Investigation of the Immune Receptors CEACAM3 and CEACAM4

Investigation of the human immune receptors CEACAM3 and CEACAM4

Dissertation Zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.)

vorgelegt von

Julia Delgado Tascón

An der Universität Konstanz des Fachbereichs Biologie

Konstanz, Oktober 2015

Konstanzer Online-Publikations-System (KOPS) URL: http://nbn-resolving.de/urn:nbn:de:bsz:352-0-306516

Tag der mündlichen Prüfung: 05.11.2015 Vorsitzender und mündlicher Prüfer: Herr Professor Dr. Bürkle 1. Referent und und mündlicher Prüfer: Herr Professor Dr. Hauck 2. Referent und und mündlicher Prüfer: Herr Professor Dr. Tschan, Universität Bern

A mi familia

Acknowledgements

I would like to express my special gratitude to my advisor Prof. Dr. Christof Hauck. His patient guidance and enthusiastic encouragement during these four years of PhD were a crucial aid to my process. I’m very thankful for his willingness and for granting me with his time in search for valuable and constructive suggestions during the planning and development of this research work. This certainly allowed me to grow as a person and as a scientist. I would also like to thank my committee members: to Prof. Dr. Mario Tschan for giving me his academic support at this last phase of my PhD thesis, and to Prof. M.Dr. Alexander Bürkle for his wise advices accompanied with Spanish greetings along this time. My thanks are extended to every member of the AG Hauck as well. To Anne, Susana, Petra and Claudia: thank you very much for your technical and personal guidance during these years. I’m also thankful to my fellow colleagues for countless ‘Kaffeepausen’ full of jokes, nice discussions, and delicious vegan cakes. I specially thank Nina, Arnaud, Lexi, Chris, Yong and also our former colleagues Alexa, Naja, Timo and Thomi for the nice times ‘inside-out’ of the lab. Thank you for your motivations in the right moment and for the party time we had together. I’m very grateful with Lisa for her support and co-work during every hard time we had with the mice. I’m also thankful to Annette for the FRET analysis in the Tec manuscript, and to Dr. Joachim Hentschel for his assistance when employing the electron microscope. Thanks to the Center of Molecular Biology of Inflammation (ZMBE) for the generation of the transgenic CEACAM3 mice, and thanks as well to my lovely Nora H. for her time and help in the formatting process of this thesis. Special thanks to my beloved family and friends. This has been a wonderful life experience and words cannot express how grateful I am!

Gracias totales!

Table of contents

Summary ...... 11 Zusammenfassung ...... 13 1 General Introduction ...... 15 1.1 Innate (natural) Immunity ...... 15 1.1.1 Host defense against infection ...... 17 1.1.2 Response of phagocytic cells to infection ...... 21 1.2 Human CEACAM family ...... 24 1.2.1 Granulocytes CEACAMs ...... 26 1.2.2 CEACAM3: Phagocytic Hem-ITAM receptor ...... 28 1.2.3 CEACAM4: Orphan receptor of the CEACAM family ...... 30 2 Aims of the study ...... 32 3 Chapter I: Tec kinase contributes to CEACAM3-initiated Hem- ITAM signaling to promote bacterial phagocytosis and destruction by human granulocytes ...... 34 3.1 Summary ...... 35 3.2 Introduction ...... 35 3.3 Material and Methods ...... 37 3.4 Results ...... 43 3.5 Discussion ...... 56 3.6 Supplemental figures ...... 62 3.7 Acknowledgments ...... 64 4 Chapter II: Generation of a humanized mouse model for in vivo analysis of CEACAM3 ...... 65 4.1 Abstract ...... 66 4.2 Introduction ...... 66 4.3 Material and Methods ...... 69 4.4 Results ...... 77 4.5 Discussion ...... 93 4.6 Acknowledgments ...... 95 5 Chapter III: The granulocyte orphan receptor CEACAM4 is able to trigger phagocytosis of bacteria ...... 97 5.1 Abstract ...... 98 5.2 Introduction ...... 98 5.3 Material and Methods ...... 100 5.4 Results and Discussion ...... 107 5.5 Conclusion ...... 119 5.6 Supplementary figures ...... 120

Table of contents

5.7 Acknowledgments ...... 123 6 Chapter IV: Finding bacterial ligand of the orphan receptor CEACAM4 ...... 124 6.1 Abstract ...... 125 6.2 Introduction ...... 125 6.3 Material and Methods ...... 127 6.4 Results ...... 133 6.5 Discussion ...... 139 6.6 Acknowledgments ...... 142 7 Concluding remarks ...... 143 8 Declaration of author’s contributions ...... 152 List of publications ...... 154 8.1 Publications part of this thesis or ongoing to be submitted ...... 154 8.2 External publications ...... 154 Abbreviations ...... 155 References ...... 157

Summary

The innate immune system provides an immediate response to infection which can be activated via different recognition molecules allowing specialized immune cells to recognize but also to phagocytose and eliminate a wide range of microbes. Human granulocytes express a peculiar receptor, the carcinoembryonic antigen-related cell adhesion molecule 3 (CEACAM3). This membrane protein is responsible for initiating the opsonin-independent recognition, phagocytosis and killing of a limited set of human- specific gram-negative bacteria. CEACAM3 harbors a hemi-immunoreceptor tyrosine- based activation motif (Hem-ITAM) which after phosphorylation by Src family Kinases serves as a docking site for SH2-domain containing proteins. This study provides the first evidence of a specific role of Tec kinase in the host innate immune response of neutrophils against bacterial infection. Upon phosphorylation of the Hem-ITAM of CEACAM3, the SH2 domain of Tec kinase directly binds to the phosphorylated Hem-ITAM and gets recruited to the site of bacterial phagocytosis. Functional experiments showed that Tec kinase is essential and maximizes Hem-ITAM signaling for efficient CEACAM3-mediated bacterial uptake and actin reorganization as well as contributing in the clearance of CEACAM-binding bacteria such as Neisseria gonorrhoeae. To this day, the study of the granulocyte CEACAM3 has been limited due to the lack of a suitable in vivo standard model such as the mouse. To investigate the in vivo role of this innate immune receptor in controlling infection and to shed light on the CEACAM3 signaling, we generated a humanized transgenic mouse model of CEACAM3 fluorescently mKate-tagged. Although the human transgene resulted in a successful germ line transmission to the first generation, our results demonstrated that the integration of CEACAM3 into the mouse genome resulted in a non-functional transgene. Strikingly, protein expression of CEACAM3 or the mKate-reporter as well as CEACAM3 mRNA were undetected in neutrophils from transgenic mice. Our data suggest that the only surviving founder animal could have inserted the transgene cassette at a silent locus, allowing it to survive by repressing transcription of CEACAM3. To circumvent a possible lethality of this gene, we recommend the generation of a conditional and inducible humanized CEACAM3 mouse for future investigations.

Summary

In contrast to CEACAM3, the function of a closely related protein, CEACAM4, is currently unknown. CEACAM4 is the orphan receptor of the CEACAM family and particularly, as CEACAM3, it encompasses an ITAM-like sequence in the cytoplasmic domain. By generating chimeric proteins containing the extracellular binding domain of CEACAM3 fused to the transmembrane and cytoplasmic part of CEACAM4 (chimera CEACAM3/4), we could overcome the lack of a ligand. Interestingly, the intracellular motif of CEACAM4 was able to trigger bacterial uptake of binding bacteria. Phagocytosis of bacteria was accompanied by tyrosine phosphorylation of CEACAM4 which was dependent on the integrity of the cytoplasmic ITAM sequence. After Src phosphorylation of tyrosine residues, the ITAM of CEACAM4 were associated with SH2 domain of cytoplasmic proteins involved in signaling processes during phagocytosis. Here we demonstrated that this orphan receptor has phagocytic function which prompts efforts to identify potential ligands. The investigation of CEACAM4 has been neglected mainly due to the lack of a bona fide ligand, therefore, we aimed to screen for a commensal bacterial ligand of CEACAM4 within the human gut microbiota. Human stool samples were used to enrich CEACAM4- binding bacteria by an anti-GFP magnetic bead-isolation, using GFP soluble fusion proteins of the N-terminal domain of CEACAM4. After 16S rRNA gene sequencing of associated bacteria, data were analysed by cluster analysis of sequences (CLANS) and the SILVA database. Bioinformatic analyses revealed species of Prevotella, Clostridiales and Selenomonadales as potential CEACAM4-binding bacteria. Unexpectedly, bacterial pull- downs could not confirm binding of the commensal bacteria to CEACAM4. In addition, we discuss possible improvements of the used setup. The possibility of another type of associated microorganism such as fungi or protozoans as well as a possible endogenous ligand should be considered for future efforts in the search for a ligand of the orphan receptor CEACAM4.

Zusammenfassung

Das angeborene Immunsystem stellt eine unmitelbare Abwehrreaktion auf Infektionen dar und wird durch die Aktivierung von Rezeptormolekülen auf spezialisierten immunzellen induziert. Dies führt sowohl zur Erkennung als auch zur Phagozytose und schlussendlicher Eliminierung eingedrungener Pathogene und Mikroben. Ein Mitglied aus der Familie der Carcinoembryonic antigen-related cell adhesion molecules (CEACAMs), CEACAM 3, wird ausschließlich von humanen Granulozyten exprimiert. CEACAM3 ist ein transmembraner, phagozytischer Rezeptor, der für die Opsonin-unabhängigen Erkennung, Internalisierung und Tötung von CEACAM-bindenden, gramnegativen Bakterien verantwortlich ist. Auf der cytoplasmatischen Seite besitzt CEACAM3 ein Hem-ITAM (hemi-Immunrezeptor Tyrosin-basiertes Aktivierungsmotiv), das nach Phosphorylierung durch eine Kinase der Src Familie eine Bindestelle für SH2-Domänen Proteine darstellt. Die vorliegende Studie liefert erste Hinweise für eine Rolle der Tec Kinase in der unspezifischen Immunantwort neutrophiler Granulozyten auf bakterielle Infektionen. Die Phosphorylierung der Hem-ITAM von CEACAM3 führt zur Rekrutierung der Tec Kinase an den Ort der Phagozytose. Anhand funktioneller Experimente konnte gezeigt werden, dass Tec die Signaltransduktion durch Hem-ITAM verstärkt und essentiell für die CEACAM3 vermittelte Aufnahme von Bakterien und die damit einhergehende Reorganisation des Aktin-Zytoskeletts ist. Zudem trägt Tec zur Beseitigung von CEACAM-bindenden Bakterien wie Neisseria gonorrhoeae bei. Untersuchungen zur funktionellen Relevanz von CEACAM3 auf Granulozyten war bis zum heutigen Tag nur sehr eingeschränkt möglich, da ein geeignetes in vivo Modell nicht existiert. Um zu klären, welche Rolle CEACAM3 in vivo bei der Kontrolle einer Infektion mit humanspezifischen Pathogenen spielt und um die CEACAM3 abhängige Signaltransduktion besser zu verstehen, generierten wir ein humanisiertes, transgenes Mausmodell mit dem Ziel, fluoreszenz-markiertes CEACAM3 (mKate-CEACAM3) in Mäusen zu exprimieren. Obwohl das transgene CEACAM3 erfolgreich in die Keimbahn der ersten Generation integriert wurde, konnte weder auf mRNA- noch auf Proteinlevel eine Expression von CEACAM3 oder des Fluoreszenzmarkers mKate detektiert werden. Anhand der Datenlage ist anzunehmen, dass die Insertierung der transgenen Kassette in das Wirtsgenom des einzig überlebenden Gründungstiers in einem stummen Genlocus

Zusammenfassung erfolgte, wodurch die Transkription von CEACAM3 verhindert wurde. Um eine mögliche Letalität, hervorgerufen durch die Expression von CEACAM3, zukünftig zu umgehen, empfehlen wir die Erzeugung eines konditional induzierbaren humanisierten CEACAM3 Mausmodells. Im Gegensatz zu CEACAM3 ist die Funktion des eng verwandten Proteins CEACAM4 völlig unbekannt. CEACAM4 ist der Orphan-Rezeptor der CEACAM Familie und besitzt wie CEACAM3 eine ITAM-ähnliche Sequenz, was ein Alleinstellungsmerkmal dieser beiden CEACAMs in der CEACAM-Familie darstellt. Aufgrund des Mangels eines bekannten Liganden für CEACAM4 generierten wir chimäre Proteine, bei denen die extrazelluläre Bakterien-bindende Domäne von CEACAM3 an den transmembranen und zytoplasmatischen Teil von CEACAM4 fusioniert ist (CEACAM3/4). Interessanterweise war bei unseren Versuchen der intrazelluläre Teil von CEACAM4 in der Lage, die Aufnahme gebundener Bakterien auszulösen. Die Phagozytose von Bakterien ging einher mit der Tyrosinphosphorylierung von CEACAM4 in Abhängigkeit von der Integrität der zytoplasmatischen ITAM-Sequenz. Nach Phosphorylierung der Tyrosinreste durch eine Src-Kinase konnten SH2-Domänenproteine, die an der Signaltransduktion während der Phagozytose beteiligt sind, an die ITAM Sequenz binden. Wir konnten somit zeigen, dass dieser Orphan-Rezeptor eine phagozytische Funktion aufweist, was die Notwendigkeit potentieller Liganden weiter erhöht. Untersuchungen zur Relevanz von CEACAM4 wurden bisher vernachlässigt, weil kein geeigneter Ligand bekannt war, um die Funktionsweise von CEACAM4 zu analysieren. Dies veranlasste uns, nach einem bakteriellen CEACAM4-Liganden innerhalb menschlicher Darmmikrobiota zu suchen. Dazu wurden Bakterien aus Stuhlproben mit GFP-gekoppeltem CEACAM4 inkubiert und anschließend mittels anti-GFP magnetic bead Isolierung aufkonzentriert. Nach der 16S rRNA Gensequenzierung von assozierten Bakterien wurden die „Cluster Analysis of Sequences“ (CLANS) mit Hilfe der SILVA Datenbank durchgeführt. Die bioinformatischen Analysen identifizierten die Spezies Prevotella, Clostridiales und Selenomonadales als potentielle CEACAM4 bindende Bakterien, was in nachfolgenden Pull-down-Experimenten jedoch nicht bestätigt werden konnte. Daher diskutieren wir mögliche Verbesserungen des angewendeten Versuchsaufbaus zur Identifizierung von Liganden des Orphan-Rezeptors CEACAM4. Es sollte in Betracht gezogen werden, dass ein anderer Typ von Mikroorganismus wie z.B. Pilze oder Protozoen oder sogar ein endogener Ligand an CEACAM4 binden können.

General Introduction

1 General Introduction

This section will provide an overall view of the natural immune response to infection and an update on the human carcinoembryonic antigen-related cell adhesion molecules (CEACAM) family. Readers with basic knowledge in immunology and specially familiar with the innate immune system may prefer to skip directly to the introductory section 1.2 which introduces the CEACAM family and family members specifically expressed in the granulocyte lineages, such as CEACAM3 and CEACAM4, which are the focus of the present study.

1.1 Innate (natural) Immunity

Microbes form most of the biomass in the world (Whitman et al., 1998). Thus, since our birth we are daily exposed to millions of microorganisms co-existing on this planet. However, they do not only live in our environment, but also, they can colonize our body and make us their host. The human body is colonized by a vast number of microbes, collectively referred to as the human microbiota. Indeed, most multicellular organisms contain a great number of symbiotic bacteria; a human adult body for instance contains at least ten times more microbial than human cells (Ley et al., 2006). Normally, microbes live in a symbiotic relationship with their hosts and only a fraction of microbes are harmful or virulent and can cause disease, therefore, they are referred to as ‘pathogens’ (Casadevall and Pirofski, 2014). Humans are continuously exposed to potential pathogens through contact, ingestion or inhalation, so the innate (natural) immunity is the first defense that the body has against the outside world. The immune system consists of cells, tissues and molecules protecting the body from different pathogenic microbes and toxins from our environment. Innate immune responses have been found among both vertebrates, invertebrates, as well as in plants. In contrast, the acquired (adaptive) immune system arose in evolution less than 500 million years ago and is restricted to vertebrates (Litman et al., 2005). Innate immune responses in vertebrates are indispensable to activate adaptive immune responses. Innate immunity is the first line of defense against invading pathogens and, unlike the acquired immunity, protects us from infection during the first critical hours of exposure to a new antigen, while the adaptive immune response is more complex and slow, requiring few days after

General Introduction infection to develop an antigen-specific immune response, which provide us with an ongoing protection against future pathogens (Figure 1.1). Thus, acquired immunity after an initial response to a specific pathogen provides a long-lasting protection ‘memory’ that makes future responses against a specific antigen more efficient. The innate and the acquired immune responses interplay and cooperate to eliminate pathogens. In this way, the ability to avoid infection relies on our immune system which triggers different mechanisms depending on how fast and for how long it responds to pathogens, its central effector cell types and its specificity for different classes of microbes (Alberts et al., 2002; Dranoff, 2004).

Figure 1.1 The immune system: key mechanism of defense against infection. All cells of the immune system have their origin in the bone marrow. The myeloid progenitor (stem) cell in the bone marrow gives rise to erythrocytes, platelets, neutrophils, monocytes/macrophages and dendritic cells; whereas the lymphoid progenitor (stem) cell gives rise to the Natural killer cells, T cells and B cells. The innate immune response functions as the first line of defense against infection. It consists of soluble factors (such as complement proteins), and diverse cellular components including granulocytes (basophils, eosinophils and neutrophils), mast cells, macrophages, dendritic cells and natural killer cells. The adaptive immune response is slower to develop but manifests as increased antigenic specificity and memory. It consists of antibodies, B cells, and CD4+ and CD8+ T lymphocytes. Natural killer T cells and γδ T cells are cytotoxic lymphocytes that bestride the interface of innate and adaptive immunity. For T cell development the precursor T cells must migrate to the thymus where they undergo differentiation into two distinct types of T cells: the CD4+ T helper cell and the CD8+ pre-cytotoxic T cell. Two types of T helper cells are produced in the thymus, the TH1 cells, which help the CD8+ pre-cytotoxic cells to differentiate into cytotoxic T cells, and TH2 cells, which help B cells to differentiate into antibody-secreting plasma cells. (Dranoff, 2004).

General Introduction

The immune system is the body’s key mechanism of defense against infection, but also, since the immune system can easily damage cells during inflammation (as a response to invading organisms), is important that the body regulates the immune response to only harmful agents (Dzik, 2010). Disorders of the immune system could lead to attack harmless substances as in allergic reactions (e.g. dust and pollen), autoimmune diseases (when the response is directed toward self-tissues) or even cancer (Coussens and Werb, 2001; Dranoff, 2004; Miller et al., 2012; O'Byrne and Dalgleish, 2001). Thus, the main function of the immune system is self/non-self discrimination. This ability is necessary to protect the organism from pathogenic invaders and to get rid of modified or altered cells (e.g. malignant cells). In this line, considering that the immune system in most cases is able to eliminate the infection in an early stage, infections do not necessarily result in diseases (Casadevall and Pirofski, 2014; Mayer, 2006).

1.1.1 Host defense against infection

Cellular and humoral components are specific barriers of the immune (innate and acquired) system as protective mechanisms against infection. But additionally, the innate immune system also relies on anatomical features. Although these two immune responses cover distinct functions, there is interplay of components and they complement each other (Mayer, 2006).

 Anatomical barriers The anatomical barriers are the immediate physical obstacles of the pathogenic invaders and they are very effective in preventing colonization of tissues by pathogens. These barriers consist of mechanical, chemical and biological factors.

Mechanical Factors: Mechanical anatomical barriers include epithelial barriers such as the skin as the first impermeable barrier to infection, followed by mucous membranes which line the body’s cavities including the nose, mouth and the gastrointestinal tract. The scull and thoracic cage also provide protection to the internal organs from exposure to pathogens. Ciliary movements help to keep the gastrointestinal tract free of microorganisms as well as the flushing action of tears and saliva protects eyes and mouth from infection (Boyton and Openshaw, 2002; Coussens and Werb, 2001; Mayer, 2006).

General Introduction

Chemical Factors: Fatty acids, low molecular weight anti-microbial peptides and the low pH in sweat as well as gastric secretions prevent growth of bacteria. Lysozyme and phospholipase found in tears, saliva and nasal secretions can breakdown bacterial membranes. Antimicrobial activity is possessed by defensins (host defense peptides) present in the lung and gastrointestinal tract. In addition, surfactants in the lung can act as opsonins (substances promoting uptake of particles by phagocytic cells) (Hankiewicz and Swierczek, 1974; Mayer, 2006; Moreau et al., 2001).

