2.82%. The Family BOL. However, we conclude this long-standing issue is most Nototheniidae is very diverse in Argentine waters and within the efficiently addressed through DNA barcoding. genus Patagonotothen 14 species have been recorded. Some of them are very difficult to recognize. The divergence between the two Supporting Information groups of P. ramsayi possibly represents a misidentification. Because we only retained the e-voucher, in which no diagnostic distinctive Table S1 List and number of Argentinean fishes features are observed, we could not confirm the actual specimen barcoded, arranged by taxonomic category. Clasification identification. follows Nelson [64]. Collection sites: MdP coast, coast of Mar del On the other hand, the use of barcode permitted the Plata city; SAO coast, coast of San Antonio Oeste; MCh lagoon, recognition of flatfish species present in Argentine waters. Mar Chiquita coastal lagoon; 1, Off Buenos Aires province; 2, The NJ tree of Pleuronectiformes revealed deep divergences Inner shelf of Patagonian waters; 3, outer shelf of Patagonian between some species of the genus Paralichthys (Figure 7). Two of waters. See Figure 1 for location in map. * Indicates species with them, P. orbignyanus and P. patagonicus, are cluster together; voucher specimens deposited. whereas a third species (P. isosceles) formed a cohesive cluster (PDF) located far away from the other Paralichthys.Moreover,genetic distance between these two groups is 16.2%, well above typical Table S2 Details of species and specimens. BOLD ‘‘within genera’’ values. Dıáz de Astarloa and Munroe (in specimen numbers given, along with GenBank accession numbers, preparation) based on morphological features propose the geographic locality and voucher details. reassignment of P. isosceles into a new genus. Present results (PDF) on COI analysis are in accordance with them, but need to be Appendix S1 Neighbour-joining tree of 577 COI se- supported by performing phylogenetic analysis that is beyond quences from the 125 fish species sampled as obtained the aim of this study. in BOLD, using K2P distances. Figure 7 also shows the neighbour-joining tree obtained from (PDF) specimens of cusk eels from the SW Atlantic (Ophidiiformes). Each of the two nominal species, the Brazilian cusk eel Genypterus Acknowledgments brasiliensis Regan, 1903 and the Pink cusk-eel G. blacodes (Forster, 1801) formed cohesive units and were separated from each other in The authors wish to thank the Universidad Nacional de Mar del Plata and the NJ tree showing a genetic divergence of 5.8%, suggesting that the Instituto Nacional de Investigacioń y Desarrollo Pesquero for giving both should be regarded as two different species. Dıáz de Astarloa logistical assistance for the sampling collection in Mar Chiquita coastal and Figueroa [61], based on morphological and osteological lagoon and onboard respectively. The authors would like to thank: Julio analysis, stated that the cusk eels Genypterus brasiliensis and G. blacodes Mangiarotti and Monica Iza (forest guard of Mar Chiquita Biosphere Reserve) and Town Hall Mar Chiquita authorities. We also would like to are different species. However in the FAO species catalogue thank the following people for their valuable help during the present ‘Ophidiiform fishes of the world’ [62] and in the Catalogue of Fishes survey: Matıás Delpiani, Lorena Scenna, Gabriela Blasina and Daniel [63] Genypterus brasiliensis appears as a junior synonym of G. blacodes. Bruno. Finally we would like to thank Vincent Laudet the Academic Editor Present results based on analysis of COI showed a deep genetic and two anonymous reviewers for offering helpful comments that improved divergence between the two species. Thus, both morphological and the earlier drafts of the manuscript. molecular approaches strongly support that Genypterus blacodes and G. brasiliensis should be considered as valid species. Author Contributions Finally, DNA barcode strongly suggest a likely second species of Conceived and designed the experiments: EM JMDdA MGC RH. American harvestfish different from Peprilus paru (Figure 7). The Performed the experiments: EM JMDdA MGC RH JZ. Analyzed the kimura 2 parameter distance value was 12.83%, well above a data: EM JMDdA MGC RH JZ. Contributed reagents/materials/analysis conspecific value. In order to avoid the possibility of a mislabeling tools: RH JZ. Wrote the paper: EM JMDdA MGC RH JZ. result, one individual (Peprilus paru FARG 563-09) was resampled

References 1. Teletchea F (2010) After 7 years and 1000 citations: Comparative assessment of 4. Hajibabaei M, Singer GAC, Hebert PDN, Hickey DA (2007) DNA barcoding: the DNA barcoding and the DNA taxonomy proposals for taxonomists and non- how it complements taxonomy, molecular phylogenetics and population taxonomists. Mitochondrial DNA 21: 206–226. genetics. Trends in Genetics 23: 167–172. 2. Hebert PDN, Cywinska A, Ball SL, deWaard JR (2003a) Biological 5. Hubert N, Hanner R, Holm E, Mandrak NE, Taylor E, et al. (2008) Identifying identification through DNA barcodes. Proceedings of the Royal Society of Canadian freshwater fishes through DNA barcodes. PloS ONE 3: e2490. London, Series B: Biological Sciences 270: 313–321. 6. Ebach MC, Holdredge C (2005) DNA barcoding is no subsitute for taxonomy. 3. Hebert PDN, Ratnasingham S, deWaard JR (2003b) Barcoding animal life: cyto- Nature 434: 697. chrome c oxidase subunit 1 divergences among closely related species. Proceedings of 7. Golding GB, Hanner R, Hebert PDN (2009) Preface. Molecular Ecology the Royal Society of London, Series B: Biological Sciences (Suppl 1) 270: 96–99. Resources 9(Suppl. 1): iv–vi.

PLoS ONE | www.plosone.org 10 December 2011 | Volume 6 | Issue 12 | e28655 DNA Barcoding of Argentine Fishes

8. Hogg ID, Hebert PDN (2004) Biological identification of springtails (Collem- 36. Cousseau MB, Figueroa E, Dıáz de Astarloa JM, Mabraganã E, Lucifora LO bola: Hexapoda) from the Canadian Arctic, using mitochondrial DNA barcodes. (2007) Rayas, chuchos y otros batoideos del Atlańtico Sudoccidental (34uS– Canadian Journal Zoology 82: 749–754. 55uS). Publicaciones Especiales INIDEP Mar del Plata. 104 p. 9. Barrett RDH, Hebert PDN (2005) Identifying spiders through DNA barcodes. 37. Garcıá ML, Morgan CC (2002) Poromitra crassiceps (Teleostei, Melamphaidae) Canadian Journal of Zoology 83: 481–491. associated with the 500 fathoms fauna off Argentina. Journal of Applied 10. Janzen DH, Hajibabaei M, Burns JM (2005) Wedding biodiversity inventory of a Ichthyology 18: 216–218. large and complex Lepidoptera fauna with DNA barcoding. Philosophical 38. Dıáz de Astarloa JM, Mabraganã E (2004) Bathyraja cousseauae sp. n.: A New Transactions of the Royal Society of London Series B Biological Sciences 1462: Softnose Skate from the Southwestern Atlantic (Rajiformes, Rajidae). Copeia 2: 1835–1846. 326–335. 11. Hajibabaei M, Janzen DH, Burns JM, Hallwachs W, Hebert PDN (2006) DNA 39. Wo¨hler OC, Scarlato N (2006) Occurrence of orange roughy, Hoplostethus barcodes distinguish species of tropical Lepidoptera. Proceedings of the National atlanticus (Trachichthyidae) off Argentina. Cybium 30: 285–286. Academy of Sciences of the United Sates of America, 103: 968–971. 40. Dıáz de Astarloa JM, Mabraganã E, Hanner R, Figueroa DE (2008) 12. Lukhtanov VA, Sourakov A, Zakharov EV, Hebert PDN (2009) DNA barcoding Morphological and molecular evidence for a new species of longnose skate Central Asian butterflies: increasing geographical dimension does not signifi- (Rajiformes: Rajidae: Dipturus) from Argentinean waters based on DNA cantly reduce the success of species identification. Molecular Ecology Resources barcoding. Zootaxa 1921: 35–46. 9: 1302–1310. 41. Menni RC, Rincoń G, Garcıá ML (2008) Discopyge castelloi sp. nov. (Torpedini- 13. Smith MA, Wood DM, Janzen DH, Hallwachs W, Hebert PDN (2007) DNA formes, Narcinidae), una nueva especie de raya elećtrica del Mar Argentino. barcodes affirm that 16 species of apparently generalist tropical parasitoid flies Revista del Museo Argentino de Ciencias Naturales, n. s. 10(1): 161–171. (Diptera, Tachinidae) are not all generalists. Proceedings of the National 42. Solari A, Garcia ML, Jaureguizar JA (2010) First record of Eucinostomus Academy of Sciences of the United Sates of America 104: 4967–4972. melanopterus, Bleeker 1863 (Perciformes, Gerreidae) from the Rıó de la Plata 14. Ja¨rnegren J, Schander C, Sneli JA, Ronningen V, Young CM (2007) Four genes, Estuary. Journal of Applied Ichthyology 26: 137–139. morphology and ecology: distinguishing a new species of Acesta (Mollusca; 43. Menni RC, Freı´s RA, Lucı´fora LO (2007) Condrictios de la Argentina y Bivalvia) from the Gulf of Mexico. Marine Biology 152: 43–55. Uruguay. Lista de Trabajo. ProBiota Serie Tećnica-Didactica, La Plata, 15. Ward RD, Zemlak TS, Innes BH, Last PR, Hebert PDN (2005) DNA barcoding Argentina 11: 1–15. Australia’s fish species. Philosophical Transactions of the Royal Society B 360: 44. Ratnasingham S, Hebert PDN (2007) BOLD: the Barcode of Life Data System 1847–1857. (www.barcodinglife.org). Molecular Ecology Notes 7: 355–364. 16. Hebert PDN, Stoeckle MY, Zemlak TS, Francis CM (2004) Identification of 45. Ivanova NV, deWaard JR, Hebert PDN (2006) An inexpensive, automation- birds through DNA barcodes. PLoS Biology 2: 1657–1663. friendly protocol for recovering high-quality DNA. Molecular Ecology Notes 6: 17. Kerr KCR, Lijtmaer DA, Barreira AS, Hebert PDN, Tubaro PL (2009) Probing 998–1002. evolutionary patterns in neotropical birds through DNA barcodes. PloS ONE 4: 46. Ivanova NV, Zemlak TS, Hanner RH, Hebert PDN (2007) Universal primer e4379. cocktails for fish DNA barcoding. Molecular Ecology Notes 7: 544–548. 18. Clare EL, Lim BK, Engstrom MD, Eger JL, Hebert PDN (2007) DNA 47. Kimura M (1980) A simple method for estimating evolutionary rate of base barcoding of Neotropical bats: species identification and discovery within substitutions through comparative studies of nucleotide sequences. Journal Guyana. Molecular Ecology Notes 7: 184–190. Molecular Evolution 16: 111–120. 