Varicella-Zoster Virus ORF61 Deletion Mutants Replicate in Cell Culture, but a Mutant with Stop Codons in ORF61 Reverts to Wild-Type Virus

VIROLOGY 246, 306±316 (1998) ARTICLE NO. VY989198

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector

Varicella-Zoster Virus ORF61 Deletion Mutants Replicate in Cell Culture, but a Mutant with Stop Codons in ORF61 Reverts to Wild-Type Virus

Jeffrey I. Cohen1 and Hanh Nguyen

Medical Virology Section, Laboratory of Clinical Investigation, National Institute of Allergy and Infectious Diseases, NIH, Bethesda, Maryland 20892 Received January 26, 1998; returned to author for revision February 24, 1998; accepted April 16, 1998

Varicella-zoster virus (VZV) ORF61 encodes a phosphoprotein that transactivates VZV promoters. Transfection of cells with cosmid DNAs, including a cosmid with a large deletion in ORF61, resulted in a VZV ORF61 deletion mutant that was impaired for growth in vitro and could be partially complemented by growth in neuroblastoma or osteosarcoma cell lines. Cells infected with the VZV ORF61 deletion mutant expressed normal levels of an immediate-early VZV protein, but had reduced levels of a late protein and showed abnormal syncytia. Carboxy terminal truncation mutants of VZV ORF61 protein have a transrepressing phenotype and inhibit the infectivity of cotransfected wild-type viral DNA. Transfection of cells with cosmid DNAs, including a cosmid with stop codons that should result in an ORF61 truncation mutant expressing a transrepressing protein that retains the RING finger domain, resulted in a viral genome which reverted back to the wild-type sequence. BAL-31 exonuclease was used to produce deletions at the site of the stop codons in ORF61 of the cosmid, resulting in loss of the RING finger domain. Transfection of tissue culture cells with the ORF61 BAL-31 deletion mutants and other cosmid DNAs yielded viable viruses. Thus, while deletion mutants lacking the RING finger domain of ORF61 replicate in cell culture, a mutant with stop codons that retains this domain could not be propagated and reverted to wild-type virus.

INTRODUCTION VZV ORF61 protein transactivates VZV immediate-early (IE) and putative early gene promoters in transient ex- Varicella-zoster virus (VZV) is a member of the al- pression assays. In addition, ORF61 protein transacti- phaherpesvirus subfamily of herpesviruses. Other vates HSV IE, early, and latency-associated transcript members include herpes simplex virus (HSV), pseudorabies virus (PRV), and bovine herpesvirus (BHV). Each gene promoters as well as other viral promoters in tran- of these viruses has a homolog of the ORF61 transac- sient expression assays (Moriuchi et al., 1993). VZV tivator protein present in VZV (Cheung, 1991; Perry et ORF61 protein can repress or transactivate the function al., 1986; Wirth et al., 1992). This family of proteins all of VZV transactivators (ORF4, ORF62) on VZV gene promoters, depending on the transfection conditions and share a RING finger domain, also termed the C3HC4 motif, containing a similar pattern of cysteine and cell lines used (Moriuchi et al., 1993; Nagpal and Os- histidine residues near their amino terminus (Free- trove, 1991; Perera et al., 1992). A carboxy terminal trun- mont et al., 1991; Moriuchi et al., 1994). RING finger cation mutant of ORF61 protein that retains the RING domains have been shown to bind zinc and are finger domain acts as transrepressor and as a dominant thought to be important for protein±protein interac- negative mutant in the presence of full-length ORF61 tions (Saurin et al., 1996). protein (Moriuchi et al., 1994). Transient expression of ORF61 encodes a 62- to 65-kDa phosphorylated pro- VZV ORF61 protein enhances the infectivity of VZV and tein that localizes to the nucleus of infected cells with HSV-1 DNA (Moriuchi et al., 1993). nucleolar exclusion (Stevenson et al., 1992). The RING VZV ORF 61 protein is homologous to HSV ICP0 (Perry finger domain of ORF61 is located between amino acids et al., 1986) and can functionally complement an ICP0 19 and 57 (Barlow et al., 1994). The amino terminal region deletion mutant of HSV-1 (Moriuchi et al., 1992). ICP0 is of ORF61 is more highly phosphorylated than the carboxy not essential for growth of HSV-1 in cell culture; however, terminal region (Stevenson et al., 1992). The carboxy deletion of the gene results in marked impairment of portion of the protein contains sequences necessary for growth after infection at a low multiplicity of infection (Cai localization in the nucleus. and Schaffer, 1992; Chen and Silverstein, 1992; Stow and Stow, 1986). Furthermore, cells infected with HSV-1 mutants that do not express ICP0 show decreased levels of 1 To whom reprint requests should be addressed at Bldg. 10, Rm. HSV-1 early and late proteins, decreased levels of the 11N214, NIH, Bethesda, MD 20892. Fax: (301) 496-7383. immediate-early ICP27 protein, and normal levels of the