Biological factors: The microbiota of the skin or in the gastrointestinal tract play an important role to prevent colonization of pathogenic microorganisms by releasing toxic secretions or by competing with pathogens for nutrients or attachment to cell surfaces (Cho and Blaser, 2012; Gerritsen et al., 2011; Gorbach, 1990; Mayer, 2006; Salminen et al., 2005).

 Humoral barriers Infection may occur once pathogens have penetrated tissues and the anatomical barriers are breached. In this moment, another innate defense mechanism comes into play namely acute inflammation (fast protective innate immune response that involves, blood vessels, molecular mediators and leukocyte recruitment to the infected tissue), which help to eliminate the initial cause of cell injury (microbial clearance), clear out necrotic cells and damaged tissues. In addition, a longer process of tissue repair (chronic inflammation) is also initiated (Ferencik and Stvrtinova, 1996; Mayer, 2006; Miyake and Kaisho, 2014). Humoral factors play a key role in inflammation. These humoral factors are found in serum or they are formed at the site of infection. This innate immune response is characterized by an abnormal accumulation of fluid beneath the skin or in the cavities of the body (edema) and the recruitment of phagocytic cells at sites of infection (Ferencik et al., 2007; Mayer, 2006).

Complement system: It is the major humoral innate defense mechanism and, as it is named, helps or complements the ability of antibodies and phagocytic cells to clear pathogens from an organism. The complement system consists of a number of small proteins found in the blood, generally synthesized by the liver, and normally circulating as inactive precursors (pro-proteins). Plasma and membrane bound proteins of the complemented system include serum proteins, serosal proteins, and cell membrane receptors (Muller- Eberhard, 1988). The complement system can be activated by three pathways: The

General Introduction classical (antigen-antibody reaction –adaptive response), the alternative (triggered by the fragment C3b) and the lectin pathway (triggered by Mannose Binding Lectin microorganism -MBL). The alternative and lectin pathways are part of the first line of defense in the innate immune response. The main functions of complement system are opsonization (enhancing phagocytosis of antigens), chemotaxis (attracting macrophages and neutrophils), cell lysis (rupturing membranes of foreign cells) and agglutination (clustering and binding of pathogens) (Dzik, 2010; Janeway et al., 2001; Rutkowski et al., 2010).

Coagulation system: The coagulation system is activated or not depending on tissue injury severity. Products of the coagulation system can contribute to the innate immune defense by increasing vascular permeability (acting as chemotactic agents for phagocytic cells) or because of their antimicrobial effect (Furie and Furie, 2007; Mayer, 2006). Other humoral factors like lactoferrin, transferrin, interferons, lysozyme and Interleukin-1, either limit the replication or help in the clearance of microbial cells (Dussurget et al., 2014; Ganz et al., 2003; Schultz et al., 2002; Skaar, 2010; Vareille et al., 2011).

 Cellular barriers The innate immune system as the first line of defense against invading pathogens comprises a particular set of cells prompt to be mobilized and battle microbes at the site of infection. The main line of defense in the innate immune system is the white blood cells (leukocytes) consisting of granulocytes (neutrophils, eosinophils, and basophils) and monocytes (which develop into macrophages). These leukocytes play a critical role in host defense and their recruitment to the site of infection is part of the inflammatory response. Inflammatory mediators also include mast cells. These cells together regulate the inflammatory responses and signal the body to mount an inflammatory response for invading microorganisms. Thus, the inflammatory response is important in the regulation of phagocytic cells activation (Alberts et al., 2002).

Granulocytes: These cells are characterized by the presence of granules in their cytoplasm. They are also called polymorphonuclear leukocytes (PMN) because of the varying shapes of the nucleus but often PMNs refer specifically to neutrophil granulocytes. Neutrophils are the most abundant granulocytes, followed by eosinophils, basophils, and mast cells. Granulocytes have a common myeloid progenitor (granulocyte precursor) in the bone

General Introduction barrow during differentiation of blood cells (haematopoiesis). PMNs circulate in the bloodstream and must be signaled to leave the bloodstream and enter tissues, playing an important role during acute inflammation (Ley et al., 2007; Petri et al., 2008). Granulocytes are recruited to the site of infection. Activation of these phagocytic cells results from microbes per se, from complement proteins, or from damaged tissue (chemotaxis). Invading organism are recognized and phagocytosed by neutrophils and eosinophils (specifically parasites), whereas basophils and mast cells contain abundant histamine, and other substances which contribute to the inflammatory response that helps fight invading organisms (Akuthota et al., 2008; Borregaard and Cowland, 1997; Hickey and Kubes, 2009; Stvrtinova et al., 2001).

Macrophages: In the myeloid lineage, monocytes (which differentiate into macrophages) together with lymphocytes constitute the mononuclear agranulocytes of the white blood cells. Macrophages represent a multi-functional cell type in innate immunity. Tissue macrophages and newly recruited monocytes contribute to bacterial clearance by recognition, phagocytosis and killing. Beyond their crucial role in the innate defense, they also are important to initiate specific (acquired or adaptive) defense mechanisms by acting as antigen-presenting cells, which are required for the induction of specific immune responses (Moldovan and Moldovan, 2005; North, 1970; Pinet et al., 2003). Furthermore, as scavengers, they play an important role in acute and chronic inflammation by removing dying or dead cells and cellular debris of the body as well as in wound healing (they replace PMNs as the predominant cells in the wound and phagocytose damage tissue) (Gurtner et al., 2008; Rodero and Khosrotehrani, 2010).

Natural killer cells: They are effector lymphocytes of the immune system with biological functions attributed to both innate and adaptive immunity. These cells as type of cytotoxic lymphocytes are critical to the innate immune system in viral infection and tumor development. NK cells are not part of the inflammatory response but important for cytolytic granule mediated cell apoptosis, antibody-dependent cell-mediated cytotoxicity, cytokine activation, tumor cell surveillance among other functions (Arina et al., 2007; Iannello et al., 2008; Lodoen and Lanier, 2005; Terunuma et al., 2008; Vivier et al., 2011).

Denditric cells: The name of these cells refers to the branched projection ‘dendrites’ of their cell body. Their main function is to induce either immune tolerance or lymphocyte activation minimizing as well autoimmune reactions. They capture and process antigens,

General Introduction migrate to lymphoid organs and secrete cytokines to initiate immune responses. These cells act as messengers between the innate and the adaptive immune systems (Banchereau and Steinman, 1998; McKenna et al., 2005).

1.1.2 Response of phagocytic cells to infection

Granulocytic neutrophils and macrophages are professional phagocytes which play a critical role in host defense to infection for an effective ingestion and killing of microorganisms. They require a sequential and integrated function of elements of the phagocytic system, but also, they are equipped with a vast arsenal of intracellular microbicidal mechanisms which provide an overkill capacity and allow them to face the many and varied microbial invaders. Phagocytic cells target microorganisms for phagocytosis and produce a combination of degradative enzymes, antimicrobial peptides, and reactive oxygen species to kill the invading microorganisms. In addition, they contribute in the activation of the inflammatory response and subsequently cooperate to onset of the adaptive immune system (Flannagan et al., 2009).

 Phagocytosis In the innate immune system, phagocytosis is a major mechanism used to eliminate pathogens and cell debris. The theory of phagocytosis started with Osler and later Metchnikoff who coined the term, phagocyte, from the Greek words, ‘phages’, meaning ‘to eat’, and ‘cite’, meaning ‘cell’ (Ambrose, 2006; Tan and Dee, 2009). Phagocytosis is a specific form of endocytosis involving the vascular internalization of solids particles (size more than 0.5 μm) such as bacteria, and it is a receptor-mediated, actin-driven process (Groves et al., 2008). This process requires a substantial membrane remodeling, facilitated by the actin-myosin contractile system activated by the Rho family of GTPases. The phagosome (vesicle formed around) of ingested particles is then fused with the lysosome (vesicle containing hydrolytic enzymes), forming a phagolysosome and leading to degradation. During phagosome maturation, changes in both the membrane and the contents are brought about by vesicular trafficking coordinated by a family of molecular switches, the Rab GTPases. (Flannagan et al., 2012; Jutras and Desjardins, 2005). Phagocytosis in mammalian immune cells is activated by different pathways mediated by specific cell surface receptors. Phagocytic cells express a wide range of receptors able to recognize particular sets of microorganisms. Presumably due to evolutionary pressure, ligands for phagocytic receptors became very specific (Groves et al., 2008); apart from

General Introduction receptors of apoptotic bodies which are activated by chemoattractants substances or apoptotic signals of dying cells (Brown et al., 2002; Martin et al., 1995; Michlewska et al., 2007). Phagocytosis is mediated by specific surface receptors that bind directly or indirectly, through opsonins. For instance, receptors can bind directly to specific structures on pathogenic surfaces so called ‘pathogen-associated molecular patterns’ (PAMPs). This type of receptor mainly include Toll-like receptors (TLR) (Hayashi et al., 2003; Hirayama et al., 2011; Negrini Tde et al., 2013; Shen et al., 2010; Zou and Shankar, 2015), but also some phagocytic receptors like the C-type lectin Dectin-1 (recognizing a variety of beta- glucans or polysaccharides present on the surface of some yeast cells)(Kennedy et al., 2007), the mannose receptor (Ezekowitz et al., 1990), the scavenger receptor A (recognition of lipopolysaccharides (LPS) displayed by gram-negative bacteria) (Peiser et al., 2000), Siglecs (binding to sialic acid) (Chang and Nizet, 2014), or recently, the carcinoembryonic antigen-related cell adhesion molecules (CEACAMs), another germ-line encoded receptors tailored toward particular subsets of host-associated pathogens (Kuespert et al., 2006) (Figure 1.2). On the other hand, opsonic receptors recognized microbes coated by opsonins which act as attachment sites and aid phagocytosis of pathogens mediated by either receptors to the Fc (fragment crystallizable) portion of immunoglobulin G (IgG) or receptors that bind complement component iC3b (Anderson et al., 1990; Ross et al., 1992).

Figure 1.2 CEACAM3-mediated, opsonin-independent phagocytosis by human granulocytes. Isolated human PMNs were infected with Neisseria gonorrhoeae expressing a CEACAM3-binding Opa protein and processed for scanning electron microscopy. Shown is a pseudocolored image of a human neutrophil (blue) in the process of opsonin-independent phagocytosis of multiple gonococci (orange) via large lamellipodial protrusions (indicated with arrowheads). The boxed area is enlarged in the right panel and shows in detail the membrane surface of the neutrophil at the site of the phagocytic cup during CEACAM3-mediated phagocytosis of N. gonorrhoeae (Buntru et al., 2012).

General Introduction

 Intracellular killing During phagocytosis an increase in glucose and oxygen consumption occur named respiratory or oxidative burst. The killing response by phagocytes can be consequence of the oxidative burst (oxygen-dependent intracellular killing) or in addition, bacteria can be killed by pre-formed substances released from granules or lysosomes when they fuse with the phagosome (oxygen-independent intracellular killing) (Mayer, 2006).

Oxidative burst: The oxidative burst plays an important role in the immune system as crucial reaction that occurs in phagocytes to destroy internalized bacteria. This killing process is characterized by the fast release of reactive oxygen species (ROS): superoxide − anion radical (O 2) and hydrogen peroxide (H2O2). The nicotinamide adenine dinucleotide phosphate hydrogen (NADPH) oxidase is responsible for the production of ROS in the phagosome and it is formed during phagocytosis after glucose is metabolized via the pentose monophosphate. In phagocytic cells, the NOX2 isoform of the NADPH oxidase is a multimeric protein complex that assembles in response to proinflammatory stimuli to − mediate the production of O 2 by transferring electrons from nicotinamide adenine dinucleotide phosphate (NADP+) to molecular oxygen. Upon activation, the cytosolic components assemble together with the small GTPases Rac1 and Rac2 and associate with the flavocytochrome b558 to transport electrons across the limiting membrane of the − phagosome to form O 2 (itself is a cytotoxic species), but it can also form highly reactive − H2O2. H2O2 can lead to the generation of toxic hydroxyl radicals (OH ) when directly reacting with phagosomal contents (Flannagan et al., 2012). Additionally, the myeloperoxidase (MPO) is released into the phagolysosome when the primary

(azurophilic) granules fuse with the phagosome, and it utilizes H2O2 to convert chloride ions (Cl−) into deadly hypochlorous acid (HClO) to combat infections (Winterbourn, 2008). Neutrophils and macrophages also elicit detoxification reactions to protect − themselves from the toxic oxygen intermediates by dismutation of O 2 to H2O2 (reaction catalyzed by superoxide dismutase) and the conversion of H2O2 to water (H2O) by catalase (Mayer, 2006).

Antibacterial proteins: Phagocytes can kill either intra- or extracellular pathogens by releasing from the neutrophil granules into phagosomes or the extracellular milieu, respectively. They rely on oxygen–independent killing mechanisms such as cathepsins (degrade specific polypeptides), defensins (forming pore-like membrane defects that allow

General Introduction efflux of essential ions and nutrients), lysozyme (splits mucopeptide in bacterial cell wall); lactoferrin (affect bacterial membrane permeability) or hydrolytic enzymes (break down bacterial proteins) (Borregaard, 2010; Hager et al., 2010; Kolaczkowska and Kubes, 2013; Mayer, 2006). Beside the NADPH oxygenase-dependent mechanisms (ROS) or antibacterial proteins, highly activated neutrophils can eliminate extracellular pathogens by releasing genomic DNA which is enmeshed with antimicrobial proteins, namely neutrophil extracellular traps (NETs), to immobilize and subsequently phagocytose trapped microorganisms (Brinkmann et al., 2004; Halverson et al., 2015; Kolaczkowska and Kubes, 2013; Papayannopoulos and Zychlinsky, 2009).

1.2 Human CEACAM family

In humans the carcinoembryonic antigen-related cell adhesion molecules (CEACAM) together with the pregnancy-specific glycoproteins (PSG) form the carcinoembryonic antigen (CEA) multigene family, subgroup of the immunoglobulin superfamily. CEA (CEACAM5) and related genes are encoded in the human chromosomal 19 (Beauchemin et al., 1999; Zid and Drouin, 2013). The CEACAMs comprise 12 protein-encoding genes: CEACAM1, CEACAM3-CEACAM8, CEACAM16, and CEACAM18-2, which are found mostly expressed in epithelial, endothelial or immune cells. However, the recently discovered genes (CEACAM16, CEACAM18-21) show a distinctive expression pattern compared to the rest of the family members (Kammerer et al., 2012; Zebhauser et al., 2005). All CEACAMs are highly glycosylated and characterized by an N-terminal immunoglobulin variable (IgV)-like domain followed by a varied number (from zero up to six) of immunoglobulin constant (IgC)-like domains. They are attached to the membrane either by a transmembrane domain or by a glycosylphosphatidylinositol (GPI) anchor (Thompson et al., 1991). Particularly, while the cytoplasmic domain of CEACAM1 bears an immunoreceptor tyrosine-based inhibitory motif (ITIM)-like sequence, the cytoplasmic tail of CEACAM3 and CEACAM4 encompass an immunoreceptor tyrosine-based activation motif (ITAM)-like sequence (Chen et al., 2001a; Chen et al., 2001b) (Figure 1.3). These glycoproteins are expressed on the apical side of cells and through the N-terminal IgV-like domain can mediate cell–cell adhesion of neighboring cells via hemophilic or heterophilic CEACAM-interactions as well as modulate signal transduction. CEACAM1,

General Introduction

CEACAM6, and CEACAM5 can exhibit homotypic and heterotypic adhesion, while CEACAM8 has been shown to exhibit only heterotypic adhesion with CEACAM6 (Gray- Owen and Blumberg, 2006; Kuespert et al., 2006; Obrink, 1997; Oikawa et al., 1989; Skubitz and Skubitz, 2008; Zheng et al., 2011).

Figure 1.3 Overview of the human CEACAM family. Schematic representation of major isoforms of the different CEACAM family members is depicted. Further information with regard to alternative splice variants can be found at http://cea.klinikum.uni-muenchen.de/. Species abbreviations: c, cow; d, dog; e, elephant; h, human; m, mouse; o, opossum; r, rat (Kuespert et al., 2006).

CEACAM family members have a wide range of functions and have been shown to play important roles in the regulation of immune responses, angiogenesis, the differentiation of mammary glands, insulin signaling turnover, tumorigenesis, and metastasis (Chevinsky, 1991; Gray-Owen and Blumberg, 2006; Horst et al., 2006; Huang et al., 1999; Kuespert et al., 2006; Leung et al., 2006; Poy et al., 2002; Schmitter et al., 2004; Sintsova et al., 2014; Yokoyama et al., 2007). CEACAMs are also known as tumor-related proteins and even

General Introduction used as tumor markers (Beauchemin and Arabzadeh, 2013; Blumenthal et al., 2007; Simeone et al., 2007; Zhou et al., 2011). Interestingly, a recent study analyzed the mRNA expression profiles of CEACAM family members in colonic, gastric, pancreatic, lung, breast, and thyroid cancer cell lines, demonstrating that CEACAM1, CEACAM5, and CEACAM6 were expressed in the majority of carcinoma cells. CEACAM7 exhibited a restricted expression and CEACAM3 was detected in only 5 (out of 46) cell lines without apparently type-specific expression. CEACAM8 showed to be specifically expressed in colonic cancer cell lines (HCA-2 and HCA-46) and a medullary thyroid carcinoma (TT) cell line exhibited a unique expression pattern for CEACAM4. However, the presence of the indicated CEACAMs in the tested cell lines has to be confirmed at the protein levels (Wakabayashi-Nakao et al., 2014).

1.2.1 Granulocytes CEACAMs

CEACAM family members can be exploited by a diverse group of human-restricted gram- negative bacteria including Neisseria gonorrhoeae, Neisseria meningitidis, Haemophilus influenzae, Moraxella catarrhalis, as well as some strains of pathogenic Escherichia coli. (Barnich et al., 2007; Chen and Gotschlich, 1996; Chen et al., 1997; Gray-Owen et al., 1997b; Hill et al., 2001; Hill and Virji, 2003; Virji et al., 1996). In order to reach and colonize human mucosal surfaces, these pathogenic species have evolved to express specific adhesins to bind CEACAMs (Tchoupa et al., 2014). The recognition of human CECAMs also seems to be species-specific and strongly suggests a coevolution of microbial adhesins with their host receptor (Kammerer et al., 2007; Kammerer and Zimmermann, 2010; Voges et al., 2010). This is in line with genome analyses which revealed that human CEACAMs belong to the 139 fastest-evolving human genes, likely due to the selective pressure of pathogens (Chang et al., 2013). Up to date, four CEACAM family members (CEACAM1, CEACAM3, CEACAM5, and CEACAM6) served as receptors of CEACAM-binding pathogens (Kuespert et al., 2006). However, the strategy of these human-adapted pathogens to colonize mucosa surfaces by binding to epithelial CEACAMs (CEACAM1, CEACAM5, CEACAM6) has as well a selective disadvantage to be killed by the innate immune response. The expression of CEACAM3 mediates the bactericidal response by granulocytes and, therefore, limits the spread of CEACAM-binding pathogens in their human host (Roth et al., 2013). Human granulocytes express CEACAM1, CEACAM3, CEACAM4, CEACAM6, and CEACAM8.

General Introduction

The granulocyte CEACAMs were discovered as CEA-related proteins in human leukocytes (Kuroki et al., 1991; Kuroki et al., 1990). In human neutrophils, CEACAM6 has been found associated selectively with the primary (azurophilic) granule-fraction, while CEACAM1 and CEACAM8 are restrictedly located in the secondary (specific) granule- fraction (Ducker and Skubitz, 1992; Kuroki et al., 1995). Since specific granules of neutrophils contain a variety of cytotoxic molecules which are released during degranulation after neutrophil activation, whereas azurophilic granules are predominantly involved in intracellular killing after phagocytosis, the differential localization of these CEACAMs has implied distinct physiological roles (Borregaard et al., 1993). Upregulation of CEACAM1, CEACAM8, and CEACAM6 on the neutrophil surface and the heterophilic interaction between CEACAM8 and CEACAM6 upon stimulation suggested an interaction between primary and secondary granules. This occurs when neutrophils are activated and subsequently expose CEACAMs to the membrane which were stored in different subcellular compartments (Ducker and Skubitz, 1992; Kuroki et al., 1992; Kuroki et al., 1995; Oikawa et al., 1991; Tetteroo et al., 1986). While some of these granulocyte CEACAMs are also expressed in epithelial cells (such as CEACAM1, CEACAM6), others seem to be exclusively expressed by granulocytes. CEACAM3 and CEACAM4 are restrictedly express in neutrophils whereas CEACAM8 expression has been found on neutrophils and eosinophils (Lasa et al. 2008). The different roles of CEACAMs in neutrophil function are complex and due to a multiple CEACAM expression, single contributions are not well described. However, ligation of all granulocyte CEACAMs, except for CEACAM4, by CD66 monoclonal antibodies (mAbs) independently stimulated and transduced signals in neutrophils resulting in a calcium- dependent activation of CD11/CD18, and an increase in neutrophil adhesion to endothelial cells (a crucial step to initiate inflammation) (Skubitz et al., 1996). Furthermore, a subsequent study confirmed that the interdependency of CEACAM1, CEACAM3, CEACAM6, and CEACAM8 induces human neutrophil adhesion to endothelial cells. Indeed, granulocytes CEACAMs form homo- or heterodimers that are able, upon activation, to transduce signal ultimately promoting neutrophil adhesion. (Skubitz and Skubitz, 2008). In addition, CEACAM3 has been shown as an innate decoy receptor responsible for the efficient opsonin-independent phagocytosis and killing of a set of human-restricted pathogens, as well as playing an important contribution during acute inflammation (Buntru et al., 2012; Sarantis and Gray-Owen, 2011; Schmitter et al., 2004; Schmitter et al., 2007a; Sintsova et al., 2014).