19. Amaral AR, Sequeira M, Coelho MM (2007) A first approach to the usefulness 48. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular Evolutionary of cytochrome c oxidase I barcodes in the identification of closely related Genetics Analysis (MEGA) software version 4.0. Molecular Biology and delphinid cetacean species. Marine and Freshwater Research 58: 505–510. Evolution 24: 1596–1599. 20. Borisenko AB, Lim BK, Ivanova NV, Hanner RH, Hebert PDN (2008) DNA 49. Zhang DX, Hewitt GM (1996) Nuclear integrations: challenge for mitochondria barcoding in surveys of small mammal communities: a field study in Suriname. DNA markers. Trends in Ecology and Evolution 11: 247–251. Molecular Ecology Resources 8: 471–479. 50. Nakamura I, Inada T, Takeda M, Hatanaka H (1986) Important fishes trawled 21. Hollingsworth PM, Forrest LL, Spouge JL, Hajibabaei M, Ratnasingham S, off Patagonia. Japan Marine Fishery Resource Research Center, Tokyo. 369 p. et al. (2009) A DNA barcode for land plants. Proceedings of the National 51. Gon O, Heemstra PC (1990) Fishes of the Southern Ocean. Grahamstown Academy of Science of the United Sates of America 106: 12794–12797. J.L.B. Smith Institute of Ichthyology, South Africa. 462 p. 22. Saunders GW (2005) Applying DNA barcoding to red macroalgae: a 52. Ward RD (2009) DNA barcode divergence among species and genera of birds and preliminary appraisal holds promise for future applications. Philosophical fishes. Molecular Ecology Resources;doi: 10.1111/j.1755-0998.2009.02541.x. Transactions of the Royal Society of London Series B Biological Sciences 360: 53. Yearsley GK, Last P, Gleghill DC (2003) Bony fishes. In: Yearsley GK, Last P & 1879–1888. Ward, RD Eds. Australian Seafood. CSIRO Marine Research & Development 23. Sogin ML, Morrison HG, Huber JA, Welch DM, Huse SM, et al. (2006) Corporation, Australia. pp 44–142. Microbial diversity in the deep sea and the underexplored ‘rare biosphere’. 54. Spies IB, Gaichas S, Stevenson DE, Orr JW, Canino MF (2006) DNA based Proceedings of the National Academy of Sciences USA 103: 12115–12120. identification of Alaska skates (Amblyraja, Bathyraja and Raja: Rajidae) using 24. Ward RD, Hanner R, Hebert PDN (2009) The campaign to DNA barcode all cytochrome c oxidase subunit I (COI) variation. Journal of Fish Biology (Suppl. fishes, FISH-BOL. Journal of Fish Biology 74: 329–356. B) 69: 283–292. 25. Steinke D, Hanner R (2010) The FISH-BOL collaborators’ protocol. 55. Stehmann MFW (1986) Notes on the systematics of the rajids genus Bathyraja Mitochondrial DNA 21(S2): 1–5. and its distribution in the world ocean. In: T. Uyeno T, Arai R, Taniuchi T, 26. Ward RD, Holmes BH, White WT, Last PR (2008) DNA barcoding Matsuura K, eds. Indo-Pacific fish biology: proceedings of the second Australasian chondrichthyans: results and potential uses in conservation. Marine international conference on Indo-Pacific fishes, Ichthyological Society of Japan, and Freshwater Research 59: 57–71. Tokyo. pp 261–268. 27. Steinke D, Zemlak TS, Boutillier JA, Hebert PDN (2009) DNA barcoding of 56. Compagno LJ (1999) Checklist of living Elasmobranchs. In: Hamlet WC, ed. Pacific Canada’s fishes. Marine Biology 156: 2641–2647. Sharks, skates, and rays. The biology of Elasmobranch Fishes John Hopkins 28. Ward RD, Holmes BH (2007) An analysis of nucleotide and amino acid University Press. 515 p. variability in the barcode region of cytochrome c oxidase I (cox1) in fishes. 57. McEachran JD, Dunn KA (1998) Phylogenetic analusis of skates, a Molecular Ecology Notes 7: 899–907. morphologically conservative clade of elasmobranches (Chondrichthyes: Raji- 29. Pegg GG, Sinclair B, Briskey L, Aspden WJ (2006) MtDNA barcode dae). Copeia 2: 271–290. identification of fish larvae in the southern Great Barrier Reef, Australia. 58. McEachran JD, Aschliman N (2004) Phylogeny of Batoidea. In: Carrier JC, Scientia Marina 70: 7–12. Musick JA, Heithaus MR, eds. Biology of Sharks and their Relatives, CRC 30. Victor BC (2007) Coryphopterus kuna, a new goby (Perciformes: Gobiidae: Press, Boca Raton, EE.UU. pp 79–113. Gobiinae) from the western Caribbean, with the identification of the late larval 59. McEachran JD (1983) Results of the research cruises of FRV ‘‘Walther Herwig’’ stage and an estimate of the pelagic larval duration. Zootaxa 1526: 51–61. to South America LXI. Revision of the South American skate genus Psammobatis 31. Webb KE, Barnes DKA, Clark MS, Bowden DA (2006) DNA barcoding: a Gu¨nther, 1870. (Elasmobranchii, Rajiformes, Rajidae). Archiv fu¨r Fischeriwis- molecular tool to identify Antarctic marine larvae. Deep-Sea Research Part II- senschaf Bundesforschungsanstalt fu¨r Fischerie 34: 23–80. Topical Studies in Oceanography 53(8–10): 1053–1060. 60. Mabraganã E (2007) Las rayas del geńero Psammobatis de la Plataforma 32. Norman JR (1937) Coast fishes, part II. The Patagonian region. Discovery Argentina: Biologıá y Ecologıá. Ph.D. thesis. Universidad Nacional de Mar del Reports 16: 1–150. Plata, Mar del Plata, Argentina. 33. Menni RC, Ringuelet RA, Ara´mburu RH (1984) Peces marinos de la Argentina 61. Dıáz de Astarloa JM, Figueroa D (1993) Las especies del geńero Genypterus y Uruguay. Resenã histo´rica. Clave de familias, geńeros y especies. Cata´logo (Pisces, Ophidiiformes) presentes en aguas argentinas. Universidad Cato´lica del crı´tico. Editorial Hemisferio Sur, Buenos Aires. 359 p. Norte, Facultad de Ciencias del Mar, Serie Ocasional 2: 47–56. 34. Menni RC, Stehmann MFW (2000) Distribution, environment and biology of 62. Nielsen JG, Cohen DM (1999) Ophidiiform fishes of the world (Order batoid fishes off Argentina, Uruguay and Brazil. A review. Revista del Museo Ophidiiformes). An annotated and illustrated catalogue of pearlfishes, cusk-eels, Argentino de Ciencias Naturales, n.s. 2: 69–109. brotulas and other ophidiiform fishes known to date. FAO species catalogue. 35. Cousseau MB, Gosztonyi AE, Elıás I, Re ME (2004) Estado actual del FAO Fisheries Synopsis 125: 18 Rome. 178 p. conocimiento de los peces de la plataforma continental argentina y adyacencias. 63. Eschmeyer WN, ed. Catalog of Fishes electronic version (19 February 2010). In: Sańchez RP, Bezzi SI, eds. El mar argentino y sus recursos pesqueros Tomo http://research.calacademy.org/ichthyology/catalog/fishcatmain.asp. 4. Los peces marinos de intere´s pesquero. Caracterizacioń biolo´gica y evaluacioń 64. Nelson JS (2006) Fishes of the world, 4th edition. John Wiley & Sons, Inc., New del estado de explotacioń INIDEP. pp 17–38. Jersey. 601 p.

PLoS ONE | www.plosone.org 11 December 2011 | Volume 6 | Issue 12 | e28655 Class Collection site Family Species Order MdP SAO MCh 1 2 3 coast Coast lagoon Actinopterygii Anguilliformes Congridae Bassanago albescens 7 Conger orbignyanus 5 Atheriniformes Atherinopsidae Odontesthes argentinensis 8 Odontesthes platensis* 1 Batrachoidiformes Batrachoididae Porichthys porosissimus 1 Triathalassothia argentina 3 Characiformes Characidae Oligosarcus jenynsii 5 Clupeiformes Clupeidae Brevoortia aurea 15 Platanichthys platana 6 Engraulidae Anchoa marinii 3 Engraulis anchoita 3 Lycengraulis grossidens 7 Anablepidae Jenynsia multidentata 10 Poeciliidae Cnesterodon decemmaculatus 1 Gadiformes Gadidae Micromesistius australis 7 Macrouridae Coelorinchus fasciatus 2 Coelorinchus marinii 6 Macrourus holotrachys 6 Merlucciidae Macruronus magellanicus 5 Merluccius australis 7 Merluccius hubbsi 5 5 Moridae Notophycis marginata 4

Salilota australis 2 Phycidae Urophycis brasiliensis 1 Urophycis cirrata 1 Myctophiformes Myctophidae Gymnoscopelus nicholsi 8 Gymnoscopelus piabilis 1 Ophidiiformes Ophidiidae Genypterus blacodes 5 Genypterus brasiliensis 2 Raneya brasiliensis 2 Perciformes Blenniidae Hypleurochilus fissicornis 1 Bovichtidae Bovichtus chilensis 4 Cottoperca gobio 4 Bramidae Brama brama 5 Carangidae Parona signata 6 Selene setapinnis* 1 Selene vomer* 1 Trachurus lathami 1 1 Centrolophidae Icichthys australis 1 Seriolella caerulea 2 Seriolella porosa 4 Cheilodactylidae Nemadactylus bergi 7 Eleginopidae Eleginops maclovinus 3 4 Gobiidae Gobiosoma parri 5 Malacanthidae Lopholatilus villarii 1 Mugilidae Mugil platanus 6 Mullidae Mullus argentinae 5 Nototheniidae Dissostichus eleginoides 6 Patagonotothen ramsayi 5 4 Notothenidae Patagonotothen tessellata 1 4

Percophidae Percophis brasiliensis 1 4 3 Pinguipedidae Pinguipes brasilianus 1 1 Pseudopercis semifasciata 1 5 Polyprionidae Polyprion americanus 3 Pomatomidae Pomatomus saltatrix 5 Sciaenidae Cynoscion guatucupa 5 Menticirrhus americanus 5 Micropogonias furnieri 8 Paralonchurus brasiliensis 3 Pogonias cromis 11 Scombridae Allothunnus fallai 1 Scomber japonicus 5 Serranidae Acanthistius brasilianus 1 7 Serranus auriga 2 Sparidae Pagrus pagrus 5 Sphyraenidae Sphyraena guachancho 1 Stromateidae Peprilus paru 2 Stromateus brasiliensis 7 Zoarcidae Austrolycus laticinctus 4 Iluocoetes fimbriatus 3 4 4 Pleuronectiformes Achiropsettidae Mancopsetta maculata 2 Neoachiropsetta milfordi 2 Paralichthyidae Paralichthys isosceles 2 3 Paralichthys orbignyanus 11 Paralichthys patagonicus 3 Xystreurys rasile 2 6 Pleuronectidae Oncopterus darwini* 1 Scorpaeniformes Congiopodidae Congiopodus peruvianus 7

Dactylopteridae Dactylopterus volitans 1 Psychrolutidae Psychrolutes marmoratus 1 Sebastidae Helicolenus lahillei 13 Sebastes oculatus 5 Triglidae Prionotus nudigula 4 Prionotus punctatus 2 Siluriformes Callichthyidae Corydoras paleatus 2 Heptapteridae Rhamdia sapo 1 Syngnathiformes Centriscidae Notopogon fernandezianus 2 Syngnathidae Hippocampus patagonicus 6 Tetraodontiformes Tetraodontidae Sphoeroides pachygaster 3 Zeiformes Oreosomatidae Allocyttus verrucosus 1 Pseudocyttus maculatus 1 Zeidae Zenopsis conchifera 1 Myxinii Myxinidae Myxine australis 1 Notomyxine tridentiger 1 Chondrichthyes Chimaeriformes Callorhinichidae Callorhinchus callorynchus 1 8 Carcharhiniformes Scyliorhinidae Schroederichthys bivius 2 6 Triakidae Galeorhinus galeus 1 Mustelus schmitti 1 2 Hexanchiformes Hexanchidae Notorynchus cepedianus 1 Squaliformes Squalidae Squalus acanthias 3 4 4 Squalus mitsukurii 2 Squatiniformes Squatinidae Squatina guggenheim 2 3 Myliobatiformes Myliobatidae Myliobatis goodei 2 Rajiformes Rajidae Amblyraja doellojuradoi 12 7 Atlantoraja castelnaui 1