0042-6822/98 306 MUTAGENESIS OF VZV ORF61 307

FIG. 1. Construction of VZV ORF61 mutants. The VZV genome is 124,884 bp in length (line 1) and contains terminal repeat (TRL,TRS) unique (UL, US), and internal repeat (IRL,IRS) DNA segments (line 2). The NotI and MstII restriction fragments contained in the parental plasmid and cosmids are shown (lines 3,4). The nucleotide positions are based on the prototype Dumas strain of VZV (Davison and Scott, 1987). Cosmid MstIIA-61S contains stop codons in all three reading frames after the 79th codon of ORF61 (line 5). Cosmid MstIIA-61dA has stop codons after amino acid 13 and deletion of amino acids 14 to 127 (line 6). Cosmid MstII A-61dB has stop codons after amino acid 13 and deletion of amino acids 14 to 100 (line 7). Cosmid MstIIA-61D has a deletion beginning 26 bp upstream from the start codon and ending at amino acid 453 of ORF61 (line 8). Two identical, independent cosmid clones, MstIIA-61DA and MstIIA-61DB, were used to construct viruses with a large deletion in ORF61. immediate-early ICP4 protein (Cai and Schaffer, 1992; a large deletion in the ORF61 gene (Fig. 1). Plasmid Chen and Silverstein, 1992). pNotB, which overlaps cosmids MstIIA and MstII B, was To determine whether VZV ORF61 is essential for also constructed, since the previously described cosmid growth in cell culture and to study its role in regulating NotI BD (Cohen and Seidel, 1993) contains ORF61 and VZV gene expression during infection in vitro, we con- would have interfered with attempts to delete this gene. structed VZV mutants that were deleted for ORF61. VZV Initial transfections of MeWo cells with the large ORF61 with a large deletion in ORF61 was impaired for growth in deletion mutant cosmid along with pNotB, cosmids NotI vitro and partially complemented when grown in neuro- A and MstII B did not yield infectious virus. Therefore cell blastoma and osteosarcoma cell lines. In contrast, an lines containing ORF61 driven by the its endogenous ORF61 mutant with stop codons that retained the RING promoter were constructed. Individual cell clones were finger domain could not be propagated and reverted to transfected with cosmids without prior screening. wild-type virus. Transfection of one of these cell lines, M61-22-2, with VZV plasmid pNotB, cosmids NotI A, MstII B, and MstII A RESULTS or MstII A-61D yielded infectious VZV. Plaques were first detected 9 days after transfection with pNotB and cos- VZV ORF61 is not essential for replication of virus in mids NotI A, MstII B, and MstII A and 20 days after cell culture transfection, CPE was observed in M61-22-2 cells trans- To produce a virus that does not express VZV ORF61 fected with pNotB, NotI A, MstII B, and MstII A-61DA or protein, cosmid MstII A-61D was constructed, which has MstII A-61DB. 308 COHEN AND NGUYEN

FIG. 2. Southern blots of virion DNAs from VZV ORF61 mutants. Virion DNA was digested with BamHI and probed with a BsmI fragment from the ORF61 region (A,D). Virion DNA was also digested with NsiI (B,E) or BamHI and AscI (C) and hybridized with the BsmI fragment.

To determine whether VZV deleted for ORF61 could that each of the lysates was obtained from VZV-infected grow on MeWo cells, VZV obtained from the transfection cells, another aliquot of each lysate was immunoblotted using cosmid MstII A-61DA or MstII A-61DB was propa- using murine monoclonal antibody to VZV gE. Each of the gated in M61-22-2 cells and cell-free virus was obtained VZV-infected cell lysates expressed gE (Fig. 3B). by sonicating infected cells. MeWo cells were infected with cell-free virus and CPE was noted. The resulting VZV with stop codons in ORF61, and predicted to viruses were termed VZV ROka61DA and ROka61DB. express a transrepressing protein, reverts to wild- Subsequent experiments were performed using these type virus viruses grown in MeWo cells. Further experiments indicated that VZV ROka61DA or ROka61DB could be gener- To further characterize the role of ORF61 in the context ated by direct transfection of cosmids into MeWo cells. of virus infection, two additional cosmids, MstII A-61SA Transfection of MeWo cells with pNotB, NotI A, MstII B, and MstII A-61SB (Fig. 1), were constructed in which stop and MstII A-61DA or MstII A-61DB resulted in CPE 19 or codons were inserted into the ORF61 gene after the 79th 18 days after transfection, respectively. codon. VZV produced from the cosmids with stop codons Southern blots were performed to verify that the VZV in ORF61 would be expected to produce a carboxy- ORF61 mutants had the expected genome structure. Viral truncated form of ORF61 protein containing the RING DNA was prepared and digested with BamHI. Southern finger domain. Prior experiments have shown that trun- blot analysis of a BamHI digest probed with a BsmI cation mutants of VZV ORF61 protein containing the fragment from the ORF61 region showed a 10.6-kb RING finger domain have a transrepressing phenotype BamHI B fragment in VZV ROka and a 9.3-kb fragment in and inhibit the infectivity of transfected VZV DNA (Moriu- ROka61DA or ROka61DB due to the large deletion in the chi et al., 1994). Thus, virus with a carboxy terminal ORF61 gene (Fig. 2A). An additional band of 1.9 is present truncation in ORF61 might be more difficult to isolate due to hybridization of the probe [which contains a por- than virus deleted for ORF61. Multiple transfections of tion of the IRS (internal repeat short) sequence] with the MeWo cells with pNotB, VZV cosmids NotI A, MstII B, and TRS terminal repeat short sequence. MstII A-61SA or MstII A-61SB failed to yield virus. To determine that cells infected with the VZV ORF61 To further evaluate whether carboxy truncation mu- deletion mutant viruses do not express ORF61 protein, tants of ORF61 protein containing the RING finger do- lysates were obtained from cells infected with these main inhibit the ability to produce infectious VZV, cosmid viruses and immunoblotted using a rabbit antibody to MstII A-61SA was linearized with AscI, located in the ORF61 protein. Cells infected with parental (ROka) VZV oligonucleotide containing the stop codons, and BAL-31 expressed a 63-kDa protein corresponding to ORF61 exonuclease was used to create small deletions in the protein, while cells infected with VZV ROka61DA or cosmid resulting in cosmids MstII A-61dA and MstII ROka61DB did not produce the protein (Fig. 3A). To verify A-61dB (Fig. 1). VZV produced from these cosmids would MUTAGENESIS OF VZV ORF61 309

FIG. 3. Immunoblot of protein extracts from cells infected with VZV ORF61 mutants. Melanoma cells inoculated with VZV ROka-infected cells express a protein of 63-kDa that reacts with a rabbit antibody to VZV ORF61. Cells infected with ORF61 mutants do not contain the 63 kDa ORF61 protein (A), while cells infected with the ORF61 rescued viruses express this protein (C). Cells infected with VZV ROka, ORF61 mutants or ORF61-rescued viruses express proteins that react with a monoclonal antibody to VZV gE (B,D). Numbers indicate molecular masses of proteins in kilodaltons.