General Introduction

1.2.2 CEACAM3: Phagocytic Hem-ITAM receptor

CEACAM3 was formerly named CEA gene family member 1 (CGM1) as well as CD66d antigen or nonspecific cross-reacting antigen (NCA) W264, W282. Among the CEACAM family, CEACAM3 is solely expressed in neutrophils and function as phagocytic receptor to initiated opsonin-independent recognition, uptake and clearance of pathogenic CEACAM-binding bacteria, including N. gonorrhoeae, M. catarrhalis, and H. influenza (Buntru et al., 2012; Schmitter et al., 2004). The mechanism of CEACAM3-mediated phagocytosis and elimination of pathogenic bacteria have been vastly elucidated over the last decades. The intracellular domain of CEACAM3 contains an ITAM-like sequence similar to the consensus sequence (YxxL/I(x)7-12YxxL/I) of canonical ITAM-bearing receptors, such as Fc-receptors (FcRs), B-cell receptors (BCR) or T-cell receptors (TCR). Key players of these immunoreceptors have been the starting point to unravel the CEACAM3-mediated signaling. Different studies have shown that the pathway initiated by CEACAM3 involves a similar subset of effector molecules as canonical immunoreceptors but also displays a different mechanism to drive a more efficient phagocytosis after receptor activation (Buntru et al., 2012). Activation of canonical ITAM-bearing receptors and downstream associated proteins require the phosphorylation on the tyrosine residues (membrane proximal and distal) within the consensus ITAM sequence of the cytoplasmic domain. First, kinases of the Src family tyrosine phosphorylate the ITAM-like sequence of the receptor. This enables the binding of the Syk kinase which can bind by its SH2 domain to the double phosphorylated ITAM (Johnson et al., 1995; Kiefer et al., 1998). Syk activation is indispensable for downstream events including the activation of small GTPases of the Rho family, such as Rac and Cdc42, which via WASP and WAVE, orchestrate the actin- cytoskeleton-driven formation of lamellipodial protrusions to form the phagocytic cup (Cox et al., 1997; Deckert et al., 1996; Greenberg and Grinstein, 2002; Swanson and Hoppe, 2004). Moreover, phosphatidylinositol-3’ (PI3) kinase activity result essential not only for bacterial killing but also during opsonin-mediated uptake of particles via the Fcγ receptor (McCaw et al., 2003).

In contrast, CEACAM3-mediated signaling promotes a Syk-independent shortcut for Rac stimulation via a direct association of Vav and others downstream molecules to the cytoplasmic domain of CEACAM3, in order to efficiently mediate an opsonin-independent phagocytosis and bactericidal mechanisms of granulocytes in response to bacterial

General Introduction infection (Billker et al., 2002; McCaw et al., 2003; Schmitter et al., 2004; Schmitter et al., 2007a). Upon infection, CEACAM3 is clustered to the site of infection and bacteria are able to bind the CEACAM receptor through specific adhesins. CEACAM3 is activated after phosphorylation by the Src family kinases Hck and Fgr (Hauck et al., 1998). After tyrosine phosphorylation, downstream effector molecules are directly recruited to the phosphorylated membrane proximal tyrosine residue (pY230) of the ITAM-like sequence via Src homology 2 (SH2) domains. Thus, the phosphorylated ITAM-like sequence of CEACAM3 serves as a docking site for SH2-domain containing proteins and additionally provides a short wire connecting bacterial recognition and stimulation of the GTPase Rac (Schmitter et al., 2004). In this line, the SH2 domain of the guanidine nucleotide exchange factor (GEF) Vav directly binds to the pY230 (Schmitter et al., 2007a). At the same time, the phosphorylated cytoplasmic domain of CEACAM3 allows recruitment of Nck adaptor proteins, which connect CEACAM3 via Nap1 with the WAVE complex promoting f-actin nucleation by the Arp2/3 complex (Pils et al., 2012). While Vav activates Rac, the WAVE- complex is formed and can be activated by Rac to initiate actin-based lamellipodial protrusions and rapid engulfment of CEACAM-binding bacteria (Buntru et al., 2012; Pils et al., 2012). Furthermore, recruitment and direct association (via SH2-domain) of the class I PI3 kinase regulatory p55 subunit to pY230 seem to be dispensable for CEACAM3- mediated phagocytosis but instrumental to regulate the NADPH oxidase complex activation and generation of ROS for an efficient elimination of CEACAM-binding bacteria by human granulocytes (Booth et al., 2003; Buntru et al., 2011) (Figure 1.4). Interestingly, this scenario shows a different signal transduction compared to canonical ITAM-bearing receptors but closely resembles the functional mechanism of the Hem- ITAM from the C-type lectin Dectin-1 receptor (Buntru et al., 2012). To this day, CEACAM3 signaling is considered to trigger a Hem-ITAM signaling where, similar to Dectin 1, a single tyrosine residue (the membrane proximal tyrosine) is sufficient to drive signal transduction (Buntru et al., 2012; Fuller et al., 2007; Rogers and Foster, 2009).

General Introduction

Figure 1.4 Current model of CEACAM3 Hem-ITAM signal transduction. Upon engagement of CEACAM3 by CEACAM-binding bacteria, the ITAM-like sequence in the cytoplasmatic domain of the receptor is phosphorylated by Src family kinase on two tyrosine residues (Y230 and Y241). In turn, pY230 serves as a docking site for several effector proteins. The Rac-GEF Vav directly binds to pY230 via its SH2 domain and activates Rac by facilitating GTP loading. While Vav activates Rac, the adaptor molecule Nck is also recruited to CEACAM3 in a phosphotyrosine-dependent manner. Nck constitutively associates via one of its SH3 domains with Nap1, an integral component of the WAVE complex. The CEACAM3-localized WAVE-complex can now be activated by GTP-Rac triggering f-actin-based lamellipodia during the opsonin- independent phagocytosis of CEACAM3-binding bacteria. On the other hand, pY230 serves as a binding site for the SH2 domain of the regulatory subunit of PI3 kinase. Together with the kinase Syk, which might indirectly associate with CEACAM3, PI3 kinase orchestrates the assembly of a membrane localized NADPH oxidase complex. Assembly and full activity of this complex again require GTP-loaded Rac (Buntru et al., 2012).

1.2.3 CEACAM4: Orphan receptor of the CEACAM family

CEACAM4 was discovered as nonspecific antigen related to CEA in human leukocytes (Kuroki et al., 1991) and was previously named CGM7 or NCA W236. The study of CEACAM4 has been neglected and the function of this membrane protein remains

General Introduction completely unknown, primarily due to a lack of a bona fide ligand. CEACAM4 is a transmembrane protein which harbors an ITAM-like sequence within its cytoplasmic domain. The extracellular part consists of a single IgV-like domain, as all CEACAMs, but lack IgC2-like domains (Thompson et al., 1991). Interestingly, CEACAM4 perfectly matches the domain structure of CEACAM3. Together, they are the only CEACAM family members which contain an ITAM consensus in the cytoplasmic domain and are exclusively expressed by granulocytes (Kuespert et al., 2006). Remarkably, this fact could suggest a phagocytic activity of CEACAM4 since CEACAM3 is a well-known phagocytic receptor of the innate immune system (Buntru et al., 2012; Schmitter et al., 2004). However, none of the CEACAM binding bacteria has been shown to bind CEACAM4. Moreover, it is important to highlight that at the genomic level, the number of exons is the same between CEACAM3 and CEACAM4. Interestingly, most of the length variation is due to intron 2, which separate the exons encoding the IgV-like domain from the transmembrane and the cytoplasmic domain. Both CEACAMs also at the protein level differ mostly in the extracellular N-terminal domain whereas the C-terminal intracellular domain is pretty similar (identity 73%) (Pils et al., 2008). Since the IgV-like domain of CEACAM3 appears highly similar to other CEACAMs such as CEACAM5 (identity 92%), but not to CEACAM4 (identity 49%); Pils et al. have proposed CEACAM3 as a natural chimera with the IgV-like domain derived from a bacteria-recognizing CEACAM (e.g. CEACAM1, CEACAM5 or CEACAM6) and the ITAM-like sequence within the cytoplasmic tail (which is able to induce phagocytosis) likely inherited from an ancestor of CEACAM4. In addition, two novel splice variants have been reported to CEACAM4 (sv1 and sv2) which could be useful for future genomic analysis of CEACAM4 (Wakabayashi- Nakao et al., 2014). Due to the exclusive presence of the CEACAM4 gene in the primate lineage (Kammerer and Zimmermann, 2010; Zid and Drouin, 2013) and its expression in professional phagocytes (Kuroki et al., 1991; Kuroki et al., 1990), the yet orphan receptor could provide an interesting primate-specific contribution to the function and/or regulation of our species’ immune system. The identification of a physiological ligand, being a human-associated microorganism or an endogenous structure, could be the next step in elucidating the fascinating biology behind this protein.

Aims of the study

2 Aims of the study

This study focusses on two CEACAM family members expressed in human granulocytes: CEACAM3 and CEACAM4. The defining feature of these closely related glycoproteins is the presence of an ITAM-like sequence within their cytoplasmic domains. The following chapters attempt to provide novel insight into the signaling function of both phagocytic receptors in vitro and in vivo as well as unravel the ligand binding and signaling functions of the orphan receptor CEACAM4.

I. CEACAM3 function heavily depends on the tyrosine phosphorylation of the cytoplasmic ITAM-like sequence and its function as a docking site for SH2-domain containing proteins. As previous biochemical experiments had indicated binding of the Tec SH2 domain to CEACAM3, the functional relevance of this interaction and the regulation of Tec activity in response to CEACAM3 stimulation should be investigated.

II. Since human CEACAM3 has no murine orthologues, an in vivo model for the genetic dissection of CEACAM3 function is currently not available. Therefore, we aimed to generate transgenic mice expressing human CEACAM3 in granulocytes. The ultimate goal was to create a mouse line with granulocyte restricted expression of an mKate-tagged human CEACAM3, which not only should allow in vivo infection experiments with genetically modified mice, including crosses with defined knock-out animals, but also the microscopic analysis of CEACAM3 in living primary cells.

III. To study the function of the CEACAM4 ITAM-like sequence in the absence of a known ligand, we wanted to develop a chimeric protein consisting of the extracellular bacteria-binding domain of CEACAM3 fused to the transmembrane and cytoplasmic domain of CEACAM4. Engagement of this CEACAM3/4 chimera by CEACAM3-binding bacteria should then in principle trigger CEACAM4- initiated responses. Accordingly, by the help of chimeric receptors we wanted to

Aims of the study

study intracellular signaling and potentially phagocytic function of the CEACAM4 ITAM-like sequence.

IV. A major advance to the study of CEACAM4 function could result from the identification of a CEACAM4 ligand. To search for potential microbial ligands of CEACAM4, we initiated a functional screen based on a combination of affinity purification and next-generation sequencing to detect CEACAM4-binding members from the human intestinal microbiota. Candidate species identified via bioinformatic analysis should then be cultured and further tested for CEACAM4 binding by biochemical and cellular assays in vitro.

Chapter I

3 Chapter I

Tec kinase contributes to CEACAM3-initiated Hem-ITAM signaling to promote bacterial phagocytosis and destruction by human granulocytes

Julia Delgado Tascón1,2, Annette Buntz3,4, Olga Wiens1, Stefan Pils1, Kathrin Kopp1, Andreas Zumbusch3,4, and Christof R. Hauck1,2,4

1 Lehrstuhl Zellbiologie, Universität Konstanz, 78457 Konstanz, Germany 2 Graduate School Biological Sciences; Universität Konstanz, 78457 Konstanz, Germany 3 Lehrstuhl Physikalische Chemie, Universität Konstanz, 78457 Konstanz, Germany 4 Konstanz Research School Chemical Biology, Universität Konstanz, 78457 Konstanz, Germany

Under submission

Chapter I

3.1 Summary

Human granulocytes express several receptors of the CEACAM family, which are not present in non-primate species. In particular, CEACAM3 operates as a single chain phagocytic receptor responsible for initiating the opsonin-independent recognition, internalization and destruction of a limited set of CEACAM-binding bacteria including Neisseria gonorrhoeae. Here we show that the Hem-ITAM of CEACAM3, upon phosphorylation by Src family protein tyrosine kinases (PTKs), directly binds the SH2 domain of Tec kinase and recruits this PTK to the site of bacterial phagocytosis. Upon CEACAM3 engagement by CEACAM-binding N. gonorrhoeae, Tec is phosphorylated within 15 to 30 min at critical tyrosine residues within the kinase domain indicating rapid activation of Tec. Overexpression of Tec in non-professional phagocytes enhances, whereas pharmacological inhibition of Tec reduces CEACAM3-mediated bacterial uptake in CEACAM3-expressing cell lines and primary human granulocytes. Epistasis experiments demonstrate that Tec is downstream of Src PTK activation and contributes to granulocyte phagocytic activity as well as generation of reactive oxygen species. Finally, scanning electron microscopy reveals a lack of lamellipodial protrusions and probing with phospho-specific antibodies indicates reduced activation of the guanine nucleotide exchange factor Vav upon Tec kinase inhibition. Together, these data demonstrate that in human granulocytes Tec kinase maximizes Hem-ITAM signaling and reveal for the first time a prominent role of Tec in opsonin-independent phagocytosis.

3.2 Introduction

Early response to infection is provided by the innate immune system, which is activated upon recognition of key microbial signatures. Specialized cells of the innate immune system, such as granulocytes, not only recognize, but also phagocytose and eliminate a wide range of microbes. Whereas opsonin-dependent phagocytosis provided by complement receptors (such as CR3) and receptors for the Fc portion of immunogloblin (FcRs) can in principle capture any opsonized object, additional mechanisms operate to allow opsonin-independent recognition and phagocytosis of particular pathogens. One group of phagocyte membrane proteins, the C-type lectin family, specializes on recognizing specific carbohydrate structures of microorganisms. For example, one member

Chapter I of the C-type lectin family, the type II membrane protein Dectin-1, binds to beta-glucan contained within fungal cell walls and allows rapid, opsonin-independent phagocytosis of yeast (Brown, 2006; Taylor et al., 2007). Dectin-1 function depends on a so-called Hem- ITAM motif, which is characterized by a cytoplasmic tyrosine residue within a given amino acid sequence context (Fuller et al., 2007; Goodridge et al., 2012). Recent work has shown that human granulocytes express yet another Hem-ITAM containing receptor involved in opsonin-independent phagocytosis, the immunoglobulin superfamily member CEACAM3 (Buntru et al., 2012; Pils et al., 2008). CEACAM3 belongs to the carcinoembryonic antigen-related cell adhesion molecule (CEACAM) family, a group of membrane proteins found mainly on epithelial cells. In contrast to C- type lectins, CEACAM3 and related CEACAMs bind to bacterial surface proteins via direct protein-protein interactions involving the non-gylcosylated CFG-face of their amino- terminal IgV-like immunoglobulin domain (Tchoupa et al., 2014; Virji et al., 1999). Whereas epithelial CEACAMs are exploited by several human-restricted gram-negative pathogens in order to colonize and invade mucosal surfaces (Johswich et al., 2013; Muenzner et al., 2010; Muenzner et al., 2005), CEACAM3 appears to have an important function in detecting and eliminating CEACAM-binding bacteria in an opsonin- independent manner (Buntru et al., 2012; Schmitter et al., 2004). Indeed, binding of bacteria to granulocyte CEACAM3 triggers a fulminant rearrangement of the cytoskeleton, massive lamellipodial protrusions and rapid phagocytosis of bound particles (Buntru et al., 2012; Schmitter et al., 2004). Importantly, CEACAM3 expression in non-phagocytic cells can recapitulate these aspects of bacterial uptake, albeit lamellipodia formation occurs on a slower time scale and is less pronounced (Billker et al., 2002; Pils et al., 2012). In granulocytes, clustering of CEACAM3 activates the Src family kinases Hck and Fgr, which in turn phosphorylate the CEACAM3 cytoplasmic domain. Similarly, CEACAM3 ectopically expressed in HeLa or HEK 293 cells can be phosphorylated by c-Src to initiate CEACAM3-mediated phagocytosis (Kopp et al., 2012; McCaw et al., 2003; Schmitter et al., 2007b). Furthermore, the adapter protein Nck, the guanine nucleotide exchange factor (GEF) Vav, as well as the small GTPase Rac, which are essential for CEACAM3 function in granulocytes (Pils et al., 2012; Schmitter et al., 2004; Schmitter et al., 2007a), are also found in non-hematopoetic cell types. The fact that CEACAM3 signaling relies on a ubiquitously expressed core set of proteins can explain, why CEACAM3 is able to operate in principle (e.g. upon transfection) in multiple cell types. However, the rapid and pronounced action of CEACAM3 in granulocytes also suggests that cell-type specific

Chapter I components contribute to Hem-ITAM initiated processes. As the cytoplasmic tyrosine residues of CEACAM3 are critical determinants of CEACAM3-initiated downstream processes, we focused on identifying additional binding partners of the CEACAM3 Hem- ITAM motif. Here we show that Tec, a member of the second largest family of non-receptor PTKs primarily expressed in hematopoietic cells (Schmidt et al., 2004), directly associates with the phosphorylated Hem-ITAM of CEACAM3. Functional analyses demonstrate that Tec contributes to both CEACAM3-initiated lamellipodia formation as well as the bactericidal oxidative response of granulocytes. Our results for the first time provide evidence that Tec has important functions during opsonin-independent phagocytosis of bacteria by human innate immune cells.

3.3 Material and Methods

 Antibodies and Reagents Monoclonal antibody (mAb) against human Tec (Y398) was purchased from Abcam (Abcam plc., England) and mAb against human phospho-BTK/Tec (pY551/pY519, Clone 797837) was from R&D systems (R&D systems GmbH, USA). Polyclonal antibody against c-Src (SRC2) was from Santa Cruz Biotechnology (Santa Cruz, CA) and polyclonal rabbit antibody against human phospho-Src (pY418) was from Invitrogen-life technologies (Thermo Fisher Scientific, USA). Polyclonal antibodies against Vav (C-14) and phosphor-Vav (pY174)-R were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The mAbs against HA-tag (12CA5); phospho-tyrosine residues (pY72); Opa (4B12/C11); and tubulin (E-7) were purified from hybridoma cell supernatants obtained from DSHB (University of Iowa, IA). The mAb antibody against Vinculin (hVIN-1) was from Sigma-Aldrich (St. Louis, Missouri, USA); mAb against GFP (JL-8) was from Biosciences (Becton, Dickinson and Company –BD, USA) and mAb against GST (B-14) was from Santa Cruz Biotechnology (Santa Cruz, CA). A rabbit polyclonal antibody against recombinant mKate was custom generated and affinity purified (Animal Research Facility, University of Konstanz, Germany). GST and GST-fused SH2-domains used were all expressed in E. coli BL-21 and purified using GSTrapTM FF (Amersham Biosciences, Freiburg, Germany). Protein A/G sepharose was obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Secondary antibodies were obtained from Jackson Immunoresearch

Chapter I

(West Grove, PA). NHS-Biotin was obtained from Pierce Biotechnology (Rockford, IL). Specific kinase inhibitors of the Src family kinase (PP2) and PI3K inhibitor (Wortmannin) were from Calbiochem (San Diego, CA). Tec family kinase (LFM-A13) inhibitor was obtained from Sigma-Aldrich (St. Louis, Missouri, USA).

