Supplemental Material

DLG5 CONNECTS CELL POLARITY AND HIPPO SIGNALING PROTEIN NETWORKS BY LINKING PAR-1 WITH MST1/2

Julian Kwan, Anna Sczaniecka, Emad Heidary Arash, Liem Nguyen, Chia-Chun Chen, Srdjana Ratkovic, Olga Klezovitch, Liliana Attisano, Helen McNeill, Andrew Emili and Valeri Vasioukhin

Supplemental Experimental Procedures

Immunoprecipitation and Western blot analysis HEK293T cells transfected with indicated plasmids were lysed in immunoprecipitation buffer containing 50mM Tris-HCl pH7.5, 100 mM NaCl, 1% Triton X-100, 10% glycerol, 0.1mM EDTA, 0.5mM MgCl2, phosphatase inhibitors (Roche 04906837001), and protease inhibitors (Roche 11836170001). V5-tagged proteins were immunoprecipitated using V5 Sepharose (Sigma A7345-1ML). nVA-tagged proteins were immunoprecipitated using either anti -FLAG M2 affinity beads (Sigma A2220) or Strep-Tactin Sepharose (IBA 2-1201-002). Protein complexes were washed four times in immunoprecipitation buffer and analyzed by Western blotting. For co-immunoprecipitation experiments with endogenously expressed proteins, NPC cells were lysed in immunoprecipitation buffer containing 50mM Tris, 100mM NaCl, 0.5% IGPAL, 0.1mM EDTA, 0.5mM MgCl2, phosphatase and protease inhibitors (Roche). Protein extracts from wild-type and Dlg5-/- NPCs were pre-cleared by incubation with Protein A Beads (Millipore 16-156) for 1 hour and supernatants were incubated overnight with either anti-Dlg5(Nechiporuk et al., 2013), anti-MARK3 (Cell Signaling, 9311) or anti-MST1/2 (Bethyl Laboratories A300-468A) antibodies. The protein complexes were incubated with Protein A Beads for 2 hours followed by 4 washes in the lysis buffer and western blot analyses. Western blot analysis was performed using NuPage Novex 4-12% gradient gel system, semi-dry protein transfer to Immobolon P membrane (Millipore) and ECL kit (Pierce), as previously described(Lien et al., 2008). Western blotting was performed using the flowing antibodies: Ms anti-YAP1 (Santa Cruz sc-101199), Rb anti- Phospho-YAP S127 (Cell Signaling 4911), Ms anti-TAZ (BD Pharmingen 560235), Rb anti-MST1 (abcam ab97399), Rb anti-MST1 (Millipore [Upstate] 07-061), Rb anti-MST2 (Thermo Scientific PA5-28567), Rb anti- MST1/2 (Bethyl Laboratories, A300-468A), Rb anti-Phospho-MST1/2 183/180 (Cell Signaling 3681), Rb anti- LATS1 (Cell Signaling 3477), Rb anti-LATS2 (Bethyl Labs A300-479A), Rb anti-LATS1/2 S909 (Cell Signaling 9157), Rb anti-phospho-LATS1/2 T1079 (Cell Signaling 9159), Rb anti-Dlg5 (PMID: 23466739) Primary antibodies were detected using HRP-labeled secondary antibodies (Jackson ImmunoResearch Laboratories).

Plasmids and siRNA oligos All ORFs cloned from cDNA were fully sequence verified, ORFs from existing collections were partially or fully sequenced (Table S4) Most ORFs were expressed from pLD-puro-TnVA(Mak et al., 2010). Generation of expression constructs encoding V5-tagged full-length and individual domains of DLG5 was previously described(Nechiporuk et al., 2013). siGENOME Human DLG5 (9231) and control pools were obtained from Dharmacon(GE).

Quantitative RT-PCR for mouse transcripts Total RNA was isolated using Trizol (ThermoFisher), purified using the RNeasy MinElute Cleanup Kit (Qiagen 74204), and cDNA was made using the SuperScript III First strand cDNA Synthesis System (Invitrogen 18080- 051). Relative cDNA levels were assessed using 7900 Real-Time PCR System (Applied Biosystems) and Universal Probes (Roche) or Invitrogen SuperMix-UDG (Invitrogen # 11730-025) kits. qPCR data were normalized to ribosomal protein Rps16. See Table S2 for primer sequences.

