DOCSLIB.ORG

View of Real-Time Quantitative PCR: Appli- 2966 Journal of the American Society of Nephrology J Am Soc Nephrol 14: 2958–2966, 2003

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
View of Real-Time Quantitative PCR: Appli- 2966 Journal of the American Society of Nephrology J Am Soc Nephrol 14: 2958–2966, 2003 J Am Soc Nephrol 14: 2958–2966, 2003 Gene Expression Profiles of Podocyte-Associated Molecules as Diagnostic Markers in Acquired Proteinuric Diseases HOLGER SCHMID,* ANNA HENGER,* CLEMENS D. COHEN,* KARIN FRACH,* HERMANN-JOSEF GRO¨ NE,† DETLEF SCHLO¨ NDORFF,* and MATTHIAS KRETZLER* *Medizinische Poliklinik, Ludwig-Maximilians-University of Munich, Munich, Germany; and †German Cancer Research Center, Department of Cellular and Molecular Pathology, Heidelberg, Germany Abstract. For identifying potential diagnostic markers of pro- analyzed glomeruli, whereas podocin mRNA expression did teinuric glomerulopathies, glomerular mRNA levels of mole- not correlate. Because varying amounts of housekeeper cDNA cules relevant for podocyte function (␣-actinin-4, glomerular per glomerulus can confound expression ratios relevant for a epithelial protein 1, Wilms tumor antigen 1, synaptopodin, subpopulation of cells, an “in silico” microdissection was dystroglycan, nephrin, podoplanin, and podocin) were deter- performed using a podocyte-specific cDNA as a reference mined by quantitative real-time RT-PCR from microdissected gene. Expression ratio of podocin to synaptopodin, the two glomeruli. Biopsies from 83 patients with acquired proteinuric genes with the most disparate expression, allowed a robust diseases were analyzed (minimal change disease [MCD; n ϭ separation of FSGS from MCD and nephrosclerosis. Segrega- 13], benign nephrosclerosis [n ϭ 16], membranous glomeru- tion of FSGS from MCD via this ratio was confirmed in an lopathy [n ϭ 31], focal and segmental glomerulosclerosis independent population of formaldehyde-fixed archival biop- [FSGS; n ϭ 9], and controls [n ϭ 14]). Gene expression levels sies (MCD, n ϭ 5; FSGS, n ϭ 4) after glomerular laser capture normalized to two different housekeeping transcripts (glycer- microdissection. In addition, the expression marker was able to aldehyde-3-phosphate-dehydrogenase and 18 S rRNA) did not predict steroid responsiveness in diagnostically challenging allow a separation between proteinuric disease categories. cases of MCD versus FSGS (n ϭ 6). As the above approach However, a significant positive correlation between ␣-acti- can be performed as an add-on diagnostic tool, these molecular nin-4, glomerular epithelial protein 1, synaptopodin, dystrogly- diagnostic parameters could give novel information for the can, Wilms tumor antigen 1, and nephrin was found in all management of proteinuric diseases. Proteinuric glomerular diseases still pose a formidable chal- Finnish type, has been localized to the podocyte slit diaphragm lenge to nephrology. Recent studies have highlighted the im- (6). Mutations in a gene termed NPHS2, encoding the novel portance of proteinuria both as a clinical prognostic marker and protein podocin, are associated with an autosomal-recessive as a factor predicting progressive loss of renal function (1–3). familial steroid-resistant nephrotic syndrome (7). Mutations in Alteration of the glomerular filtration barrier leads via damage the gene for ␣-actinin-4 (ACTN4) have been identified by of the glomerular podocyte to leakage of proteins into the Kaplan et al. (8) to be causative in an autosomal-dominant ultrafiltrate (4). The filtration barrier consists of a specialized form of familial focal and segmental glomerulosclerosis fenestrated endothelium, the fibrillar, hydrated meshwork of (FSGS). Thus mutations of various podocyte-specific genes in the glomerular basement membrane (GBM), and interdigitat- hereditary proteinuric diseases have identified novel compo- ing podocyte foot processes with intervening