 Recombinant DNA constructs Mammalian expression vectors encoding CEACAM3-WT-HA and CEACAM3-ΔCT-HA were described previously (Schmitter et al., 2004). Likewise, pLPS-3’-CEACAM3-mKate and pLPS-3’-CEACAM3-ΔCT-mKate as well as pLPS-3’-mCerulean, were described before (Pils et al., 2012). The cDNA of full length human Tec (pCMV6-XL4 -Tec) was purchased from Origene (Rockville, MD, USA), human Btk (pBluescriptII-KS -Btk) was kindly provided by Prof. Wirth (University of Ulm, Germany) and human Bmx (pCMV- Sport6 -Bmx) was provided by RZPD (Berlin, Germany). The above plasmids were used for PCR amplification to generate SH2 domains of human Tec, Btk and Bmx with primers: TEC-SH2-IF-sense 5’- GAAGTTATCAGTCGACACGGGAAAGAAATCAAAC-3’ and TEC-SH2-IF-anti 5’- ATGGTCTAGAAAGCTTATCCTGCAGTGGTGGGTG-3’, BTK- SH2-IF-sense 5’- GAAGTTATCAGTCGACCCTAGTAACTATGTCAC-3’ and BTK- SH2-IF-anti 5’- ATGGTCTAGAAAGCTTATTCCCATGATCCGTATCCC-3’, BMX- SH2-IF-sense 5’-GAAGTTATCAGTCGACTCATCTGAAGAAGAGG-3’ and BMX- SH2-IF-anti 5’- ATGGTCTAGAAAGCTTAGGACACAGAGTCGGGGACC-3’, respectively. The cDNA of human Tec, Btk and Bmx SH2 domains were cloned into pDNR-Dual using the In-Fusion PCR Cloning Kit (Clontech, Mountain View, CA, USA) and transferred into pGEX-4T-1-LoxP via Cre/lox recombination. The SH2 domains of Tec, Btk and Bmx were expressed as GST-fusion proteins in Escherichia coli BL21 and purified as described previously (Schmitter et al., 2007a). Human Hck WT cDNA was amplified by PCR from pOTB7 Hck human (provided by RZPD, Berlin, Germany) with primers: 5’- CTGAGTCGACATGGGGTGCATGAAGTCCAAG-3’ and 5’- CTGACCGGTTGGCTGCTGTTGGTACTG-3’). The coding sequence was inserted into pDNR-dual MCS via SalI/AgeI to yield pDNR-dual Hck WT. The cDNA was subsequently transferred into pLPS-3'EGFP (Clontech, Mountain View, CA, USA) by Cre- mediated recombination to yield Hck WT-EGFP. Human TEC wildtype (WT) was amplified using the following primers: 5’- GAAGTTATCAGTCGACACCATGAATTTTAACACTATTTTGGAGGAG-3’ and 5’- ATGGTCTAGAAAGCTTTCTTCCAAAAGTTTCTTCACATTCAAC-3’) from pCMV6-

Chapter I

XL4 human Tec full length (Origene, Rockville, MD, USA). The resulting PCR fragment was cloned into pDNR-Dual using the In-Fusion PCR Cloning Kit (Clontech, Mountain View, CA, USA) and transferred into pEGFP-C1 loxP and pLP-CMV 2x HA by Cre- mediated recombination resulting in EGFP and 2xHA fused to the N-terminus of human TEC-HA. The mammalian expression vector pcDNA3.1 was purchased from Invitrogen- Life technologies (Thermo Fisher Scientific, USA). The plasmid pRC/CMV encoding v- Src was described before (Hauck et al., 2001). The GST-fusion protein of the Src-SH2 domain was also described previously (Schmitter et al., 2007a).

 Bacteria and Growth conditions Non-piliated Neisseria gonorrhoeae MS11-B2.1 expressing a CEACAM-binding Opa protein (strain N309, Opa52 - OpaCEA) or non-CEACAM binding strain (strain N302, Ngo Opa-) (Kupsch et al., 1993b) were kindly provided by Thomas Meyer (Max-Planck-Institut für Infektionsbiologie, Berlin, Germany). Bacteria were grown on GC-agar plates (BD DifcoTM, Gonococci Agar medium base) supplemented with vitamins and appropriate antibiotics at 37 °C, 5 % CO2 in humid atmosphere. Bacteria were selected based on antibiotic resistance and microscopic evaluation of colony opacity. For infection, overnight grown bacteria were taken from GC agar plates and suspended in PBS. For labeling, bacteria were resuspended in 1:1000 dilution of either AlexaFluor647-NHS (Invitrogen, Karlsruhe, Germany), 5-(6)-CFSE (Invitrogen, Karlsruhe, Germany) or PacificBlue (Sigma Aldrich, USA) in PBS. Bacterial suspensions were incubated at 37 °C for 30 min in the dark under constant shaking. Prior to use, bacteria were washed three times with PBS. Colony forming units (cfu) were estimated by A550 readings according to a standard curve.

 Cell culture, Transfection, Cell lysis, and Western blotting Human embryonic kidney 293T cells (293 cells) were cultured in Dulbecco’s modified

Eagle’s medium (DMEM) containing 10% CS at 37 °C in 5 % CO2 and subcultured every 2-3 days. 293 cells were transfected by calcium-phosphate co-precipitation using a total amount of 6 µg DNA in a 10 cm culture dish. HeLa cells were cultured in DMEM supplemented with 10% FCS at 37 °C, 5 % CO2 in humid atmosphere and subcultured every 2-3 days. HeLa cells were transfected with Lipofectamin2000 (Life Technologies, Darmstadt, Germany) according to the manufacturer’s protocol. Both cell lines were used 48 hours after transfection. Cell lysis and Western blotting were performed as described

Chapter I previously (Hauck et al., 2001). In some experiments cells were treated 15 min prior to infection with PP2 (10 µM) or LFM-A13 (100 µM).

 GST Pull-down assay and Far Western Probing of peptide spot membranes For GST pull-down assays, purified GST or GST-fusion proteins were attached to glutathione-Sepharose beads (SephadexTM G-25, Amersham Biosciences AB, Sweden). 200 µl of washed beads (50 % in 1x PBS) were mixed with 100 µg GST-protein and washed three times with 1x PBS after two hours at 4°C under constant rotation. 10 μg of purified GST or GST-fusion proteins attached to glutathione-Sepharose beads were added to 750 μl of cleared lysates from 293 cells transfected with CEACAM-encoding constructs or the empty vector. Where indicated, the cells were additionally co-transfected with a v- Src-encoding plasmid (0.5 μg) to ensure maximum tyrosine phosphorylation of CEACAM3. Samples were incubated over 2.5 hours at 4 °C under constant rotation. After two washes with ice-cold RIPA buffer, precipitates were boiled in 4 × SDS sample buffer before SDS gel electrophoresis and Western blot analysis. Generation and probing of peptide spot membranes was conducted as described previously (Buntru et al., 2011; Schmitter et al., 2007b) using 20 μg of GST-Tec-SH2 or GST alone.

 Gentamicin protection assays Gentamicin protection assays were conducted as described (Pils et al., 2012). Cells were seeded in gelatin-coated 24 well plates and infected for 30 min at a multiplicity of infection (MOI) of 20 bacteria per cell. Extracellular bacteria were killed by 45 min of incubation in DMEM medium with 50 mg/ml gentamicin and cell-binding bacteria were determined after 30 min of infection. Cells were lysed with 1 % saponin in PBS for 15 min. The samples were diluted with PBS and the number of viable bacteria was determined by plating suitable dilutions in duplicate on vitamin supplemented GC-agar base medium. Associated bacteria are determined in parallel without antibiotic treatment.

 Human granulocyte isolation, Phagocytosis and Oxidative burst Primary human granulocytes were isolated from freshly drawn citrate-buffered blood as described previously (Schmitter et al., 2004). In some experiments cells were treated 15 min prior to infection with PP2 (10 µM), LFM-A13 (100 µM), Wortmannin (100 nM) or DMSO as vehicle control. Phagocytosis was performed as described before (Buntru et al., 2011). Briefly, indicated kinase inhibitors were added and cells were infected with 5-(6) carboxyfluorescein-succinylester (CFSE) labeled bacteria at MOI 30 for 30 min. Trypan

Chapter I blue (2 mg/ml) was used before measurements to quench CFSE fluorescence of extracellular bacteria and to selectively detect the fluorescence derived from intracellular bacteria. Phagocytosed bacteria were quantified by flow cytometry (LSRII cytometer, BD Biosciences) and the percentage of CFSE-positive cells was multiplied by the mean fluorescence intensity of the sample to obtain an estimate of the total number of internalized bacteria (uptake index). For oxidative burst, granulocytes were suspended in chemiluminescence buffer (8 g/l NaCl, 0.2 g/l KCl, 0.62 g/l KH2PO4, 1.14 g/l Na2HPO4, 1 g/l glucose, 50 mg/l BSA, pH 7.2) containing luminol (20 μg/ml) and treated before infection with the indicated inhibitors. 2 x 105 cells were infected at MOI 50 or left uninfected and chemiluminescence was determined as described before (Buntru et al., 2011) with a Varioskan Flash spectrofluorometer (Thermo Scientific). To determine the total amount of reactive oxygen produced, the response curves were exported to GraphPad Prism and the areas under the curves over 90 min were calculated.

 Phosphorylation assays Isolated granulocytes were resuspended at a concentration of 1 × 106 cells/ml in Eppendorf tubes with a PBS containing 10 mM HEPES. Granulocytes were infected at MOI 20 at 37 °C under rotation. 1 x 106 transfected 293 cells seeded in 24 well plates were starved for 16 h with Dulbecco’s modified Eagle’s medium (DMEM) containing 0.5 % CS and infected at

MOI 50 at 37 °C in 5 % CO2. Granulocytes and 293 cells were pre-incubated with PP2 and LFM-A13 inhibitors for 15 min or 30 min respectively. After infection, the reactions were stopped on ice. Samples were centrifuged at 350 x g for 5 min at 4 °C; resuspended in 2x Laemmli sample buffer (SB) (62.5 mM Tris–HCl, pH 6.8, 4 % SDS, 5 % β- mercaptoethanol, 8.5 % glycerol, 2.5 mM orthovanadate, 10 mM p-nitrophenylphosphate, 10 μg/ml leupeptin, 10 μg/ml aprotinin, 0.025 % bromophenol blue) (Gilbert et al., 2002) supplemented with 2 mM PSMF, and boiled for 7 min. Lysates were used for the determination of protein phosphorylation levels by western blot analysis.

 Confocal laser scanning microscopy and FRET acceptor photobleaching For immuno-staining of intra/extra cellular bacteria, 4 x 104 293 transfected cells were seeded onto coated glass coverslips (4 µg/ml fibronectin, 10 µg/ml poly-L-Lysine in PBS) in 24 well plates. Prior to infection, bacteria were biotinylated and PacificBlue-labelled as described (Agerer et al., 2004). The cells were infected with labeled OpaCEA-expressing N. gonorrhoeae (Ngo OpaCEA) for 30 min. After infection, cells were fixed with 4 %

Chapter I paraformaldehyde and extracellular bacteria were selectively detected prior to cell permeabilization (0.2 % saponin in blocking buffer) with Cy5-streptavidin in blocking buffer (PBS, 5 % FCS). All samples were analyzed with a TCS Sp5 confocal laser scanning microscope (Leica, Wetzlar, Germany). Images were digitally processed with ImageJ and merged to yield pseudo-coloured pictures. For co-localization and FRET experiments, 4 x 104 HeLa cells were seeded onto coated glass coverslips (4 µg/ml fibronectin, 10 µg/ml poly-L-Lysine in PBS) in 24 well plates one day before transfection.

Transfected cells were infected with AlexaFluor647-labeled Ngo OpaCEA and fixed with 4 % PFA 30 min after infection. Following two washes, cells were embedded in mounting medium (Dako, Glostrup, Denmark). Fluorescence microscopy was performed with a TCS SP5 confocal laser scanning microscope (Leica, Wetzlar, Germany) using a 63 x, 1.4 NA PLAPO oil immersion objective lens. For acceptor photobleaching FRET experiments, the implemented FRET acceptor bleaching wizard of the Leica TCS SP5 was used. Prebleach and postbleach images were serially recorded with excitation of EGFP at 488 nm and mKate at 561 nm and appropriate emission bands. Low laser intensities were used to avoid acquisition bleaching. The acceptor mKate was bleached with high laser intensity at 561 nm. Cells expressing donor constructs only were used to exclude donor bleaching under these conditions. A pixel-by-pixel analysis of FRET by acceptor photobleaching was performed using the FRETcalc plugin for ImageJ (Stepensky, 2007). To calculate FRET efficiency, donor prebleach and postbleach images were smoothed by median filtering and background subtracted. An intensity threshold and a bleaching threshold were applied to filter off all pixels with less than 80 % acceptor bleaching. Apparent FRET efficiency was calculated as:

 Scanning electron microscopy 2 x 105 isolated human granulocytes were seeded onto glass coverslips coated with 10 mg/ml poly-L-lysine in 24 well plates. After 15 min of infection (MOI 30), samples were fixed as described before (Muenzner et al., 2005). Samples were dehydrated in a graded series of ethanol, critical point dried with liquid CO2 and sputter-coated with 10 nm gold/palladium and 5-12 nm platinum (BAL-TEC SCD 030 Critical Pint Dryer). The samples were analyzed with a Auriga-Crossbeam Workstation (Carl Zeiss AG, Jena, Germany) scanning electron microscope at 5 kV accelerating voltage and a WD of 5 mm. The used magnifications were x19 k and more detailed images x50 k.

Chapter I

3.4 Results

 The Tec SH2 domain binds to phosphorylated CEACAM3 Three distinct PTKs of the Tec family, namely Bmx (bone marrow kinase on the X chromosome; or also named Etk), Btk (Brutons’s tyrosine kinase), and Tec are expressed in myeloid cells (Schmidt et al., 2004). To investigate if Tec kinases are able to interact with phosphorylated CEACAM3, we generated recombinant GST-fusion proteins comprising the SH2 domains of Bmx, Btk, or Tec, respectively. Using lysates of 293 cells co-expressing v-Src and CEACAM3 -promoting constitutive phosphorylation of the Hem- ITAM of CEACAM3 (McCaw et al., 2003; Schmitter et al., 2007b)-, GST pull-down experiments were conducted. Interestingly, only the Tec kinase could specifically bind to the activated receptor via the SH2 domain, while Btk and Bmx kinases showed no CEACAM3-interaction (Figure 3.1A). In order to confirm the specificity of the SH2 domain-binding to the phosphorylated CEACAM3 additional pull-down analyses of GST- Tec-SH2, GST-Src-SH2 or GST alone were also performed. Similar to the known interaction of the Src kinase SH2 domain, the SH2 domain of Tec was able to associate with CEACAM3, while GST alone was not sufficient to precipitate CEACAM3 (Figure 3.1B). This interaction was shown to be dependent on the cytoplasmic domain of CEACAM3, since a CEACAM3-mutant lacking the cytoplasmic domain (CEACAM3 ΔCT) did not associate with either GST-Src-SH2 or GST-Tec-SH2 (Figure 3.1A-B). However, GST-pull down assays do not exclude the possibility that the observed association is indirect due to an interaction of the SH2-domain with another CEACAM3- bound cellular protein. Therefore, we performed binding assays with synthetic peptides and recombinant proteins. Accordingly, a peptide spot membrane containing synthetic phosphorylated or non-phosphorylated peptides encompassing 15 amino acids surrounding the tyrosine residues of the ITAM-like sequence of CEACAM3 was generated. This

membrane was probed with either the purified GST-Tec-SH2-domain or GST alone.

Chapter I

Figure 3.1 Tec kinase binds to the proximal tyrosine phosphorylated residue (pY230) within the ITAM-like sequence of CEACAM3. (A) 293 cells were transfected either with an empty vector (pcDNA) or HA-tagged CEACAM3 constructs (wildtype -WT or lacking cytoplasmic domain -ΔCT) in the presence or not of a constituted phosphorylated Src kinase (v-Src). Lysates were used in pull-down assays with the indicated GST fusion proteins encoding Tec, Btk or Bmx SH2-domains. CEACAM detection was conducted with a monoclonal anti-HA antibody (top panel). Equal amounts of the GST fusion protein used in the pull-

Chapter I down assay were verified by coomassie staining of the membrane (bottom panel). (B) 293 cells were co- transfected with or without a constituted phosphorylated Src kinase together with HA-tagged CEACAM3- WT or CEACAM3-ΔCT. Lysates were subjected to pull-down assays with GST-Tec-SH2, GST-Src-SH2 or GST alone. GST fusion proteins were visualized by coomassie staining of the membrane (bottom panel). CEACAM3 variants co-precipitating with GST-Tec-SH2 were detected by anti-HA antibody (middle panel) and kinase activity were analyzed regarding their phosphorylation status (top panel). Whole cell lysates (WCLs) were verified for equal expression of CEACAM3 constructs by anti-HA antibody (WCL, right top panel) and activation by anti-pY antibody (WCL, right bottom panel). (C) Peptide spot membrane harbouring synthetic 15-mer peptides surrounding the indicated tyrosine residues of the CEACAM3 cytoplasmic domain (as indicated). Tyrosine residues either unphosphorylated (Y) or phosphorylated (pY) were probed with GST-Tec-SH2 or only GST as a control. Bound GST fusion proteins were detected with monoclonal anti- GST antibody.

Importantly, GST-Tec-SH2 associated selectively with the peptide comprising the phosphorylated tyrosine 230 (pY230) of CEACAM3, but not the non-phosphorylated peptide verifying a direct and specific protein-protein interaction (Figure 3.1C). GST alone was not detected binding to any of the peptides (Figure 3.1C). These results confirm the interaction of the phosphorylated Hem-ITAM of CEACAM3 with the SH2 domain of the non-receptor PTK Tec, suggesting that this enzyme could have a functional role in CEACAM3-initiated signaling.

 Tec associates specifically with CEACAM3 at sites of bacterial contact in intact cells To analyze if the in vitro binding of recombinant GST-Tec-SH2 to phosphorylated CEACAM3 also translates to an interaction in the cellular context, we co-transfected HeLa cells with CEACAM3-mKate and full-length Tec-EGFP. The transfected cells were infected with Pacific Blue-labeled OpaCEA-expressing N. gonorrrhoeae and fixed 30 min after infection. Confocal fluorescence images show the clustering of CEACAM3 around the cell-associated bacteria and the recruitment of Tec to the clustered receptor (Figure 3.2A). Co-localization of the two fluorescent labels refers to the presence of the two interaction partners within one pixel, which due to the diffraction limit has a spatial accuracy of about 250 nm. Hence, co-localization does not necessarily confirm a direct binding of Tec to CEACAM3. Instead, an indirect association of Tec with the cytoplasmic domain of CEACAM3 in a signaling complex through multiple adapter proteins could be possible. Therefore, we applied Förster resonance energy transfer (FRET) microscopy to resolve the spatial interaction more precisely, as the distance over which FRET can occur is limited to less than 10 nm, which is in the range of direct protein-protein interactions. We previously showed that FRET allows the analysis of protein-protein interactions at the

Chapter I

CEACAM3 cytoplasmic domain in intact cells (Buntru et al., 2009; Kopp et al., 2012). Accordingly, we used acceptor photobleaching to assess the efficiency of energy transfer between CEACAM3-mKate and Tec-EGFP (Figure 3.2B). In this technique, the FRET acceptor (mKate) is photochemically destroyed with a short high-intensity laser pulse, which should result, in the case of prior FRET between the two fluorophores, in an increase of the donor (EGFP) fluorescence. Therefore, mKate was bleached in the region surrounding CEACAM3-bound bacteria (highlighted by the circle) and donor fluorescence was monitored before (prebleach) and after (postbleach) the laser pulse (Figure 3.2B). Indeed, upon comparison of prebleaching and postbleaching images, a clear increase of donor intensity could be observed, where bacteria were in close contact with the host cell (Figure 3.2B). FRET efficiency was calculated pixel-by-pixel and the average FRET efficiency of all pixels in the bleached area was 7.3 %. When including only positive FRET values between 0 % and 50 % in the calculation, the thresholded apparent FRET efficiency was 10.3 %. The FRET efficiencies can vary from cell to cell and even within one cell at different host-contact sites. Amongst others, the apparent FRET efficiency depends on the stoichiometry of the interaction partners. Moreover, the confocal images of fixed samples represent a snapshot of the infection process with different stages of phagocytosis being captured, during which a temporal change of the signaling complex composition and protein stoichiometry seems likely. As positive control, we measured the FRET efficiency between CEACAM3-mKate and Hck-EGFP (Suppl. Figure 3.1A), as this Src family PTK is a known interaction partner of CEACAM3 (Buntru et al., 2009). In the case of Hck, the average FRET efficiency was 4.6 %, when all pixels of the bleached spot were included in the analysis. When including only positive FRET values between 0 % and 50 % in the calculation, the thresholded FRET efficiency increased to 13.4 %. These FRET efficiencies are comparable to the ones obtained for the CEACAM3-mKate - Tec-EGFP interaction. As a further control, we co- transfected HeLa cells with CEACAM3-mKate and EGFP alone (Figure 3.2C and D). In this case, EGFP was not recruited to the clustered receptor and the donor intensity was not increased after acceptor photobleaching, confirming that EGFP does not interact with bacteria-engaged CEACAM3. Finally, correct expression of EGFP and the various fusion proteins (Tec-EGFP, Hck-EGFP, or CEACAM3-mKate) was demonstrated by western blotting (Suppl. Figure 3.1B).