be expected to express only the first 13 amino acids of ization of the probe (which contains a portion of the IRS ORF61 without the RING finger domain and not have a sequence) with the TRS terminal repeat short sequence. transrepressing phenotype. While initial transfections of Digestion of ROka61SA with BamHI and AscI should MeWo cells with these cosmids did not yield virus, trans- cut the 10.6-kb BamHI B fragment into two fragments of fection of M61-22-2 cells with pNotB, NotI A, MstII B and 7.9 and 2.7 kb, due to the oligonucleotide that contains MstII A-61dA, or MstII A-61dB resulted in CPE 19 days an AscI site that was inserted into the MstII A-61S cos- and 20 days after transfection, respectively. Similarly, mid. However, only the 10.6-kb band (and the 1.9-kb band transfection of M61-22-2 cells with the pNotB, NotI A, as described for Fig. 2A) was seen, indicating that the MstII B, and MstII A-61SA or MstII A-61SB resulted in AscI site had been lost (Fig. 2C). Similar findings were CPE 22 days and 28 days after transfection, respectively. also noted with ROka61SB. Nucleotide sequencing of In order to verify whether viruses obtained from the PCR products from ROka61SA and ROka61SB indicated cosmids with the stop codons and small deletions could that the inserted oligonucleotide had been lost at this grow in MeWo cells, two clones each of VZV ROka61d site and wild-type sequence was present in its place. and ROka61S were propagated in M61-22-2 cells, cell- Immunoblots of cells infected with VZV ROka61dA and free viruses were obtained by sonicating infected cells, ROka61dB did not express ORF61 protein (Fig. 3A); how- and CPE was noted after MeWo cells were infected with ever, these cells did express VZV gE (Fig. 3B), verifying the cell-free viruses. Subsequent experiments were per- that they were infected with VZV. formed using virus grown in MeWo cells. Additional experiments showed that transfection of MeWo cells with Construction of rescued viruses in which the ORF61 pNotB, NotI A, MstII B, and MstII A, MstII A-61dA, or MstII deletion has been restored A-61dB resulted in CPE 9, 19, and 18 days after transfec- To verify that growth properties of the ORF61 deletion tion, respectively. Virus could not be obtained after trans- mutants were solely due to the lack of expression of fection of MeWo cells using cosmid MstII A-61SA or ORF61 and not due to a mutation at an additional site, the MstII A-61SB despite multiple attempts. deletions were repaired with a wild-type ORF61 gene. Southern blots of viral DNA cut with BamHI and MeWo cells were cotransfected with ROka61dA or probed with a BsmI probe (Fig. 2A) showed a slight ROka61DA virion DNA and a plasmid containing ORF61 decrease in size of the BamHI B fragment in VZV and flanking sequences. Virus was obtained in MeWo ROka61d, compared with ROka, due to the 0.3-kb dele- cells, and cell-free virus was prepared and used to infect tion in ORF61. Digestion of VZV ROka61dA or ROka61dB schwannoma cells. Schwannoma cells were used to with NsiI resulted in loss of 4.0 and 2.1 bands, with new select rescued virus from the background of ORF61 de- fragments of 5.75 or 5.8 due to the deletion of an NsiI site leted virus, since the latter virus grows to very low titers in VZV ORF61dA or ORF61dB, respectively (Fig. 2B). (The in these cells (see below). Virus was subsequently pas- 2.1-kb band is not visible in the exposure shown). A saged four times in schwannoma cells and ROka61dAR second band of 3.4 kb was also present due to hybrid- and ROka61DAR were isolated. 310 COHEN AND NGUYEN

FIG. 4. Growth curves of VZV ROka and ORF61 mutants in melanoma (A), M61-22-2 (B), schwannoma (C), Vero (D), osteosarcoma (E), and neuroblastoma (F) cells. Cells were inoculated with VZV-infected cells, aliquots were harvested on days 1 to 5 after infection, and the titer of the virus was determined by plating on melanoma cells. Day 0 is the titer of virus in the input inocula.

To verify that the ORF61 gene was restored in pared after 7 days. Cells infected with the ORF61 VZV ROka61DAR, viral DNA was cut with BamHI and probed mutants produced much smaller plaques than those with a BsmI fragment from the ORF61 region. Viral DNA with VZV ROka. The mean diameter of plaques (Ϯ the from ROka61DAR and ROka contained a 10.6-kb BamHI B standard deviation) after infection of MeWo cells with fragment, while the ROka61DA showed the 9.3-kb frag- cells containing VZV ROka was 0.62 Ϯ 0.17 mm, while ment corresponding to the deletion in the ORF61 gene the mean size of plaques produced by VZV ROka61dA (Fig. 2D). To ensure that the ORF61 gene was restored in was 0.15 Ϯ 0.09 mm and for ROka61dB was 0.13 Ϯ 0.07 ROka61dAR, virion DNA was cut with NsiI and probed mm. The mean size of plaques produced by VZV with the BsmI fragment. ROka61dAR and ROka resulted ROka61DA was 0.21 Ϯ 0.09 mm and by ROka61DB was in 4.0-, 3.4-, and 2.1-kb fragments, and the 5.75-kb band 0.16 Ϯ 0.06 mm. The mean plaque size of each of the associated with the deletion in ROka61dA was absent ORF61 deletion mutants was significantly different (Fig. 2E). (P Ͻ 0.01) from the mean size of plaques produced by To ascertain that ORF61 protein was expressed in VZV ROka. cells infected with the rescued ORF61 mutant viruses, To further determine whether deletion of ORF61 im- lysates from cells infected with VZV ROka, ROka61DAR, pairs the ability of VZV to grow in vitro, we measured ROka61dAR, and ROka61DA were immunoblotted using production of VZV ROka and the ORF61 deletion mutants antibody to ORF61 protein. Cells infected with VZV ROka, during a 5-day growth analysis. MeWo cells were inoc- ROka61DAR, and ROka61dAR expressed a 63-kDa pro- ulated with virus-infected cells and the cells were har- tein corresponding to ORF61, while cells infected with vested at various time points and the titer of virus was ROka61dA did not produce the protein (Fig. 3C). Immu- determined. On the first day after infection the titer of VZV noblotting with antibody to VZV gE showed that each of ROka increased, while the titer of ROka61d or ROka61D the VZV-infected cell lysates contained gE (Fig. 3D). declined (Fig. 4A). A difference in growth persisted throughout the growth analysis. Thus, both the plaque VZV unable to express ORF61 protein is impaired for morphologies and growth curves indicated that the ab- growth in cell culture sence of ORF61 impairs growth of VZV. The VZV ORF61 MeWo cells were infected by plating them together mutants grew to similar titers in M61-22-2 cells (Fig. 4B) with cells containing VZV ROka, ROka61DA, ROka61DB, and the peak titer of the ORF61 mutants was similar in ROka61dA, or ROka61dB and plaque sizes were com- MeWo and M61-22-2 cells. MUTAGENESIS OF VZV ORF61 311

FIG. 5. Growth of VZV with the ORF61 deletions restored in melanoma (A) and schwannoma (B) cells. VZV growth analysis was performed as described in the legend to Fig. 4.

