Varicella-Zoster Virus ORF57, Unlike Its Pseudorabies Virus UL3.5 Homolog, Is Dispensable for Viral Replication in Cell Culture

VIROLOGY 250, 205±209 (1998) ARTICLE NO. VY989349

Edward Cox,1 Sanjay Reddy,1 Ilya Iofin, and Jeffrey I. Cohen2

Medical Virology Section, Laboratory of Clinical Investigation, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland 20892 Received May 27, 1998; returned to author for revision June 24, 1998; accepted July 23, 1998

Varicella zoster virus (VZV) encodes five genes that do not have homologs in herpes simplex virus. One of these genes, VZV ORF57, is predicted to encode a protein containing 71 amino acids. Antibody to ORF57 protein immunoprecipitated a 6-kDa protein in the cytosol of VZV-infected cells. Although the homolog of VZV ORF57 in pseudorabies virus, UL3.5, is critical for viral egress and growth in cell culture, VZV unable to express ORF57 replicated to titers similar to those seen with parental virus. Thus VZV ORF57 has a different role in viral replication than its pseudorabies virus homolog.

INTRODUCTION itis virus UL3.5 to 220 amino acids for PRV UL3.5. These proteins have sequence homology in their first 50 amino Varicella-zoster virus (VZV) is a member of the alpha- acids (Khattar et al., 1995) and contain a large number of herpesvirus subfamily. This subfamily is further divided basic amino acids with isoelectric points ranging from 10 into the genus Simplexvirus, which includes herpes sim- to 13. BHV-1 UL3.5 is a virion protein associated with the plex virus (HSV) and herpesvirus simiae, and Varicello- tegument or envelope whose role in virus replication is virus, which includes VZV, equine herpesvirus type 1 unknown (Schikora et al., 1998). In contrast, PRV UL3.5 (EHV-1), EHV-4, bovine herpesvirus type 1 (BHV-1), and encodes a nonstructural protein that is critical for viral pseudorabies virus (PRV). egress (Fuchs et al., 1996). VZV encodes at least 69 unique genes, and all except Here we show that VZV ORF57 encodes a 6-kDa pro- five of these genes have homologs in HSV (Cohen and tein present in the cytosol of virus-infected cells. Unlike Straus, 1996). Three of the five genes, ORFs 1, 13, and 32, its PRV counterpart, deletion of VZV ORF57 does not have been shown to be dispensable for replication of impair growth of the virus in cell culture. VZV in vitro. ORF1 encodes a membrane protein (Cohen and Seidel, 1995), whereas ORF32 encodes a phospho- RESULTS AND DISCUSSION protein that is posttranslationally modified by the VZV ORF47 kinase (Reddy et al., 1998). ORF13 encodes the To verify that ORF57 is expressed in VZV-infected cells, viral thymidylate synthetase (Cohen and Seidel, 1993). rabbit antibodies were made to a fusion protein derived 35 The other two VZV proteins that do not have HSV ho- from VZV ORF57. Immunoprecipitation of [ S]methi- mologs have not been studied. onine-labeled cells showed a 6-kDa protein from VZV- VZV ORF57 is predicted to encode a 71-amino-acid infected cells using antisera to VZV ORF57 (Fig. 1A). A protein containing hydrophilic and basic residues (Davi- similar-sized protein was not present in uninfected cells. 32 son and Scott, 1986). Although VZV ORF57 does not have Immunoprecipitations of [ P]orthophosphoric acid-ra- a homolog with HSV, it does share positional and limited diolabeled VZV-infected cells were performed to deter- sequence homology with other Varicellovirus proteins. mine whether the ORF57 protein is phosphorylated. An- These include EHV-1 gene 59 (Telford et al., 1992), EHV-4 tibody to ORF57 protein did not immunoprecipitate a gene 59 (Telford et al., 1998), PRV UL3.5 (Dean et al., phosphoprotein from VZV-infected cells, whereas anti- 1993), BHV-1 UL3.5 (Khattar et al., 1995), and infectious body to gE detected the phosphorylated glycoprotein laryngotracheitis virus UL3.5 proteins (Fuchs and Met- (data not shown). tenleiter, 1996). Although VZV ORF57 protein is predicted Cytosolic and membrane fractions were prepared from to be 71 amino acids in length, the other proteins range radiolabeled VZV-infected cells to determine where in size from 72 amino acids for infectious laryngotrache- ORF57 protein is located in infected cells. Immunopre- cipitation with antibody to ORF57 protein showed that the protein was located in the cytosolic fraction of infected 1 These two authors have contributed equally to this work. cells but not in the membrane fraction (Fig. 2). As a 2 To whom reprint requests should be addressed at Building 10, control for separation of the cellular fractions, VZV gE Room 11N214. Fax: (301) 496-7383. localized to the membrane but not the cytosolic fraction.