Drosophila Dlg5 RNAi stocks used were: BDSC stock#: 30925, 30926, VDRC ID#: 46234, 101596, 22496. Expression of RNAi was induced using en-Gal4 at 25C and ey-Gal4 at 29C. Changes in expression were examined using wing imaginal discs from ex697/UAS-Dicer2; UAS-Dlg5RNAi30925/dpp-Gal4 and ex697/en-Gal4; UAS- Dlg5RNAi30925/UAS-Dicer2 at 25C. Quantification was performed for three discs from each condition, the mean staining intensity was measured using ImageJ in five areas of mutant tissue and adjacent non-mutant tissue areas. Chosen areas were representative of the heterogeneity of the tissue.

siRNA knockdowns in MDA-MB-231 and HepG2 cells Cells were transfected with Dharmacon siGENOME pools of four individual siRNAs (GE) using Lipofectamine RNAiMAX (Life Technologies) according to the manufacturer's instructions. Cells were lysed in lysis buffer (50 mM Tris–HCl, 150 mM NaCl, 1 mM EDTA, 0.5% Triton X-100, 1 mM DTT containing phosphatase and protease inhibitors). Lysates were separated on SDS–PAGE gels, and immunoblotting was performed using standard protocols. Phos-Tag gels(Waco Chemicals), were prepared according to manufacturer's instructions. The antibodies used were as follows: pYAP (D9W2I; Cell Signaling #13008); YAP (Cell Signaling #4912), TAZ (Cell Signaling #2149), Lats1 (C66B5; Cell Signaling #3477).

Immunofluorescence microscopy of cultured cells Cell were plated in 4-well Lab-Tek chambers (#154526) and fixed with 4% paraformaldehyde for 10 min at room temperature. After washing with PBS, cells were permeabilized with 0.5% Triton X-100 in PBS for 10 min at room temperature. Samples were washed three times with 0.01% PBS–Tween and then blocked in 2% BSA–PBS for 30 min before treatment with primary antibody. Samples were then incubated with mouse anti- YAP 1:300; Santa Cruz sc-101199 in 2% BSA–PBS overnight at 4°C. After washing three times with 0.01% PBS–Tween, slides were incubated with goat anti-mouse Alexa Fluor 546 (Invitrogen #A11029, 1:1,000 in 2% BSA–PBS) for 1–2 h at room temperature. Slides were washed three times with 0.01% PBS–Tween and once with PBS and mounted with ProLong Gold Antifade Reagent (Life Technologies #P36035). Cell nuclei were visualized by DAPI staining. Images were captured using a spinning disc confocal scanner (CSU10, Yokogawa) on Leica DMI6000B microscope, and Volocity software was used for image acquisition and processing.

Quantitative RT-PCR for human transcripts Total RNA was purified using PureLink RNA Mini Kit (Life Technologies). cDNA was synthesized using 1 µg of purified RNA using oligo-dT primers and M-MLV Reverse Transcriptase (Invitrogen #28025-013). Real- Time PCR was performed using the SYBR Green master mix (Applied Biosystems) on the ABI Prism 7900 HT system (Applied Biosystems). Relative gene expression was quantified by ΔΔCt method and normalized to Gapdh. See Table S2 for primer sequences.

Luciferase assay For luciferase reporter assays, cells were seeded in 96-well black/clear imaging plates (BD Falcon). Firefly Luciferase reporter, CMV-Renilla Luciferase, and indicated plasmids were co-transfected into HEK293 cells. 48 hours after transfection, cells were lysed and luciferase activity was assayed using the Dual Glo Luciferase assay system (Promega) by Biotek Synergy 2 multi-mode plate reader utilizing Gen5 software. CTGF- luciferase(Lai et al., 2011) or 8xGTIIC-luciferase (Dupont et al., 2011) were used as reporters of YAP1 transcriptional activity. CTGF-luciferase was a gift from Xiaolong Yang (Lai et al., 2011). 8xGTIIC-luciferase was a gift from Stefano Piccolo, Addgene plasmid # 34615 (Dupont et al., 2011). Firefly luciferase activities were normalized to Renilla Luciferase.