filtration slits as nents of the glomerular filtration barrier. the final filtration barrier (5). Identification of mutations in Gene expression analysis of the aforementioned molecules podocyte-associated molecules in various hereditary nephrotic might elucidate common or distinct regulatory pathways in disorders has highlighted the key role of the podocyte for the nonhereditary proteinuria and provide valuable diagnostic and pathophysiology of proteinuria. The gene product of NPHS1, prognostic information. This additional diagnostic information nephrin, mutated in congenital nephrotic syndrome of the could be of particular relevance, as proteinuric diseases not only have a highly variable cause but also follow distinctly different clinical courses. Furthermore, similar clinical presen- Received January 24, 2003. Accepted July 19, 2003. tation, lack of specific clinical or laboratory parameters, and Correspondence to Dr. Matthias Kretzler, Medizinische Poliklinik, Ludwig- histologically indistinguishable lesions can complicate the di- Maximilians-Universität München, Pettenkoferstrasse 8a, D-80336, Munich, Germany. Phone: 49-89-5996845; Fax: 49-89-5996860; E-mail: kretzler@ agnostic process (9) and the clinical management of the glo- medpoli.med.uni-muenchen.de merulopathies. For example, minimal change glomerulopathy 1046-6673/1411-2958 (MCD), although often protracted, does not lead to terminal Journal of the American Society of Nephrology renal failure, whereas FSGS, if not controlled by aggressive Copyright © 2003 by the American Society of Nephrology therapy, frequently progresses to ESRD. DOI: 10.1097/01.ASN.0000090745.85482.06 The present study focuses on the glomerular mRNA expres- J Am Soc Nephrol 14: 2958–2966, 2003 Gene Expression Profiles of Podocyte-Associated Molecules in Proteinuric Diseases 2959 sion of a comprehensive series of podocyte-associated mole- Microdissection, LCM, and RNA Isolation cules in a large number of renal biopsies from adult patients For a detailed description of the protocol used, see reference 10. In with acquired proteinuric glomerulopathies. mRNA expression brief, cortical tissue segments were manually microdissected in glo- of the podocyte markers ACTN4, Glomerular epithelial protein meruli and tubulointerstitial compartments. Glomerular microdissec- 1 (GLEPP-1), Wilms tumor antigen 1 (WT-1), synaptopodin, tion was confirmed by detection of the glomerulus-specific cDNA for dystroglycan, nephrin, podoplanin, and podocin was evaluated WT-1. Total RNA was isolated from the microdissected glomeruli by real-time RT-PCR on RNA isolated from microdissected using a commercially available silica gel–based isolation protocol (RNeasy-Mini; Qiagen, Hilden, Germany) followed by random glomeruli. A systematic analysis of the relationship between primed reverse transcription. For confirmation experiments on form- the expression levels revealed a stringent positive correlation aldehyde-fixed archival renal tissues, glomeruli were microdissected of most podocyte-specific cDNA. From the expression data, a by a laser beam and harvested by laser pressure catapulting (PALM marker set could be extracted, allowing a robust separation of Laser Micro Beam System; P.A.L.M, Wolfratshausen, Germany), and the histologic entities FSGS from MCD and benign nephro- total RNA was isolated as described in detail (11). sclerosis (NS). These findings could be confirmed in formal- dehyde-fixed archival renal tissues after laser capture micro- dissection (LCM), making routine clinical application Real-Time RT-PCR technically feasible. Real-time RT-PCR was performed on a TaqMan ABI 7700 Se- quence Detection System (Applied Biosystems, Weiterstadt, Ger- many) using heat-activated TaqDNA polymerase (Amplitaq Gold; Material and Methods Applied Biosystems). After an initial hold of 2 min at 50°C and 10 Kidney Biopsies: Patients and Control Groups min at 95°C, the samples were cycled 40 