0042-6822/98 205 206 COX ET AL.

plaques (Ϯ the standard deviation) produced by the ROka57DA (0.87 Ϯ 0.21 mm) was not statistically different from the size of plaques produced by ROka (0.80 Ϯ 0.16 mm) in melanoma cells (P ϭ .21, Tukey's multiple comparison test). The size of plaques from the ORF57 mutant and ROka were similar in U2OS osteosarcoma cells (0.44 Ϯ 0.09 and 0.38 Ϯ 0.04 mm, respectively) and in schwannoma cells (0.60 Ϯ 0.07 and 0.72 Ϯ 0.08, respectively). To further verify that the ORF57 deletion mutants were not impaired for growth in vitro, melanoma cells were infected with the ORF57 mutants and the titer of virus was determined at different time points. VZV ROka57D grew to titers similar to those seen in cells infected with the parental (ROka) virus (Fig. 4). Although the VZV ORF57 mutant was not impaired for FIG. 1. Characterization of ORF57 protein from VZV-infected cells. (A) growth in cell culture, a PRV UL3.5 mutant that truncates Antibody to ORF57 protein immunoprecipitates a 6-kDa protein in VZV the protein after the first 10 amino acids was severely ROka-infected cells (arrow) but not in ROka57DA- or ROka57DB-in- impaired for growth in vitro (Fuchs et al., 1996). The PRV fected cells. (B) Cells infected with VZV ROka, ROka57DA, or ROka57DB UL3.5 deletion mutant was blocked for the development express proteins of 60±100 kDa that react with monoclonal antibody to VZV gE. Numbers refer to molecular weight of proteins in kilodaltons. and release of virions from infected cells and required a complementing cell line to produce plaques. Although BHV-1 UL3.5 and PRV UL3.5 proteins show Unlike VZV ORF57, PRV UL3.5 is located in the mem- limited sequence identity (26%) and difference in size, brane-plus-microsome fraction of virus-infected cells the BHV-1 protein can complement the PRV protein (Fuchs et al., 1996). (Fuchs et al., 1997). These findings, along with the To determine whether ORF57 is essential for growth of observation that other alphaherpesviruses have UL3.5 VZV in vitro, cells were transfected with cosmids NotIA, homologs led Fuchs et al. (1997) to postulate that MstII B, MstII A-57DA, or MstII A-57DB and plasmids ªmembers of this gene family might contribute to the pNotI B and pCMV62. Cytopathic effects, indistinguish- same general step of alphaherpesvirus maturation able from those seen with parental VZV, were present in and egress.º Our observation that VZV ORF57, the cells transfected with the ORF57 deletion mutant cos- homolog of PRV UL3.5, is fully dispensable for repli- mids. Virion DNA was prepared from cells infected with VZV ROka and ROka57D, and Southern blots were performed to verify that the genomes had the expected configurations. Digestion of DNA from VZV ROka57D with EcoRI showed restriction fragments that were identical to those seen with the parental virus (Fig. 3A). Digestion of DNA from ROka with SphI showed a 1.8-kb band, whereas DNA from ROka57D had a 1.6-kb band due to the deletion in ORF57 (Fig. 3B). To verify that cells infected with ROka57D were unable to express ORF57 protein, infected cells were radiolabeled and lysates were immunoprecipitated with antibody to the proteins. Although cells infected with ROka expressed a 6-kDa protein that reacted with antibody to ORF57 protein, ROka57DA- and ROka57DB-infected cells did not produce a similar-size protein (Fig. 1A). To ensure that the absence of expression of ORF57 protein was not due to the lack of VZV gene expression, immunoprecipitations were performed from cells infected with the FIG. 2. VZV ORF57 is a cytosolic protein. Cells infected with VZV ORF57 deletion mutants with antibody to gE. Cells in- ROka were radiolabeled with [35S]methionine, and membrane (A) and fected with the mutants expressed VZV gE (Fig. 1B). cytosolic (B) fractions were prepared. An aliquot of each fraction was Melanoma cells were infected with cells containing immunoprecipitated using antibody to ORF57 (lanes 1 and 2) or VZV gE (lanes 3 and 4) proteins. VZV ORF57 protein is detected only in the the ORF57 mutant virus, and the plaque sizes were cytosolic fraction of cells infected with VZV (arrow), whereas gE is measured to determine whether the absence of ORF57 present in the membrane fraction (arrow). Numbers refer to molecular affects the growth of VZV in vitro. The mean size of weight of proteins in kilodaltons. VZV ORF57 IS DISPENSABLE FOR VIRUS REPLICATION 207