Chapter I

Figure 3.2 A direct interaction between CEACAM3 and Tec occurs in intact cells. (A-D) HeLa cells were co-transfected with expression plasmids encoding for CEACAM3-mKate and Tec-EGFP (A, B) or CEACAM3-mKate and EGFP (C, D). Cells were infected with AlexaFluor647-labeled OpaCEA-expressing N. gonorrhoeae (Ngo OpaCEA) at a MOI of 50 and fixed 30 min after infection. Confocal images show the recruitment of full length Tec-EGFP to bacteria-bound CEACAM3 represented with arrows in (A), whereas no recruitment of EGFP to the clustered CEACAM3 receptor is observed in (C). Acceptor photobleaching was performed at sites of receptor-binding by bacteria (boxed areas). (B, D) The enlargements of the boxed

Chapter I region show intensity images recorded in the donor (Tec-GFP or GFP) and acceptor (CEACAM3-mKate) channel before and after photobleaching of the acceptor (left panels). From these areas, apparent FRET was calculated and presented in pseudo-color on the right hand side (FRET efficency range from 0 % - 40 %) (right panels). Note the FRET signal at the side of CEACAM3-Tec interaction in (B), and the absence of FRET in the CEACAM3 and GFP expressing cells (D). FRET was calculated as described under ‘Material and Methods’. Images of the bleached area are presented in pseudo-color for better visualization. Scale bar 10 μm.

Together, these results do not only verify the specific and direct association of Tec and CEACAM3 upon infection with N. gonorrhoeae in intact cells, but also precisely localize this protein-protein interaction to the site of receptor engagement by the pathogenic bacteria.

 Tec activation is mediated by CEACAM3-Hem-ITAM signaling As Tec interacted with CEACAM3, we wanted to elucidate if Tec kinase has a functional role in CEACAM3-mediated signal transduction. To first investigate the kinetics of Tec activation, 293 cells were co-transfected with plasmids encoding CEACAM3-HA and Tec and then infected with OpaCEA-expressing N.gonorrhoeae (Ngo OpaCEA; able to engage CEACAM3) or a non Opa-expressing N.gonorrhoeae (Ngo Opa-; unable to bind CEACAM3). The Opa phenotype of the used bacterial populations was confirmed by western blotting with a monoclonal anti-Opa antibody (Figure 3.3A). After different time points, whole cell lysates were prepared and analyzed by western blotting (Figure 3.3A and B). As a confirmation of receptor engagement by the bacteria, an increased tyrosine phosphorylation of CEACAM3 (~34 kDa protein size) was observed upon infection with Ngo OpaCEA, which was maximal after 30 min (Figure 3.3A). As expected, no increased phosphorylation of CEACAM3 occurred upon infection with Ngo Opa-, which are not able to engage CEACAM3 (Figure 3.3A). CEACAM3 expression in the transfected cells was confirmed by blotting with anti-HA antibodies and equal loading of the lysates was verified by probing with anti-tubulin antibodies (Figure 3.3A; lower panel). Within the same time course a marked increase in the phosphorylation of Src and

Tec upon infection with CEACAM-binding gonococci (Ngo OpaCEA) was observed (Figure 3.3B). Tec family kinases require tyrosine phosphorylation in the kinase domain activation loop as a pre-requisite for full activation, which can be monitored by phospho- specific antibodies directed against pY519 (Bradshaw, 2010). Indeed, Tec kinase showed a pronounced increase in tyrosine phosphorylation in the Tec kinase domain activation loop

Chapter I

(pY519) upon infection with Ngo OpaCEA, but not Ngo Opa-, implying a substantial activation of this enzyme in response to CEACAM3 engagement (Figure 3.3B).

Figure 3.3 Inhibition of Tec kinase reduces CEACAM3-mediated phagocytosis. (A) Opa expression of gonococci strains used for infection was confirmed by western blotting. Transfected 293 cells with

Chapter I

CEACAM3-HA and full length Tec were infected with OpaCEA or non Opa-expressing N. gonorrhoeae (Ngo OpaCEA or Ngo Opa-) for the indicated time points. Whole cell lysates (WCL) were probed against phosphotyrosine resides (pY), HA-tag and tubulin. (B) Lysates from (A) were probed against active phospho-Src (pSrc -Y418) and inactive c-Src (upper panels) or against active phospho-Tec (pTec-Y519) and inactive (lower panels). (C) 293 cells were transfected with a pcDNA empty vector or co-transfected with CEACAM3-Cerulean and Tec-HA. For protein expression of transfected cells, whole cell lysates were probed against Tec, GFP (for CEACAM3-Cerulean detection) or tubulin as antibody as loading control. (D) Transfected cells were incubated or not with 100 µM LFM-A13 for 15 min before infection with OpaCEA- expresing gonococci. Cells were employed for total bacterial adhesion. (E) The number of viable intracellular bacteria was determined by gentamicin protection assays of transfected cells. After gentamicin treatment, internalized bacteria were recovered and counted. Bars represent mean values ± S.E.M of three independent experiments done in triplicate. Statistical significance was determined using a paired two-tailed Student's t- test (* p<0.05; ** p<0.01, *** p<0,001). (F) CEACAM3 co-transfected 293 cells with Tec were treated or with inhibitors of the Src (10 µM PP2) or Tec (100 µM LFMA-13) for 15 min before infection (Ngo Opa- or OpaCEA) as indicated. Western blot analyses were performed for Tec, phospho-Tec (pY519), CEACAM3 (HA) and Vinculin as loading control.

 Tec activity contributes to bacterial internalization by CEACAM3 To examine the functional role of Tec in CEACAM3-initiated processes, CEACAM3- Cerulean was expressed in 293 cells with or without Tec-HA. Furthermore, 293 cells were transfected with the empty control vector (pcDNA) as a negative control. Expression of transfected CEACAM3-Cerulean was verified by western blotting with anti-GFP antibody (Figure 3.3C). Also, overexpression of Tec was determined by anti-Tec antibody, which detected low levels of endogenous Tec in control transfected 293 cells (Figure 3.3C).

Transfected cells were then employed in infection assays with OpaCEA-expressing N. gonorrhoeae to examine CEACAM3-dependent cell binding and bacterial uptake. Importantly, neither overexpression of Tec nor inhibition of Tec kinase activity by the pharmacological inhibitor LFM-A13 (Mahajan et al., 1999; Uckun et al., 2003) altered the overall cell-binding of Ngo OpaCEA to the cells (Figure 3.3D). However, Tec overexpression clearly resulted in a gain of function with increased internalization of Ngo

OpaCEA by CEACAM3-expressing 293 cells (Figure 3.3E). When Tec kinase activity was inhibited by LFM-A13, a strong (~50 %) reduction in bacterial uptake was observed in CEACAM3-transfected 293 cells co-expressing Tec (Figure 3.3E). Interestingly, LFM- A13 also reduced bacterial internalization in 293 cells, which were not overexpressing Tec, indicating that the low endogenous amounts of Tec in 293 cells might also contribute to CEACAM3-mediated bacterial internalization (Figure 3.3E). As both Src and Tec PTKs were activated within 5 - 45 min after bacterial infection, we wondered, whether both protein kinases work in parallel or if one kinase depends on the other enzyme for its activity. Thus, 293 cells were co-transfected either with plasmids encoding CEACAM3- HA or CEACAM3-HA lacking the cytoplasmic tail (CEACAM3 ΔCT) together with Tec.

Chapter I

Cells were treated or not an inhibitor of Tec (LFM-A13) or a Src PTK inhibitor (PP2) and infected with Ngo OpaCEA or Ngo Opa- for 30 min. Whole cell lysates were employed in western blots against the phosphorylated Tec kinase (pY519) or against total Tec levels (Figure 3.3F). Furthermore, expression of CEACAM3 or CEACAM3 ΔCT was monitored and blotting against vinculin served as a loading control (Figure 3.3F). Interestingly, phosphorylation of the Tec kinase domain activation loop was completely inhibited by PP2 and to a lesser extent by LFM-A13, supporting the idea that Src PTKs are upstream of Tec kinase activity and Tec kinase autophosphorylation might also contribute to full Tec activity (Figure 3.3F). Clearly, activation of Tec required CEACAM3 engagement by

OpaCEA-expressing bacteria (Ngo OpaCEA) and depended on the integrity of the CEACAM3 cytoplasmic domain (Figure 3.3F). Together, these data suggest that in CEACAM3-transfected 293 cells Tec is activated in response to receptor engagement by bacteria and depends on prior Src activity.

 Tec kinase activity is downstream of CEACAM3-triggered Src PTK activation in human granulocytes To investigate if a similar signaling cascade operates in primary granulocytes; we isolated and purified polymorphonuclear cells from peripheral human blood. Following incubation with non-opaque or OpaCEA-expressing gonococci (Ngo Opa- or Ngo OpaCEA) tyrosine phosphorylation of cellular proteins occuring within 5 to 30 min of infection was monitored by western blotting. As expected, the professional phagocytes showed a rapid increase in tyrosine phosphorylation of multiple proteins with a maximum occuring at ~15 min after infection with Ngo OpaCEA (Figure 3.4A). Within the same time frame, Ngo Opa- did not trigger a change in tyrosine phosphorylation compared to uninfected cells

(Figure 3.4A). As observed in transfected 293 cells, infection with Ngo OpaCEA also induced a rapid activation of Src and Tec PTKs (Figure 3.4B). When primary granulocytes were infected for 15 min in the presence of PP2 or LFM-A13, respectively, Src activation was blocked by PP2, but not by the Tec kinase inhibitor LFM-A13 (Figure 3.4C). In line with the results obtained in transfected 293 cells, both PP2 and LFM-A13 treatment affected Tec kinase domain phosphorylation in primary granulocytes (Figure 3.4C). These findings corroborate the view that CEACAM3 engagement by bacteria triggers rapid Src kinase activity, which is required to promote the activation of Tec.

Chapter I

Figure 3.4 Src family kinases act upstream of Tec during CEACAM3-Hem-ITAM signaling. (A) Isolated granulocytes from human peripheral blood were infected in three different time points of infection with OpaCEA-expressing or non-Opa-expressing N. gonorrhoeae (Ngo OpaCEA or Ngo Opa-, respectively). Whole cell lysates (WCL) were probed against a phosphor-tyrosine antibody as well as Vinculin as loading control. (B) Same lysates used in (A) were probed to a set of phospho-antibodies against phosphorylated Tec and Src. Membrane was sequentially analyzed by general antibodies as indicated. (C) Human isolated granulocytes were also pre-treated for 15 min prior to infection with Src (10 µM PP2) or Tec (100 µM LFMA-13), and WCL were probed as it was described in (B).

 Tec kinase is involved in CEACAM-initiated production of ROS Via CEACAM3-initiated signaling, gonococci trigger the production of reactive oxygen species (ROS) by granulocytes (Buntru et al., 2011; Sarantis and Gray-Owen, 2007). To investigate if Tec kinase has a major role in modulating the oxidative burst in response to Neisseria gonorrhoeae, ROS production of primary human granulocytes was measured. As shown before, OpaCEA protein expressing N. gonorrhoeae (Ngo OpaCEA) induce a prominent oxidative burst within 5 to 30 min (Figure 3.5A). In contrast, non-opaque bacteria, which do not engage CEACAM3, do not trigger ROS formation in the absence of opsonizing agents, confirming that the observed release of reactive oxygen species in response to Ngo OpaCEA is CEACAM-dependent (Figure 3.5A). Previously, phosphatidylinositol-3’ kinases (PI3Ks) have been shown to be essential for CEACAM3- initiated reactive oxygen formation (Buntru et al., 2011), as evidenced by the complete abrogation of ROS production in the presence of the PI3K inhibitor wortmannin (Figure

Chapter I

3.5A). In a similar manner, the Src PTK inhibitor PP2 almost completely disrupted the oxidative burst and also Tec kinase inhibition impaired the production of reactive oxygen species (Figure 3.5A). Compared to solvent treated cells (DMSO), the Tec inhibitor LFM- A13 reduced the oxidative response during the first hour of infection by 50 %, whereas PP2 as well as wortmannin had a stronger impact (Figure 3.5B). Together, these data indicate that Tec contributes to maximal bactericidal responses in primary human granulocytes in response to CEACAM3 stimulation.

Figure 3.5 Tec activity contributes to granulocyte oxidative burst upon gonococcal infection. Primary human granulocytes were infected at MOI 50 with OpaCEA or non-Opa expressing gonococci (Ngo OpaCEA or Ngo Opa-), left uninfected or pre-treated with indicated inhibitors (100 nM Wortmannin; 10 µM PP2; 100 µM LFM-A13) as well with DMSO as solvent control. Reactive oxygen species (ROS) production was measured by luminol-dependent chemiluminescence. (A) The graph shows counts of absorbance units. (a.u.) from measurements every 2 min over 100 min. Counts are mean values from one representative experiment (of three independent experiments) done in triplicate. (B) Total oxidative burst was calculated by the area under the curves and values were normalized to the untreated sample infected with Ngo OpaCEA. Statistical significance was determined by using a paired two-tailed Student's t-test (** p<0.01, *** p<0,001). Bars represent mean values ± S.E.M, n=3.

 Tec kinase inhibition impairs CEACAM3-initiated signaling to the cytoskeleton

Tec inhibition in CEACAM3-expressing 293 cells impaired phagocytosis of OpaCEA- protein expressing gonococci. In order to confirm the role of Tec in opsonin-independent phagocytosis of primary cells, human granulocytes from peripheral blood were treated or not with the Tec specific inhibitor LFM-A13 or the Src inhibitor PP2, respectively.

Granulocytes were next infected for 15 min with fluorescein-labeled OpaCEA protein- expressing (Ngo OpaCEA) or non-opaque (Ngo Opa-) N. gonorrhoeae. Infected granulocytes were then analyzed for cell-associated fluorescein fluorescence in the presence of trypan blue, which quenches fluorescence derived from extracellular bacteria.

Chapter I

Therefore, the remaining fluorescence intensity is a measure of the amount of internalized bacteria. Importantly, Ngo Opa- are not recognized and phagocytosed under these conditions, whereas OpaCEA protein expressing gonococci were rapidly internalized by the primary cells within 15 min (Figure 3.6A). Pre-treatment of granulocytes with solvent

(DMSO) did not impair opsonin-independent phagocytosis of Ngo OpaCEA, whereas both inhibition of Src as well as inhibition of Tec PTKs resulted in a significant decrease in bacterial uptake (Figure 3.6A). To further illuminate the process of phagocytosis in untreated versus inhibitor treated granulocytes, we performed scanning electron microscopy on infected samples. Importantly, untreated and DMSO-treated granulocytes elaborated extensive, micrometer-sized lamellipodial protrusions at the sites of bacterial contact upon CEACAM3 engagement (Figure 3.6B). These prominent membrane protrusions have been observed before and result from a massive induction of f-actin based cytoskeletal structures (Pils et al., 2012; Schmitter et al., 2004). In line with the central role of Src family PTKs in CEACAM3-mediated phagocytosis, lamellipodia were completely absent in PP2-treated granulocytes, while bacteria still associated with the cell surface (Figure 3.6B). Strikingly, inhibition of Tec kinase by LFM-A13 still allowed minor cell protrusions in the form of ~500 nm filopodia (Figure 3.6B). However, lamellipodia formation was also completely suppressed upon Tec inhibition suggesting that Tec kinase activity is critical to allow progression of initial filopodial structures into the massive lamellipodial protrusions observed in untreated cells (Figure 3.6B). These results indicated that Tec kinase contributes to the regulation of actin cytoskeletal rearrangements, which occur upon CEACAM3 clustering downstream of Src PTK activation. A key factor responsible for f-actin formation in response to CEACAM3 engagement is the small GTPase Rac, which in turn is stimulated by the guanine nucleotide exchange factor (GEF) Vav (Buntru et al., 2012; Schmitter et al., 2007a). Previous studies have indicated a functional interaction of the Tec family kinase member Btk with Vav during Dectin1- mediated phagocytosis of Candida albicans (Strijbis et al., 2013). Therefore, we monitored

Vav tyrosine phosphorylation in primary human granulocytes upon infection with OpaCEA protein expressing N. gonorrhoeae. Indeed, Vav was rapidly phosphorylated at Y174 within 5-15 min upon infection (Figure 3.6C).

Chapter I

Figure 3.6 Inhibition of Tec kinase impairs CEACAM3-innitiated lamelipodial formation and Vav activation in human granulocytes. (A) Isolated granulocytes were treated with Src (10 µM PP2), Tec (100 µM LFMA-13) or DMSO as solvent for 15 min prior to infection with CFSE-labelled OpaCEA-expressing gonococci. After 30 min of infection, internalized bacteria were determined by flow cytometry analysis and CFSE fluorescence from extracellular gonococci was quenched by addition of trypan blue to a final concentration of 0.2mg/ml. Bars represent mean values ± S.E.M of at least three independent experiments. Statistical significance was determined using a paired, two-tailed Student's t-test (** p<0.01, *** p<0.001). (B) Primary human cells were isolated and pre-treated with indicated inhibitors as well as with the vehicle - DMSO (10 µM PP2 and 100 µM LFM-A13). After inhibition-treatment granulocytes were infected for 15 min with OpaCEA-expressing N. gonorrhoeae. Upon fixation, samples were processed for scanning electron microscopy (SEM). SEM images show human granulocytes in the process of opsonin-independent phagocytosis of multiple gonococci via large lamellipodial protrusions (boxed area). The boxed area (x19 k) is enlarged in the right panel and at higher magnification (x50 k) a detailed image of the phagocyte surface and lamepodial protrusion are indicated with arrows at the site of infection. (C) Human granulocytes were infected with non-Opa or OpaCEA-expressing N. gonorrhoeae. Whole cell lysates (WCL) of human granulocytes infected at different times as indicated were probed against active phospho-Vav (pVav -pY174) or regular Vav. Infected human granulocytes were treated or not with Src or Tec inhibitors (10 µM PP2 and 100 µM LFMA-13, respectively). Lysates were used in western blotting as indicated.

Chapter I

More importantly, inhibition of both Src PTKs as well as Tec kinases completely abrogated Vav tyrosine phosphorylation (Figure 3.6C) suggesting that Tec contributes to maximal CEACAM3-mediated phagocytosis by controlling the tyrosine phosphorylation of Vav. Thereby, Tec has a prominent role downstream of Src PTKs in regulating the massive cytoskeletal rearrangements necessary for the efficient opsonin-independent phagocytosis and elimination of CEACAM3-binding bacteria by human granulocytes.

3.5 Discussion

Among myeloid Tec family kinases, Btk and Tec are well known PTKs in regulation calcium signaling following B-cell receptor activation (Fluckiger et al., 1998). Mutations of Btk can cause X-linked agammaglobulinemia (XLA) in humans (Satterthwaite et al., 1998) or X-linked immunodeficiency (xid) in mice (Rawlings et al., 1993; Thomas et al., 1993), resulting in defective responses to antigen receptor signaling which lead to altered development and defects in functional responses, including cellular proliferation, expression of activation markers, cytokine and antibody production as well as responses to infectious disease (Lewis et al., 2001; Satterthwaite and Witte, 2000). Previous in vivo studies with Tec kinase-deficient mice revealed that the absence of Tec kinase causes no major phenotypic alteration of the immune system. However, Tec/Btk double-deficient mice could show that both Tec kinases are functionally redundant and essential for B cell function and development (Ellmeier et al., 2000). On the other hand, Tec kinases are also involved in T-cell-receptor (TCR) signaling in response to antigen recognition and appear to be required for full phosphorylation and activation of PLC-γ, important for production and Calcium mobilization due to its enzymatic activity to generate IP3 and diacylglycerol (DAG) (Lewis et al., 2001; Rhee, 2001; Scharenberg and Kinet, 1998). Particularly, Tec kinase has been shown to be activated besides BCR (Kitanaka et al., 1998) by TCR/CD28- mediated signals (Yang et al., 1999). In addition Tec family kinases also contribute to regulation of actin cytoskeletal rearrangements in response to antigen receptor and other signaling pathways. Further contributions of the Tec kinases to actin cytoskeleton regulation have been suggested from interactions with WASP (Baba et al., 1999; Guinamard et al., 1998; Sakuma et al., 2015) and Vav (Kline et al., 2001; Strijbis et al., 2013; Takahashi-Tezuka et al., 1997). Former studies have been reported the interaction between Tec kinase and the GEF Vav via the TH domain (Machide et al., 1995) or the SH2 domain of Tec (Takahashi-Tezuka et al., 1997).