Atlantoraja cyclophora 3 Atlantoraja platana 2 Bathyraja albomaculata 5 Bathyraja brachyurops 5 Bathyraja cousseauae 3 Bathyraja griseocauda 8 Bathyraja macloviana 4 Bathyraja magellanica 4 Bathyraja multispinis 7 Bathyraja papilionifera 1 Bathyraja scaphiops 1 5 Dipturus argentinensis* 6 1 Dipturus chilensis 8 Psammobatis lentiginosa 6 Psammobatis normani 2 1 Psammobatis rudis 3 11 4 Rioraja agassizii 2 Sympterygia acuta 2 Sympterygia bonapartii 5 Torpediniformes Narcinidae Discopyge tschudii 4 TOTAL 70 9 111 95 144 148

BOLD GenBank Identification Geographic locality Voucher type Sample ID Process ID Acc. Nº Acanthistius brasilianus Argentina, off Patagonian waters INIDEP-T 0001 FARG001-06 EU074305 Tissue e-voucher Acanthistius brasilianus Argentina, off Patagonian waters INIDEP-T 0002 FARG002-06 EU074304 Tissue e-voucher Acanthistius brasilianus Argentina, off Patagonian waters INIDEP-T 0224 FARG224-06 EU074306 Tissue e-voucher Acanthistius brasilianus Argentina, off Patagonian waters INIDEP-T 0225 FARG225-06 EU074307 Tissue e-voucher Acanthistius brasilianus Argentina, off Patagonian waters INIDEP-T 0386 FARG387-08 Tissue e-voucher Acanthistius brasilianus Argentina, off Patagonian waters INIDEP-T 0387 FARG388-08 Tissue e-voucher Acanthistius brasilianus Argentina, off Patagonian waters INIDEP-T 0388 FARG389-08 Tissue e-voucher Acanthistius brasilianus Argentina, Buenos Aires province coast INIDEP-T 0522 FARG523-08 Tissue e-voucher Allocyttus verrucosus Argentina, Buenos Aires province coast INIDEP-T 0543 FARG544-08 Tissue e-voucher Allothunnus fallai Argentina, off Patagonian waters INIDEP-T 0149 FARG149-06 EU074308 Tissue e-voucher Amblyraja doellojuradoi Argentina, off Patagonian waters INIDEP-T 0102 FARG102-06 EU074313 Tissue e-voucher Amblyraja doellojuradoi Argentina, off Patagonian waters INIDEP-T 0241 FARG241-06 EU074310 Tissue e-voucher Amblyraja doellojuradoi Argentina, off Patagonian waters INIDEP-T 0242 FARG242-06 EU074311 Tissue e-voucher Amblyraja doellojuradoi Argentina, off Patagonian waters INIDEP-T 0243 FARG243-06 EU074312 Tissue e-voucher Amblyraja doellojuradoi Argentina, off Buenos Aires province INIDEP-T 0396 FARG397-08 Tissue e-voucher Amblyraja doellojuradoi Argentina, off Buenos Aires province INIDEP-T 0397 FARG398-08 Tissue e-voucher Amblyraja doellojuradoi Argentina, off Buenos Aires province INIDEP-T 0399 FARG400-08 Tissue e-voucher Amblyraja doellojuradoi Argentina, off Buenos Aires province INIDEP-T 0496 FARG497-08 Tissue e-voucher Amblyraja doellojuradoi Argentina, off Buenos Aires province INIDEP-T 0533 FARG534-08 Tissue e-voucher Amblyraja doellojuradoi Argentina, off Buenos Aires province INIDEP-T 0534 FARG535-08 Tissue e-voucher Amblyraja doellojuradoi Argentina, off Buenos Aires province INIDEP-T 0535 FARG536-08 Tissue e-voucher Amblyraja doellojuradoi Argentina, off Buenos Aires province INIDEP-T 0536 FARG537-08 Tissue e-voucher Amblyraja doellojuradoi Argentina, off Buenos Aires province INIDEP-T 0537 FARG538-08 Tissue e-voucher Amblyraja doellojuradoi Argentina, off Buenos Aires province INIDEP-T 0538 FARG539-08 Tissue e-voucher Amblyraja sp. Argentina, off Patagonian waters INIDEP-T 0130 FARG130-06 EU074317 Tissue e-voucher Amblyraja sp. Argentina, off Patagonian waters INIDEP-T 0140 FARG140-06 EU074309 Tissue e-voucher Amblyraja sp. Argentina, off Patagonian waters INIDEP-T 0158 FARG158-06 EU074316 Tissue e-voucher Amblyraja sp. Argentina, off Patagonian waters INIDEP-T 0171 FARG171-06 EU074315 Tissue e-voucher Amblyraja sp. Argentina, off Patagonian waters INIDEP-T 0186 FARG186-06 EU074314 Tissue e-voucher Anchoa marinii Argentina, off Buenos Aires province INIDEP-T 0664 FARG610-09 Tissue e-voucher Anchoa marinii Argentina, off Buenos Aires province INIDEP-T 0665 FARG611-09 Tissue e-voucher Anchoa marinii Argentina, off Buenos Aires province INIDEP-T 0666 FARG612-09 Tissue e-voucher Atlantoraja castelnaui Argentina, off Buenos Aires province INIDEP-T 0406 FARG407-08 Tissue e-voucher Atlantoraja cyclophora Argentina, off Buenos Aires province INIDEP-T 0469 FARG470-08 Tissue e-voucher Atlantoraja cyclophora Argentina, off Buenos Aires province INIDEP-T 0471 FARG472-08 Tissue e-voucher Atlantoraja cyclophora Argentina, off Buenos Aires province INIDEP-T 0474 FARG475-08 Tissue e-voucher Uruguay, common fishing area Argentina- Atlantoraja platana Uruguay INIDEP-T 0425 FARG426-08 Tissue e-voucher Uruguay, common fishing area Argentina- Atlantoraja platana Uruguay INIDEP-T 0426 FARG427-08 Tissue e-voucher Austrolycus laticinctus Argentina, off Patagonian waters INIDEP-T 0125 FARG125-06 EU074319 Tissue e-voucher Austrolycus laticinctus Argentina, off Patagonian waters INIDEP-T 0134 FARG134-06 EU074320 Tissue e-voucher Austrolycus laticinctus Argentina, off Patagonian waters INIDEP-T 0315 FARG316-07 EU074318 Tissue e-voucher Austrolycus laticinctus Argentina, off Patagonian waters INIDEP-T 0382 FARG383-08 Tissue e-voucher Bassanago albescens Argentina, off Patagonian waters INIDEP-T 0229 FARG229-06 EU074326 Tissue e-voucher Bassanago albescens Argentina, off Patagonian waters INIDEP-T 0231 FARG231-06 EU074322 Tissue e-voucher Bassanago albescens Argentina, off Patagonian waters INIDEP-T 0232 FARG232-06 EU074323 Tissue e-voucher Bassanago albescens Argentina, off Patagonian waters INIDEP-T 0233 FARG233-06 EU074324 Tissue e-voucher Bassanago albescens Argentina, off Patagonian waters INIDEP-T 0234 FARG234-06 EU074325 Tissue e-voucher Bassanago albescens Argentina, off Buenos Aires province INIDEP-T 0359 FARG360-07 EU074321 Tissue e-voucher Bassanago albescens Argentina, off Buenos Aires province INIDEP-T 0400 FARG401-08 Tissue e-voucher Bathyraja albomaculata Argentina, off Patagonian waters INIDEP-T 0101 FARG101-06 EU074331 Tissue e-voucher Bathyraja albomaculata Argentina, off Patagonian waters INIDEP-T 0141 FARG141-06 EU074330 Tissue e-voucher Bathyraja albomaculata Argentina, off Patagonian waters INIDEP-T 0142 FARG142-06 EU074328 Tissue e-voucher Bathyraja albomaculata Argentina, off Patagonian waters INIDEP-T 0143 FARG143-06 EU074329 Tissue e-voucher Bathyraja albomaculata Argentina, off Patagonian waters INIDEP-T 0145 FARG145-06 EU074327 Tissue e-voucher Bathyraja brachyurops Argentina, off Patagonian waters INIDEP-T 0226 FARG226-06 EU074335 Tissue e-voucher Bathyraja brachyurops Argentina, off Patagonian waters INIDEP-T 0235 FARG235-06 EU074333 Tissue e-voucher Bathyraja brachyurops Argentina, off Patagonian waters INIDEP-T 0244 FARG244-06 EU074332 Tissue e-voucher Bathyraja brachyurops Argentina, off Patagonian waters INIDEP-T 0245 FARG245-06 EU074334 Tissue e-voucher Bathyraja brachyurops Argentina, off Buenos Aires province INIDEP-T 0492 FARG493-08 Tissue e-voucher Bathyraja cousseauae Argentina, off Patagonian waters INIDEP-T 0172 FARG172-06 EU074338 Tissue e-voucher Bathyraja cousseauae Argentina, off Patagonian waters INIDEP-T 0181 FARG181-06 EU074337 Tissue e-voucher Bathyraja cousseauae Argentina, off Patagonian waters INIDEP-T 0185 FARG185-06 EU074336 Tissue e-voucher Bathyraja griseocauda Argentina, off Patagonian waters INIDEP-T 0153 FARG153-06 EU074345 Tissue e-voucher Bathyraja griseocauda Argentina, off Patagonian waters INIDEP-T 0155 FARG155-06 EU074346 Tissue e-voucher Bathyraja griseocauda Argentina, off Patagonian waters INIDEP-T 0156 FARG156-06 EU074340 Tissue e-voucher Bathyraja griseocauda Argentina, off Patagonian waters INIDEP-T 0161 FARG161-06 EU074339 Tissue e-voucher Bathyraja griseocauda Argentina, off Patagonian waters INIDEP-T 0258 FARG258-06 EU074342 Tissue e-voucher Bathyraja griseocauda Argentina, off Patagonian waters INIDEP-T 0259 FARG259-06 EU074341 Tissue e-voucher Bathyraja griseocauda Argentina, off Patagonian waters INIDEP-T 0260 FARG260-06 EU074343 Tissue e-voucher Bathyraja griseocauda Argentina, off Patagonian waters INIDEP-T 0261 FARG261-06 EU074344 Tissue e-voucher Bathyraja macloviana Argentina, off Patagonian waters INIDEP-T 0117 FARG117-06 EU074348 Tissue e-voucher Bathyraja macloviana Argentina, off Patagonian waters INIDEP-T 0120 FARG120-06 EU074349 Tissue e-voucher Bathyraja macloviana Argentina, off Patagonian waters INIDEP-T 0121 FARG121-06 EU074347 Tissue e-voucher Bathyraja macloviana Argentina, off Patagonian waters INIDEP-T 0128 FARG128-06 EU074350 Tissue e-voucher Bathyraja magellanica Argentina, off Patagonian waters INIDEP-T 0129 FARG129-06 EU074354 Tissue e-voucher Bathyraja magellanica Argentina, off Patagonian waters INIDEP-T 0147 FARG147-06 EU074353 Tissue e-voucher Bathyraja magellanica Argentina, off Patagonian waters INIDEP-T 0148 FARG148-06 EU074351 Tissue e-voucher Bathyraja magellanica Argentina, off Patagonian waters INIDEP-T 0257 FARG257-06 EU074352 Tissue e-voucher Bathyraja multispinis Argentina, off Patagonian waters INIDEP-T 0146 FARG146-06 EU074357 Tissue e-voucher Bathyraja multispinis Argentina, off Patagonian waters INIDEP-T 0150 FARG150-06 EU074361 Tissue e-voucher Bathyraja multispinis Argentina, off Patagonian waters INIDEP-T 0154 FARG154-06 EU074358 Tissue e-voucher Bathyraja multispinis Argentina, off Patagonian waters INIDEP-T 0262 FARG262-06 EU074360 Tissue e-voucher Bathyraja multispinis Argentina, off Patagonian waters INIDEP-T 0263 FARG263-06 EU074356 Tissue e-voucher Bathyraja multispinis Argentina, off Patagonian waters INIDEP-T 0264 FARG264-06 EU074359 Tissue e-voucher Bathyraja multispinis Argentina, off Patagonian waters INIDEP-T 0266 FARG266-06 EU074355 Tissue e-voucher Bathyraja papilionifera Argentina, off Patagonian waters INIDEP-T 0500 FARG501-08 Tissue e-voucher Bathyraja scaphiops Argentina, off Patagonian waters INIDEP-T 0097 FARG097-06 EU074363 Tissue e-voucher Bathyraja scaphiops Argentina, off Patagonian waters INIDEP-T 0098 FARG098-06 EU074366 Tissue e-voucher Bathyraja scaphiops Argentina, off Patagonian waters INIDEP-T 0099 FARG099-06 EU074362 Tissue e-voucher Bathyraja scaphiops Argentina, off Patagonian waters INIDEP-T 0100 FARG100-06 EU074364 Tissue e-voucher Bathyraja scaphiops Argentina, off Patagonian waters INIDEP-T 0114 FARG114-06 EU074365 Tissue e-voucher Bathyraja