nizes CACNNNGTG, the DraIII site of plasmid Litmus 38 was ablated, and two new DraIII sites, corresponding to the DraIII sites near ORF57 (VZV nucleotides 98,632 and 99,818) were inserted. Oligonucleotides CTAGTCCACGTTGTGGA and AGCTTCCACAACGTGGA were used to insert the first DraIII site at the SpeI and HindIII sites of the plasmid, and oligonucleotides GATC- CCCACGGGGTGCG and AATTCGCACCCCGTGGG were used to insert the second DraIII site at the BamHI and EcoRI sites of the plasmid. The resulting plasmid, pLit38- DraIII-2, was cut with DraIII, and the 1.2-kb DraIII fragment containing ORF57 from the NheI plasmid was inserted. The resulting plasmid was cut with AgeI and BsiWI (which cut at VZV nucleotides 99,450 and 99,616), and two oligonucleotides, CCGGTTACGTTCTC and GTAC- GAGAACGTAA were annealed and ligated into the AgeI and BsiWI sites of the plasmid. The latter oligonucleotides were used to restore the 3Ј carboxyl terminus of ORF58, which overlaps the first 17 nucleotides of ORF57. The sequence of the inserted oligonucleotides was confirmed in two independent plasmid clones. The two clones then were cut with DraIII, and the mutated DNAs were inserted into the NheI plasmid. The latter then were cut with NheI, and the ORF57 mutant DNA was inserted FIG. 3. Southern blot of virion DNAs from VZV ORF57 deletion into cosmid MstII A to produce cosmids MstII A-57DA mutants. (A) Virion DNA digested with EcoRI and probed with all four radiolabeled cosmids shows no rearrangement of the genome. (B) and MstII A-57DB. These cosmids have a 152-nucleotide Digestion of ROka57D with SphI followed by hybridization with a probe deletion that begins 20 nucleotides after the start of from the ORF57 region of VZV shows that a 1.8-kb band in ROka is ORF57 and ends 41 nucleotides before the stop codon of reduced in size to 1.6 kb in ROka57D due to the deletion in ORF57. ORF57. Numbers refer to molecular weights in kilobase pairs. Transfections cation in cell culture indicates that the VZV gene Cosmids were digested with NotIorBsu36I to linear- differs substantially from its PRV counterpart. In con- ize the DNAs. To produce VZV with a deletion in ORF57, trast to PRV, VZV is highly cell associated in vitro and cells were transfected with 1 ␮g of cosmid NotIA,MstII little or no cell-free virus is released into the medium. B, 0.5 ␮g of cosmid MstII A-57D, 1 ␮g of plasmid NotIB, Thus, future ultrastructural studies will be required to 50 ng of plasmid pCMV62, and 2 ␮g of salmon sperm determine the role of the VZV ORF57 protein in virion DNA. Transfection of MeWo cells was performed as maturation and spread in vitro. previously described (Cohen and Seidel, 1993).