times at 95°C for 15 s and Human kidney biopsies from a total of 83 patients, obtained in a 60°C for 60 s. Target gene forward and reverse primers and probes multicenter study for gene expression analysis in renal biopsies (the were designed using Primer Express 1.5 software (Applied Biosys- European Renal cDNA Consortium; see appendix for participating tems, Foster City, CA). Commercially available predeveloped Taq- centers) were included. From diagnostic renal biopsies, a segment not Man assay reagents were used for the internal standards human required for diagnostic evaluation was processed for gene expression glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) and 18 S ribo- analysis after informed consent was obtained according to the guide- somal RNA (18 S rRNA). All primers and probes were obtained from lines of the respective local ethical committees. Applied Biosystems. The primers for GAPDH, ACTN4, GLEPP-1, Microdissected glomeruli from 69 patients with five different pro- WT-1, synaptopodin, dystroglycan, nephrin (NPHS1), podoplanin, teinuric diseases and 14 control subjects were analyzed. Patients were and podocin (NPHS2) were cDNA-specific, not amplifying genomic stratified according to their histologic diagnosis by the reference DNA. The following sequences of oligonucleotide primers (300 nM) pathologist of the European Renal cDNA Consortium into the follow- and probes (100 nM) were used: ACTN4: sense GAGGCCCAGAG- ing five groups: MCD (n ϭ 13), benign NS (n ϭ 16), membranous GATCGCT, antisense ACTTGGAGTTGATGATTTGCGG, internal glomerulopathy (MGN; n ϭ 31), and FSGS (n ϭ 9). For control probe CAACCACATCAAGCTGTCGGGCAG; GLEPP-1: sense biopsies, renal tissue was derived from pretransplantation kidney TCACTGTGGAGATGATTTCAGAGG, antisense CGTCAGCAT- biopsies during cold ischemia time from four cadaveric and four AGTTGATCCGGA, internal probe AGCAGGACGACTGGGCCT- living donors (n ϭ 8). Histologic nonaffected parts of tumor nephrec- GTAGACAC; dystroglycan: sense ACAGGGACCCTGAGAA- tomies
Load more

Recommended publications
  • Decreases in Podocin, CD2-Associated Protein (CD2AP) and Tensin2 May Be Involved in Albuminuria During Septic Acute Renal Failure
    FULL PAPER Laboratory Animal Science Decreases in Podocin, CD2-Associated Protein (CD2AP) and Tensin2 May Be Involved in Albuminuria during Septic Acute Renal Failure Takashi KATO1,2), Yoko MIZUNO-HORIKAWA3) and Shinya MIZUNO1,4)* 1)Division of Molecular Regenerative Medicine, Department of Biochemistry and Molecular Biology, Osaka University Graduate School of Medicine, 2–2–B7 Yamadaoka, Suita, Osaka 565–0871, 2)Research Division for Regenerative Drug Discovery, Center for Advanced Science and Innovation, Osaka University, 2–1 Yamadaoka, Suita, Osaka 565–0871, 3)Protein Research Institute, Osaka University, 1–2 Yamadaoka, Suita, Osaka 565–0871 and 4)Division of Virology, Department of Microbiology and Immunology, Osaka University Graduate School of Medicine, 2–2–B7 Yamadaoka, Suita, Osaka 565–0871, Japan (Received 27 April 2011/Accepted 15 July 2011/Published online in J-STAGE 29 July 2011) ABSTRACT. Podocytes have a peculiar structure constituting slit diaphragm (SD) and foot process (FP), and play essential roles in the glom- erular filtration barrier. There is now ample evidence that SD- and FP-associated molecules, such as podocin and CD2-associated protein (CD2AP), are down-regulated during albuminuria of chronic kidney disease. However, it is still unclear whether these molecules are altered during acute renal failure (ARF) with albuminuria. Using lipopolysaccharide (LPS)-treated mice as a model of septic ARF, we provide evidence that the expression of SD- and FP-associated molecules becomes faint, along with albuminuria. In the LPS-treated mice, urinary albumin levels gradually increased, associated with the elevation of blood urea nitrogen levels, indicating the successful induction of albuminuria during septic ARF.