Chapter I

Though Tec family kinases are known to be critical signaling components in lymphocytes downstream of the T- or B-cell receptor, their role in myeloid cells is less clear. Monocyte cells from XLA patients showed a defective CR3-, CR1-, and Fc-mediated phagocytosis and chemotaxis, where superoxide anion production was not affected by the deficiency of Btk (Amoras et al., 2003). Due to conflicting roles for Tec family kinases in regulation of TLR-dependent signaling in myeloid cells, a recent study has compared the phosphoproteome regulated by Tec kinases upon LPS stimulation in primary peritoneal and bone marrow-derived macrophages. The study is consistent with a model where Tec kinases (Btk, Tec, Bmx) are required for TLR-dependent signaling and distinctly regulated in many types of myeloid cells (Tampella et al., 2015). However, in granulocytes other functions such as chemotaxis, adhesion, production of reactive oxygen species, degranulation, inflammatory response as well as calcium mobilization have been shown to be dependent on Tec family kinase activity (Fernandes et al., 2005; Gilbert et al., 2003; Lachance et al., 2002; Mangla et al., 2004). Peculiarly, Tec kinase has also been shown to be activated in other hematopoietic cells by cytokine receptors for IL-3 (Mano et al., 1995; Takahashi-Tezuka et al., 1997; Yamashita et al., 1998), IL-6 (Takahashi-Tezuka et al., 1997), stem cell factor (Tang et al., 1994), thrombopoietin (Yamashita et al., 1997), and GM-CSF (Yamashita et al., 1998). Albeit Tec family kinases are implicated in many signaling processes, their role in microbial infection remains elusive. From Tec kinases expressed in myeloid cells, BTK has been reported to be involved in TLR4-mediated activation of nuclear factor κB (NFκB) after LPS stimulation (Jefferies et al., 2003), in Listeria monocytogenes infection upon TLR2 activation (Koprulu et al., 2013) as well as in Dectin-1-mediated phagocytosis of Candida albicans (Strijbis et al., 2013). Moreover, Btk and Tec are involved in FcγR- mediated phagocytosis of IgG-RBC (Jongstra-Bilen et al., 2008). Recently, Tec kinase has been also reported to play a role in the immune response by macrophages upon fungal but not so far by bacterial pathogens (Zwolanek et al., 2014). Zowolanek and colleagues showed that Tec is responsible for the inflammatory response against Candida albicans infection regulated via Dectin-1. Interestingly, the Tec-dependent activation of the caspase- 8 inflammasome is phagocytosis-independent, indicating as well that Tec (opposite to Btk) might interact with Dectin-1 not by its phagocytic but in a sensing mode (Gringhuis et al., 2012).

Chapter I

Tec kinases have versatile roles reflected by their protein-protein and lipid-protein interaction modular structures (Qiu and Kung, 2000). They encompass four distinctive structural modules which recognize and bind to a variety of cellular factors to form signal complexes: 1) Pleckstrin homology (PH) domain located at the N-terminus (except for RIk). 2) Tec homology (TH) domain consisting of a Btk homology (BH) motif and of one or two Proline-rich (PR) regions. 3) Single Src homology (SH) domains SH2 and SH3. 4) Tyrosine kinase catalytic domain(SH1) (Smith et al., 2001). Tec family kinases have been shown similarities and differences with regard to activation in comparison to others non- receptor PTKs. Tec kinases resemble those of the Src-family in regard to their submolecular make up; both are all auto-inhibited and regulated by extrinsic factors but their phosphorylation show different types of activation. Src kinases possess a graded switches pattern; they first have to be dephosphorylated on the C-terminal tail followed by the phosphorylation of the kinase domain. In addition, different signals like SH2 and SH3 ligand binding also contribute to gradually increase kinase activity for full activation. On the other hand, Tec family tyrosine kinases need in parallel two stimuli to get fully activated: phosphorylation of the kinase domain (in the activation loop) as well as the proper localization and binding to a linker between the SH2 and the kinase domains (phosphorylation switch “AND-graded”) (Bradshaw, 2010). Thus, multiple domains help to localize the kinase and regulate its activity. Unlike the Src kinases, the displacement of the surrounding domains is not sufficient to activate the Tec kinase, while an isolated Src kinase domain displays high activity, a solitary Tec kinase domain will be almost inactive (Bradshaw, 2010). In this regard, it can be assumed that upon SH2 binding, phosphorylation of the activation loop of the Tec kinase (Tyr 519) may occur more easily and the SH2-Kinase linker may get relocated to allow interaction with the kinase domain to establish activation. In particular, Tec kinases activation requires membrane localization, which for most Tec kinases is regulated by the interaction of the PH domain with PIP3, and subsequent tyrosine-phosphorylation by Src PTKs (Takesono et al., 2002). CEACAM3 represents an efficient phagocytic receptor, which allows the recognition and elimination of CEACAM-binding bacteria by human granulocytes. Therefore, the intracellular signaling connections of this protein are of particular interest to explain the rapid action of CEACAM3. The direct association of CEACAM3 with the SH2 domain of the regulatory subunit of PI3K activates the kinase at the plasma membrane and also leads to a strong increase of PIP3 levels in the vicinity of CEACAM3-associated bacteria, observed by the specific recruitment of fluorescently labeled PH domains (Booth et al.,

Chapter I

2003). However, inhibition of the class I PI3K by wortmannin treatment (concentrations up to 200 nM) does not interfere with phagocytosis of CEACAM-binding bacteria by CEACAM3-transfected cell lines or by primary human neutrophils (Buntru et al., 2011).

Thus, the PI3K-independent uptake of OpaCEA-expressing N. gonorrhoeae suggest a membrane recruitment of Tec kinase independently of PH binding to PIP3 as product of class I PI3K, whereas a direct binding of Tec to CEACAM3 facilitates the close proximity to the phosphorylated receptor for interaction of protein domains and further kinase phosphorylation by Src PTKs which fully activate the Tec kinase. Therefore, upon bacterial infection, we propose that Tec kinase is targeted to the membrane via its SH2 domain in a tyrosine phosphorylation dependent, but PIP3-independent manner to the CEACAM3-Hem-ITAM. However, future studies are required to test the role of PI3K in the CEACAM3-initiated activation of Tec observed upon N. gonorrhoeae infection. Circulating leukocytes are known to respond at the site of infection by developing a polarized morphology with the formation of a lamellipodium at the leading edge and auropod at the trailing edge. After infection, the rapid nucleation and actin polymerization of granulocytes are essential in lamellipodium formation for an efficient phagocytosis (Eddy et al., 2002). In this investigation, we find that a direct association of the Hem- ITAM of CEACAM3 with the cytoplasmic protein tyrosine kinase Tec contributes to CEACAM3-initiated functional responses of granulocytes. In particular, the Tec SH2 domain binds to pY230 of CEACAM3-Hem-ITAM and this kinase is activated within 5 min of CEACAM3 ligation. Tec kinase activity is responsible for maximal tyrosine phosphorylation of the GEF Vav, and contributes to bacterial internalisation and induction of an oxidative burst by the phagocytes. These observations provide direct evidence that Tec kinase is involved in CEACAM3-initiated actin cytoskeleton-based subcellular structures downstream Src PTKs activation. Taking into account that CEACAM3 signaling differs from canonical ITAM signaling, the Hem-ITAM-like sequence of CEACAM3 short-wires bacterial recognition and Rac stimulation via a direct association with the GEF Vav to promote actin reorganization, rapid phagocytosis and elimination of CEACAM-binding human bacterial pathogens (Hauck et al., 1998; Pils et al., 2012; Schmitter et al., 2007a). Previous studies have reported that association of Btk with Vav contributes to Dectin1-depedent Candida phagocytosis (Strijbis et al., 2013), as well as immunoprecipitation experiments have been demonstrated a specific binding of Vav to Tec kinase (Kline et al., 2001; Machide et al.,

Chapter I

1995; Takahashi-Tezuka et al., 1997). Moreover, tyrosine phosphorylated Vav has been found constitutively associated with Tec (Yamashita et al., 1997) as well as Tec has been shown to enhance the GEF activity of Vav1 by an increase in GTP-bound Rac1 (Kline et al., 2001). Vav family members are GEFs that facilitate the exchange of GDP for GTP to activate members of the Rho GTPase family, such as Rac, which are involved in actin cytoskeleton reorganization (Bustelo, 2001; Crespo et al., 1997). In line with this, our results revealed a reduced tyrosine phosphorylation of Vav in the presence of Src and Tec PTKs inhibitors (PP2 and LFM-A13, respectively). Thus, it is likely that Tec participates in the active reorganization of the actin cytoskeleton for bacterial uptake by activating the GEF Vav as upstream regulator of the GTPase Rac. Furthermore, the specific granulocyte phenotype observed in the presence of the Tec inhibitor LFM-A13 could be explained by affecting phosphorylation of Vav and, therefore, impairing Rac activation for downstream cytoskeleton rearrangements. Remarkably, Tec kinases are known also to act on phospholipase C (PLC)-γ, thereby affecting downstream events such as DAG production and Protein kinase C (PKC) family activation for enabling proper closure of the phagocytic cup (Scott et al., 2005; Strijbis et al., 2013). In consequence, we assume that these signal molecules could also be involved downstream of Tec activation during CEACAM3 Hem- ITAM signaling, however, further studies are required to analyse Tec-dependant signaling pathways (Suppl. Figure 3.2). CEACAM3 coordinates signaling events that not only mediate bacterial uptake, but also initiate the bactericidal response by human granulocytes. GTPases are critical activators of several granulocyte functions such as actin cytoskeleton rearrangements, phagocytosis and the generation of reactive oxygen derivatives by activation of the NADPH oxidase (Diekmann et al., 1994; Dinauer, 2003; Schmitter et al., 2007a). Our data demonstrate that Tec kinase also influences the regulation of the oxidative metabolism in granulocytes. In this study, after Tec kinase is regulated in a protein-protein interaction directly with CEACAM3, the recognition and bacterial uptake is initiated by the stimulation of the small GTPase Rac (possibly mediated by Tec kinase), critical for further effector functions of human granulocytes such as actin cytoskeleton rearrangements, phagocytosis as well as the generation of reactive oxygen species by the NADPH oxidase (Bokoch and Diebold, 2002; Cox et al., 1997; Hauck et al., 1998). The rapid generation of ROS by granulocytes in response to CEACAM-binding bacteria depends on the activity of PI3K that is recruited to clustered CEACAM3 (pY230) via its SH2 domain (Buntru et al., 2011). Since PI3K activity regulates the neutrophil NADPH oxidase complex at several stages by 3´-

Chapter I phosphorylated phosphatidylinositides (Bokoch and Diebold, 2002; Hawkins et al., 2007), it is also known that the products of PI3Ks work particularly in cooperation with GTP- loaded Rac to assemble a functional NADPH oxidase complex at the phagosomal membrane (Buntru et al., 2011) (Suppl. Figure 3.2). Our results reveal an unforeseen functional contribution of Tec kinase to the opsonin- independent phagocytosis of bacteria by the granulocyte receptor CEACAM3. However, the capacity of the cytoplasmic tyrosine kinase Tec to regulate downstream proteins (which may contribute dependent or independently to the activation of Vav and PLC) in human granulocytes still to be solved. In addition, deciphering the coordination of the Tec-binding to the Hem-ITAM of CEACAM3 will require further studies to resolve the temporal patterns of kinase recruitment within a sequential and spatial distribution. Due to the lack of a transgenic animal model with specific expression of CEACAM3, experimentation in vitro with Tec knock out granulocyte-like cells will help to clarify the role of this kinase in the context of a signaling network driven by the innate immune receptor CEACAM3.

Chapter I

3.6 Supplemental figures

Suppl. Figure 3.1 Direct interaction of Hck-SH2 domain with CEACAM3 is confirmed by FRET. (A) HeLa cells were co-transfected with expression plasmids encoding for CEACAM3-mKate and Hck-EGFP. Cells were infected with AF647-labeled OpaCEA-expressing N. gonorrhoeae at a MOI of 50 and fixed 30 min after infection. Confocal images show the recruitment of full length Hck to CEACAM3 at bacterial site represented with arrows. Enlarged images of the boxed region were recorded before and after photobleaching the mKate acceptor in a defined spot area. FRET was calculated as described under ‘Material and Methods’ (FRET efficency range from 0 % - 40 %). Images of the bleached area are presented in pseudo-color for better visualization. Scale bar 10 μm. (B) 293 cells were co-transfected with mKate- tagged CEACAM3 together with the indicated EGF- tagged constructs. Whole cell lysates (WCL) were analyzed by western blotting to verify expression of constructs used for FRET analysis (EGFP, Hck-EGFP, and Tec-EGFP as well as expression of CEACAM3-mKate).

Chapter I

Suppl. Figure 3.2 The role of the non-receptor protein tyrosine kinase Tec in CEACAM3 Hem-ITAM signaling. Upon receptor clustering by CEACAM-binding bacteria engagement (e.g. OpaCEA protein expressing Neisseria gonorrhoeae) CEACAM3 is tyrosine phosphorylated by the Src family kinases. Tec is recruited at the membrane and localized to the site of the activated receptor by binding of its SH2-domain to the pY230 of the CEACAM3-Hem-ITAM. The subsequent binding conformation facilitates the phosphorylation of Tec kinase by Src PTKs to complete activation. Fully activated Tec phosphorylates the Rac-GEF Vav leading to a dynamic membrane and cytoskeleton remodeling meditated by Vav, which activates the small GTPase Rac. Subsequently, one of the SH3 domains of the adaptor molecule Nck constitutively binds Nap1 facilitating the activation of the WAVE complex by the GTP-loaded Rac. Together, they orchestrate the f-actin reorganization and final lamelipodia formation during CEACAM3- innitated phagocytosis. The SH2-domain of the p55 subunit of PI3K is also recruited directly to the pY230 of CEACAM3, whereas Syk might indirectly interact with CEACAM3. After bacterial uptake, downstream oxidative burst requires PI3K, Syk and GTP-Rac to regulate the assembly and activation of the NADPH oxidase complex for bacterial killing by human granulocytes. Furthermore, Tec kinase could possibly activate PLCγ, leading to DAG production and PKC activation which might also contribute to bacteria internalization.

Chapter I

3.7 Acknowledgments

We thank T.F. Meyer (MPI for Infection Biology, Berlin, Germany) for the Neisseria strains used in this study, W. Zimmermann (Ludwig-Maximilians-Universität, München, Germany) for providing CEACAM cDNA, R. Frank (Leibniz-Institut für Molekulare Pharmakologie, Berlin, Germany) for synthesis of peptide spot membranes, S. Feindler- Boeckh and C. Hentschel for expert technical assistance, and J. Braun (Universität Konstanz, Germany) for support with electron microscopy and image analysis. This study was supported by funds from the Deutsche Forschungsgemeinschaft (DFG) to CRH. JDT acknowledges the support by the International Office - Universität Konstanz.

Chapter II

4 Chapter II

Generation of a humanized mouse model for in vivo analysis of CEACAM3

Julia Delgado Tascón1,2, Lisa Hörmann1, Boris V. Skryabin3, and Christof R. Hauck1,2

1 Lehrstuhl für Zellbiologie, Universität Konstanz, 78457 Konstanz, Germany 2 Graduate School Biological Sciences; Universität Konstanz, 78457 Konstanz, Germany 3 Institute of Experimental Pathology, Center of Molecular Biology of Inflammation (ZMBE), Westfälische Wilhelms-Universität Münster, 48149 Münster, Germany

In preparation

Chapter II

4.1 Abstract

CEACAM3 is a peculiar member of the human CEACAM family exclusively expressed on neutrophils, and a well-known phagocytic receptor of human-restricted pathogens including Neisseria gonorrhoeae. This innate immune receptor exhibits a phosphotyrosine- based (Hem-ITAM) signaling which promotes phagocytosis and killing of a diverse group of CEACAM-binding bacteria. So far, the study of the granulocyte CEACAM3 has been mainly by ex vivo / in vitro experiments due to the lack of a suitable in vivo standard model such as the mouse. To help in clarifying the in vivo role of this innate immune receptor in controlling infection by human-restricted bacteria and shed light on the CEACAM3 signaling, a humanized transgenic mouse was generated to express exclusively CEACAM3. The CEACAM3 construct was cloned into a sleeping beauty transponson vector for an efficient genome insertion. The transgenesis model consist of a mKate fusion protein of CEACAM3 together with an intact 4 Kb long promoter region from a human bacterial artificial chromosome of the CEACAM3 gene. After microinjection of fertilized oocytes, mice were analyzed by southern blot. One out of two founder animals could survive and be bred. Unexpectedly, Genotyping indicated germ line transmission of the human transgene but with a frequency of transmission lower than 0.5. Transgenic mouse neutrophils were characterized and CEACAM3 expression was tested by flow cytometry and western blotting. However, CEACAM3 was strikingly undetected in mouse neutrophils. The lack of association with gonococci in functional assays and a failure to detect CEACAM3 mRNA by RT-PCR in samples from transgenic animals supported the idea, that the CEACAM3 transgene was silenced in these animals. For future studies of CEACAM3 and its contribution to the infection process in vivo, novel transgenesis techniques need to be applied.

4.2 Introduction

Carcinoembryonic antigen-related cell adhesion molecule 3 (CEACAM3), also known as CGM1 (CEA family member 1) or CD66d (Cluster of Differentiation 66d), is a human protein coding gene organized into the proximal CEA gene cluster of 250 Kb, relative to the centromere on the long arm (q) of chromosome 19 in the region 19q13.2 (orientation plus strand) (Brandriff et al., 1992; Nagel et al., 1993; Thompson et al., 1992).

Chapter II

Granulocytes play a critical role in the innate immune response against invading microorganisms. Recognition of bacteria by granulocytes can be mediated through binding of Fc receptor or complement receptor 1 (CR1) which target specific opsonins (immunoglobulins or complement system proteins, respectively) and coat the bacteria for ingestion. However, the interaction between some human-adapted pathogens and neutrophils is also opsonin independent and facilitated by bacterial surface adhesins which specifically bind to the carcinoembryonic antigen-related cell adhesion molecule (CEACAM) family to colonize and infect different tissues in the human body (Barnich et al., 2007; Chen and Gotschlich, 1996; Chen et al., 1997; Gray-Owen et al., 1997b; Hill et al., 2001; Hill and Virji, 2003; Tchoupa et al., 2014; Virji et al., 1996). CEACAM-binding bacteria are known to bind four members of the CEACAM family (CEACAM1, CEACAM3, CEACAM5, CEACAM6) where three of them (excluding CEACAM5) are expressed on human granulocytes (Bos et al., 1998; Chen et al., 1997; Gray-Owen et al., 1997a; Kuespert et al., 2006). However, CEACAM3 is restrictedly expressed on neutrophils and acts as a decoy receptor of the innate immune system to capture human- restricted bacteria and initiate a potent bactericidal response (Buntru et al., 2012; McCaw et al., 2003; Pils et al., 2008; Sarantis and Gray-Owen, 2011; Schmitter et al., 2004). One of the difficulties of investigating CEACAM-mediated interactions has been the lack of naturally occurring human homologues in mammalian animals such as the mouse. Studies of CEACAM3 as a phagocytic receptor exclusively expressed on human neutrophils have traditionally been limited to ex vivo / in vitro analyses. Experimental work has demonstrated the contribution of this receptor to the innate immune response against human restricted bacteria like Neisseria gonorrhoeae, Haemophilus influenzae, and Moraxella catarrhalis (Hauck et al., 1997; Pils et al., 2012; Sarantis and Gray-Owen, 2011; Schmitter et al., 2004; Schmitter et al., 2007a). During the last decades the signaling of CEACAM3 has been well described. Recently, CEACAM3 was proposed to harbor a functional hem-ITAM instead of a canonical ITAM-like sequence. The phosphorylation of only one of the tyrosine residues (the membrane proximal Tyr230) within the Hem-ITAM is sufficient to provide a short wire for activation of several signaling factors to orchestrate a fast opsonin-independent phagocytosis and additionally to drive the bacterial clearance of human-restricted bacteria by human neutrophils (Buntru et al., 2012). Neutrophil granulocytes are the most abundant cell type of white blood cells (WBC) in mammals and form an essential part of the innate immune system. They can be easily obtained from peripheral blood. However, due to their short half-life ex vivo (being

Chapter II inherently pre-programmed to die by apoptosis) it is difficult to study neutrophils’ function by applying current techniques for genetic modification (McCracken and Allen, 2014). In this regard, immune response signaling pathways and effector functions of neutrophils have been preferentially study in genetically modified mice as a suitable in vivo model. Neisseria species are important Gram-negative bacterial pathogens from which Neisseria gonorrhoeae exclusively colonize human mucosal surfaces. CEACAM homologues can be found in all vertebrates (Chang et al., 2013; Kammerer et al., 2007) but only human CEACAMs are able to bind Neisseria gonorrhoeae in a Opa-dependent manner (Sarantis and Gray-Owen, 2007). Opa-CEACAM binding receptors (CEACAM3, CEACAM5, CEACAM6) have no identified murine orthologues and even though CEACAM1 is also expressed on mouse neutrophils, mouse CEACAM1 does not bind to Neisseria gonorrhoeae (Voges et al., 2010; Zebhauser et al., 2005). Different CEACAM transgenic mouse lines have already been used as in vivo models for studying the immune response to gonococci infection including the CEABAC mice expressing CEACAM3, CEACAM6 and CEACAM7 (Chan and Stanners, 2004; Gu et al., 2010). Albeit CEABAC mice expressed CEACAM3, the co-expression of other CEACAMs on granulocytes makes it almost impossible to determine the contribution of individual CEACAMs during the infection. To investigate specific neutrophil functions and provide a clear-cut system for CEACAM3- mediated signaling in response to bacterial infection, we aimed to generate a humanized mouse expressing CEACAM3 on neutrophils. In addition, we wanted to combine CEACAM3 with a fluorescent mKate-tag to easily visualize CEACAM3 protein expression, subcellular localization and internalization during phagocytosis. The transgene included a 4 kb promoter region from the human CEACAM3 gene and should be integrated into the mouse genome via the Sleeping Beauty (SB) transposon system. The SB is an active vertebrate element (from transposons found in fish genomes) able to transpose in species other than the host from which it was isolated (Izsvak and Ivics, 2004). The SB had shown significantly higher activity in mammalian cells (mouse and humans) than any other transposon tested before (Aronovich et al., 2011). SB is a binary system consisting of a transposase and a DNA transposon vector in which the desired stretch of DNA is flanked by long terminal inverted repeats in a direct orientation (inverted repeat/direct repeat IR/DRs) that are recognized by the transposase, which is supposed to mediate an efficient genome insertion. (Fischer et al., 2001; Ivics et al., 2014; Izsvak et al., 2000). In this study we have successfully generated a transgenic mouse line harboring the CEACAM3 gene. However, intensive characterization of transgenic mouse neutrophils indicated that

Chapter II

CEACAM3 is not expressed. Despite repeated efforts, only a single founder animal encoding the transgene could be obtained and this transgenic line lacked expression of the transgene cassette. Our results point to potential deleterious effects of CEACAM3 cDNA expression in mice. The generated transgenic mice did not allow us to investigate the CEACAM3-mediated neutrophil response to infection; however, these results point to more suitable transgenesis strategies for future in vivo studies of this phagocyte receptor.