In vitro pull down assay Mouse Dlg5 domains were cloned into pGEX vectors, expressed and purified from BL21 cells. FLAG tagged SAV1, MST1, and MST2 or MARK3 were immunoprecipitated from HEK 293T cells with M2 affinity agarose gel (Sigma) and incubated in high salt buffer 50mM Tris, 1.15M NaCl, 0.7% Nonidet P-40 with protease and phosphatase inhibitors for 4 hours to disrupt weaker protein interactions. Salt-washed-bait-bound affinity gel was then incubated with 100ug of purified GST-PDZ fusion protein overnight. Affinity gel was washed 3 times and pull-downs were analyzed by western blot.

Supplemental Figures

Figure S1. Interaction between DLG5 and MST2 proteins expressed in HEK293FT cells, related to Figure 1. (A) Western blot (WB) analysis of total (input) and immunoprecipitated using Strep-Tactin-sepharose (IP-nVA) proteins with anti-V5 (V5-DLG5) and FLAG (nVA-MST2) antibodies. Cells were transfected with indicated expression constructs two days before the analysis.

(B) Western blot (WB) analysis of total (input) and immunoprecipitated using anti-V5-sepharose (IP-V5) proteins with anti-V5 (V5-DLG5) and FLAG (nVA-MST2) antibodies. Cells were transfected with indicated expression constructs two days before the analysis.

Figure S2. Decreased YAP/TAZ levels and phosphorylation of YAP1 in Dlg5-/- embryos in vivo, related to Figure 2. Western blot analyses of total brain, lung, and skin protein extracts from E14.5 wild type (WT) and Dlg5-/- (KO) embryos with anti-phosphoS127-YAP1 (P-Yap), total YAP1, total TAZ, and b-actin antibodies.

Figure S3. Negative genetic interaction between murine Dlg5 and Hippo pathway effectors Yap1 and Taz(Wwtr1), related to Figure 3.

(A) Negative genetic interaction between murine Dlg5 and Yap1. Dlg5+/- females were crossed with Dlg5+/- /Yap1+/- males and the resulting progeny were genotyped at postnatal days 7-10. Table shows the expected and observed genotypes (Chi-squared analysis). (B) Negative genetic interaction between murine Dlg5 and Taz (Wwtr1). Dlg5+/-/Taz+/- females were crossed with Dlg5+/-/Taz+/- males and the resulting progeny were genotyped at postnatal days 7-10 (Chi-squared analysis). (C) Negative genetic interaction between murine Dlg5 and Taz (Wwtr1). Dlg5+/-/Taz+/- females were crossed with Dlg5+/-/Taz-/- males and the resulting progeny were genotyped at postnatal day 0 (Chi-squared analysis).

Figure S4: Dlg5 negatively regulates Hippo signaling pathway in gain-of-function experiments, related to Figure 6. (A-B) Western blot analyses of total protein extracts from HEK 293 FT cells transfected (in duplicates) with indicated expression constructs. Note that presence of Dlg5 antagonizes Lats1 function and increases Taz and Yap protein levels. (C) Luciferase transcriptional activity assay in HEK 293 FT cells. The CTGF promoter driven firefly luciferase construct was used to measure TAZ activity. Flag-Lats1, Flag-Mst2, and Flag-Taz were expressed in the presence or absence of V5-Dlg5. Note statistically significant increase in CTGF promoter activity in the presence of DLG5. Student’s t-test.

Figure S5. Interaction between purified MST1/2 and DLG5 proteins, related to Figure 6. (A) PDZ3 domain of DLG5 sufficient to bind MST2. Western blot (WB) analysis of immunoprecipitated with V5 (IP:V5) proteins from HEK293T cells expressing FLAG-MST2 and indicated V5-tagged fragments of DLG5. (B) PDZ3 of DLG5 directly binds to MST1/2 proteins. Western blot (WB) analyses of Inputs and anti-FLAG- Sepharose pulled down proteins with anti-FLAG, anti-MST2, andi-SAV1 and anti-GST antibodies. GST fusions with PDZ domains of DLG5 were purified from bacteria. FLAG-SAV1, FLAG -MST1 and FLAG - MST2 were purified from HEK293F cells.