MATERIALS AND METHODS Cells and viruses MeWo (human melanoma) cells were used for transfections and preparation of virus stocks. Recombinant viruses were derived from cosmids corresponding to the attenuated Oka strain of VZV.

Plasmids and cosmids VZV cosmids NotIA,MstII A, and MstII B and plasmid NotI B contain the entire VZV genome (Fig. 5). To produce VZV with a deletion in ORF57, the MstIIA cosmid was cut with NheI, which cuts at VZV nucleotides 91,047 and 100,741, and the 9.7-kb fragment was FIG. 4. Growth of VZV ROka, ROka57DA, and ROka57DB in Mewo inserted into the NheI site of plasmid Litmus 38 (New cells. MeWo cells were inoculated with VZV-infected cells, and at England Biolabs, Beverly, MA) in which the DraIII site various times after infection the cells were harvested and the titer of had been ablated previously. Because DraIII recog- virus was determined in MeWo cells. 208 COX ET AL.

FIG. 5. Construction of recombinant VZV with a deletion in ORF57. The VZV genome is 124,884 bp in length (line 1) and contains unique long (UL), unique short (US), terminal repeat (TR), and internal repeat (IR) DNA sequences (line 2). NotI and MstII restriction fragments used to generate parental VZV are shown (lines 3 and 4). Cosmid MstII A-57D (line 5) has a deletion beginning at codon 7 and ending at codon 58. Numbers for cosmid MstII A-57D indicate the site of the deletion. This site is generated by oligonucleotides inserted at the AgeI and BsiWI restriction endonuclease sites. Two identical, independent cosmid clones, MstIIA-57DA and MstIIA-57DB, were used to construct viruses with a deletion in ORF57. Restriction endonuclease sites used for construction of cosmid MstII A-57D (line 6) and location of VZV open reading frames in this region (line 7) are shown.