    [Show full text]
  • Podocin Inactivation in Mature Kidneys Causes Focal Segmental Glomerulosclerosis and Nephrotic Syndrome
    BASIC RESEARCH www.jasn.org Podocin Inactivation in Mature Kidneys Causes Focal Segmental Glomerulosclerosis and Nephrotic Syndrome Ge´raldine Mollet,*† Julien Ratelade,*† Olivia Boyer,*†‡ Andrea Onetti Muda,*§ ʈ Ludivine Morisset,*† Tiphaine Aguirre Lavin,*† David Kitzis,*† Margaret J. Dallman, ʈ Laurence Bugeon, Norbert Hubner,¶ Marie-Claire Gubler,*† Corinne Antignac,*†** and Ernie L. Esquivel*† *INSERM, U574, Hoˆpital Necker-Enfants Malades, Paris, France; †Faculte´deMe´ decine Rene´ Descartes, Universite´ Paris Descartes, Paris, France; ‡Pediatric Nephrology Department and **Department of Genetics, Hoˆpital Necker- Enfants Malades, Assistance Publique-Hoˆpitaux de Paris, Paris, France; §Department of Pathology, Campus ʈ Biomedico University, Rome, Italy; Department of Biological Sciences, Imperial College London, London, England; and ¶Max-Delbruck Center for Molecular Medicine, Berlin, Germany ABSTRACT Podocin is a critical component of the glomerular slit diaphragm, and genetic mutations lead to both familial and sporadic forms of steroid-resistant nephrotic syndrome. In mice, constitutive absence of podocin leads to rapidly progressive renal disease characterized by mesangiolysis and/or mesangial sclerosis and nephrotic syndrome. Using established Cre-loxP technology, we inactivated podocin in the adult mouse kidney in a podocyte-specific manner. Progressive loss of podocin in the glomerulus recapitu- lated albuminuria, hypercholesterolemia, hypertension, and renal failure seen in nephrotic syndrome in humans. Lesions of FSGS appeared
    [Show full text]
  • NPHS2 (Podocin) Mutations in Nephrotic Syndrome
    0031-3998/05/5705-0054R PEDIATRIC RESEARCH Vol. 57, No. 5, Pt 2, 2005 Copyright © 2005 International Pediatric Research Foundation, Inc. Printed in U.S.A. NPHS2 (Podocin) Mutations in Nephrotic Syndrome. Clinical Spectrum and Fine Mechanisms GIANLUCA CARIDI, FRANCESCO PERFUMO, AND GIAN MARCO GHIGGERI Laboratory on Pathophysiology of Uremia [G.C., G.M.C.], and Renal Unit [F.P., G.M.C.], Istituto Giannina Gaslini, 16148 Genova, Italy. ABSTRACT Nephrotic syndrome (NS) is the most frequent cause of iments with the common R229Q polymorphism demonstrated an proteinuria in children and is emerging as a leading cause of altered interaction with nephrin that affects the stability of the uremia. Molecular studies in families with recessive NS have led functional unit. Overall, data are here presented that underscore to the discovery of specialized molecules endowed in podocytes a major role of inherited defects of NPHS2 in NS in children that play a role in proteinuria. This review focalizes the key (including a relevant impact in sporadic cases) and give the position of podocin (NPHS2 gene) in this rapidly evolving field functional rationale for the association. A practical compendium and furnishes a compendium to those involved in clinics and is also given to clinicians involved in the management of NS that genetics of NS. Screening for NPHS2 mutations have been done should modify the classic therapeutic approach. (Pediatr Res 57: in sporadic NS and familial cases with recessive inheritance, 54R–61R, 2005) documenting a mutation detection rate of 45–55% in families and 8–20% in sporadic NS according to the different groups and considering all the clinical phenotypes.