Figure S6: Dlg5 functions as a scaffold promoting interaction between MST and MARK3, related to Figure 7. (A) N-terminal domains of DLG5 interact with MARK3. Western blot analysis of total and immunoprecipitated with V5 (IP:V5) proteins from HEK293 cells expressing FLAG-MARK3 and indicated V5-tagged fragments of DLG5. (B) Coiled-coil domain of DLG5 directly binds to MARK3. WB analyses of Inputs and anti-FLAG-Sepharose pulled down proteins with anti-GST and anti-MARK3 antibodies. GST fusions with CARD, DUF622 and Coiled-Coil domains of DLG5 were purified from bacteria. FLAG-MARK3 was purified from HEK293F cells. (C) Western blot (WB) analyses of total (Input) and immunoprecipitated with anti-V5 antibody (IP:V5) proteins from HEK293T cells transiently transfected with FLAG-MARK3, V5-MST1 and DLG5 expression constructs, as indicated. (D) Western blot analysis of total (input) and immunoprecipitated with anti-GFP-antibodies (IP:GFP) proteins from HEK293T cells stably expressing FLAG-MARK3 and transiently transfected with GFP-MST2 and V5- tagged DLG5 expression constructs, as indicated.

Figure S7. DLG5 is overexpressed in 5% of human renal clear cell carcinoma tumors and its overexpression is significantly associated with tumor recurrence. (A) Oncoprint, a graphical summary of overexpression of DLG5 across Kidney Renal Clear Cell Carcinoma samples. (B) Kaplan-Meier analysis of disease-free survival differences between tumor samples with overexpression of DLG5 (red) and tumor samples without DLG5 overexpression (blue). P value 0.00555 is calculated by a logrank test.

Supplementary Tables

v1 v1 v2 v2 tx tx GN AP1 AP2 AP1 AP2 AP1 AP2 Description DLG5 421 355 123 128 124 126 Disks large homolog 5 OS=Homo sapiens GN=DLG5 PE=1 SV=4 STK3 23 30 19 24 36 26 Serine/threonine-protein kinase 3 OS=Homo sapiens GN=STK3 PE=1 SV=2 MAP/microtubule affinity-regulating kinase 3 OS=Homo sapiens MARK3 26 33 17 15 17 21 GN=MARK3 PE=1 SV=3 ATP-dependent metalloprotease YME1L1 OS=Homo sapiens GN=YME1L1 YME1L1 11 14 19 20 14 10 PE=1 SV=2 Calcium/calmodulin-dependent protein kinase type II subunit delta OS=Homo CAMK2D 21 19 7 13 9 7 sapiens GN=CAMK2D PE=1 SV=3 Serine/threonine-protein kinase MARK2 OS=Homo sapiens GN=MARK2 MARK2 17 14 11 8 11 9 PE=1 SV=2 Calcium/calmodulin-dependent protein kinase type II subunit alpha CAMK2A 18 20 7 9 7 7 OS=Homo sapiens GN=CAMK2A PE=1 SV=1 SAV1 20 16 5 5 14 8 Protein salvador homolog 1 OS=Homo sapiens GN=SAV1 PE=1 SV=2 Phosphoribosyl pyrophosphate synthase-associated protein 2 OS=Homo PRPSAP2 0 3 11 4 31 16 sapiens GN=PRPSAP2 PE=1 SV=1 Calcium/calmodulin-dependent protein kinase type II subunit gamma CAMK2G 10 15 8 11 7 6 OS=Homo sapiens GN=CAMK2G PE=1 SV=3 CEP97 19 13 9 7 5 3 Centrosomal protein of 97 kDa OS=Homo sapiens GN=CEP97 PE=1 SV=1 STK4 0 4 13 6 12 7 Serine/threonine-protein kinase 4 OS=Homo sapiens GN=STK4 PE=1 SV=2 FAM135A 11 5 3 3 7 11 Protein FAM135A OS=Homo sapiens GN=FAM135A PE=1 SV=2 SEC16A 19 10 0 0 5 5 Protein transport protein Sec16A OS=Homo sapiens GN=SEC16A PE=1 SV=3 TRIM27 5 13 3 4 7 6 Zinc finger protein RFP OS=Homo sapiens GN=TRIM27 PE=1 SV=1 Ubiquitin carboxyl-terminal hydrolase 15 OS=Homo sapiens GN=USP15 USP15 5 4 7 7 6 5 PE=1 SV=3 CDC37 5 7 8 7 3 0 Hsp90 co-chaperone Cdc37 OS=Homo sapiens GN=CDC37 PE=1 SV=1 NT5C2 2 1 9 10 0 0 Cytosolic purine 5-nucleotidase OS=Homo sapiens GN=NT5C2 PE=1 SV=1 HOOK3 5 6 0 2 3 5 Protein Hook homolog 3 OS=Homo sapiens GN=HOOK3 PE=1 SV=2 DnaJ homolog subfamily C member 13 OS=Homo sapiens GN=DNAJC13 DNAJC13 0 2 5 5 3 3 PE=1 SV=4 Uncharacterized protein C20orf117 OS=Homo sapiens GN=C20orf117 PE=1 C20orf117 3 3 5 0 4 0 SV=2 Calcium/calmodulin-dependent protein kinase type II subunit beta OS=Homo CAMK2B 4 5 3 3 0 0 sapiens GN=CAMK2B PE=1 SV=2 Coiled-coil domain-containing protein 18 OS=Homo sapiens GN=CCDC18 CCDC18 5 7 0 2 0 0 PE=1 SV=1 Uncharacterized protein KIAA0802 OS=Homo sapiens GN=KIAA0802 PE=1 KIAA0802 0 2 0 0 3 5 SV=3 Proline synthetase co-transcribed bacterial homolog protein OS=Homo PROSC 0 4 2 0 0 4 sapiens GN=PROSC PE=1 SV=1 Serine/threonine-protein kinase MARK1 OS=Homo sapiens GN=MARK1 MARK1 3 3 0 2 0 0 PE=1 SV=2