4.3 Material and Methods

 Reagents and Antibodies Monoclonal antibodies (mAbs); D14HD11 (suitable for western blot, reactivity profile with CEACAM1,3,5,6) was purchased from GENOVAC (Freiburg, Germany), COL-1 (CD66-10) against CEA (specific cross-reactivity with CEACAM3) was from Invitrogen (Thermo Fisher Scientific) and CD66b (80H3) against CEACAM8 was from Immunotech (Beckman Coulter company). Rat mAb antibody against mouse GR-1(RB6-8C5) was from ImmunoTools (Friesoythe, Germany). MAb antibody against Vinculin (hVIN-1) was from Sigma-Aldrich (St. Louis, Missouri, USA). A rabbit polyclonal antibody, generated against formaldehyde-fixed N. gonorrhoeae and N. meningitidis (IG-511) was from Immunoglobe (Himmelstadt, Germany). MAbs against CEACAM 1,3,5 (18/20) and IgG1/IgG2 isotype (96/1) were purified from hybridoma cell supernatants obtained from DSHB (University of Iowa, IA). A rabbit polyclonal antibody against recombinant mKate was custom generated and affinity purified (Animal Research Facility, University of Konstanz, Germany). Conjugated monoclonal antibody against mouse Ly-6G/C (Gr-1-FITC) was kindly provided by Marcus Groettrup (Department of Immunology, University of Konstanz, Germany). Secondary antibodies were obtained from Jackson Immunoresearch (West Grove, PA).

 Cloning into the transposon sleeping beauty system The Sleeping Beauty (SB) transposon vector pT2/BH was used to clone CEACAM3- mKate tagged under a considered promoter region of 4 kb upstream of the CEACAM3 coding sequence. The primer sequences used for cloning procedures are summarized in Table 4.1. The human CEACAM3 promoter sequence was amplified from human genomic DNA contained in the bacterial artificial chromosome (BAC) pBACe3.6 clone RP11- 343B1 (Osoegawa et al., 2001) obtained from the BACPAC Resource Center (Children's

Chapter II

Hospital Oakland Research Institute, Oakland, CA). Using pBAC e3.6 clone RP11-343B1 as a template, the CEACAM3 promoter region including a 5’-located NotI site was amplified with primers CC3 Promoter sense and CC3 Promoter anti NotI containing NotI restriction sites. The promoter sequence was cloned into the NotI site of the Sleeping Beauty (SB) transposon vector pT2/BH kindly provided by Jürgen Brosius (Center of Molecular Biology of Inflammation -ZMBE, University of Münster, Germany). The mammalian expression plasmid encoding CEACAM3-HA described before (Schmitter et al., 2004) was used to amplify the human CEACAM3-HA cDNA with primers CC3-HA NotI sense and CC3-HA EcoRI Reverse. Subsequently, the PCR product was inserted into the NotI/EcoRI sites of pT2/BH vector encoding the CEACAM3 Promoter region. Finally, mKate cDNA (kindly provided by D. Chudakov, Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry, Moscow, Russia) was amplified using the primers mKate-polyA EcoRI sense and CEACAM4-polyA-HindIII- anti. The PCR fragment was inserted into the EcoRI/HindIII sites of pT2/BH vector encoding the CEACAM3 Promoter and CEACAM3-HA-mKate. All constructs were verified by sequencing after each cloning step.

 Pronuclear microinjection of fertilized oocytes For production of oocytes, 8-12 weeks old FVB/NHsd female mice (Harlan Laboratories) were superovulated by injecting each donor mouse with 7.5 pregnant mares serum gonadotropin -PMSG (0.1 ml intraperitoneal), and 42 hours later 7.5 Human chorionic gonadotropin -HCG (0.1 ml intraperitoneal). Next day fertilized oocytes were collected after presence of the copulation plug. All female donors mice were euthanized by CO2 exposure, their oviducts were collected in 2 ml M2 media (Specialty Media, Phillipsburg, NJ) in a 35 mm culture dish. Each oviduct was moved to a new dish containing M2 media and 0.3 mg/ml of the hyaluronidase. The ampullas of oviduct were open and oocytes released. Oocytes were washed 3 times in M2 media and transferred into a 150 µl drop of KSOM mouse embryo culture medium under embryo-tested mineral oil and kept at 37 °C,

5 % CO2. For DNA microinjection, the purified pT2/BH-CEACAM3 construct was diluted to 4 ng/µl in TE buffer, and co-injected with a hyperactive transposase SB100x into both pronuclei of FVB/NHsd oocytes with the help of a Femtojet microinjector (Eppendorf) using the Diaphot 300 microscope (Nikon) and Narishige micromanipulators (Center of Molecular Biology of Inflammation -ZMBE, University of Münster, Germany), following a standard

Chapter II protocol (Hogan et al., 1994). For one-cell stage embryo, manipulated oocytes which survived the microinjention were transferred surgically into the oviducts of 0.5 dpc (day post coitus) pseudopregnant foster female mice. Founder animals were backcrossed for at least 5 generations to BALB/c (Jackson laboratory). CEACAM3 transgenic strain was maintained by mating heterozygous transgenic mice (Tg/0) with wild-type (0/0) mice, aged 8-12 weeks (Animal facility, University of Konstanz, Germany). All mouse procedures were performed in compliance with the guidelines for the welfare of experimental animals issued by the Federal Government of Germany. Mice were kept at 12 hours light/dark cycle, at 21 °C and 55 % humidity. Pups were weaned at 19 to 23 days after birth, and females were kept separately from males. Mice were housed in standard IVC cages (groups of 4-6 animals) with 24 hours access to food and water. General health checks were performed regularly in order to ensure that any findings were not the result of deteriorating physical conditions of the animals.

 DNA tail biopsy and Genotyping After DNA microinjection, genotyping of positive CEACAM3 transgenic mice was performed with mouse-tail DNA. Briefly, tails from 3-4 weeks old mice (5 mm) were lysed overnight at 56 °C in Laird’s buffer (200 mM NaCl, 100 mM Tris-HCl pH 8.3, 5 mM EDTA, 0.2 % SDS) supplemented with proteinase K (100 µg/ml). Next day samples were extracted three times with water saturated phenol pH 7,5 and one time with chlorophorm. The aqueous phase was transferred in new tube and DNA was precipitated with 300 l of isopropanol at RT. The DNA pellet was recovered by centrifugation, 14.000 rpm for 15 min at 20 C, washed with 80 % ethanol, dried and resuspended in 50 l of MilliQ water.

For southern blot analysis, 5 μg of genomic DNA was digested with EcoRI restriction endonuclease, fractionated on 0.8 % agarose gels, and transferred to GeneScreen nylon membranes (NEN DuPont). as described by (Khanam et al., 2007). After EcoRI digestion, DNA fragments of 2 Kb, 1.3 Kb and 3.2 Kb were expected. Membranes were hybridized with a 32P-labeled probe containing the transgene DNA fragments (6.5 kb) from the pT2/BH-CEACAM3. The labeled probe containing all transgenic sequences was washed twice with 0.5 × SSPE, 0.5 % SDS at 65 °C and exposed to MS film (Kodak) at −80 °C overnight.

Chapter II

PCR analysis was performed by using 2 µl of genomic tail DNA into a final 20 µl reaction and a homemade Phusion 7x polymerase (Hauck laboratory, University of Konstanz, Germany). The primer sequences used for mice genotyping are summarized in Table 4.1. The amplification parameters were initiated at 98 °C for 3 min, then 98 °C for 10 s, 62 °C for 30 s, and 72 °C for 60 s for a total of 27 cycles, followed by 5 min at 72 °C for the final extension.

 Bacteria The non-piliated MS11 strains expressing a CEACAM-binding Opa protein (strain N309-

Opa52, Ngo OpaCEA), or non-CEACAM-binding (strain N302-Opa negative, Ngo Opa-) bacteria (Kupsch et al., 1993b) were kindly provided by Thomas Meyer (Max-Planck- Institute für Infektionsbiologie, Berlin, Germany) and cultured as previously described (Schmitter et al. 2004). Briefly, Neisseria strains were grown on GC agar plates (Difco

BRL, Paisley, UK) supplemented with vitamins at 37 °C and 5 % CO2. For infection assays overnight grown bacteria were taken from GC agar plates and suspended in Plant

Preservative Medium (PPM) with a final OD550 of 0.1. After 4 hours of inoculation the colony forming units (cfu) were estimated by OD550 was according to a standard growth curve.

 Neutrophil isolation Primary human granulocytes were isolated from freshly drawn blood as previously described (Schmitter et al., 2004). Isolation of mouse neutrophils was carried out from freshly drawn eye-drop blood or bone marrow. For isolation of white blood cells out from mouse peripheral blood, whole blood (5-7 drops taken out of the eye with a capillary) was placed directly in an EDTA microvette (Microvette 500 K3 EDTA, Sarstedt). 50 µl of blood was added to 450 µl ammonium chloride buffer (0.8 % NH4Cl in A. bidest + 0.1 mM EDTA buffered with KHCO3 pH 7.4) and incubated for 10 min with gentle shaking. Samples were centrifuged at 2000 rpm for 5 min at 4 °C and the supernatant was removed. The pellet was taken up in 100 µl of ammonium chloride buffer and incubated for 10 min with gentle shaking. After incubation, 1 ml of FACS buffer (2 mM EDTA, 5 % h.i CS in PBS, pH 7.4) was added to the solution and centrifuged at 2000 rpm for 5 min at 4 °C. Cells were washed once with FACS buffer and taken up in phagocyte buffer (0.9 mM CaCl2, 0.5 mM MgCl2, 5 mM Glucose, 1 % h.i FCS in PBS pH 7.4).

Chapter II

For bone marrow neutrophil isolation, 10-15 weeks old mice were anesthetized with Isofluran (Actavis) and killed by head-neck dislocation. Femur and tibia from both of hind legs were removed together with soft tissue attachments. Clean bones were placed in a Ca/Mg-free HBSS to avoid drying. The extreme distal tip of each extremity was cut off and bones were flushed with HBSS by using a short (1") 25 G needle and a 10 ml syringe. After dispersing cell clumps, the suspension was centrifuged at 1450 rpm for 5 min and resuspended in 6 ml of 0.2 % NaCl. After 45 s, the osmolarity was restored with 14 ml 1.2 % NaCl. The suspension was poured into a 50 ml conical tube through a 70 micron cell strainer (Falcon #352350) to get rid of the clot and also of any bone remnants. The suspension was centrifuged again, resuspended in 5ml of HBSS supplemented with 0.5% h.i FCS. Cells were laid over 62 % Percoll (Sigma-Aldrich) diluted in HBSS (100% Percoll = nine parts of Percoll and one part 10x HBSSS) and centrifuged at 2300 rpm for 30 min without breaking. A sharp interface above the 62 % Percoll (immature cells and non-granulocytic lineages) and a cloudier pellet (neutrophils) were visible. Cells at the interface, the HBSS and the upper part of the 62 % Percoll were carefully removed and discarded. 2-3 ml of the 62 % gradient was left in the tube to avoid disturbing the neutrophil pellet. The remaining cells were resuspended in 5 ml of HBSS supplemented with 0.5 % h.i FCS and centrifuged at 1450 rpm. The pellet was washed once and cells were taken up in phagocyte buffer without Ca/Mg (5 mM Glucose, 1 % h.i FCS in PBS pH 7.4) and used within 6 hours. Cell density was determined using a Neubauer counting chamber and adjusted according to experiments. 1 x 105 isolated cells from peripheral blood or bone marrow were analyzed by cytospin centrifugation (Cellspin I-Tharmac, 3 min at 1000 x g) followed by Hemacolor staining according to the manufacturer’s instructions (Merck Millipore). Cells were visualized and counted by bright-field microscopy (1000x).

 CEACAM3 protein detection For immunofluorescence staining of CEACAM3, 1 x 106 mouse blood or bone marrow cells as well as primary human cells were resuspended in blocking solution (2 mM EDTA, 5 % heat inactivated goat serum, 1 % BSA in PBS pH 7,4) and incubated on ice for 30 min. Cells were centrifuged at 300 x g for 5 min and washed with FACS buffer (2 mM EDTA, 5 % h.i CS in PBS pH 7.4). Samples were incubated with respective antibodies for 40 min. Neutrophil staining was conducted with mouse monoclonal antibodies (mAbs) against CEACAM3 (18/20 for mouse and COL-1 for human neutrophils) and the IgG

Chapter II isotype control (96/1). In addition granulocyte markers where used in parallel (rat mAb against mouse Gr-1 and mouse mAb anti-human CEACAM8 -CD66b). All primary antibodies were used in a 1:100 dilution (in blocking solution). After 2 washes and 5 min of incubation in blocking solution, samples were stained with Cy2 anti-mouse or Rhodamine red anti-rat (1:200 dilution in blocking solution) for 20 min in the dark. Following 2 washes, samples were measured using the LSRII flow cytometer (BD Biosciences). 293 cells (human embryonic kidney 293T cells) cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10 % CS and kept at 37 °C in 5 % CO2 were co-transfected by calcium-phosphate in a 10 cm culture dish with pT2/BH encoding CEACAM3- promotor and CEACAM3-HA-mKate (5 µg) together or not with 3 µg of pcDNA3.1 encoding the transcription factor PU.1-VS-His kindly provided by Mario Tschan (Department of Clinical Research, University of Bern, Bern, Switzerland) or 3 µg of empty pcDNA3.1 or encoding or not CEACAM3-HA (Pils et al., 2012). 48 hours after transfection, cells were trypsinized, washed with FACS and fixed with 4 % of paraformaldehyde in PBS. Cells were resuspended in a modified blocking solution (45 nM CaCl2, 35 nM MgCl2, 10 % h.i CS in PBS pH 7,4) and immunofluorescence staining was performed at RT as described previously using monoclonal antibodies (mAb) against CEA (Col-1) or IgG isotype together with secondary Cy2-antibody as previously for neutrophil staining. For Whole cell lyses of granulocytes, 1 × 106 cells were pelleted in Eppendorf tubes and resuspended in 2x modified Laemmli sample buffer (SB) (62.5 mM Tris-HCl, pH 6.8, 4 % SDS, 5 % β-mercaptoethanol, 8.5 % glycerol, 2.5 mM orthovanadate, 10 mM p- nitrophenylphosphate, 10 μg/ml leupeptin, 10 μg/ml aprotinin, 0.025 % bromophenol blue) (Gilbert et al., 2002), and boiled for 7 min. Western blotting were performed as described previously (Hauck et al., 2001) CEACAM expression was tested by using a monoclonal D14HD11 antibody (cross-reactive with CEACAM3) or polyclonal mKate antibody. Whole cell lysates of transfected 293 cells with pcDNA3.1-CEACAM3-HA or pLPS3’mKate-CEACAM3 (Pils et al., 2012) and human promyelocytic leukemia (HL-60) cells were differentiated by all-trans retinoic acid (ATRA) into granulocyte-like cells as described before (Delgado Tascón et al., 2015).

Chapter II

 Granulocyte Phagocytosis and Oxidative burst Phagocytosis was determined by flow cytometry as described previously (Pils et al., 2006). Briefly, bacteria were stained with 5-(6) carboxyfluorescein-succinylester (CFSE) and primary cells were infected at MOI 30 for 30 or 60 min. CFSE fluorescence was measured using the LSRII flow cytometer (BD Biosciences) and internalized bacteria were quantified in the presence of 2 mg ml-1 trypan blue to quench fluorescence of extracellular bacteria. The percentage of CFSE-positive cells was multiplied by the mean fluorescence intensity of the sample to obtain an estimate of the total number of bacterial uptake. Oxidative burst measurements were done as described before (Buntru et al., 2011). Granulocytes were suspended in chemiluminescence buffer (8 g/l NaCl, 0.2 g/l KCl, 0.62 g/l KH2PO4, 1.14 g/l Na2HPO4, 1 g/l glucose, 50 mg/l BSA, pH 7.2) containing luminol (20 μg/ml). Cells were infected at MOI 50 or 100, and PMA (1 μg/ml) was used as a positive control. Chemiluminescence was determined from 2 x 105 cells per 96 well plate and measured every 2 min at 37 °C with a Varioskan Flash spectrofluorometer (Thermo Scientific). To determine the total amount of reactive oxygen produced, the response curves were exported to GraphPad Prism and the areas under the curves over 90 min were calculated.

 Immunofluorescence staining for confocal microscopy 5 x 105 human mouse granulocytes were seeded onto Poly-L-Lysine (10 µg/ml in PBS) or mouse-serum (5 % in PBS) coated glass coverslips within 24 well plates. Cells were left to settle for about 20 min at 37 °C. Liquid cultured bacteria were used for PacificBlue staining (20 min of shaking incubation at 37 °C in the dark). After staining, bacteria were washed 3 times with PBS (4 min at 4000 rpm). Cells were infected with MOI 30, centrifuged for 3 min at 300 x g and incubated for 30 min at 37 °C. After infection, cells were carefully washed and fixed with 4 % paraformaldehyde (20 min at RT in the dark) followed by 3 washes steps. Samples were incubated with blocking solution (2 mM EDTA, 5 % heat inactivated goat serum, 1 % BSA in PBS pH 7,4) for 5 min. Extracellular bacteria were stained with a polyclonal rabbit antibody against N. gonorrhoeae (IG-511) (1:50 dilution in blocking solution) at RT for 1 hour in the dark. After 3 washes, samples were keep in blocking solution for 5 min. Secondary staining was performed with a Cy5- antibody (1:200 dilution in blocking solution) for 45 min in the dark. After 3 washes and 5 min of incubation in blocking solution, cells were stained during 40 min with a conjugated anti-mouse Ly-6G/C (Gr-1)-FITC or (1:150 dilution in blocking solution) for mouse

Chapter II granulocyte staining. For human granulocyte staining, cells were incubated with a CD66b (80H3) monoclonal antibody (1:100 dilution in blocking solution) for 45 min followed by secondary Cy2-antibody staining (1:200 dilution in blocking solution). Samples were washed 3 times and mounted onto glass slides with fluorescent mounting medium (Dako; S302380). The slides were left to dry in the dark overnight and the next day cells were analyzed with a Leica confocal microscope (DMI6000, Software: LAS AF, Leica Microsystems)

 Detection of human CEACAM3 mRNA expression by RT-PCR Total RNA was extracted from isolated human or mouse granulocytes using the Qiagen RNeasy Mini kit (Qiagen, Hilden, Germany) and DNase digested according to the manufacturer's instructions (RNase-free DNase, Qiagen). Complementary DNA (cDNA) was synthesized from 2 μg of total RNA in a 20 μl reaction using the MMuLV reverse transcriptase and Oligo-dT primers. As a control for chromosomal DNA contamination, RNA was used directly for PCR amplification. The predesigned TaqMan® assay used for expression of human CEACAM3 as well as primers for human glyceraldehyde 3- phosphate dehydrogenase (hGAPDH) were described before (Delgado Tascón et al., 2015). Primer sequences for mouse glyceraldehyde 3-phosphate dehydrogenase (mGAPDH) are listed in Table 4.1. Amplicons were visualized in 2 % agarose gel.