scaphiops Argentina, off Buenos Aires province INIDEP-T 0466 FARG467-08 Tissue e-voucher Bovichtus chilensis Argentina, Buenos Aires province coast INIDEP-T 0563 FARG559-09 Tissue e-voucher Bovichtus chilensis Argentina, Buenos Aires province coast INIDEP-T 0564 FARG560-09 Tissue e-voucher Bovichtus chilensis Argentina, Buenos Aires province coast INIDEP-T 0682 FARG628-09 Tissue e-voucher Bovichtus chilensis Argentina, Buenos Aires province coast INIDEP-T 0693 FARG639-09 Tissue e-voucher Brama brama Argentina, off Patagonian waters INIDEP-T 0008 FARG008-06 EU074367 Tissue e-voucher Brama brama Argentina, off Buenos Aires province INIDEP-T 0432 FARG433-08 Tissue e-voucher Brama brama Argentina, off Buenos Aires province INIDEP-T 0435 FARG436-08 Tissue e-voucher Brama brama Argentina, off Buenos Aires province INIDEP-T 0439 FARG440-08 Tissue e-voucher Brama brama Argentina, off Buenos Aires province INIDEP-T 0503 FARG504-08 Tissue e-voucher Brevoortia aurea Argentina, Mar Chiquita coastal lagoon INIDEP-T 0270b FARG271-07 EU074372 Tissue e-voucher Brevoortia aurea Argentina, Mar Chiquita coastal lagoon INIDEP-T 0271 FARG272-07 EU074371 Tissue e-voucher Brevoortia aurea Argentina, Mar Chiquita coastal lagoon INIDEP-T 0272 FARG273-07 EU074370 Tissue e-voucher Brevoortia aurea Argentina, Mar Chiquita coastal lagoon INIDEP-T 0273 FARG274-07 EU074369 Tissue e-voucher Brevoortia aurea Argentina, Mar Chiquita coastal lagoon INIDEP-T 0291 FARG292-07 EU074368 Tissue e-voucher Brevoortia aurea Argentina, Mar Chiquita coastal lagoon INIDEP-T 0646 FARG592-09 Tissue e-voucher Brevoortia aurea Argentina, Mar Chiquita coastal lagoon INIDEP-T 0647 FARG593-09 Tissue e-voucher Brevoortia aurea Argentina, Mar Chiquita coastal lagoon INIDEP-T 0648 FARG594-09 Tissue e-voucher Brevoortia aurea Argentina, Mar Chiquita coastal lagoon INIDEP-T 0649 FARG595-09 Tissue e-voucher Brevoortia aurea Argentina, Mar Chiquita coastal lagoon INIDEP-T 0677 FARG623-09 Tissue e-voucher Brevoortia aurea Argentina, Mar Chiquita coastal lagoon INIDEP-T 0678 FARG624-09 Tissue e-voucher Brevoortia aurea Argentina, Mar Chiquita coastal lagoon INIDEP-T 0679 FARG625-09 Tissue e-voucher Brevoortia aurea Argentina, Mar Chiquita coastal lagoon INIDEP-T 0680 FARG626-09 Tissue e-voucher Brevoortia aurea Argentina, Mar Chiquita coastal lagoon INIDEP-T 0681 FARG627-09 Tissue e-voucher Brevoortia aurea Argentina, Mar Chiquita coastal lagoon INIDEP-T 0685 FARG631-09 Tissue e-voucher Callorhinchus callorynchus Argentina, off Patagonian waters INIDEP-T 0003 FARG003-06 EU074379 Tissue e-voucher Callorhinchus callorynchus Argentina, off Patagonian waters INIDEP-T 0004 FARG004-06 EU074378 Tissue e-voucher Callorhinchus callorynchus Argentina, off Patagonian waters INIDEP-T 0006 FARG006-06 EU074375 Tissue e-voucher Callorhinchus callorynchus Argentina, off Patagonian waters INIDEP-T 0007 FARG007-06 EU074381 Tissue e-voucher Callorhinchus callorynchus Argentina, off Patagonian waters INIDEP-T 0223 FARG223-06 EU074380 Tissue e-voucher Callorhinchus callorynchus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0329 FARG330-07 EU074377 Tissue e-voucher Callorhinchus callorynchus Argentina, off Patagonian waters INIDEP-T 0379 FARG380-08 Tissue e-voucher Callorhinchus callorynchus Argentina, off Patagonian waters INIDEP-T 0380 FARG381-08 Tissue e-voucher Callorhinchus callorynchus Argentina, off Patagonian waters INIDEP-T 0381 FARG382-08 Tissue e-voucher Argentina, Parque Lago lagoon, Buenos Cnesterodon decemmaculatus Aires INIDEP-T 0671 FARG617-09 Tissue e-voucher Coelorinchus fasciatus Argentina, off Patagonian waters INIDEP-T 0163 FARG163-06 EU074374 Tissue e-voucher Coelorinchus fasciatus Argentina, off Patagonian waters INIDEP-T 0165 FARG165-06 EU074373 Tissue e-voucher Coelorinchus marinii Argentina, off Buenos Aires province INIDEP-T 0353 FARG354-07 EU074385 Tissue e-voucher Coelorinchus marinii Argentina, off Buenos Aires province INIDEP-T 0354 FARG355-07 EU074384 Tissue e-voucher Coelorinchus marinii Argentina, off Buenos Aires province INIDEP-T 0355 FARG356-07 EU074383 Tissue e-voucher Coelorinchus marinii Argentina, off Buenos Aires province INIDEP-T 0356 FARG357-07 EU074382 Tissue e-voucher Coelorinchus marinii Argentina, off Buenos Aires province INIDEP-T 0460 FARG461-08 Tissue e-voucher Coelorinchus marinii Argentina, off Buenos Aires province INIDEP-T 0461 FARG462-08 Tissue e-voucher Conger orbignianus Argentina, off Buenos Aires province INIDEP-T 0430 FARG431-08 Tissue e-voucher Conger orbignianus Argentina, off Buenos Aires province INIDEP-T 0499 FARG500-08 Tissue e-voucher Conger orbignianus Argentina, Buenos Aires province coast INIDEP-T 0641 FARG587-09 Tissue e-voucher Conger orbignianus Argentina, Buenos Aires province coast INIDEP-T 0642 FARG588-09 Tissue e-voucher Conger orbignianus Argentina, Buenos Aires province coast INIDEP-T 0697 FARG643-09 Tissue e-voucher Congiopodus peruvianus Argentina, off Patagonian waters INIDEP-T 0009 FARG009-06 EU074388 Tissue e-voucher Congiopodus peruvianus Argentina, off Patagonian waters INIDEP-T 0010 FARG010-06 EU074390 Tissue e-voucher Congiopodus peruvianus Argentina, off Patagonian waters INIDEP-T 0011 FARG011-06 EU074389 Tissue e-voucher Congiopodus peruvianus Argentina, off Patagonian waters INIDEP-T 0012 FARG012-06 EU074386 Tissue e-voucher Congiopodus peruvianus Argentina, off Patagonian waters INIDEP-T 0013 FARG013-06 EU074387 Tissue e-voucher Congiopodus peruvianus Argentina, Buenos Aires province coast INIDEP-T 0637 FARG583-09 Tissue e-voucher Congiopodus peruvianus Argentina, Buenos Aires province coast INIDEP-T 0695 FARG641-09 Tissue e-voucher Argentina, Parque Lago lagoon, Buenos Corydoras paleatus Aires INIDEP-T 0672 FARG618-09 Tissue e-voucher Argentina, Parque Lago lagoon, Buenos Corydoras paleatus Aires INIDEP-T 0673 FARG619-09 Tissue e-voucher Cottoperca gobio Argentina, off Patagonian waters INIDEP-T 0116 FARG116-06 EU074394 Tissue e-voucher Cottoperca gobio Argentina, off Patagonian waters INIDEP-T 0118 FARG118-06 EU074391 Tissue e-voucher Cottoperca gobio Argentina, off Patagonian waters INIDEP-T 0124 FARG124-06 EU074392 Tissue e-voucher Cottoperca gobio Argentina, off Patagonian waters INIDEP-T 0222 FARG222-06 EU074393 Tissue e-voucher Cynoscion guatucupa Argentina, Mar Chiquita coastal lagoon INIDEP-T 0286 FARG287-07 EU074399 Tissue e-voucher Cynoscion guatucupa Argentina, Mar Chiquita coastal lagoon INIDEP-T 0304 FARG305-07 EU074398 Tissue e-voucher Cynoscion guatucupa Argentina, Mar Chiquita coastal lagoon INIDEP-T 0305 FARG306-07 EU074397 Tissue e-voucher Cynoscion guatucupa Argentina, Mar Chiquita coastal lagoon INIDEP-T 0306 FARG307-07 EU074396 Tissue e-voucher Cynoscion guatucupa Argentina, Mar Chiquita coastal lagoon INIDEP-T 0307 FARG308-07 EU074395 Tissue e-voucher Dactylopterus volitans Argentina, Buenos Aires province coast INIDEP-T 0541 FARG542-08 Tissue e-voucher Dipturus argentinensis Argentina, off Patagonian waters INIDEP-T 0019 FARG019-06 EU074405 Tissue Specimen Dipturus argentinensis Argentina, off Patagonian waters INIDEP-T 0020 FARG020-06 EU074409 Tissue Specimen Dipturus argentinensis Argentina, off Patagonian waters INIDEP-T 0021 FARG021-06 EU074410 Tissue Specimen Dipturus argentinensis Argentina, off Patagonian waters INIDEP-T 0127 FARG127-06 EU074411 Tissue Specimen Dipturus argentinensis Argentina, off Patagonian waters INIDEP-T 0317 FARG318-07 EU074408 Tissue Specimen Dipturus argentinensis Argentina, off Patagonian waters INIDEP-T 0318 FARG319-07 EU074407 Tissue Specimen Dipturus argentinensis Argentina, off Patagonian waters INIDEP-T 0319 FARG320-07 EU074406 Tissue Specimen Dipturus chilensis Argentina, off Patagonian waters INIDEP-T 0014 FARG014-06 EU074404 Tissue e-voucher Dipturus chilensis Argentina, off Patagonian waters INIDEP-T 0015 FARG015-06 EU074402 Tissue e-voucher Dipturus chilensis Argentina, off Patagonian waters INIDEP-T 0016 FARG016-06 EU074400 Tissue e-voucher Dipturus chilensis Argentina, off Patagonian waters INIDEP-T 0018 FARG018-06 EU074403 Tissue e-voucher Uruguay, common fishing area Argentina- Dipturus chilensis Uruguay INIDEP-T 0337 FARG338-07 EU074401 Tissue e-voucher Dipturus chilensis Argentina, off Buenos Aires province INIDEP-T 0592 FARG567-09 Tissue e-voucher Dipturus chilensis Argentina, off Buenos Aires province INIDEP-T 0593 FARG568-09 Tissue e-voucher Dipturus chilensis Argentina, off Buenos Aires province INIDEP-T 0594 FARG569-09 Tissue e-voucher Discopyge tschudii Argentina, off Patagonian waters INIDEP-T 0022 FARG022-06 EU074415 Tissue e-voucher Discopyge tschudii Argentina, off Patagonian waters INIDEP-T 0023 FARG023-06 EU074412 Tissue e-voucher Discopyge tschudii Argentina, off Patagonian waters INIDEP-T 0024 FARG024-06 EU074414 Tissue e-voucher Discopyge tschudii Argentina, off Patagonian waters INIDEP-T 0251 FARG251-06 EU074413 Tissue e-voucher Dissostichus eleginoides Argentina, off Patagonian waters INIDEP-T 0159 FARG159-06 EU074418 Tissue e-voucher Dissostichus eleginoides Argentina, off Patagonian waters INIDEP-T 0160 FARG160-06 EU074420 Tissue e-voucher Dissostichus eleginoides Argentina, off Patagonian waters INIDEP-T 0170 FARG170-06 EU074419 Tissue e-voucher Dissostichus eleginoides Argentina, off Patagonian waters INIDEP-T 0277 FARG278-07 EU074417 Tissue e-voucher Dissostichus eleginoides Argentina, off Patagonian waters INIDEP-T 0278 FARG279-07 EU074416 Tissue e-voucher Dissostichus eleginoides Argentina, off Buenos Aires province INIDEP-T 0487 FARG488-08 Tissue e-voucher Eleginops maclovinus Argentina, off Patagonian waters INIDEP-T 0025 FARG025-06 EU074421 Tissue e-voucher Eleginops maclovinus Argentina, off Patagonian waters INIDEP-T 0383 FARG384-08 Tissue e-voucher Eleginops maclovinus Argentina, off Patagonian waters INIDEP-T 0384 FARG385-08 Tissue e-voucher Eleginops maclovinus Argentina, off Patagonian waters INIDEP-T 0385 FARG386-08 Tissue e-voucher Eleginops maclovinus Argentina, Buenos Aires province coast INIDEP-T 0511 FARG512-08 Tissue e-voucher Eleginops maclovinus Argentina, Buenos Aires province coast INIDEP-T 0512 FARG513-08 Tissue e-voucher Eleginops maclovinus Argentina, Buenos