    [Show full text]
  • Urine-Derived Epithelial Cells As Models for Genetic Kidney Diseases
    cells Review Urine-Derived Epithelial Cells as Models for Genetic Kidney Diseases Tjessa Bondue 1 , Fanny O. Arcolino 1 , Koenraad R. P. Veys 1,2, Oyindamola C. Adebayo 1,3, Elena Levtchenko 1,2, Lambertus P. van den Heuvel 1,4 and Mohamed A. Elmonem 5,* 1 Department of Development and Regeneration, KU Leuven, 3000 Leuven, Belgium; [email protected] (T.B.); [email protected] (F.O.A.); [email protected] (K.R.P.V.); [email protected] (O.C.A.); [email protected] (E.L.); [email protected] (L.P.v.d.H.) 2 Department of Pediatrics, Division of Pediatric Nephrology, University Hospitals Leuven, 3000 Leuven, Belgium 3 Centre for Molecular and Vascular Biology, Department of Cardiovascular Sciences, KU Leuven, 3000 Leuven, Belgium 4 Department of Pediatric Nephrology, Radboud University Medical Center, 6500 Nijmegen, The Netherlands 5 Department of Clinical and Chemical Pathology, Faculty of Medicine, Cairo University, Cairo 11628, Egypt * Correspondence: [email protected] Abstract: Epithelial cells exfoliated in human urine can include cells anywhere from the urinary tract and kidneys; however, podocytes and proximal tubular epithelial cells (PTECs) are by far the most relevant cell types for the study of genetic kidney diseases. When maintained in vitro, they have been proven extremely valuable for discovering disease mechanisms and for the development of new therapies. Furthermore, cultured patient cells can individually represent their human sources and their specific variants for personalized medicine studies, which are recently gaining much Citation: Bondue, T.; Arcolino, F.O.; interest. In this review, we summarize the methodology for establishing human podocyte and PTEC Veys, K.R.P.; Adebayo, O.C.; cell lines from urine and highlight their importance as kidney disease cell models.
    [Show full text]
  • Identification of Podocin (NPHS2) Gene Mutations in African
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Kidney International, Vol. 68 (2005), pp. 256–262 Identification of podocin (NPHS2) gene mutations in African Americans with nondiabetic end-stage renal disease JUDITH A. ENGELER DUSEL,1 KATHRYN P. B URDON,1 PAMELA J. HICKS,GREGORY A. HAWKINS, DONALD W. B OWDEN, and BARRY I. FREEDMAN Departments of Internal Medicine, Center for Human Genomics, Biochemistry, Wake Forest University School of Medicine, Medical Center Boulevard, Winston-Salem, North Carolina Identification of podocin (NPHS2) gene mutations in African End-stage renal disease (ESRD), with its associated Americans with nondiabetic end-stage renal disease. glomerulosclerosis and interstitial fibrosis, is a major Background. Podocin, encoded by NPHS2 and mapped to cause of morbidity and mortality worldwide. The lead- 1q25.2, is an integral membrane protein exclusively expressed in glomerular podocytes. Mutations in the NPHS2 gene cause ing causes of ESRD are diabetic nephropathy, hy- autosomal-recessive nephrotic syndrome and have been associ- pertension, and chronic glomerular diseases. Alarming ated with proteinuria in several populations. Evidence for link- increases in health care costs and numbers of individu- age of end-stage renal disease (ESRD) to chromosome 1q25-31 als affected by ESRD have recently been reported. More in the region of NPHS2 has been identified in a genome-wide than 96,000 Americans were diagnosed with ESRD, and scan in African American (AA) siblings. Methods. To investigate the potential role of this gene in 364,000 received renal replacement therapy (dialysis) in ESRD, we sequenced all coding regions and approximately 2 kb 2001 (www.usrds.org).