VZV unable to express ORF61 protein is partially only partially complemented by this cell line, since the complemented by growth in neuroblastoma and titer of virus produced was still well below that obtained osteosarcoma cell lines with wild-type HSV-1 on any of the cell lines. While the HSV ICP0 null mutant produced similar numbers of HSV ICP0 mutants can be complemented by growth in plaques on melanoma cells as on Vero cells, the ICP0 the human osteosarcoma U2OS cell line (Yao and Schaf- mutant produced 200-fold more plaques on osteosar- fer, 1995). Therefore, we analyzed the plaque morpholo- coma cells. Thus, while the VZV ORF61 and HSV-1 ICP0 gies of the VZV ORF61 mutants on a number of cell lines mutants were both complemented by neuroblastoma to look for complementation. Compared with parental and osteosarcoma cells, the VZV mutant was comple- virus, the plaque sizes of the VZV ORF61 mutants were mented more by the neuroblastoma cells, while the HSV smallest in human schwannoma and largest in human mutant more by osteosarcoma cells. osteosarcoma and neuroblastoma cell lines. Growth analysis showed that the VZV ORF61 mutants grew to Cells infected with VZV ORF61 mutants show very low titers in the schwannoma cell line, never reach- abnormal syncytia formation ing the titer of the input inocula (Fig. 4C). Similarly, the VZV ORF61 mutants grew to low titers in Vero cells Infected MeWo cells were examined by immunofluo- (Fig. 4D). rescent microscopy to compare CPE induced by parental To verify that the growth impairment of the ORF61 and ORF61 mutant viruses. MeWo cells were infected mutants in MeWo and schwannoma cells was due to the with parental (ROka), ORF61 mutant, and ORF61-restored deletion in ORF61 and not to a mutation elsewhere in the VZV and stained with BODIPY FL ceramide that localizes genome, the growth of the ORF61-rescued viruses were to the Golgi apparatus. Cells infected with VZV ROka analyzed in these cell lines. ROka61DAR and ROka61dAR showed large syncytia with a central Golgi complex grew to titers similar to those of the parental ROka virus surrounded by multiple nuclei (Fig. 6A), while cells in- in both MeWo (Fig. 5A) and schwannoma (Fig. 5B) cells. fected with either VZV ROka61DA or ROka61dA showed a The VZV ORF61 mutants were partially complemented pattern of abnormal syncytia with nuclei distributed in a by growth in U2OS cells (Fig. 4E). While the titer of the disorganized pattern around the central Golgi complex ORF61 mutants was lower on the first day after infection (Figs. 6B and 6C). Cells infected with VZV in which the than the input inoculum, the ORF61 mutant viruses grew to within 0.5 log of the maximum titer of the parental TABLE 1 virus. Surprisingly, the VZV ORF61 mutants grew to the highest titers in human neuroblastoma cells (Fig. 4F). Titration of HSV-1 Wild-Type (KOS) and ICP0 Null Mutant (7134) Like the growth in U2OS cells, the ORF61 mutants also on Cell Lines grew in human neuroblastoma cells to within 0.5 log of KOS titer Fold 7134 titer Fold the maximum titer of the parental virus. Cell line (107 PFU/ml) increasea (PFU/ml) increasea Since the VZV ORF61 mutants were complemented by the neuroblastoma cell line, we tested the ability of this Vero 5.1 1.0 4.2 ϫ 104 1.0 MeWo 4.9 0.96 3.6 ϫ 104 0.86 cell line to complement the growth of an HSV-1 ICP0 null 5 mutant [7134 (Cai and Schaffer, 1989)]. HSV-1 7134 pro- SK-N-SH 4.3 0.84 6.5 ϫ 10 16 U2OS 3.6 0.71 8.3 ϫ 106 200 duced 16-fold more plaques on the neuroblastoma cell line than on Vero cells (Table 1). The ICP0 mutant was a Ratio of virus titer on the indicated cell line to the titer on Vero cells. 312 COHEN AND NGUYEN

FIG. 6. Syncytia formation in cells infected with parental and ORF61 deletion mutants. MeWo cells were infected with VZV ROka (A), ROka61DA (B), ROka61dA (C), or ROka61DAR (D) and stained with BODIPY fluorescein ceramide. Asterisks indicate syncytia.

ORF61 gene was restored, ROka61DAR, showed syncytia DISCUSSION surrounded by multiple nuclei (Fig. 6D), similar to that We have shown that ORF61 deletion mutants of VZV seen with parental virus. are impaired for replication in cell culture, while an VZV unable to express ORF61 protein shows reduced ORF61 stop codon mutant that retains the RING finger expression of a VZV late gene, but not an immediate- domain reverts to wild-type virus. The ORF61 mutant with early gene stop codons would be expected to express only the first Cells infected with HSV deleted for ICP0, the homolog of VZV ORF61, express normal levels of the immediate-early protein ICP4, but reduced levels of late proteins compared with cells infected with wild- type HSV (Cai and Schaffer, 1992; Chen and Silver- stein, 1992). To determine whether cells containing ORF61 deletion mutants show similar changes in levels of expression of VZV proteins, melanoma cells were infected with parental (ROka) and ORF61-deleted (ROka61dA, ROka61DA) viruses and immunoprecipitations were performed using antibodies against the ORF62 immediate-early protein and a putative late protein (gE). Cells infected with ORF61 deletion mutants expressed ORF62 protein at levels similar (within 75%) to those seen in cells infected with parental virus (Fig. 7A). In contrast, cells infected with the ORF61 FIG. 7. Immunoprecipitations of protein extracts from cells infected mutants expressed gE at much lower levels (Ͻ40%) with parental and VZV ORF61 deletion mutants. Cells infected with VZV than those obtained with parental virus (Fig. 7B). Thus, ROka, ROka61dA, or ROka61DA express similar levels of the 175-kDa cells infected with VZV deleted for ORF61 show levels ORF62 protein (A), while cells infected with ROka61dA or ROka61DA express less gE (B) than cells infected with ROka. Numbers below the of expression of immediate-early and late proteins lanes indicate ratio of the intensity of the band (arrowhead) in cells similar to those seen for cells infected with HSV lack- infected with the ORF61 mutant virus to the intensity of the band for ing ICP0. VZV ROka. MUTAGENESIS OF VZV ORF61 313