Aires province coast INIDEP-T 0513 FARG514-08 Tissue e-voucher Engraulis anchoita Argentina, off Patagonian waters INIDEP-T 0026 FARG026-06 EU074422 Tissue e-voucher Engraulis anchoita Argentina, off Patagonian waters INIDEP-T 0027 FARG027-06 EU074424 Tissue e-voucher Engraulis anchoita Argentina, off Patagonian waters INIDEP-T 0029 FARG029-06 EU074423 Tissue e-voucher Galeorhinus galeus Argentina, coastal Patagonian waters INIDEP-T 0039 FARG039-06 EU074425 Tissue e-voucher Genypterus blacodes Argentina, off Patagonian waters INIDEP-T 0032 FARG032-06 EU074428 Tissue e-voucher Genypterus blacodes Argentina, off Patagonian waters INIDEP-T 0033 FARG033-06 EU074430 Tissue e-voucher Genypterus blacodes Argentina, off Patagonian waters INIDEP-T 0034 FARG034-06 EU074427 Tissue e-voucher Genypterus blacodes Argentina, off Patagonian waters INIDEP-T 0035 FARG035-06 EU074426 Tissue e-voucher Genypterus blacodes Argentina, off Patagonian waters INIDEP-T 0036 FARG036-06 EU074429 Tissue e-voucher Genypterus brasiliensis Argentina, off Patagonian waters INIDEP-T 0037 FARG037-06 EU074431 Tissue e-voucher Genypterus brasiliensis Argentina, off Patagonian waters INIDEP-T 0038 FARG038-06 EU074432 Tissue e-voucher Gobiosoma parri Argentina, Mar Chiquita coastal lagoon INIDEP-T 0688 FARG634-09 Tissue e-voucher Gobiosoma parri Argentina, Mar Chiquita coastal lagoon INIDEP-T 0689 FARG635-09 Tissue e-voucher Gobiosoma parri Argentina, Mar Chiquita coastal lagoon INIDEP-T 0690 FARG636-09 Tissue e-voucher Gobiosoma parri Argentina, Mar Chiquita coastal lagoon INIDEP-T 0691 FARG637-09 Tissue e-voucher Gobiosoma parri Argentina, Mar Chiquita coastal lagoon INIDEP-T 0692 FARG638-09 Tissue e-voucher Gymnoscopelus nicholsi Argentina, off Patagonian waters INIDEP-T 0168 FARG168-06 EU074435 Tissue e-voucher Gymnoscopelus nicholsi Argentina, off Patagonian waters INIDEP-T 0169 FARG169-06 EU074439 Tissue e-voucher Gymnoscopelus nicholsi Argentina, off Patagonian waters INIDEP-T 0174 FARG174-06 EU074436 Tissue e-voucher Gymnoscopelus nicholsi Argentina, off Patagonian waters INIDEP-T 0175 FARG175-06 EU074438 Tissue e-voucher Gymnoscopelus nicholsi Argentina, off Patagonian waters INIDEP-T 0176 FARG176-06 EU074434 Tissue e-voucher Gymnoscopelus nicholsi Argentina, off Patagonian waters INIDEP-T 0177 FARG177-06 EU074437 Tissue e-voucher Gymnoscopelus nicholsi Argentina, off Patagonian waters INIDEP-T 0180 FARG180-06 EU074433 Tissue e-voucher Gymnoscopelus nicholsi Argentina, off Patagonian waters INIDEP-T 0187 FARG187-06 EU074440 Tissue e-voucher Gymnoscopelus piabilis Argentina, off Patagonian waters INIDEP-T 0188 FARG188-06 EU074441 Tissue e-voucher Helicolenus lahillei Argentina, off Buenos Aires province INIDEP-T 0454 FARG455-08 Tissue e-voucher Helicolenus lahillei Argentina, off Buenos Aires province INIDEP-T 0455 FARG456-08 Tissue e-voucher Helicolenus lahillei Argentina, off Buenos Aires province INIDEP-T 0456 FARG457-08 Tissue e-voucher Helicolenus lahillei Argentina, Buenos Aires province coast INIDEP-T 0595 FARG570-09 Tissue e-voucher Helicolenus lahillei Argentina, Buenos Aires province coast INIDEP-T 0596 FARG571-09 Tissue e-voucher Helicolenus lahillei Argentina, Buenos Aires province coast INIDEP-T 0597 FARG572-09 Tissue e-voucher Helicolenus lahillei Argentina, Buenos Aires province coast INIDEP-T 0598 FARG573-09 Tissue e-voucher Helicolenus lahillei Argentina, Buenos Aires province coast INIDEP-T 0599 FARG574-09 Tissue e-voucher Helicolenus lahillei Argentina, Buenos Aires province coast INIDEP-T 0600 FARG575-09 Tissue e-voucher Helicolenus lahillei Argentina, Buenos Aires province coast INIDEP-T 0601 FARG576-09 Tissue e-voucher Helicolenus lahillei Argentina, Buenos Aires province coast INIDEP-T 0602 FARG577-09 Tissue e-voucher Helicolenus lahillei Argentina, Buenos Aires province coast INIDEP-T 0603 FARG578-09 Tissue e-voucher Helicolenus lahillei Argentina, Buenos Aires province coast INIDEP-T 0628 FARG579-09 Tissue e-voucher Hippocampus patagonicus Argentina, San Antonio Oeste coast INIDEP-T 0505 FARG506-08 Tissue e-voucher Hippocampus patagonicus Argentina, San Antonio Oeste coast INIDEP-T 0506 FARG507-08 Tissue e-voucher Hippocampus patagonicus Argentina, San Antonio Oeste coast INIDEP-T 0507 FARG508-08 Tissue e-voucher Hippocampus patagonicus Argentina, San Antonio Oeste coast INIDEP-T 0508 FARG509-08 Tissue e-voucher Hippocampus patagonicus Argentina, San Antonio Oeste coast INIDEP-T 0509 FARG510-08 Tissue e-voucher Hippocampus patagonicus Argentina, San Antonio Oeste coast INIDEP-T 0510 FARG511-08 Tissue e-voucher Hypleurochilus fissicornis Argentina, Buenos Aires province coast INIDEP-T 0565 FARG561-09 Tissue e-voucher Icichthys australis Argentina, off Patagonian waters INIDEP-T 0539 FARG540-08 Tissue e-voucher Iluocoetes fimbriatus Argentina, off Buenos Aires province INIDEP-T 0040 FARG040-06 EU074442 Tissue e-voucher Iluocoetes fimbriatus Argentina, off Buenos Aires province INIDEP-T 0237 FARG237-06 EU074446 Tissue e-voucher Iluocoetes fimbriatus Argentina, off Buenos Aires province INIDEP-T 0238 FARG238-06 EU074443 Tissue e-voucher Iluocoetes fimbriatus Argentina, off Patagonian waters INIDEP-T 0239 FARG239-06 EU074444 Tissue e-voucher Iluocoetes fimbriatus Argentina, off Patagonian waters INIDEP-T 0240 FARG240-06 EU074445 Tissue e-voucher Iluocoetes fimbriatus Argentina, off Patagonian waters INIDEP-T 0368 FARG369-08 Tissue e-voucher Iluocoetes fimbriatus Argentina, off Patagonian waters INIDEP-T 0369 FARG370-08 Tissue e-voucher Iluocoetes fimbriatus Argentina, off Patagonian waters INIDEP-T 0370 FARG371-08 Tissue e-voucher Iluocoetes fimbriatus Argentina, off Buenos Aires province INIDEP-T 0554 FARG555-09 Tissue e-voucher Iluocoetes fimbriatus Argentina, off Buenos Aires province INIDEP-T 0555 FARG556-09 Tissue e-voucher Iluocoetes fimbriatus Argentina, off Buenos Aires province INIDEP-T 0556 FARG557-09 Tissue e-voucher Jenynsia multidentata Argentina, Mar Chiquita coastal lagoon INIDEP-T 0409 FARG410-08 Tissue e-voucher Jenynsia multidentata Argentina, Mar Chiquita coastal lagoon INIDEP-T 0410 FARG411-08 Tissue e-voucher Jenynsia multidentata Argentina, Mar Chiquita coastal lagoon INIDEP-T 0427 FARG428-08 Tissue e-voucher Jenynsia multidentata Argentina, Mar Chiquita coastal lagoon INIDEP-T 0428 FARG429-08 Tissue e-voucher Jenynsia multidentata Argentina, Mar Chiquita coastal lagoon INIDEP-T 0515 FARG516-08 Tissue e-voucher Jenynsia multidentata Argentina, Mar Chiquita coastal lagoon INIDEP-T 0516 FARG517-08 Tissue e-voucher Argentina, Parque Lago lagoon, Buenos Jenynsia multidentata Aires INIDEP-T 0667 FARG613-09 Tissue e-voucher Argentina, Parque Lago lagoon, Buenos Jenynsia multidentata Aires INIDEP-T 0668 FARG614-09 Tissue e-voucher Argentina, Parque Lago lagoon, Buenos Jenynsia multidentata Aires INIDEP-T 0669 FARG615-09 Tissue e-voucher Argentina, Parque Lago lagoon, Buenos Jenynsia multidentata Aires INIDEP-T 0670 FARG616-09 Tissue e-voucher Uruguay, Common fishing area Argentina- Lopholatilus villarii Uruguay INIDEP-T 0338 FARG339-07 EU074447 Tissue e-voucher Lycengraulis grossidens Argentina, Mar Chiquita coastal lagoon INIDEP-T 0279 FARG280-07 EU074449 Tissue e-voucher Lycengraulis grossidens Argentina, Mar Chiquita coastal lagoon INIDEP-T 0281 FARG282-07 EU074448 Tissue e-voucher Lycengraulis grossidens Argentina, Mar Chiquita coastal lagoon INIDEP-T 0517 FARG518-08 Tissue e-voucher Lycengraulis grossidens Argentina, Mar Chiquita coastal lagoon INIDEP-T 0518 FARG519-08 Tissue e-voucher Lycengraulis grossidens Argentina, Mar Chiquita coastal lagoon INIDEP-T 0519 FARG520-08 Tissue e-voucher Lycengraulis grossidens Argentina, Mar Chiquita coastal lagoon INIDEP-T 0520 FARG521-08 Tissue e-voucher Lycengraulis grossidens Argentina, Mar Chiquita coastal lagoon INIDEP-T 0521 FARG522-08 Tissue e-voucher Macrourus carinatus Argentina, off Patagonian waters INIDEP-T 0106 FARG106-06 EU074450 Tissue e-voucher Macrourus carinatus Argentina, off Patagonian waters INIDEP-T 0107 FARG107-06 EU074453 Tissue e-voucher Macrourus carinatus Argentina, off Patagonian waters INIDEP-T 0108 FARG108-06 EU074454 Tissue e-voucher Macrourus carinatus Argentina, off Patagonian waters INIDEP-T 0109 FARG109-06 EU074451 Tissue e-voucher Macrourus carinatus Argentina, off Patagonian waters INIDEP-T 0110 FARG110-06 EU074455 Tissue e-voucher Macrourus carinatus Argentina, off Patagonian waters INIDEP-T 0236 FARG236-06 EU074452 Tissue e-voucher Macruronus magellanicus Argentina, off Patagonian waters INIDEP-T 0041 FARG041-06 EU074456 Tissue e-voucher Macruronus magellanicus Argentina, off Patagonian waters INIDEP-T 0042 FARG042-06 EU074460 Tissue e-voucher Macruronus magellanicus Argentina, off Patagonian waters INIDEP-T 0043 FARG043-06 EU074458 Tissue e-voucher Macruronus magellanicus Argentina, off Patagonian waters INIDEP-T 0044 FARG044-06 EU074457 Tissue e-voucher Macruronus magellanicus Argentina, off Patagonian waters INIDEP-T 0045 FARG045-06 EU074459 Tissue e-voucher Mancopsetta maculata Argentina, off Patagonian waters INIDEP-T 0115 FARG115-06 EU074462 Tissue e-voucher Mancopsetta maculata Argentina, off Patagonian waters INIDEP-T 0183 FARG183-06 EU074461 Tissue e-voucher Menticirrhus americanus Argentina, off Buenos Aires province INIDEP-T 0312 FARG313-07 EU074467 Tissue e-voucher Menticirrhus americanus Argentina, off Buenos Aires province INIDEP-T 0313 FARG314-07 EU074466 Tissue e-voucher Menticirrhus americanus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0323 FARG324-07 EU074465 Tissue e-voucher Menticirrhus americanus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0324 FARG325-07 EU074464 Tissue e-voucher Menticirrhus americanus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0325 FARG326-07 EU074463 Tissue e-voucher Merluccius australis Argentina, off Patagonian waters INIDEP-T 0173 FARG173-06 EU074468 Tissue e-voucher Merluccius australis New Zealand INIDEP-T 0445 FARG446-08 Tissue e-voucher Merluccius australis New Zealand INIDEP-T 0446 FARG447-08 Tissue e-voucher Merluccius australis New Zealand INIDEP-T 0447 FARG448-08 Tissue e-voucher Merluccius australis New Zealand INIDEP-T 