Table S1. Spectral counts for specific proteins identified by APMS using DLG5 as bait. 6 separate affinity purification(AP)experiments were performed from 3 independently generated pools of HEK293T cells expressing nVA-Dlg5.

Table S2. See file "TableS2_HCIP.xlsx" for high confidence interacting proteins (HCIP) from 2 replicate APMS experiments per bait.

qPCR primers for mouse transcripts Cyr61 forward GGATCTGTGAAGTGCGTCCT, Universal Probe # 66 Cyr61 reverse CTGCATTTCTTGCCCTTTTT, Universal Probe # 66 Ctgf forward TGACCTGGAGGAAAACATTAAGA, Universal Probe # 71 Ctgf reverse AGCCCTGTATGTCTTCACACTG, Universal Probe # 71 Rps16 forward GATATTCGGGTCCGTGTGA, Universal Probe # 77 Rps16 reverse TTGAGATGGACTGTCGGATG, Universal Probe # 77 Taz forward TGCTACAGTGTCCCCACAAC, Universal Probe # 73 Taz reverse TGACCGGAATTTTCACCTGT, Universal Probe # 73 Yap1 forward AAATGCTCCAAAATGTCAGGA, Universal Probe # 47 Yap1 reverse CATTCGGAGTCCCTCCATC, Universal Probe # 47 qPCR primers for human transcripts ANKRD1 FOR AGTAGAGGAACTGGTCACTGG ANKRD1 REV TGGGCTAGAAGTGTCTTCAGAT CTGF FOR AGGAGTGGGTGTGTGGACGA CTGF REV CCAGGCAGTTGGCTCTAATC CYR61 FOR CGAGGTGGAGTTGACGAGAAA CYR61 REV CTTTGAGCACTGGGACCATGA HPRT FOR ATGGACAGGACTGAACGTCTTGCT HPRT REV TTGAGCACACAGAGGGCTACAATG DLG5 FOR GCAGGTGTTGAAGCACAACG DLG5 REV CCGAAGGGCGTCATAGTCC

Table S3. Oligonucleotides used in qPCR experiments.