79 amino acids of the ORF61 protein. Prior experiments pressed levels of VZV ORF62 protein similar to those showed that a plasmid expressing a similar portion of expressed by cells infected with parental virus; however, ORF61 (amino acids 1±80), which includes the RING cells infected with the mutants expressed much lower finger domain, has a transrepressing phenotype when amounts of VZV gE. Previous studies showed that ORF61 cotransfected with a reporter plasmid containing the VZV protein can transactivate VZV immediate-early and puta- ORF62 promoter (Moriuchi et al., 1994). Other carboxy tive early promoters (Moriuchi et al., 1993). The ability of terminal truncation mutants of ORF61 protein that retain cells infected with the ORF61 mutants to express high the RING finger domain also have a transrepressing levels of ORF62 protein indicates that ORF61 protein is phenotype and reduce the infectivity of VZV virion DNA not necessary for expression of this immediate-early (Moriuchi et al., 1994). VZV ROka61S was expected to gene in vitro. ORF61 protein, however, might be impor- produce a truncated ORF61 protein that was predicted to tant for expression of this gene in vivo, such as during impair virus replication. Multiple attempts in both mela- reactivation from latency. noma and M61-22-12 cells to produce infectious VZV Cells infected with the VZV ORF61 mutants showed ROka61S with the expected genome were unsuccessful; abnormal formation of syncytia. Since ORF61 protein is two of the transfections yielded a virus whose genome required for high-level expression of gE, the dysregu- reverted back to the wild-type virus. Since virus derived lation of gE (and perhaps other glycoproteins as well) from transfection with a cosmid that should result in a truncated ORF61 had a full-length ORF61, either the in- may be responsible for the disorganized syncytia. A serted oligonucleotide was deleted or ORF61 DNA prior study using a VZV mutant that does not express present in the M61-22-2 cell line recombined with the VZV gI that results in abnormal processing of gE also ROka61S viral or MstII A-61S cosmid DNA to restore the showed abnormalities in syncytia formation (Mallory wild-type sequence. Thus, ROka61S is either unable to et al., 1997). grow or is highly impaired for growth, and the genome The VZV ORF61 deletion mutant viruses grew to very reverts to the wild-type sequence. low titers in human schwannoma and Vero cells. In The carboxy-truncated form of HSV-1 ICP0, the ho- both cell lines the titer of ROka61D or ROka61d never molog of ORF61 protein, has also been shown to have a exceeded the titer of the input inoculum. In schwan- transrepressing phenotype (Weber et al., 1992; Weber noma cells the maximum titer of the deletion mutants and Wigdahl, 1992) and much of the region correspond- was Ͼ2 logs lower than that obtained with the paren- ing to the portion of ICP0 required for maximum transre- tal virus. Schwann cells are the equivalent in the pression (Spatz et al., 1996) would also be present in peripheral nervous system of satellite cells (Moses, ROka61S. The amino termini of both VZV ORF61 protein 1976). VZV RNA has been detected in satellite cells of and HSV ICP0 contain a RING finger domain and can humans (Croen et al., 1988). Therefore, the marked function as dominant negative transrepressing mutants growth impairment of VZV deleted for ORF61 suggests (Weber and Wigdahl, 1992; Moriuchi et al., 1994). The that this virus might be especially impaired for reacti- amino terminus of HSV ICP0 has been shown to func- vation from latency. tionally substitute for the amino terminus of VZV ORF61 The VZV ORF61 mutants were partially complemented protein in transient expression assays (Moriuchi et al., by growth in human osteosarcoma and neuroblastoma 1994). cell lines. Yao and Schaffer (1995) showed that the U2OS While the VZV and HSV-1 truncation mutants behave osteosarcoma cell line could complement the growth of similarly in transient transfection assays, recombinant an HSV ICP0 mutant. We found that neuroblastoma cells viruses containing these proteins have very different could also partially complement the HSV ICP0 mutant. phenotypes. Although we were unable to obtain an The VZV ORF61 deletion mutants grew to the highest ORF61 truncation mutant containing the RING finger do- titers in neuroblastoma cells. These data suggest that main, a recombinant HSV which overexpresses a trans- neuroblastoma and osteosarcoma cell lines may ex- repressing ICP0 truncation mutant has been constructed and replicates at levels similar to those seen with the press a protein(s) that can partially substitute for the ICP0 null mutant virus (Spatz et al., 1997). Unlike ORF61, function of the ORF61 protein. ICP0 is spliced and aberrant or alternative splicing can In summary we have shown that an ORF61 mutant result in truncated mRNAs (Carter and Roizman, 1996). A with stop codons that retains the RING finger domain carboxy terminal-truncated protein that has trans- reverts to wild-type virus, while virus deleted for ORF61 is repressing activity (Weber and Wigdahl, 1992) has been impaired for growth in cell culture. Since deletion of detected in HSV-infected cells in vitro (Everett et al., ICP0, the homolog of ORF61, reduces the efficiency of 1993). Thus, unlike HSV ICP0, a carboxy-truncated form establishment and reactivation of HSV-1 latency in mice of ORF61 would not normally be expected in VZV-infected (Cai et al., 1993; Leib et al., 1989), future studies using cells. VZV deleted for ORF61 will address the role of the protein Cells infected with VZV ORF61 deletion mutants ex- in latency of VZV in animal models. 314 COHEN AND NGUYEN