0449 FARG450-08 Tissue e-voucher Merluccius australis New Zealand INIDEP-T 0450 FARG451-08 Tissue e-voucher Merluccius australis Argentina, off Patagonian waters INIDEP-T 0476 FARG477-08 Tissue e-voucher Merluccius hubbsi Argentina, off Patagonian waters INIDEP-T 0046 FARG046-06 EU074471 Tissue e-voucher Merluccius hubbsi Argentina, off Patagonian waters INIDEP-T 0047 FARG047-06 EU074470 Tissue e-voucher Merluccius hubbsi Argentina, off Patagonian waters INIDEP-T 0048 FARG048-06 EU074476 Tissue e-voucher Merluccius hubbsi Argentina, off Patagonian waters INIDEP-T 0049 FARG049-06 EU074477 Tissue e-voucher Merluccius hubbsi Argentina, off Patagonian waters INIDEP-T 0050 FARG050-06 EU074478 Tissue e-voucher Merluccius hubbsi Argentina, off Patagonian waters INIDEP-T 0246 FARG246-06 EU074474 Tissue e-voucher Merluccius hubbsi Argentina, off Patagonian waters INIDEP-T 0247 FARG247-06 EU074469 Tissue e-voucher Merluccius hubbsi Argentina, off Patagonian waters INIDEP-T 0248 FARG248-06 EU074472 Tissue e-voucher Merluccius hubbsi Argentina, off Patagonian waters INIDEP-T 0249 FARG249-06 EU074473 Tissue e-voucher Merluccius hubbsi Argentina, off Patagonian waters INIDEP-T 0250 FARG250-06 EU074475 Tissue e-voucher Micromesistius australis Argentina, off Patagonian waters INIDEP-T 0103 FARG103-06 EU074480 Tissue e-voucher Micromesistius australis Argentina, off Patagonian waters INIDEP-T 0104 FARG104-06 EU074479 Tissue e-voucher Micromesistius australis Argentina, off Patagonian waters INIDEP-T 0105 FARG105-06 EU074481 Tissue e-voucher Micromesistius australis Argentina, off Patagonian waters INIDEP-T 0367 FARG368-08 Tissue e-voucher Micromesistius australis Argentina, off Patagonian waters INIDEP-T 0371 FARG372-08 Tissue e-voucher Micromesistius australis Argentina, off Patagonian waters INIDEP-T 0372 FARG373-08 Tissue e-voucher Micromesistius australis Argentina, off Buenos Aires province INIDEP-T 0489 FARG490-08 Tissue e-voucher Micropogonias furnieri Argentina, Mar Chiquita coastal lagoon INIDEP-T 0288 FARG289-07 EU074482 Tissue e-voucher Micropogonias furnieri Argentina, Mar Chiquita coastal lagoon INIDEP-T 0411 FARG412-08 Tissue e-voucher Micropogonias furnieri Argentina, Mar Chiquita coastal lagoon INIDEP-T 0412 FARG413-08 Tissue e-voucher Micropogonias furnieri Argentina, Mar Chiquita coastal lagoon INIDEP-T 0413 FARG414-08 Tissue e-voucher Micropogonias furnieri Argentina, Mar Chiquita coastal lagoon INIDEP-T 0414 FARG415-08 Tissue e-voucher Micropogonias furnieri Argentina, Mar Chiquita coastal lagoon INIDEP-T 0415 FARG416-08 Tissue e-voucher Micropogonias furnieri Argentina, Mar Chiquita coastal lagoon INIDEP-T 0654 FARG600-09 Tissue e-voucher Micropogonias furnieri Argentina, Mar Chiquita coastal lagoon INIDEP-T 0684 FARG630-09 Tissue e-voucher Mugil platanus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0293 FARG294-07 EU074485 Tissue e-voucher Mugil platanus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0297 FARG298-07 EU074484 Tissue e-voucher Mugil platanus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0330 FARG331-07 EU074483 Tissue e-voucher Mugil platanus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0422 FARG423-08 Tissue e-voucher Mugil platanus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0452 FARG453-08 Tissue e-voucher Mugil platanus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0683 FARG629-09 Tissue e-voucher Mullus argentinae Argentina, Buenos Aires province coast INIDEP-T 0544 FARG545-08 Tissue e-voucher Mullus argentinae Argentina, Buenos Aires province coast INIDEP-T 0545 FARG546-08 Tissue e-voucher Mullus argentinae Argentina, Buenos Aires province coast INIDEP-T 0546 FARG547-08 Tissue e-voucher Mullus argentinae Argentina, Buenos Aires province coast INIDEP-T 0547 FARG548-08 Tissue e-voucher Mullus argentinae Argentina, Buenos Aires province coast INIDEP-T 0548 FARG549-08 Tissue e-voucher Mustelus schmitti Argentina, off Patagonian waters INIDEP-T 0051 FARG051-06 EU074488 Tissue e-voucher Mustelus schmitti Argentina, off Patagonian waters INIDEP-T 0052 FARG052-06 EU074487 Tissue e-voucher Uruguay, Common fishing area Argentina- Mustelus schmitti Uruguay INIDEP-T 0331 FARG332-07 EU074486 Tissue e-voucher Myliobatis goodei Argentina, Mar Chiquita coastal lagoon INIDEP-T 0322 FARG323-07 EU074489 Tissue e-voucher Myliobatis goodei Argentina, Mar Chiquita coastal lagoon INIDEP-T 0451 FARG452-08 Tissue e-voucher Myxine australis Argentina, off Patagonian waters INIDEP-T 0132 FARG132-06 EU074490 Tissue e-voucher Nemadactylus bergi Argentina, off Patagonian waters INIDEP-T 0053 FARG053-06 EU074496 Tissue e-voucher Nemadactylus bergi Argentina, coastal Patagonian waters INIDEP-T 0054 FARG054-06 EU074497 Tissue e-voucher Nemadactylus bergi Argentina, coastal Patagonian waters INIDEP-T 0055 FARG055-06 EU074493 Tissue e-voucher Nemadactylus bergi Argentina, coastal Patagonian waters INIDEP-T 0056 FARG056-06 EU074495 Tissue e-voucher Nemadactylus bergi Argentina, coastal Patagonian waters INIDEP-T 0057 FARG057-06 EU074494 Tissue e-voucher Nemadactylus bergi Argentina, off La Plata River INIDEP-T 0345 FARG346-07 EU074492 Tissue e-voucher Nemadactylus bergi Argentina, off La Plata River INIDEP-T 0346 FARG347-07 EU074491 Tissue e-voucher Neoachiropsetta milfordi Argentina, off Patagonian waters INIDEP-T 0157 FARG157-06 EU074499 Tissue e-voucher Neoachiropsetta milfordi Argentina, off Patagonian waters INIDEP-T 0182 FARG182-06 EU074498 Tissue e-voucher Notomyxine tridentiger Argentina, off Patagonian waters INIDEP-T 0131 FARG131-06 EU074500 Tissue e-voucher Notophycis marginata Argentina, off Patagonian waters INIDEP-T 0111 FARG111-06 EU074501 Tissue e-voucher Notophycis marginata Argentina, off Patagonian waters INIDEP-T 0112 FARG112-06 EU074504 Tissue e-voucher Notophycis marginata Argentina, off Patagonian waters INIDEP-T 0113 FARG113-06 EU074502 Tissue e-voucher Notophycis marginata Argentina, off Patagonian waters INIDEP-T 0166 FARG166-06 EU074503 Tissue e-voucher Notopogon fernandezianus Argentina, off La Plata River INIDEP-T 0342 FARG343-07 EU074506 Tissue e-voucher Notopogon fernandezianus Argentina, off La Plata River INIDEP-T 0343 FARG344-07 EU074505 Tissue e-voucher Notorynchus cepedianus Argentina, off Patagonian waters INIDEP-T 0230 FARG230-06 EU074507 Tissue e-voucher Odontesthes argentinensis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0274 FARG275-07 EU074512 Tissue e-voucher Odontesthes argentinensis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0275 FARG276-07 EU074511 Tissue e-voucher Odontesthes argentinensis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0294 FARG295-07 EU074510 Tissue e-voucher Odontesthes argentinensis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0295 FARG296-07 EU074509 Tissue e-voucher Odontesthes argentinensis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0320 FARG321-07 EU074508 Tissue e-voucher Odontesthes argentinensis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0423 FARG424-08 Tissue e-voucher Odontesthes argentinensis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0424 FARG425-08 Tissue e-voucher Odontesthes argentinensis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0686 FARG632-09 Tissue e-voucher Odontesthes platensis Argentina, off Buenos Aires province INIDEP-T 0314 FARG315-07 EU074513 Tissue Specimen Oligosarcus jenynsii Argentina, Mar Chiquita coastal lagoon INIDEP-T 0528 FARG529-08 Tissue e-voucher Oligosarcus jenynsii Argentina, Mar Chiquita coastal lagoon INIDEP-T 0529 FARG530-08 Tissue e-voucher Oligosarcus jenynsii Argentina, Mar Chiquita coastal lagoon INIDEP-T 0530 FARG531-08 Tissue e-voucher Oligosarcus jenynsii Argentina, Mar Chiquita coastal lagoon INIDEP-T 0531 FARG532-08 Tissue e-voucher Oligosarcus jenynsii Argentina, Mar Chiquita coastal lagoon INIDEP-T 0532 FARG533-08 Tissue e-voucher Oncopterus darwinii Argentina, Mar Chiquita coastal lagoon INIDEP-T 0514 FARG515-08 Tissue Specimen Pagrus pagrus Argentina, off Buenos Aires province INIDEP-T 0483 FARG484-08 Tissue e-voucher Pagrus pagrus Argentina, off Buenos Aires province INIDEP-T 0484 FARG485-08 Tissue e-voucher Pagrus pagrus Argentina, off Buenos Aires province INIDEP-T 0491 FARG492-08 Tissue e-voucher Pagrus pagrus Argentina, coastal Buenos Aires waters INIDEP-T 0639 FARG585-09 Tissue e-voucher Pagrus pagrus Argentina, coastal Buenos Aires waters INIDEP-T 0640 FARG586-09 Tissue e-voucher Paralichthys isosceles Argentina, off Patagonian waters INIDEP-T 0058 FARG058-06 EU074514 Tissue e-voucher Paralichthys isosceles Argentina, off Patagonian waters INIDEP-T 0059 FARG059-06 EU074515 Tissue e-voucher Paralichthys isosceles Argentina, off Patagonian waters INIDEP-T 0060 FARG060-06 EU074516 Tissue e-voucher Paralichthys isosceles Argentina, off Patagonian waters INIDEP-T 0252 FARG252-06 EU074518 Tissue e-voucher Paralichthys isosceles Argentina, off Patagonian waters INIDEP-T 0253 FARG253-06 EU074517 Tissue e-voucher Paralichthys orbignyanus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0285 FARG286-07 EU074520 Tissue e-voucher Paralichthys orbignyanus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0321 FARG322-07 EU074519 Tissue e-voucher Paralichthys orbignyanus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0421 FARG422-08 Tissue e-voucher Paralichthys orbignyanus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0524 FARG525-08 Tissue e-voucher Paralichthys orbignyanus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0525 FARG526-08 Tissue e-voucher Paralichthys orbignyanus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0526 FARG527-08 Tissue e-voucher Paralichthys orbignyanus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0643 FARG589-09 Tissue e-voucher Paralichthys orbignyanus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0644 FARG590-09 Tissue e-voucher Paralichthys orbignyanus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0659 FARG605-09 Tissue e-voucher Paralichthys orbignyanus Argentina, Buenos Aires province coast INIDEP-T 0700 FARG646-09 Tissue e-voucher Paralichthys orbignyanus Argentina, Mar Chiquita coastal lagoon