Notch Signaling, Wt1 and Foxc2 Are Key Regulators of the Podocyte Gene Regulatory Network in Xenopus Jeffrey T
Total Page:16
File Type:pdf, Size:1020Kb

Load more
Recommended publications
-
1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia
1 Evidence for gliadin antibodies as causative agents in schizophrenia. C.J.Carter PolygenicPathways, 20 Upper Maze Hill, Saint-Leonard’s on Sea, East Sussex, TN37 0LG [email protected] Tel: 0044 (0)1424 422201 I have no fax Abstract Antibodies to gliadin, a component of gluten, have frequently been reported in schizophrenia patients, and in some cases remission has been noted following the instigation of a gluten free diet. Gliadin is a highly immunogenic protein, and B cell epitopes along its entire immunogenic length are homologous to the products of numerous proteins relevant to schizophrenia (p = 0.012 to 3e-25). These include members of the DISC1 interactome, of glutamate, dopamine and neuregulin signalling networks, and of pathways involved in plasticity, dendritic growth or myelination. Antibodies to gliadin are likely to cross react with these key proteins, as has already been observed with synapsin 1 and calreticulin. Gliadin may thus be a causative agent in schizophrenia, under certain genetic and immunological conditions, producing its effects via antibody mediated knockdown of multiple proteins relevant to the disease process. Because of such homology, an autoimmune response may be sustained by the human antigens that resemble gliadin itself, a scenario supported by many reports of immune activation both in the brain and in lymphocytes in schizophrenia. Gluten free diets and removal of such antibodies may be of therapeutic benefit in certain cases of schizophrenia. 2 Introduction A number of studies from China, Norway, and the USA have reported the presence of gliadin antibodies in schizophrenia 1-5. Gliadin is a component of gluten, intolerance to which is implicated in coeliac disease 6. -
PARSANA-DISSERTATION-2020.Pdf
DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks. -
Id Proteins Promote a Cancer Stem Cell Phenotype in Triple Negative Breast
bioRxiv preprint doi: https://doi.org/10.1101/497313; this version posted March 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Id proteins promote a cancer stem cell phenotype in triple negative 2 breast cancer via negative regulation of Robo1 3 Wee S. Teo1,2, Holly Holliday1,2#, Nitheesh Karthikeyan3#, Aurélie S. Cazet1,2, Daniel L. 4 Roden1,2, Kate Harvey1, Christina Valbirk Konrad1, Reshma Murali3, Binitha Anu Varghese3, 5 Archana P. T.3,4, Chia-Ling Chan1,2, Andrea McFarland1, Simon Junankar1,2, Sunny Ye1, 6 Jessica Yang1, Iva Nikolic1,2, Jaynish S. Shah5, Laura A. Baker1,2, Ewan K.A. Millar1,6,7,8, 7 Mathew J. Naylor1,2,10, Christopher J. Ormandy1,2, Sunil R. Lakhani11, Warren Kaplan1,12, 8 Albert S. Mellick13,14, Sandra A. O’Toole1,9, Alexander Swarbrick1,2*, Radhika Nair1,2,3* 9 Affiliations 10 1Garvan Institute of Medical Research, Darlinghurst, New South Wales, Australia 11 2St Vincent’s Clinical School, Faculty of Medicine, UNSW Sydney, New South Wales, 12 Australia 13 3 Cancer Research Program, Rajiv Gandhi Centre for Biotechnology, Kerala, India 14 4Manipal Academy of Higher Education, Manipal, Karnataka, India 15 5Centenary Institute, The University of Sydney, New South Wales, Australia 16 6 Department of Anatomical Pathology, NSW Health Pathology, St George Hospital, 17 Kogarah, NSW, Australia 18 7 School of Medical Sciences, UNSW Sydney, Kensington NSW, Australia. -
Overlap of Vitamin a and Vitamin D Target Genes with CAKUT- Related Processes [Version 1; Peer Review: 1 Approved with Reservations]
F1000Research 2021, 10:395 Last updated: 21 JUL 2021 BRIEF REPORT Overlap of vitamin A and vitamin D target genes with CAKUT- related processes [version 1; peer review: 1 approved with reservations] Ozan Ozisik1, Friederike Ehrhart 2,3, Chris T Evelo 2, Alberto Mantovani4, Anaı̈s Baudot 1,5 1Aix Marseille University, Inserm, MMG, Marseille, 13385, France 2Department of Bioinformatics - BiGCaT, Maastricht University, Maastricht, 6200 MD, The Netherlands 3Department of Bioinformatics, NUTRIM/MHeNs, Maastricht University, Maastricht, 6200 MD, The Netherlands 4Istituto Superiore di Sanità, Rome, 00161, Italy 5Barcelona Supercomputing Center (BSC), Barcelona, 08034, Spain v1 First published: 18 May 2021, 10:395 Open Peer Review https://doi.org/10.12688/f1000research.51018.1 Latest published: 18 May 2021, 10:395 https://doi.org/10.12688/f1000research.51018.1 Reviewer Status Invited Reviewers Abstract Congenital Anomalies of the Kidney and Urinary Tract (CAKUT) are a 1 group of abnormalities affecting the kidneys and their outflow tracts, which include the ureters, the bladder, and the urethra. CAKUT version 1 patients display a large clinical variability as well as a complex 18 May 2021 report aetiology, as only 5% to 20% of the cases have a monogenic origin. It is thereby suspected that interactions of both genetic and 1. Elena Menegola, Università degli Studi di environmental factors contribute to the disease. Vitamins are among the environmental factors that are considered for CAKUT aetiology. In Milano, Milan, Italy this study, we collected vitamin A and vitamin D target genes and Any reports and responses or comments on the computed their overlap with CAKUT-related gene sets. -
Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897 -
Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7 -
Supplementary Table 1: Adhesion Genes Data Set
Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like, -
Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1. -
LMX1B Gene LIM Homeobox Transcription Factor 1 Beta
LMX1B gene LIM homeobox transcription factor 1 beta Normal Function The LMX1B gene provides instructions for producing a protein that attaches (binds) to specific regions of DNA and regulates the activity of other genes. On the basis of this role, the LMX1B protein is called a transcription factor. The LMX1B protein appears to be particularly important during early embryonic development of the limbs, kidneys, and eyes. Health Conditions Related to Genetic Changes Nail-patella syndrome At least 145 mutations in the LMX1B gene have been found to cause nail-patella syndrome. Most mutations result in the production of an abnormally short, nonfunctional version of the LMX1B protein or change a single protein building block (amino acid). Mutations that substitute one amino acid for another amino acid reduce or eliminate the protein's ability to bind to DNA, disrupting the regulation of other genes during early development. Deletions of the entire LMX1B gene or large portions of the gene have also been shown to cause nail patella syndrome. It is unclear exactly how mutations in the LMX1B gene lead to the signs and symptoms of nail-patella syndrome. Other Names for This Gene • LIM homeo box transcription factor 1, beta • LIM homeobox transcription factor 1, beta • LMX1.2 • LMX1B_HUMAN • MGC138325 • MGC142051 • NPS1 Reprinted from MedlinePlus Genetics (https://medlineplus.gov/genetics/) 1 Additional Information & Resources Tests Listed in the Genetic Testing Registry • Tests of LMX1B (https://www.ncbi.nlm.nih.gov/gtr/all/tests/?term=4010[geneid]) -
Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Identification of Novel Kirrel3 Gene Splice Variants in Adult Human
Durcan et al. BMC Physiology 2014, 14:11 http://www.biomedcentral.com/1472-6793/14/11 RESEARCH ARTICLE Open Access Identification of novel Kirrel3 gene splice variants in adult human skeletal muscle Peter Joseph Durcan1, Johannes D Conradie1, Mari Van deVyver2 and Kathryn Helen Myburgh1* Abstract Background: Multiple cell types including trophoblasts, osteoclasts and myoblasts require somatic cell fusion events as part of their physiological functions. In Drosophila Melanogaster the paralogus type 1 transmembrane receptors and members of the immunoglobulin superfamily Kin of Irre (Kirre) and roughest (Rst) regulate myoblast fusion during embryonic development. Present within the human genome are three homologs to Kirre termed Kin of Irre like (Kirrel) 1, 2 and 3. Currently it is unknown if Kirrel3 is expressed in adult human skeletal muscle. Results: We investigated (using PCR and Western blot) Kirrel3 in adult human skeletal muscle samples taken at rest and after mild exercise induced muscle damage. Kirrel3 mRNA expression was verified by sequencing and protein presence via blotting with 2 different anti-Kirrel3 protein antibodies. Evidence for three alternatively spliced Kirrel3 mRNA transcripts in adult human skeletal muscle was obtained. Kirrel3 mRNA in adult human skeletal muscle was detected at low or moderate levels, or not at all. This sporadic expression suggests that Kirrel3 is expressed in a pulsatile manner. Several anti Kirrel3 immunoreactive proteins were detected in all adult human skeletal muscle samples analysed and results suggest the presence of different isoforms or posttranslational modification, or both. Conclusion: The results presented here demonstrate for the first time that there are at least 3 splice variants of Kirrel3 expressed in adult human skeletal muscle, two of which have never previously been identified in human muscle.