MATERIALS AND METHODS ORF61. Both cosmids were sequenced to verify that the oligonucleotide had been inserted at the correct Cells and viruses site. MeWo cells, derived from a human melanoma and Second, small deletions were engineered into the 5Ј kindly supplied by Charles Grose, were used for trans- end of the ORF61 gene. Cosmid VZV MstII-61SA was fections and propagation of virus. The attenuated Oka cut with AscI, digested with BAL-31 exonuclease, and strain of VZV was the source for the cosmids used to blunted with T4 DNA polymerase, and the oligonucle- derive recombinant VZV (Takahashi et al., 1975). HSV-1 otide containing stop codons TAGCTAGGCGCGC- 7134, a gift from Priscilla Schaffer, is an ICP0 null mutant CTAGCTA was inserted. Two cosmids, VZV MstII (Cai and Schaffer, 1989). Human schwannoma cells A-61dA and MstII A-61dB, were selected. Sequencing (ST88-14) were a gift from Cynthia Morton (Reynolds et showed that cosmid MstII A-61dA has a deletion from al., 1992) and Vero, human U2OS osteosarcoma, and VZV nucleotides 104,105 to 104,445 resulting in stop human SK-N-SH neuroblastoma cells were obtained codons after amino acid 13 and deletion of amino from the American Type Culture Collection. acids 14 to 127. Cosmid MstII A-61dB has a deletion A MeWo cell line containing the ORF61 gene was from VZV nucleotides 104,187 to 104,445 resulting in constructed by inserting a HindIII fragment [VZV nu- stop codons after amino acid 13 and deletion of amino cleotides 102,110±106,741 (Davison and Scott, 1986)] acids 14 to 100. from VZV cosmid MstIIA (Cohen and Seidel, 1993) into Third, cosmid VZV MstII A was partially digested with the Bst1107I site of plasmid pSV2neo (Southern and HpaII using the recA-assisted restriction endonuclease Berg, 1982). The resulting plasmid pSV2neo-ORF61 cleavage procedure (Ferrin and Camerini-Otero, 1991). contains the G418 resistance gene driven by the sim- Two single-stranded 60-base oligonucleotides, CTTGTT- ian virus 40 early promoter and the VZV ORF61 gene TGGAATACCTTTACCCGCTTTACCGGCAGAGCTTTTT- with its polyadenylation sequence and endogenous TTGGTAAGGTGTTTCAG and ATGGTAACAACTGGCTG- promoter (Nagpal and Ostrove, 1991). Plasmid pSV2neo- TATTCTAATGTCCGGGCATCCAAACACGTAGCAGAACTG- ORF61 was linearized with AatII and MeWo cells were CCAT centered around the HpaII sites at nucleotides transfected with the plasmid using the calcium phosphate 103,125 and 104,512 of VZV (Davison and Scott, 1986), procedure. The cells were treated with trypsin after 2 days were annealed to cosmid VZV MstII A with Escherichia and plated onto 100-mm-diameter dishes, and the next day coli recA as previously described (Heineman and Cohen, G418 (geneticin; Life Technologies, Inc., Grand Island, NY) 1994). HpaII methylase and S-adenosylmethionine were was added at 400 ␮g/ml. After 7 days the concentration of added to methylate the remaining HpaII sites in the G418 was reduced to 250 ␮g/ml and individual colonies cosmid and the DNA±recA complexes were dissociated were isolated and amplified. by heating to 65°C. After precipitation, the DNA was digested with HpaII, releasing the 1.4-kb fragment between the two unmethylated HpaII sites. The large DNA Cosmids and plasmids fragment, lacking most of the ORF61 gene, was extracted Cosmids VZV NotI A, NotI BD, MstII A, and MstII B with phenol and precipitated, and the ends were ligated encompass the entire VZV genome and can recombine together. The DNA was packaged and inserted into E. after transfection of cells to produce recombinant VZV coli, and two cosmids, VZV MstII A-61DA and MstII (Cohen and Seidel, 1993). The VZV ORF61 open read- A-61DB were selected. These cosmids contain a deletion ing frame is located between VZV nucleotides 103,085 beginning 26 bp upstream from the start codon of ORF61 and 104,485 in cosmid VZV MstII A. Three strategies and ending at amino acid 453 of ORF61. Both cosmids were used to construct mutations in VZV ORF61. First, were sequenced to verify that the deletion was at the stop codons were engineered into the ORF61 gene. A expected site. partial digest of cosmid MstII A was performed using To restore the deletion in ORF61, a plasmid contain- ApaLI, which cuts both the VZV DNA insert of the ing ORF61 with additional flanking sequences was cosmid at nucleotide 104,246 and the cosmid vector obtained. Cosmid MstII A was cut with NgoMI and PstI (Fig. 1). The partially cut cosmid DNA was separated and the 4.2-kb fragment containing ORF61 was in- from uncut and multiply cut cosmid by pulsed-field gel serted into the NgoMI and PstI sites of plasmid electrophoresis and blunted with the large (Klenow) pGEM2 (Promega, Madison, WI). The resulting plas- fragment of DNA polymerase I, and a double-stranded mid, pORF61, contains VZV nucleotides 101,627 to oligonucleotide, TAGCTAGGCGCGCCTAGCTA, was in- 105,768. serted into the ApaLI site. This oligonucleotide con- Plasmid pNotB was constructed by cutting cosmid tains stop codons in all three open reading frames and VZV NotI BD with NotI and cloning the 29-kb NotIB an AscI restriction site. Two cosmids, VZV MstII fragment into the NotI site of pBluescript II (KSϩ) A-61SA and MstII A-61SB, were selected. These cos- (Stategene, LaJolla, CA). Plasmid pCMV62 contains mids contain stop codons after amino acid 79 of the VZV ORF62 immediate-early transactivator gene MUTAGENESIS OF VZV ORF61 315 driven by the human cytomegalovirus IE promoter Immunofluorescent microscopy (Perera et