INIDEP-T 0701 FARG647-09 Tissue e-voucher Paralichthys patagonicus Argentina, off Buenos Aires province INIDEP-T 0434 FARG435-08 Tissue e-voucher Paralichthys patagonicus Argentina, off Buenos Aires province INIDEP-T 0437 FARG438-08 Tissue e-voucher Paralichthys patagonicus Argentina, off Buenos Aires province INIDEP-T 0438 FARG439-08 Tissue e-voucher Paralonchurus brasiliensis Argentina, off Buenos Aires province INIDEP-T 0661 FARG607-09 Tissue e-voucher Paralonchurus brasiliensis Argentina, off Buenos Aires province INIDEP-T 0662 FARG608-09 Tissue e-voucher Paralonchurus brasiliensis Argentina, off Buenos Aires province INIDEP-T 0663 FARG609-09 Tissue e-voucher Parona signata Argentina, off Patagonian waters INIDEP-T 0061 FARG061-06 EU074522 Tissue e-voucher Parona signata Argentina, off Patagonian waters INIDEP-T 0062 FARG062-06 EU074523 Tissue e-voucher Parona signata Argentina, off Patagonian waters INIDEP-T 0063 FARG063-06 EU074524 Tissue e-voucher Parona signata Argentina, off Patagonian waters INIDEP-T 0064 FARG064-06 EU074525 Tissue e-voucher Parona signata Argentina, Mar Chiquita coastal lagoon INIDEP-T 0328 FARG329-07 EU074521 Tissue e-voucher Parona signata Argentina, Mar Chiquita coastal lagoon INIDEP-T 0658 FARG604-09 Tissue e-voucher Patagonotothen ramsayi Argentina, off Patagonian waters INIDEP-T 0065 FARG065-06 EU074533 Tissue e-voucher Patagonotothen ramsayi Argentina, off Patagonian waters INIDEP-T 0066 FARG066-06 EU074530 Tissue e-voucher Patagonotothen ramsayi Argentina, off Patagonian waters INIDEP-T 0067 FARG067-06 EU074531 Tissue e-voucher Patagonotothen ramsayi Argentina, off Patagonian waters INIDEP-T 0068 FARG068-06 EU074532 Tissue e-voucher Patagonotothen ramsayi Argentina, off Buenos Aires province INIDEP-T 0360 FARG361-07 EU074529 Tissue e-voucher Patagonotothen ramsayi Argentina, off Buenos Aires province INIDEP-T 0361 FARG362-07 EU074528 Tissue e-voucher Patagonotothen ramsayi Argentina, off Buenos Aires province INIDEP-T 0362 FARG363-07 EU074527 Tissue e-voucher Patagonotothen ramsayi Argentina, off Buenos Aires province INIDEP-T 0363 FARG364-07 EU074526 Tissue e-voucher Patagonotothen ramsayi Argentina, off Buenos Aires province INIDEP-T 0472 FARG473-08 Tissue e-voucher Patagonotothen tessellata Argentina, off Patagonian waters INIDEP-T 0135 FARG135-06 EU074536 Tissue e-voucher Patagonotothen tessellata Argentina, off Patagonian waters INIDEP-T 0136 FARG136-06 EU074537 Tissue e-voucher Patagonotothen tessellata Argentina, off Patagonian waters INIDEP-T 0137 FARG137-06 EU074538 Tissue e-voucher Patagonotothen tessellata Argentina, off Patagonian waters INIDEP-T 0138 FARG138-06 EU074534 Tissue e-voucher Patagonotothen tessellata Argentina, off Patagonian waters INIDEP-T 0152 FARG152-06 EU074535 Tissue e-voucher Peprilus paru Argentina, Buenos Aires province coast INIDEP-T 0588 FARG563-09 Tissue e-voucher Peprilus paru Argentina, Buenos Aires province coast INIDEP-T 0589 FARG564-09 Tissue e-voucher Percophis brasiliensis Argentina, off Patagonian waters INIDEP-T 0083 FARG083-06 EU074541 Tissue e-voucher Percophis brasiliensis Argentina, coastal Patagonian waters INIDEP-T 0084 FARG084-06 EU074540 Tissue e-voucher Percophis brasiliensis Argentina, coastal Patagonian waters INIDEP-T 0085 FARG085-06 EU074539 Tissue e-voucher Percophis brasiliensis Argentina, off Buenos Aires province INIDEP-T 0431 FARG432-08 Tissue e-voucher Percophis brasiliensis Argentina, off Buenos Aires province INIDEP-T 0436 FARG437-08 Tissue e-voucher Percophis brasiliensis Argentina, off Buenos Aires province INIDEP-T 0475 FARG476-08 Tissue e-voucher Percophis brasiliensis Argentina, off Buenos Aires province INIDEP-T 0502 FARG503-08 Tissue e-voucher Percophis brasiliensis Argentina, Buenos Aires province coast INIDEP-T 0699 FARG645-09 Tissue e-voucher Pinguipes brasilianus Argentina, off Patagonian waters INIDEP-T 0086 FARG086-06 EU074542 Tissue e-voucher Pinguipes brasilianus Argentina, off Buenos Aires province INIDEP-T 0464 FARG465-08 Tissue e-voucher Platanichthys platana Argentina, Mar Chiquita coastal lagoon INIDEP-T 0416 FARG417-08 Tissue e-voucher Platanichthys platana Argentina, Mar Chiquita coastal lagoon INIDEP-T 0417 FARG418-08 Tissue e-voucher Platanichthys platana Argentina, Mar Chiquita coastal lagoon INIDEP-T 0418 FARG419-08 Tissue e-voucher Platanichthys platana Argentina, Mar Chiquita coastal lagoon INIDEP-T 0419 FARG420-08 Tissue e-voucher Platanichthys platana Argentina, Mar Chiquita coastal lagoon INIDEP-T 0420 FARG421-08 Tissue e-voucher Platanichthys platana Argentina, Mar Chiquita coastal lagoon INIDEP-T 0429 FARG430-08 Tissue e-voucher Pogonias cromis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0287 FARG288-07 EU074550 Tissue e-voucher Pogonias cromis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0292 FARG293-07 EU074549 Tissue e-voucher Pogonias cromis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0298 FARG299-07 EU074548 Tissue e-voucher Pogonias cromis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0299 FARG300-07 EU074547 Tissue e-voucher Pogonias cromis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0300 FARG301-07 EU074546 Tissue e-voucher Pogonias cromis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0301 FARG302-07 EU074545 Tissue e-voucher Pogonias cromis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0302 FARG303-07 EU074544 Tissue e-voucher Pogonias cromis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0303 FARG304-07 EU074543 Tissue e-voucher Pogonias cromis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0650 FARG596-09 Tissue e-voucher Pogonias cromis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0651 FARG597-09 Tissue e-voucher Pogonias cromis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0652 FARG598-09 Tissue e-voucher Polyprion americanus Argentina, off Buenos Aires province INIDEP-T 0674 FARG620-09 Tissue e-voucher Polyprion americanus Argentina, off Buenos Aires province INIDEP-T 0675 FARG621-09 Tissue e-voucher Polyprion americanus Argentina, off Buenos Aires province INIDEP-T 0676 FARG622-09 Tissue e-voucher Pomatomus saltatrix Argentina, Mar Chiquita coastal lagoon INIDEP-T 0296 FARG297-07 EU074555 Tissue e-voucher Pomatomus saltatrix Argentina, Mar Chiquita coastal lagoon INIDEP-T 0308 FARG309-07 EU074554 Tissue e-voucher Pomatomus saltatrix Argentina, Mar Chiquita coastal lagoon INIDEP-T 0309 FARG310-07 EU074553 Tissue e-voucher Pomatomus saltatrix Argentina, Mar Chiquita coastal lagoon INIDEP-T 0310 FARG311-07 EU074552 Tissue e-voucher Pomatomus saltatrix Argentina, Mar Chiquita coastal lagoon INIDEP-T 0311 FARG312-07 EU074551 Tissue e-voucher Porichthys porosissimus Argentina, Buenos Aires province coast INIDEP-T 0551 FARG552-08 Tissue e-voucher Prionotus nudigula Argentina, off Buenos Aires province INIDEP-T 0433 FARG434-08 Tissue e-voucher Prionotus nudigula Argentina, off Buenos Aires province INIDEP-T 0477 FARG478-08 Tissue e-voucher Prionotus nudigula Argentina, off Buenos Aires province INIDEP-T 0490 FARG491-08 Tissue e-voucher Prionotus nudigula Argentina, off Buenos Aires province INIDEP-T 0495 FARG496-08 Tissue e-voucher Prionotus punctatus Argentina, Buenos Aires province coast INIDEP-T 0634 FARG580-09 Tissue e-voucher Prionotus punctatus Argentina, Buenos Aires province coast INIDEP-T 0635 FARG581-09 Tissue e-voucher Psammobatis lentiginosa Argentina, off Buenos Aires province INIDEP-T 0347 FARG348-07 EU074559 Tissue e-voucher Psammobatis lentiginosa Argentina, off Buenos Aires province INIDEP-T 0348 FARG349-07 EU074558 Tissue e-voucher Psammobatis lentiginosa Argentina, off Buenos Aires province INIDEP-T 0349 FARG350-07 EU074557 Tissue e-voucher Psammobatis lentiginosa Argentina, off Buenos Aires province INIDEP-T 0350 FARG351-07 EU074556 Tissue e-voucher Psammobatis lentiginosa Argentina, off Buenos Aires province INIDEP-T 0462 FARG463-08 Tissue e-voucher Psammobatis lentiginosa Argentina, off Buenos Aires province INIDEP-T 0463 FARG464-08 Tissue e-voucher Psammobatis normani Argentina, off Patagonian waters INIDEP-T 0376 FARG377-08 Tissue e-voucher Psammobatis normani Argentina, off Buenos Aires province INIDEP-T 0470 FARG471-08 Tissue e-voucher Psammobatis normani Argentina, off Buenos Aires province INIDEP-T 0473 FARG474-08 Tissue e-voucher Psammobatis rudis Argentina, off Patagonian waters INIDEP-T 0070 FARG070-06 EU074569 Tissue e-voucher Psammobatis rudis Argentina, off Patagonian waters INIDEP-T 0071 FARG071-06 EU074566 Tissue e-voucher Psammobatis rudis Argentina, off Patagonian waters INIDEP-T 0072 FARG072-06 EU074563 Tissue e-voucher Psammobatis rudis Argentina, off Patagonian waters INIDEP-T 0073 FARG073-06 EU074562 Tissue e-voucher Psammobatis rudis Argentina, off Patagonian waters INIDEP-T 0074 FARG074-06 EU074565 Tissue e-voucher Psammobatis rudis Argentina, off Patagonian waters INIDEP-T 0075 FARG075-06 EU074567 Tissue e-voucher Psammobatis rudis Argentina, off Patagonian waters INIDEP-T 0076 FARG076-06 EU074568 Tissue e-voucher Psammobatis rudis Argentina, off Patagonian waters INIDEP-T 0077 FARG077-06 EU074564 Tissue e-voucher Psammobatis rudis Argentina, off Patagonian waters INIDEP-T 0122 FARG122-06 EU074560 Tissue e-voucher Psammobatis rudis Argentina, off Patagonian waters INIDEP-T 0123 FARG123-06 EU074561 Tissue e-voucher Psammobatis rudis Argentina, off Patagonian waters INIDEP-T 0377 FARG378-08 Tissue e-voucher Psammobatis rudis Argentina, off Patagonian waters INIDEP-T 0378 FARG379-08 Tissue e-voucher Psammobatis rudis Argentina, off Patagonian waters INIDEP-T 0389 FARG390-08 Tissue e-voucher Psammobatis rudis Argentina, off Patagonian waters INIDEP-T 0390 FARG391-08 Tissue e-voucher Psammobatis rudis Argentina, off Patagonian waters INIDEP-T 0391 FARG392-08 Tissue e-voucher Psammobatis rudis Argentina, off Buenos Aires province INIDEP-T 0468 FARG469-08 Tissue e-voucher Psammobatis rudis Argentina, off Buenos Aires province INIDEP-T 0478 FARG479-08 Tissue e-voucher Psammobatis rudis Argentina, off Buenos Aires province INIDEP-T 0493 FARG494-08 Tissue e-voucher Pseudocyttus maculatus Argentina, off Patagonian waters INIDEP-T 0276 FARG277-07 