    [Show full text]
  • Broadening the Spectrum of Diseases Related to Podocin Mutations
    J Am Soc Nephrol 14: 1278–1286, 2003 Broadening the Spectrum of Diseases Related to Podocin Mutations GIANLUCA CARIDI,* ROBERTA BERTELLI,* MARCO DI DUCA,* MONICA DAGNINO,* FRANCESCO EMMA,‡ ANDREA ONETTI MUDA,§ FRANCESCO SCOLARI,¶ NUNZIA MIGLIETTI,ʈ GIANNA MAZZUCCO,# LUISA MURER,@ ALBA CARREA,* LAURA MASSELLA,‡ GIANFRANCO RIZZONI,‡ FRANCESCO PERFUMO,† and GIAN MARCO GHIGGERI*† *Laboratory on Pathophysiology of Uremia, and †Department of Nephrology, Istituto G. Gaslini, Genova, Italy; ‡Section of Nephrology, Bambin Gesu`Children Hospital, Rome, Italy; §Department of Experimental Medicine and Pathology, University “La Sapienza,” Rome, Italy; ¶Unit of Nephrology, Spedali Civili di Brescia, Italy; ʈDepartment of Pediatrics, University of Brescia, Italy; #Pathology Section, Department of Biomedical Sciences and Human Oncology, University of Torino, Italy; @Department of Pediatrics, University of Padova, Italy. Abstract. A total of 179 children with sporadic nephrotic father, respectively. Immunohistochemistry with anti-podocin syndrome were screened for podocin mutations: 120 with antibodies revealed markedly decreased expression of the pro- steroid resistance, and 59 with steroid dependence/frequent tein in their kidneys. All carriers of heterozygous coding podo- relapses. Fourteen steroid-resistant patients presented homozy- cin mutation or R229Q were screened for nephrin mutation that gous mutations that were associated with early onset of pro- was found in heterozygosity associated with R229Q in one teinuria and variable renal lesions, including one case with patient. Finally, podocin loss of heterozygosity was excluded mesangial C3 deposition. Single mutations of podocin were in one heterozygous child by characterizing cDNA from dis- found in four steroid-resistant and in four steroid-dependent; sected glomeruli. These data outline the clinical features of five patients had the same mutation (P20L).
    [Show full text]
  • NPHS2 Gene NPHS2, Podocin
    NPHS2 gene NPHS2, podocin Normal Function The NPHS2 gene provides instructions for making a protein called podocin. Podocin is primarily found in the kidneys, which are organs that filter waste products from the blood and remove them in urine. Specifically, podocin is found in cells called podocytes, which are located in specialized kidney structures called glomeruli. Podocin is located at the cell surface in the area between two podocytes called the slit diaphragm. The slit diaphragm is known as a filtration barrier because it captures proteins in blood so that they remain in the body while allowing other molecules like sugars and salts to be excreted in urine. Podocin likely helps bring other proteins that are needed for a functional slit diaphragm to the podocyte cell surface. The protein also is involved with podocyte cell signaling, helping the cell adapt to changes that occur during the filtration process. Health Conditions Related to Genetic Changes Congenital nephrotic syndrome At least 170 mutations in the NPHS2 gene have been found to cause congenital nephrotic syndrome. This condition is a kidney disorder that begins in infancy and typically leads to irreversible kidney failure (end-stage renal disease) by early childhood. Mutations in this gene appear to be the most frequent cause of congenital nephrotic syndrome. Most NPHS2 gene mutations change single protein building blocks (amino acids) in the podocin protein. These mutations result in a reduction or absence of functional protein, which impairs the formation of normal slit diaphragms. Without a functional slit diaphragm, molecules pass through the kidneys abnormally and are excreted in urine.
    [Show full text]
  • Mutations in NPHS2 Encoding Podocin Are a Prevalent Cause of Steroid-Resistant Nephrotic Syndrome Among Israeli-Arab Children
    J Am Soc Nephrol 13: 400–405, 2002 Mutations in NPHS2 Encoding Podocin Are a Prevalent Cause of Steroid-Resistant Nephrotic Syndrome among Israeli-Arab Children YAACOV FRISHBERG,* CHONI RINAT,* ORLI MEGGED,* ELI SHAPIRA,* SOFIA FEINSTEIN,* and ANNICK RAAS-ROTHSCHILD† *Division of Pediatric Nephrology, Shaare Zedek Medical Center, Jerusalem, Israel; and †Department of Human Genetics, Hadassah University Medical Center and Hadassah-Hebrew University School of Medicine, Jerusalem, Israel. Abstract. Steroid-resistant nephrotic syndrome (SRNS) repre- tested (familial and nonfamilial), 15 patients (55%) were ho- sents a heterogeneous group of kidney disorders that are often mozygous for the mutation (R138X). They all shared the same resistant to other immunosuppressive agents and tend to haplotype and were homozygous for the A1023G polymor- progress to end-stage renal failure. Mutations in the gene phism, thus pointing to a possible founder effect. Thirteen NPHS2 that encode a protein named podocin have recently children of Israeli-Jewish origin with SRNS and biopsy-proven been found in a recessive form of SRNS. Ten children from FSGS and 15 children of both ethnic groups with steroid- two inbred families of Israeli-Arab descent presented with responsive FSGS were tested, and none was found to have SRNS. Renal histologic findings were of diffuse mesangial mutations in NPHS2. The results of this study demonstrate that proliferation. Six patients reached end-stage renal failure, but mutations in NPHS2 are a common cause of SRNS in Israeli- nephrotic syndrome did not recur after renal transplantation. Arab children. Mutations in NPHS2 may cause SRNS in non- Mutation analysis of NPHS2 revealed that they were homozy- familial cases.