al., 1992). Syncytia formation was examined by immunofluorescent microscopy as previously described (Mallory et al., Transfections 1997) with the following modifications. Melanoma cells Melanoma cells or cell clones, stably transfected with were grown on glass coverslips and infected with VZV. plasmid pSV2neo-ORF61 that had not been selected for After 48 to 72 h the cells were washed in PBS, fixed with expression of ORF61, were used for transfection. Cos- 2% paraformaldehyde in PBS for 10 min, washed in PBS mids were linearized using NotIorBsu36I and precipi- with 1% bovine serum, and permeabilized with 0.1% Tri- tated. Plasmids pNotB and pCMV62 along with cosmids ton X-100 in PBS for 10 min. After washing with PBS, the VZV NotI A, MstIIB and MstII A, MstII A-61D, MstII A-61S cells were incubated for 1 h with BODIPY FL ceramide or MstII A-61d were transfected into melanoma cells as (Molecular Probes, Inc., Eugene, Oregon), washed in described previously (Cohen and Seidel, 1993). Cells PBS, and examined by fluorescent microscopy. BODIPY were treated with trypsin and replated each week there- FL ceramide labels Golgi complexes with a fluores- after until CPE was detected. cein tag. To repair the deletion in viruses containing the ORF61 mutants, pORF61 was linearized and MeWo cells were Growth studies of recombinant VZV transfected with 0.5 ␮g of virion DNA from VZV Growth curves of recombinant VZV were performed by ROka61dA or ROka61DA, 1.5 ␮g of plasmid pORF61, and infecting cells with VZV-infected cells containing about 50 ng of pCMV62. The transfected cells were passaged 100 PFU of VZV. At 1, 2, 3, 4, and 5 days after infection, the into flasks after transfection and subsequently passaged cells were treated with trypsin and serial dilutions were four times in schwannoma cells. Cell-free VZV was pre- used to infect MeWo cells. Plaques were counted 7 days pared as described previously (Shiraki and Hyman, after infection. Plaques sizes for cells infected with VZV 1987). mutants were measured microscopically. The mean size of 20 plaques was determined and the Tukey multiple Southern blots, immunoblots, and comparison test was used to determine whether the immunoprecipitations differences were significant. VZV DNA was purified from nucleocapsids and cut with BamHI, NsiI, or BamHI and AscI and fractionated on ACKNOWLEDGMENTS 0.8% agarose gels. The DNA was transferred to nylon membranes and probed with a [32P]dCTP-radiolabeled We thank Paul Kinchington for rabbit antibody to VZV ORF61 protein, Priscilla Schaffer for HSV-1 7134, Karen Seidel Alexander for technical 2.7-kb BsmI fragment (VZV nucleotides 102,891 to assistance, and Stephen Straus for reviewing the manuscript. 105,631) which contains ORF61. Immunoblots were performed using rabbit antibody to REFERENCES ORF61 (a kind gift from P. Kinchington (Ng et al., 1994) or murine monoclonal antibody to VZV gE (Chemicon, Te- Barlow, P. N., Luisi, B., Milner, A., Elliott, M., and Everett, R. (1994). 1 mecula, CA). VZV-infected cell lysates were fractionated Structure of the C3HC4 domain by H-nuclear magnetic resonance on SDS±polyacrylamide gels, transferred to nitrocellu- spectroscopy: A new structural class of zinc-finger. J. Mol. Biol. 237, 201±211. lose membranes, incubated with rabbit antiserum or Cai, W., Astor, T. L., Liptak, L. M., Cho, C., Coen, D. M., and Schaffer, P. A. murine monoclonal antibody, washed, incubated with (1993). The herpes simplex virus type 1 regulatory protein ICP0 horseradish peroxidase-conjugated anti-rabbit or anti- enhances replication during acute infection and reactivation from mouse antibody, washed, and developed using en- latency. J. Virol. 67, 7501±7512. hanced chemiluminescence (Amersham Corp., Arlington Cai, W., and Schaffer, P. A. (1989). Herpes simplex virus type 1 ICP0 plays a critical role in the de novo synthesis of infectious virus Heights, IL). following transfection of viral DNA. J. Virol. 63, 4579±4589. Immunoprecipitations were performed using lysates Cai, W., and Schaffer, P. A. (1992). Herpes simplex virus type 1 ICP0 from cells that had been infected with VZV and radiola- regulates expression of immediate-early, early, and late genes in beled for 3 h with [35S]methionine. The cells were then productively infected cells. J. Virol. 66, 2904±2915. washed and lysed in RIPA buffer (10 mM Tris±HCl, pH Carter, K. L., and Roizman, B. (1996). Alternatively spliced mRNAs predicted to yield frame-shift proteins and stable intron 1 RNAs of the 8.0, 100 mM NaCl, 1 mM EDTA, 1% NP-40, 0.5% deoxy- herpes simplex virus 1 regulatory gene ␣0 accumulate in the cyto- cholate, 0.1% SDS), and the supernatant was incubated plasm of infected cells. Proc. Natl. Acad. Sci. USA 93, 12535±12540. with a murine monoclonal antibody to VZV ORF62 protein Chen, J., and Silverstein, S. (1992). Herpes simplex viruses with muta- or gE (Chemicon). After addition of protein A±Sepharose, tions in the gene encoding ICP0 are defective in gene expression. immune complexes were washed in RIPA buffer and J. Virol. 66, 2916±2927. Cheung, A. K. (1991). Cloning of the latency gene and early protein 0 fractionated on an SDS±polyacrylamide gel. Protein gene of pseudorabies virus. J. Virol. 65, 5260±5271. bands were quantitated using a phosphorimager (Mo- Cohen, J. I., and Seidel, K. E. (1993). Generation of varicella-zoster virus lecular Dynamics). (VZV) and viral mutants from cosmid DNAs: VZV thymidylate syn- 316 COHEN AND NGUYEN