Southern and Northern blots primer contained a BamHI site followed by VZV nucleotides 99,576±99,596 (CGCGGATCCAATGCCAGCGTTGC- VZV DNA was purified from nucleocapsids, cut with CACGCCG), and the second primer contained an EcoRI EcoRI or SphI, fractionated on agarose gels, and trans- ferred to nylon membranes. The four DNA cosmids span- site followed by VZV nucleotides 99,414±99,434 (CGC- ning the entire VZV genome were radiolabeled with GAATTCACGTTGATGAGCCTTGCAGGT). The amplified [32P]dCTP and hybridized to the immobilized VZV DNA. DNA was digested with BamHI and EcoRI and inserted An NheI fragment, containing VZV nucleotides to 91,047± into plasmid pGEX-2T, and the sequence of the junction 100,741, was radiolabeled and used to demonstrate the of the ORF57 DNA and pGEX-2T DNA was confirmed. ORF57 mutation. Escherichia coli containing the plasmid expressing the GST-ORF57 fusion protein were grown in 2XYT medium Growth characteristics of recombinant VZV with 2% glucose and ampicillin, and IPTG was added. The bacteria were lysed by sonication, and the GST- Growth curves for recombinant VZV were performed ORF57 fusion protein was bound to glutathione±Sepha- by infecting MeWo cells with cells containing about 100 rose, washed extensively, eluted with reduced glutathi- pfu of VZV. At days 1, 2, 3, 4, and 5 after infection, the cells one, and dialyzed. were harvested, and serial dilutions were used to inoc- ulate uninfected MeWo cells. Plaques were stained and counted 7 days after infection. Antibodies, immunoprecipitation, in vitro translation, and cell fractionation studies Generation of ORF57 fusion proteins Rabbits were immunized once with 150 ␮gofGST- The coding region of VZV ORF57, from codons 11±71, ORF57 fusion proteins in complete Freund's adjuvant was amplified from VZV cosmid DNA by PCR. The first and two additional times in incomplete Freund's adju- VZV ORF57 IS DISPENSABLE FOR VIRUS REPLICATION 209 vant. Antiserum was obtained and absorbed four times Davison, A. J., and Scott, J. E. (1986). The complete DNA sequence of with lysates of uninfected MeWo cells. varicella-zoster virus. J. Gen. Virol. 67, 1759±1816. VZV-infected and uninfected cells were radiolabeled Dean, H. J., and Cheung, A. K. (1993). A 3Ј coterminal gene cluster in 35 32 pseudorabies virus contains herpes simplex virus UL1, UL2, and UL3 with [ S]methionine or [ P]orthophosphoric acid and gene homologs and a unique UL3.5 open reading frame. J. Virol. 67, lysed. The supernatant was incubated with rabbit anti- 5955±5961. body to ORF57 protein or monoclonal antibody to VZV gE Fuchs, W., Klupp, B. G., Granzow, H., Rziha, H.-J., and Mettenleiter, T. C. (Chemicon, Temecula, CA) followed by protein A±Sepha- (1996). Identification and characterization of the pseudorabies virus rose. Immune complexes were fractionated on SDS± UL3.5 protein, which is involved in virus egress. J. Virol. 70, 3517± 3527. polyacrylamide gels. Membrane and cytosolic fractions Fuchs, W., Granzow, H., and Mettenleiter, T. C. (1997). Functional from VZV-infected MeWo cells were prepared as previ- complementation of UL3.5-negative pseudorabies virus by the bo- ously described (Cohen and Seidel, 1995). vine herpesvirus 1 UL3.5 homolog. J. Virol. 71, 8886±8892. Fuchs, W., and Mettenleiter, T. C. (1996). DNA sequence and transcrip- ACKNOWLEDGMENT tional analysis of the UL1 to UL5 gene cluster of infectious laryngotracheitis virus. J. Gen. Virol. 77, 2221±2229. We thank Stephen Straus for reviewing the manuscript. Khattar, S. K., van Drunen Littel-van den Hurk, S., Babiuk, L. A., and Tikoo, S. K. (1995). Identification and transcriptional analysis of a REFERENCES 3Ј-coterminal gene cluster containing UL1, UL2, UL3, and UL3.5 open reading frames of bovine herpesvirus-1. Virology 213, 28±37. Cohen, J. I., and Seidel, K. E. (1993). Generation of varicella-zoster virus Reddy, S. M., Cox, E., Iofin, I., Soong, W., and Cohen, J. I. (1998). (VZV) and viral mutants from cosmid DNAs: VZV thymidylate syn- Varicella-zoster virus (VZV) ORF32 encodes a phosphoprotein that is thetase is not essential for replication in vitro. Proc. Natl. Acad. Sci. posttranslationally modified by the VZV ORF47 protein kinase. J. USA 90, 7376±7380. Virol., in press. Cohen, J. I., Seidel, K. E. (1995). Varicella-zoster virus open reading Schikora, B., Lu, Z., Kutish, G. F., Rock, D., Magyar, G., and Letchworth, frame 1 encodes a membrane protein that us dispensable for growth G. J. (1998). The bovine herpesvirus type 1 UL3.5 open reading frame of VZV in vitro. Virology 206, 835±842. encodes a virion structural protein. Virology 240, 76±82. Cohen, J. I., and Straus, S. E. (1996). Varicella-zoster virus and its Telford, E. A. R., Watson, M. S., McBride, K., and Davison, A. J. (1992). replication. In ªFields Virologyº (B. N. Fields, D. M. Knipe, P. M. The DNA sequence of equine herpesvirus-1. Virology 189, 304±316. Howley, R. M. Chanock, J. L. Melnick, T. P. Monath, B. Roizman, and Telford, E. A. R., Watson, M. S., Perry, J., Cullinane, A. A., and Davison, S. E. Straus, Eds.), pp. 2525±2545. Lippincott-Raven Publishers, Phil- A. J. (1998). The DNA sequence of equine herpesvirus-4. J. Gen. Virol. adelphia. 79, 1197±1203.