    [Show full text]
  • Notch Signaling, Wt1 and Foxc2 Are Key Regulators of the Podocyte Gene Regulatory Network in Xenopus Jeffrey T
    RESEARCH ARTICLE 1863 Development 137, 1863-1873 (2010) doi:10.1242/dev.042887 © 2010. Published by The Company of Biologists Ltd Notch signaling, wt1 and foxc2 are key regulators of the podocyte gene regulatory network in Xenopus Jeffrey T. White1, Bo Zhang1, Débora M. Cerqueira1, Uyen Tran1 and Oliver Wessely1,2,* SUMMARY Podocytes are highly specialized cells in the vertebrate kidney. They participate in the formation of the size-exclusion barrier of the glomerulus/glomus and recruit mesangial and endothelial cells to form a mature glomerulus. At least six transcription factors (wt1, foxc2, hey1, tcf21, lmx1b and mafb) are known to be involved in podocyte specification, but how they interact to drive the differentiation program is unknown. The Xenopus pronephros was used as a paradigm to address this question. All six podocyte transcription factors were systematically eliminated by antisense morpholino oligomers. Changes in the expression of the podocyte transcription factors and of four selected markers of terminal differentiation (nphs1, kirrel, ptpru and nphs2) were analyzed by in situ hybridization. The data were assembled into a transcriptional regulatory network for podocyte development. Although eliminating the six transcription factors individually interfered with aspects of podocyte development, no single gene regulated the entire differentiation program. Only the combined knockdown of wt1 and foxc2 resulted in a loss of all podocyte marker gene expression. Gain-of-function studies showed that wt1 and foxc2 were sufficient to increase podocyte gene expression within the glomus proper. However, the combination of wt1, foxc2 and Notch signaling was required for ectopic expression in ventral marginal zone explants. Together, this approach demonstrates how complex interactions are required for the correct spatiotemporal execution of the podocyte gene expression program.
    [Show full text]
  • CIN85: Implications for the Development of Proteinuria in Diabetic Nephropathy
    3532 Diabetes Volume 65, December 2016 Kojiro Nagai and Toshio Doi CIN85: Implications for the Development of Proteinuria in Diabetic Nephropathy Diabetes 2016;65:3532–3534 | DOI: 10.2337/dbi16-0051 Diabetic nephropathy (DN) is the most common cause of complexes, which bind to F-actin and modulate dynamic end-stage renal disease worldwide, and the therapy option rearrangements of the cytoskeleton in podocytes (12). is far from a solution. The earliest morphological change is In CD2AP-deficient mice, CIN85 expression increases glomerular basement membrane thickening, followed by in podocytes and causes a profound defect in PI3K/AKT mesangial expansion, predominantly because of an increase and Ras-ERK-MAPK signaling response after the stimula- in mesangial matrix. The clinical manifestations of DN, tion of RTKs with various growth factors, such as fibroblast such as microalbuminuria or proteinuria, are strongly re- growth factor 4, at 3 weeks of age, which correlates with a lated to these structural changes (1). However, the onset rapid-onset nephrotic syndrome (13). In the presence of of albuminuria is also associated with podocytopathies in CIN85, which is involved in downregulation of RTKs, which several important podocyte slit diaphragm–associated nephrin is internalized by endocytosis and ubiquitinated proteins are involved (2). Podocyte slit diaphragm plays a after stimulation with fibroblast growth factor 4. CIN85 pivotal role in maintaining the size-selective barrier dem- binds directly to nephrin and podocin through its coiled- onstrated by the analysis of congenital nephrotic syn- coil domain. Coexpression of CIN85 with CD2AP leads to a drome (3,4). Slit diaphragm–associated proteins, such as decreased binding of CIN85 to nephrin and podocin, which nephrin, CD2-associated protein (CD2AP), and podocin, indicates a functional competition between CD2AP and have been investigated to clarify the phenotypical mod- CIN85, suggesting a novel role for CIN85 in slit diaphragm COMMENTARY ification of podocytes in genetic disease (5).