thetase is not essential for replication in vitro. Proc. Natl. Acad. Sci. Perera, L. P., Mosca, J. D., Ruyechan, W. T., and Hay, J. (1992). Regulation USA 90, 7376±7380. of varicella-zoster virus gene expression in human T lymphocytes. Croen, K. D., Ostrove, J. M., Dragovic, L. J., and Straus, S. E. (1988). J. Virol. 66, 5298±5304. Patterns of gene expression and sites of latency in human nerve Perry, L. J., Rixon, F. J., Everett, R. D., Frame, M. C., and McGeoch, D. J. ganglia are different for varicella-zoster and herpes simplex viruses. (1986). Characterization of the IE110 gene of herpes simplex virus Proc. Natl. Acad. Sci. USA 85, 9773±9777. type 1. J. Gen. Virol. 67, 2365±2380. Davison, A. J., and Scott, J. E. (1986). The complete DNA sequence of Reynolds, J. E., Fletcher, J. A, Lytle, C. H., Nie, L., Morton, C. C., and varicella-zoster virus. J. Gen. Virol. 67, 1759±1816. Diehl, S. R. (1992). Molecular characterization of a 17q11.2 translo- Everett, R. D., Cross, A., and Orr. A. (1993). A truncated form of herpes cation in a malignant schwannoma cell line. Hum. Genet. 90, 450± simplex virus type 1 immediate-early protein Vmw110 is expressed in 456. a cell type dependent manner. Virology 197, 751±756. Saurin, A. J., Borden, K. L. B., Boddy, M. N., and Freemont, P. S. (1996). Ferrin, L. J., and Camerini-Otero, R. D. (1991). Selective cleavage of Does this have a familiar RING. Trends Biochem. Sci. 21, 208±214. human DNA: RecA-assisted restriction endonuclease (RARE) cleav- Shiraki, K., and Hyman, R. W. (1987). The immediate early proteins of age. Science 254, 1494±1497. varicella-zoster virus. Virology 156, 423±426. Freemont, P. S., Hanson, I. M., and Trowsdale, J. (1991). A novel cys- Southern, P. J., and Berg, P. (1982). Transformation of mammalian cells teine-rich sequence motif. Cell 64, 483±484. to antibiotic resistance with a bacterial gene under control of the Heineman, T. C., and Cohen, J. I. (1994). Deletion of the varicella-zoster SV40 early region promoter. J. Mol. Appl. Genet. 1, 327±341. virus large subunit of ribonucleotide reductase impairs growth of Spatz, S. J, Nordby, E. C., and Weber, P. C. (1996). Mutational analysis of virus in vitro. J. Virol 68, 3317±3323. ICP0R, a transrepressor protein created by alternative splicing of the Leib, D. A., Coen, D. M., Bogard, C. L., Hicks, K. A., Yager, D. R., Knipe, ICP0 gene of herpes simplex virus type 1. J. Virol. 70, 7360±7370. D. M., Tyler, K. L., and Schaffer, P. A. (1989). Immediate-early regula- Spatz, S. J., Nordby, E. C., and Weber, P. C. (1997). Construction and tory gene mutants define different stages in the establishment and characterization of a recombinant herpes simplex virus type 1 which reactivation of herpes simplex virus latency. J. Virol. 63, 759±768. overexpresses the transrepressor protein ICP0R. Virology 228, 218± Mallory, S., Sommer, M., and Arvin, A. M. (1997). Mutational analysis of 228. the role of glycoprotein I in varicella-zoster virus replication and its Stevenson, D., Colman, K. L., and Davison, A. J. (1992). Characterization effects on glycoprotein E conformation and trafficking. J. Virol. 71, of the varicella-zoster virus gene 61 protein. J. Gen. Virol. 73, 521± 8279±8288. 530. Moriuchi, H., Moriuchi, M., and Cohen, J. I. (1994). The RING finger Stow, N. D., and Stow, E. C. (1986). Isolation and characterization of a domain of the varicella-zoster virus open reading frame 61 protein is required for its transregulatory functions. Virology 205, 238±246. herpes simplex virus type 1 mutant containing a deletion within the Moriuchi, H., Moriuchi, M., Smith, H. A., Straus, S., and Cohen, J. I. gene encoding the immediate-early polypeptide Vmw110. J. Gen. (1992). Varicella-zoster open reading frame 61 protein is functionally Virol. 67, 2571±2585. homologous to herpes simplex virus type 1 ICP0. J. Virol. 66, 7303± Takahashi, M., Okuno, Y., Otsuka, T., Osame, J., Takamizawa, A., 7308. Sasada, T., and Kubo, T. (1975). Development of a live attenuated Moriuchi, H., Moriuchi, M., Straus, S. E., and Cohen, J. I. (1993). Vari- varicella vaccine. Biken J. 18, 25±33. cella-zoster virus (VZV) open reading frame 61 protein transactivates Weber, P. C., Kenny, J. J., and Wigdahl, B. (1992). Antiviral properties of VZV gene promoters and enhances the infectivity of VZV DNA. J. Virol. a dominant negative mutant of the herpes simplex virus type 1 67, 4290±4295. regulatory protein ICP0. J. Gen. Virol. 73, 2955±2961. Moses, H. L. (1976). Comparative fine structure of the trigeminal gan- Weber, P. C., and Wigdahl, B. (1992). Identification of dominant-negative glia, including human autopsy studies. J. Neurosurg. 26(Suppl.), 112± mutants of the herpes simplex virus type 1 immediate-early protein 126. ICP0. J. Virol. 66, 2261±2267. Nagpal, S., and Ostrove, J. M. (1991). Characterization of a potent Wirth, U. V., Fraefel, C., Vogt, B., Vlcek, C., Paces, V., and Schwyzer, M. varicella-zoster virus-encoded trans-repressor. J. Virol. 65, 5289± (1992). Immediate-early RNA 2.9 and early RNA 2.6 of bovine her- 5296. pesvirus 1 are 3Ј coterminal and encode a putative zinc finger Ng, T. I., Keenan, L., Kinchington, P. R., and Grose, C. (1994). Phosphor- transactivator protein. J. Virol. 66, 2763±2772. ylation of varicella-zoster virus open reading frame (ORF) 62 regula- Yao, F., and Schaffer, P. A. (1995). An activity specified by the osteosar- tory product by viral ORF47-associated protein kinase. J. Virol. 68, coma line U2OS can substitute functionally for ICP0, a major regu- 1350±1359. latory protein of herpes simplex virus type 1. J. Virol. 69, 6249±6258.