ORF Category Tag(s) Variant(s) MST1 Hippo core N- WT and kinase-dead component terminal MST2 Hippo core N- WT and kinase-dead component terminal SAV1 Hippo core N- Attisano component terminal RASSF1A Hippo core N- gift from Yutaka Hata (Addgene plasmid # 37016) (Ikeda et al. component terminal 2009) RASSF2 Hippo core N- NM_014737 component terminal RASSF3 Hippo core N- gift from Yutaka Hata (Addgene plasmid # 37019) (Ikeda et al. component terminal 2009) RASSF4 Hippo core N- NM_032023 component terminal RASSF5 Hippo core N- OpenFreezer component terminal RASSF6 Hippo core N- gift from Yutaka Hata (Addgene plasmid # 40344) (Ikeda et al. component terminal 2009) NF2 Upstream Hippo N & C First lobe of FERM domain deleted ORFeome component terminal FRMD6 Upstream Hippo N & C NM_152330 component terminal LIX1 Upstream Hippo N- 2 SNPs ORFeome component terminal DLG1 Cell polarity N- Addgene plasmid # 23505 related terminal DLG2 Cell polarity N- tvar2 OpenFreezer related terminal DLG5 Cell polarity N- (Nechiporuk et al. 2007) related terminal MPP5 Cell polarity N- gift from William Hahn & David Root (Addgene plasmid # related terminal 23447) (Johannessen et al. 2010) MPP7 Cell polarity N- gift from William Hahn & David Root (Addgene plasmid # related terminal 23411) (Johannessen et al. 2010) CTNNA1 Cell polarity N- (Lien et al. 2008) related terminal SLMAP Reciprocal N- OpenFreezer V91535 tagging terminal MARK2 Reciprocal N- NM_004954 C-terminal truncation, premature stop at 432/725 tagging terminal AA gift from William Hahn & David Root (Addgene plasmid # 23404) (Johannessen et al. 2010) MARK3 Reciprocal N- NM_002376 gift from William Hahn & David Root (Addgene tagging terminal plasmid # 23716) (Johannessen et al. 2010)

Table S4. ORFs used as baits in AP-MS study, with notes on coding sequence variations and/or source.

Supplemental References:

Dupont S, Morsut L, Aragona M, Enzo E, Giulitti S, Cordenonsi M, Zanconato F, Le Digabel J, Forcato M, Bicciato S et al. 2011. Role of YAP/TAZ in mechanotransduction. Nature 474: 179-183. Ikeda M, Kawata A, Nishikawa M, Tateishi Y, Yamaguchi M, Nakagawa K, Hirabayashi S, Bao Y, Hidaka S, Hirata Y et al. 2009. Hippo pathway-dependent and -independent roles of RASSF6. Sci Signal 2: ra59. Johannessen CM, Boehm JS, Kim SY, Thomas SR, Wardwell L, Johnson LA, Emery CM, Stransky N, Cogdill AP, Barretina J et al. 2010. COT drives resistance to RAF inhibition through MAP kinase pathway reactivation. Nature 468: 968-972. Lai D, Ho KC, Hao Y, Yang X. 2011. Taxol resistance in breast cancer cells is mediated by the hippo pathway component TAZ and its downstream transcriptional targets Cyr61 and CTGF. Cancer research 71: 2728- 2738. Lien WH, Gelfand VI, Vasioukhin V. 2008. Alpha-E-catenin binds to dynamitin and regulates dynactin-mediated intracellular traffic. J Cell Biol 183: 989-997. Meng Z, Moroishi T, Mottier-Pavie V, Plouffe SW, Hansen CG, Hong AW, Park HW, Mo JS, Lu W, Lu S, Flores F, Yu FX, Halder G, Guan KL. M. 2015. MAP4K family kinases act in parallel to MST1/2 to activate LATS1/2 in the Hippo pathway. Nat Commun 6:8357. Nechiporuk T, Fernandez TE, Vasioukhin V. 2007. Failure of epithelial tube maintenance causes hydrocephalus and renal cysts in Dlg5-/- mice. Dev Cell 13: 338-350.