    [Show full text]
  • Mutations of Podocin in Sporadic Steroid-Resistant Nephrotic Syndrome
    J Am Soc Nephrol 13: 577–579, 2002 Not All in the Family: Mutations of Podocin in Sporadic Steroid-Resistant Nephrotic Syndrome MICHELLE P. WINN Division of Nephrology, Duke University Medical Center, Durham, North Carolina. The causes of familial nephrotic syndromes are varied and and may be involved with protein trafficking (12). Recently an diverse. Although phenotypic differences are seen with distinct adult form of autosomal recessive FSGS has been linked to this congenital and adult forms, renal pathology tends to be less region (13). well defined, with blurring and overlap of diagnoses. Clini- The article by Karle et al. (14) describes novel mutations of cally, symptoms of the familial nephrotic syndromes may NPHS2 in steroid-resistant congenital nephrotic syndrome and appear from birth to late in life, which demonstrates the het- provides first-time evidence for mutations in NPHS2 in spo- erogeneity of these diseases. The disease may be mild or radic disease. These findings bear out a frequently held as- severe, such that there is variable progression to end-stage sumption that genetic studies of rare familial diseases will renal disease (ESRD) (1–3). Pathologic diagnoses associated provide insight into the pathogenesis of that disease and the with familial nephrotic syndromes include minimal change- mechanism of the more common sporadic forms of that same type lesions, mesangial sclerosis, and focal segmental glomer- disease. The patients described by Karle et al. appear to differ ulosclerosis (FSGS) (4,5). Treatment depends on the specific phenotypically from the original description of families with disease state, ranging from bilateral nephrectomy and trans- steroid-resistant idiopathic nephrotic syndrome.
    [Show full text]
  • Recombinant Human Podocin/NPHS2 Catalog Number: 9287-PO
    Recombinant Human Podocin/NPHS2 Catalog Number: 9287-PO DESCRIPTION Source E. coli-derived human Podocin/NPHS2 protein Lys259-Leu383, with an N-terminal Met and a C-terminal 6-His tag Accession # Q9NP85 N-terminal Sequence Met Analysis Predicted Molecular 15 kDa Mass SPECIFICATIONS SDS-PAGE 13 kDa, reducing conditions Activity Measured by its binding ability in a functional ELISA. When recombinant human Nephrin is immobilized at 1 μg/mL, 100 μL/well, Recombinant Human Podocin/NPHS2 binds with a typical ED50 of 0.8-4 μg/mL. Endotoxin Level <0.10 EU per 1 μg of the protein by the LAL method. Purity >95%, by SDS-PAGE visualized with Silver Staining and quantitative densitometry by Coomassie® Blue Staining. Formulation Lyophilized from a 0.2 μm filtered solution in PBS. See Certificate of Analysis for details. PREPARATION AND STORAGE Reconstitution Reconstitute at 200 μg/mL in PBS. Shipping The product is shipped with polar packs. Upon receipt, store it immediately at the temperature recommended below. Stability & Storage Use a manual defrost freezer and avoid repeated freeze-thaw cycles. 12 months from date of receipt, -20 to -70 °C as supplied. 1 month, 2 to 8 °C under sterile conditions after reconstitution. 3 months, -20 to -70 °C under sterile conditions after reconstitution. BACKGROUND Podocin, encoded by the NPHS2 gene, is an approximately 50 kDa membrane protein that plays an important role in podocyte function in the kidney. Loss of Podocin function results in albuminuria, hypercholesterolemia, hypertension, and renal failure (1). Human Podocin consists of a 102 amino acid (aa) cytoplasmic domain, a 21 aa intramembrane segment, and a second 262 aa cytoplasmic domain (2, 3).
    [Show full text]