EU074570 Tissue e-voucher Pseudopercis semifasciata Argentina, off Patagonian waters INIDEP-T 0078 FARG078-06 EU074574 Tissue e-voucher Pseudopercis semifasciata Argentina, off Patagonian waters INIDEP-T 0079 FARG079-06 EU074571 Tissue e-voucher Pseudopercis semifasciata Argentina, off Patagonian waters INIDEP-T 0080 FARG080-06 EU074572 Tissue e-voucher Pseudopercis semifasciata Argentina, off Patagonian waters INIDEP-T 0081 FARG081-06 EU074573 Tissue e-voucher Pseudopercis semifasciata Argentina, off Patagonian waters INIDEP-T 0082 FARG082-06 EU074575 Tissue e-voucher Pseudopercis semifasciata Argentina, off Buenos Aires province INIDEP-T 0482 FARG483-08 Tissue e-voucher Psychrolutes marmoratus Argentina, off Patagonian waters INIDEP-T 0139 FARG139-06 EU074576 Tissue e-voucher Raneya brasiliensis Argentina, off Patagonian waters INIDEP-T 0087 FARG087-06 EU074577 Tissue e-voucher Raneya brasiliensis Argentina, off Patagonian waters INIDEP-T 0088 FARG088-06 EU074578 Tissue e-voucher Rhamdia sapo Argentina, Mar Chiquita coastal lagoon INIDEP-T 0316 FARG317-07 EU074579 Tissue e-voucher Rioraja agassizii Argentina, off Buenos Aires province INIDEP-T 0404 FARG405-08 Tissue e-voucher Rioraja agassizii Argentina, off Buenos Aires province INIDEP-T 0408 FARG409-08 Tissue e-voucher Salilota australis Argentina, off Patagonian waters INIDEP-T 0090 FARG090-06 EU074580 Tissue e-voucher Salilota australis Argentina, off Patagonian waters INIDEP-T 0374 FARG375-08 Tissue e-voucher Schroederichthys bivius Argentina, off Patagonian waters INIDEP-T 0095 FARG095-06 EU074586 Tissue e-voucher Schroederichthys bivius Argentina, off Patagonian waters INIDEP-T 0096 FARG096-06 EU074581 Tissue e-voucher Schroederichthys bivius Argentina, off Patagonian waters INIDEP-T 0189 FARG189-06 EU074585 Tissue e-voucher Schroederichthys bivius Argentina, off Patagonian waters INIDEP-T 0190 FARG190-06 EU074584 Tissue e-voucher Uruguay, common fishing area Argentina- Schroederichthys bivius Uruguay INIDEP-T 0335 FARG336-07 EU074583 Tissue e-voucher Uruguay, common fishing area Argentina- Schroederichthys bivius Uruguay INIDEP-T 0336 FARG337-07 EU074582 Tissue e-voucher Schroederichthys bivius Argentina, off Patagonian waters INIDEP-T 0365 FARG366-08 Tissue e-voucher Schroederichthys bivius Argentina, off Patagonian waters INIDEP-T 0366 FARG367-08 Tissue e-voucher Scomber japonicus Argentina, off Buenos Aires province INIDEP-T 0480 FARG481-08 Tissue e-voucher Scomber japonicus Argentina, off Buenos Aires province INIDEP-T 0481 FARG482-08 Tissue e-voucher Scomber japonicus Argentina, off Buenos Aires province INIDEP-T 0485 FARG486-08 Tissue e-voucher Scomber japonicus Argentina, off Buenos Aires province INIDEP-T 0486 FARG487-08 Tissue e-voucher Scomber japonicus Argentina, off Buenos Aires province INIDEP-T 0494 FARG495-08 Tissue e-voucher Sebastes oculatus Argentina, off Patagonian waters INIDEP-T 0191 FARG191-06 EU074589 Tissue e-voucher Sebastes oculatus Argentina, off Patagonian waters INIDEP-T 0192 FARG192-06 EU074590 Tissue e-voucher Sebastes oculatus Argentina, off Patagonian waters INIDEP-T 0193 FARG193-06 EU074587 Tissue e-voucher Sebastes oculatus Argentina, off Patagonian waters INIDEP-T 0194 FARG194-06 EU074588 Tissue e-voucher Sebastes oculatus Argentina, off Patagonian waters INIDEP-T 0195 FARG195-06 EU074591 Tissue e-voucher Selene setapinnis Argentina, Buenos Aires province coast INIDEP-T 0587 FARG562-09 Tissue Specimen Selene vomer Argentina, Mar Chiquita coastal lagoon INIDEP-T 0523 FARG524-08 Tissue Specimen Seriolella caerulea Argentina, off Patagonian waters INIDEP-T 0126 FARG126-06 EU074592 Tissue e-voucher Seriolella caerulea Argentina, off Patagonian waters INIDEP-T 0401 FARG402-08 Tissue e-voucher Seriolella porosa Argentina, off Patagonian waters INIDEP-T 0196 FARG196-06 EU074595 Tissue e-voucher Seriolella porosa Argentina, off Patagonian waters INIDEP-T 0197 FARG197-06 EU074594 Tissue e-voucher Seriolella porosa Argentina, off Patagonian waters INIDEP-T 0198 FARG198-06 EU074593 Tissue e-voucher Seriolella porosa Argentina, off Buenos Aires province INIDEP-T 0402 FARG403-08 Tissue e-voucher Serranus auriga Argentina, Buenos Aires province coast INIDEP-T 0591 FARG566-09 Tissue e-voucher Serranus auriga Argentina, Buenos Aires province coast INIDEP-T 0696 FARG642-09 Tissue e-voucher Uruguay, common fishing area Argentina- Sphoeroides pachygaster Uruguay INIDEP-T 0339 FARG340-07 EU074598 Tissue e-voucher Uruguay, common fishing area Argentina- Sphoeroides pachygaster Uruguay INIDEP-T 0340 FARG341-07 EU074597 Tissue e-voucher Uruguay, common fishing area Argentina- Sphoeroides pachygaster Uruguay INIDEP-T 0341 FARG342-07 EU074596 Tissue e-voucher

Sphyraena guachancho Argentina, coastal Buenos Aires province INIDEP-T 0542 FARG543-08 Tissue e-voucher Squalus acanthias Argentina, off Patagonian waters INIDEP-T 0199 FARG199-06 EU074609 Tissue e-voucher Squalus acanthias Argentina, off Patagonian waters INIDEP-T 0201 FARG201-06 EU074607 Tissue e-voucher Squalus acanthias Argentina, off Patagonian waters INIDEP-T 0202 FARG202-06 EU074601 Tissue e-voucher Squalus acanthias Argentina, off Patagonian waters INIDEP-T 0203 FARG203-06 EU074605 Tissue e-voucher Squalus acanthias Argentina, off Patagonian waters INIDEP-T 0204 FARG204-06 EU074606 Tissue e-voucher Squalus acanthias Argentina, off Patagonian waters INIDEP-T 0205 FARG205-06 EU074608 Tissue e-voucher Squalus acanthias Argentina, off Patagonian waters INIDEP-T 0227 FARG227-06 EU074603 Tissue e-voucher Squalus acanthias Argentina, off Patagonian waters INIDEP-T 0228 FARG228-06 EU074604 Tissue e-voucher Squalus acanthias Argentina, off Patagonian waters INIDEP-T 0254 FARG254-06 EU074600 Tissue e-voucher Squalus acanthias Argentina, off Patagonian waters INIDEP-T 0255 FARG255-06 EU074599 Tissue e-voucher Uruguay, common fishing area Argentina- Squalus acanthias Uruguay INIDEP-T 0333 FARG334-07 EU074602 Tissue e-voucher Uruguay, common fishing area Argentina- Squalus mitsukurii Uruguay INIDEP-T 0332 FARG333-07 EU074611 Tissue e-voucher Uruguay, common fishing area Argentina- Squalus mitsukurii Uruguay INIDEP-T 0334 FARG335-07 EU074610 Tissue e-voucher Squatina guggenheim Argentina, off Buenos Aires province INIDEP-T 0467 FARG468-08 Tissue e-voucher Squatina guggenheim Argentina, off Buenos Aires province INIDEP-T 0488 FARG489-08 Tissue e-voucher Squatina guggenheim Argentina, off Buenos Aires province INIDEP-T 0497 FARG498-08 Tissue e-voucher Squatina guggenheim Argentina, off Buenos Aires province INIDEP-T 0656 FARG602-09 Tissue e-voucher Squatina guggenheim Argentina, off Buenos Aires province INIDEP-T 0657 FARG603-09 Tissue e-voucher Stromateus brasiliensis Argentina, off Patagonian waters INIDEP-T 0207 FARG207-06 EU074612 Tissue e-voucher Stromateus brasiliensis Argentina, off Patagonian waters INIDEP-T 0208 FARG208-06 EU074613 Tissue e-voucher Stromateus brasiliensis Argentina, off Patagonian waters INIDEP-T 0209 FARG209-06 EU074614 Tissue e-voucher Stromateus brasiliensis Argentina, off Patagonian waters INIDEP-T 0210 FARG210-06 EU074615 Tissue e-voucher Stromateus brasiliensis Argentina, off Patagonian waters INIDEP-T 0392 FARG393-08 Tissue e-voucher Stromateus brasiliensis Argentina, off Patagonian waters INIDEP-T 0393 FARG394-08 Tissue e-voucher Stromateus brasiliensis Argentina, off Patagonian waters INIDEP-T 0394 FARG395-08 Tissue e-voucher Sympterygia acuta Argentina, off Buenos Aires province INIDEP-T 0405 FARG406-08 Tissue e-voucher Sympterygia acuta Argentina, off Buenos Aires province INIDEP-T 0407 FARG408-08 Tissue e-voucher Sympterygia bonapartii Argentina, off Patagonian waters INIDEP-T 0211 FARG211-06 EU074617 Tissue e-voucher Sympterygia bonapartii Argentina, off Patagonian waters INIDEP-T 0212 FARG212-06 EU074620 Tissue e-voucher Sympterygia bonapartii Argentina, off Patagonian waters INIDEP-T 0213 FARG213-06 EU074618 Tissue e-voucher Sympterygia bonapartii Argentina, off Patagonian waters INIDEP-T 0214 FARG214-06 EU074616 Tissue e-voucher Sympterygia bonapartii Argentina, off Patagonian waters INIDEP-T 0215 FARG215-06 EU074619 Tissue e-voucher Trachurus lathami Argentina, off Buenos Aires province INIDEP-T 0459 FARG460-08 Tissue e-voucher Trachurus lathami Argentina, Mar Chiquita coastal lagoon INIDEP-T 0552 FARG553-08 Tissue e-voucher Triathalassothia argentina Argentina, Buenos Aires province coast INIDEP-T 0549 FARG550-08 Tissue e-voucher Triathalassothia argentina Argentina, Buenos Aires province coast INIDEP-T 0550 FARG551-08 Tissue e-voucher Triathalassothia argentina Argentina, Buenos Aires province coast INIDEP-T 0636 FARG582-09 Tissue e-voucher Urophycis brasiliensis Argentina, Mar Chiquita coastal lagoon INIDEP-T 0653 FARG599-09 Tissue e-voucher Urophycis cirrata Argentina, off La Plata River INIDEP-T 0344 FARG345-07 EU074621 Tissue e-voucher Xystreurys rasile Argentina, off Patagonian waters INIDEP-T 0216 FARG216-06 EU074625 Tissue e-voucher Xystreurys rasile Argentina, off Patagonian waters INIDEP-T 0217 FARG217-06 EU074624 Tissue e-voucher Xystreurys rasile Argentina, off Patagonian waters INIDEP-T 0218 FARG218-06 EU074629 Tissue e-voucher Xystreurys rasile Argentina, off Patagonian waters INIDEP-T 0219 FARG219-06 EU074626 Tissue e-voucher Xystreurys rasile Argentina, off Patagonian waters INIDEP-T 0220 FARG220-06 EU074627 Tissue e-voucher Xystreurys rasile Argentina, off Patagonian waters INIDEP-T 0221 FARG221-06 EU074628 Tissue e-voucher Xystreurys rasile Argentina, off Buenos Aires province INIDEP-T 0357 FARG358-07 EU074623 Tissue e-voucher Xystreurys rasile Argentina, off Buenos Aires province INIDEP-T 0358 FARG359-07 EU074622 Tissue e-voucher Zenopsis conchifera Argentina, Buenos Aires province coast INIDEP-T 0590 FARG565-09 Tissue e-voucher

BOLD TaxonID Tree

Project : Fishes of Argentina [FARG] Date : 4-March-2010 Data Type : Nucleotide Distance Model : Kimura 2 Parameter Codon Positions : 1st, 2nd, 3rd Labels : ProcessID, Family, Colorization :

Sequence Count : 577 Species count : 126 Genus count : 98 Family count : 63 Unidentified : 0

Cover Page 1/1 Fishes_of_Argentina_[FARG] Thu Mar 4 17:10:38 2010 Page 1 of 6