Table 4.1. Primer list

Amplicon Primer Sequence

Promoter CEACAM3 CC3 Promoter sense NotI 5’-ATAGCGGCCGCAGGCCTTCAT (pT2/BH construct) ATGCCTCTCCTGC-3’ CC3 Promoter anti NotI 5’-ATAGCGGCCGCCTCTGCTGCC TGCTCTTTCCTCCTCTGTGGAAAAG AGC-3’ CEACAM3-HA CC3-HA NotI sense 5’-ATACATATAGCGGCCGCGCCA (pT2/BH TGGGGCCCCCCTCAGC-3’ construct/Genotyping) CC3-HA EcoRI Reverse 5’-ATACGGCGCGAATTCAGCAGC GTAATCTGGAACGT-3’ mKate mKate-polyA EcoRI sense 5’-GACAGGAATTCGTGTCTAAGGG (pT2/BH CGAAGAGCTGA-3’ construct/Genotyping) CEACAM4-polyA-HindIII- anti 5’-ATAAAGCTTAGCCCCAGCTGGT TCTTTCCGC-3’ Promotor CEACAM3 sense-primer 1 5’-ATTTCCTGGGAGTAACTGAGAA (Genotyping) (position 2800) TGAGGC-3

Chapter II

anti-primer 2 5’-ATTAGCACAGAAGCGATGTGTC (position 4400) TTTCTCAGG-3 GAPDH m GAPDH f 5’-TGATGACATCAAGAAGGTGGTG (Genotyping) AAG-3 m GAPDH r 5’-TCCTTGGAGGCCATGTAGGCC AT-3 GAPDH GAPDH_mouse_sense 5’-TGCACCACCAACTGCTTAG-3 (RT-PCR) GAPDH_mouse_anti 5’-GGATGCAGGGATGATGTTC-3 GAPDH_human_sense 5’-GAAGGTGAAGGTCGGAGTCA-3 GAPDH_human_anti 5’-TTGAGGTCAATGAAGGGGTC-3

4.4 Results

 Generation of Human CEACAM3 transgenic mice To create a humanize CEACAM3 mouse line, the human BAC library (Osoegawa et al., 2001) was used to obtain an intact promoter region of the CEACAM3 gene. We used a pBACe3.6 vector clone RP11-343B1 with an insert size of 173.19 Kb, containing part of the proximal human CEA gene cluster (cytogenetic band: 19q13.2; location: 19:41678001- 41851189). This BAC vector harbored complete genes of CEACAM5 (CEA), CEACAM6 and CEACAM3 genes (Figure 4.1A). Previously has been demonstrated an enhanced promoter activity of a 3 Kb fragment from the human CEACAM3 promoter region by using a luciferase reporter assay in response to the co-transfection of the PU.1 transcription factor (Delgado Tascón et al., 2015). Based on these observations, we considered a 4 Kb long sequence from the intergenic region between neighboring genes (CEACAM6 and CEACAM3) upstream of the CEACAM3 coding sequence, as promoter region (Figure 4.1B). This 4 Kb sequence contained primarily binding sites of transcription factors and regulatory elements for myeloid differentiation (granulopoiesis) and neutrophil development (Bjerregaard et al., 2003). Sequence analysis showed that this sequence contained specific transcription factors binding sites that play important roles in regulating gene expression. For instance, the GATA-binding factor 1, which regulates the development of hematopoietic progenitors and differentiation of specific types of blood cells; the purine-rich binding sequence (PU.1) important in differentiation of granulocyte/macrophage progenitors; Forkhead box (FOXF2) involved in cell growth

Chapter II regulation, proliferation and differentiation; Growth factor independence 1 (GFI-1) which is required for multilineage blood cell development, from stem and progenitor cells to differentiated lymphoid and myeloid cells (Figure 4.1C).

Figure 4.1 Predicted CEACAM3-promoter region. Using Geneious R8 software (2005-2015, Biomatters Ltd.) reference sequences of genomic-DNA were visualized. (A) Genomic view of the genomic sequence (19q13.2; 19:41,678,001-41,851,189) contained in the pBACe3.6 RP11-343B1 vector. Insert size: 173,189 Kb. This BAC clone encoded CEACAMs of the proximal human CEA gene cluster: CEACAM7 (partially) and complete genes of CEA (CEACAM5), CEACAM6 and CEACAM3 (green) -besides some neighboring genes. (B) Intergenic sequence between neighbor genes CEACAM6 and CEACAM3 (~24 Kb - Yellow). The sequence considered as promoter region consisted of 4 Kb long intergenic sequence upstream of the CEACAM3 transcriptional start site and ended before the start codon (Purple). Binding sites of regulatory elements were indicated as purple segments along the genomic sequence. (C) Close up of considered promoter region and binding sites of transcription factors.

Furthermore, binding sites for key regulators of hematopoiesis; among others such as NFkB, USF-1, SRF, YY1, CTCF, were predicted within the putative 4 Kb CEACAM3 promoter region. We then wondered whether the full promoter region considered in this

Chapter II study would also drive the expression of CEACAM3 in vitro. Therefore, 293 cells expressing the pT2/BH CEACAM3 construct were co-transfected with a pcDNA3.1 vector encoding the myeloid transcription factor PU.1 and the expression levels with or without transcription factor were compared. Staining of transfected cells and subsequently flow cytometry analysis showed a basal CEACAM3 expression, which was significantly increased (** p<0.001) in the presence of PU.1 (Figure 4.2A). However, in comparison to a constitutive mammalian promoter, such as cytomegalovirus -CMV, expression of CEACAM3 resulted much stronger (~103 fold) under CMV promoter than under our considered promoter region (Figure 4.2B).

 Sleeping Beauty-mediated CEACAM3 integration Since the Sleeping Beauty (SB) transposon system (Ivics et al., 1997; Ivics et al., 2004; Izsvak et al., 2000) has several advantages for transgenesis approaches such as enhanced transposition efficiency by using the novel hyperactive SB100X transposase (Jin et al., 2011; Mates et al., 2009), safe random genomic insertion profile can be performed with no preferential integration into transcription units (Ammar et al., 2012; Grabundzija et al., 2010; Ivics et al., 2014). Moreover, the SB transposon has no potential cross-mobilization between endogenous and exogenously introduced transposons due to the absence of SB- related sequences from mammalian genomes. Thus, the SB-transposon system was chosen to generate humanized CEACAM3 mice.

Figure 4.2 In vitro CEACAM3 promoter activity. (A) 293 cells were transfected with the transposon pT2/BH vector encoding the CEACAM3 construct together or not with a pcDNA3.1 encoding the myeloid transcription factor PU.1. For flow cytometry, transfected cells were stained with mAbs: COL-1 for

Chapter II

CEACAM3 expression or IgG isotype as control. (B) 293 cells were transfected with the empty vector pcDNA3.1 or encoding CEACAM3-HA. Staining of cells with mAb COL-1 was conducted for CEACAM3 expression. Flow cytometric measurements were calculated out of three independent experiments (A-B).

Figure 4.3 Sleeping Beauty transposon system. (A) Schematic representation of the CEACAM3 construct and the corresponding restriction sites. The DNA insert is flanked by the SB left (L) and right (R) inverted/direct repeats (IR/DR). (B) Vector map of the CEACAM3 construct cloned into the pT2/BH transposon vector backbone (9.4 Kb) (C) DNA construct was purified and linearized (HpaI restriction site) for microinjection (2 µg/ml).

The SB transposon pT2/BH vector harboring inverted/direct repeat (IR/DR) sequences was used to clone 4 Kb of the human CEACAM3-promotor together with the CEACAM3 coding sequence and a C-terminal mKate-fusion (Figure 4.3A-B). Purified and linearized vector (HpaI digest) (Figure 4.3C) was microinjected into pronuclei of fertilized FVB mouse oocytes together with the hyperactive (SB100x) transposase to mediate recognition of the transposon DNA and consequently, the integration (via TA dinucleotide base pairs) into the mouse genome. A total of 330 oocytes were microinjected in two independent experiments (106 oocytes/04.04.2013; 223 oocytes/27.06.2013) with 5 and 9 embryo- transfer operations, respectively. Through this procedure, 7 pups (first microinjection) and 21 mice (second microinjection) were born. In order to check for integration events of the

Chapter II human CEACAM3 in the germ line of the mice, southern blot analyses were performed. A 6.5 Kb DNA fragment (excised by SalI/SacI digestion) from the pT2/BH-CEACAM3 construct was employed as southern DNA probe (Figure 4.4A). DNA fragments of 2 Kb, 1.3 Kb and 3.2 Kb were expected to be detected after EcoRI digestion of genomic DNA. From the first microinjection, 2 out of 7 mice were CEACAM3 positive (male mouse Nr 4, female mouse Nr 6) (Figure 4.4B). The positive transgene mouse Nr 4 had two high molecular bands of around 13-15Kb, and it was later identified as partial (broken) transgene. On the other hand, the female mouse Nr 6 successfully showed a single integration site. From the second microinjection, surprisingly only 1 out of 21 was a positive transgenic mouse (male mouse Nr 9) (Figure 4.4C). Since, the mouse Nr.9 showed four DNA fragments (2, 3, 4.3 and ~ 6.5 kb) we assumed it has integrated two copies of the CEACAM3 transgene. Mouse breeding was performed with FVB/N founder animals (04.04.2013 / female Nr 6; 27.06.2013 / male Nr 9) for maintenance of the heterozygous transgene and backcrossing into the BALB/c genetic background (Figure 4.5A). Genotyping was performed by PCR with genomic DNA from 142 mouse-tail biopsies resulted in a germ line integration of the human CEACAM3 in about 39 % (Figure 4.5B). Hemizygous mice were identified with specific primers for CEACAM3, m-Kate and additionally for the considered promoter region (Table 4.1). The endogenous gene (GAPDH) was used as control of the extracted DNA (Figure 4.5C). Unexpectedly, the F1 generation did not display a normal transmission frequency (0.5) for heterozygotes but rather a transmission frequency of ~0.4. Surprisingly, during mating the female founder Nr 6 became sick and died, therefore, only the male founder Nr 9 could be bred to maintain the transgenic strain.

Chapter II

Figure 4.4 Southern blot analysis of founder animals. (A) The CEACAM3 construct (6.5 kb) was used to generate the labeled DNA-probe for southern blot analysis. After genomic DNA EcoRI digestion, DNA fragments were resolved by pulsed-field gel electrophoresis (PFGE). Southern blot analysis of DNA- extracted from tail biopsies were performed with 7 or 21 FVB/N born animals after the first (B) or second (C) microinjection (respectively). Wildtype (Wt) mice were used as a negative control. As indicated in (B), three bands were detected from the female mouse Nr 6: 6.5 Kb (undigested DNA fragment), 2 Kb (detecting CEACAM3) and a 4.3 Kb (5' end + 3' end) resulted from a concatemer of head-to-tail configuration, from the promoter region (5’ end) and the mkate-tag (3’ end). Male mouse Nr 4 showed two bands: 13 Kb and 15Kb bands from the head-to-tail configuration of double undigested DNA copies (13 Kb) and one additional partial integration of CEACAM3 with a 2Kb fragment (15 Kb). Southern blot analysis showed in (C) revealed only one positive transgenic animal. Mouse Nr 9 showed four bands: 2 Kb (detecting CEACAM3), 3 kb (detecting promoter region) and a 4.3 Kb (5' end + 3' end) due to the head-to-tail configuration of 2x DNA copies (by combining sizes of the expected bands); together with a 6.5 Kb band of undigested DNA construct.

Chapter II

Figure 4.5 Genotyping of CEACAM3 F1 generation. (A) Founder FVB/N mice were backcrossed to BALB/c genetic background by breeding FVB/N hemizygous (Tg / 0) with BALB/C wildtype (0 / 0) mice. (B) Using genomic DNA from tail biopsies, 132 animals were genotyped by PCR analysis revealing a ratio of 62:38 of wildtype to transgenic animals. (C) PCR products were detected on agarose gels showing amplicons for promoter (1600 bp), CEACAM3 (800 bp), mKate (1000 bp) and GAPDH (240 bp). Lanes (from left to right): DNA marker (M), founder transgenic mouse (Tg), wildtype mouse (Wt) and 9 F1 generation mice.

Chapter II

 Isolation of morphologically mature mouse-neutrophils After 5 generations of backcrossing BALB/c genetic background, transgenic mice as well as wildtype mice litter mates were used for further experiments. Mouse mature neutrophils were obtained from peripheral blood as well as from bone marrow, which is the major reservoir of functionally competent neutrophils (Boxio et al., 2004). To obtain a first insight on the hematology of the CEACAM3 transgenic mice, isolated leukocytes were counted and characterized by Hemacolor staining. Discrimination of morphological features was performed according to observations by light microscopy. WBC were isolated from peripheral blood taken out of the mouse eye using an erythrolysis-based preparation. Cells showed three types of cells where lymphocytes were slightly more abundant than granulocytes, followed by monocytes the WBC population. Transgenic and wildtype WBC showed the same tendency (Figure 4.6A).

Figure 4.6 Mouse neutrophil isolation from blood and bone marrow. Wildtype (Wt) or transgenic (Tg) leukocytes were isolated by an erythrolysis protocol from peripheral blood out of the mouse eye (A) or by centrifugation using a single-layer Percoll (62 %) from bone marrow (B). 1 x 105 of total isolated cells were used for cytospin preparations stained by Hemacolor. Myeloid precursor cells were identified as Myeloblast (Mb) Promyeloocyte (P), Myelocyte (Ml), Metamyelocyte (Mm), Band Neutrophil (BN) or Segmented Neutrophil (SN). Identification and counting of leukocyte cell types was conducted by bright-light

Chapter II microscopy (1000x). Cells were counted in 3 defined areas of 4 independently performed experiments. Mean ± SEM. Scale bar 20µm.

Since mouse blood is very limited (Serrander et al., 2000). Myelopoieitc cells were isolated from bone marrow by using a percoll density gradient (62 %). Segmented and band neutrophils were the most abundant cells, followed in lesser amount by other myeloid cells like Myelocyte, promyelocyte and myeloblast as well as other cell types (monocytes and lymphocytes) (Figure 4.6B). In line with the fact that leukocytes normally change their buoyant density during differentiation and mature cells display a higher density than their precursors (Cowland and Borregaard, 1999), mature neutrophils were better isolated than precursor cells. In both cytospin preparations mature neutrophils from transgenic and wildtype mice (peripheral blood and bone marrow) showed a similar size (diameter 10-12 µm) and a donut-shaped segmented nucleus typical for mouse neutrophils with a similar patter distribution of cells (Figure 4.6A-B). Peripheral blood is not an ideal source, as the volume that can be obtained from a single animal (normally less than 1 ml) is very low and in contrast to human blood, isolation of circulating PMNs only reaches 6-25 % (1- 1.5 x 106 cells/ml) in the mouse blood (Pruijt et al., 2002). In contrast, a much more convenient source of PMNs is bone marrow, which allowed us to extract 10-fold more neutrophils (1-5 x 107 cells/ml). According to these values and the morphologic features we successfully isolated mature granulocytes from peripheral blood as well as bone marrow.

 No protein expression of CEACAM3-mKate in generated transgenic mice In order to characterize the humanized mouse neutrophils we investigated whether these mice express a functionally CEACAM3 protein. Because protein expression pattern might change during development and maturation of neutrophils we decided to check for CEACAM3 expression in peripheral blood or bone marrow and compare it to the expression of human granulocytes (Figure 4.7). Taking into account that a mixed population of leukocytes is also obtained after erythrolysis of blood cells, we decided to use a Gr-1 antibody as granulocyte marker for cytometric measures. For CEACAM3 staining of mouse neutrophils we chose the mAb 18/20, a widely used antibody for flow cytometry. Because of the lack of other human CEACAMs in mouse neutrophils mAb18/20 recognizes specifically CEACAM3 (Figure 4.7A). To detect CEACAM3 in human neutrophils where other human CEACAMs are expresses, we used a

Chapter II monoclonal CD66 antibody (COL-1, CD66-10) with reactivity against CEA (CEACAM5) and CGM1 (CEACAM3) (Kuroki et al., 1995). Since CEACAM5 is not expressed in neutrophils, this antibody is employed as a specific antibody against CEACAM3 in human primary cells (Skubitz et al., 1996) (Figure 4.7B). Specificity of the staining was also controlled in each case by the use of an IgG isotype antibody (96/1). Stained neutrophils were gated via cell-size/granularity plots (forward and side scatter FCS / SSC, respectively) to distinguish a unique pattern of granulocytes from a heterogeneous population of WBC. In addition we ensure a pure population by measuring a positive fluorescence (right shift) from the mouse granulocyte marker (Gr-1-Rhodamine) as well as the human granulocyte marker (CD66b-Cy2). However, CEACAM3 expression could only be detected in human but not in mouse granulocytes. Considering that CEACAM3 was fluorescently mKate-tagged we also looked for mKate (far red) positive cells, however, no fluorescence could be detected (data not shown). Previous results were also confirmed by western blot analysis (Figure 4.8). Lysates of human CEACAM expressing cells (isolated human neutrophils, differentiated HL-60 cells or transfected 293 cells) were probed together with lysates of isolated mouse neutrophils (transgenic and wildtype) against CEACAM (mAb DH14H11) (Figure 4.8A). Moreover, lysates obtained from neutrophils isolated from mouse as well as lysates from CEACAM3- mKate transfected 293 cells were employed for mkate blotting (Figure 4.8B). Neither expression of CEACAM3 (30 KDa) nor mkate (26 KDa) could be detected in transgenic mouse neutrophils.

 Transgenic mouse neutrophils do not reponse to gonococcal infection Due to the low protein content of granulocytes and the low expression of CEACAM3, it is a possible scenario that CEACAM3 expression in mouse neutrophils was very weak that we were not able to detect it in former experiments. To rule out this hypothesis we performed phagocytic assays. Activation of CEACAMs upon binding of human-specific pathogens has been well described (Gray-Owen et al., 1997b; Hauck, 2002; McCaw et al., 2004; Sarantis and Gray-Owen, 2011). Gonoccal infection is facilitated by opacity- associated (Opa) adhesin proteins mediating the interaction of bacteria to human CEACAMs (Hauck and Meyer, 2003). CEACAM3 has been shown to efficiently trigger an opsonin-independent phagocytosis and elimination of CEACAM-binding bacteria such as Neisseria gonorrhoeae (Buntru et al., 2012; Sarantis and Gray-Owen, 2007).

Chapter II

Figure 4.7 Analyses of CEACAM3 mouse granulocyte expression by flow cytometry. 1 x105 isolated cells were stained with mAbs against mouse GR1 or human CD66b (as granulocyte markers) and CEACAM3 or isotype control coupled to the indicated fluorophores for flow cytometry. Analysis of isolated

Chapter II mouse leukocytes from peripheral blood (A) or bone marrow (B) as well as human isolated granulocytes from peripheral blood (C) were considered by gating whole cell population based upon size (FSC) and granularity (SSC). Proper population was confirmed by fluorescence staining of respective granulocyte markers and granulocytes were stained for CEACAM3 expression. In parallel, non-specific background fluorescence was controlled in all samples by IgG isotype staining.

Figure 4.8 Western blot analyses of CEACAM3 expression. (A) Lanes (from left to right) of Whole cell lysates (WCL): polymorphonuclear leukocytes (PMNs) isolated from human, wildtype (Wt) mouse, transgenic (Tg) mouse, ATRA-differentiated (diff.) HL-60 cells into granulocyte-like cells and CEACAM3- HA transfected 293 cells. Samples were probed with mAbs against human CEACAMs (clone D14HD11, reactivity profile with CEACAM1,3,5,6) and vinculin as loading control. CEACAM1 (160 KDa), CEACAM3 (27 KDa), CEACAM6 (90 KDa). (B) WCL of isolated mouse PMNs from wildtype and transgenic mice as well as 293 cells expressing mkate tagged CEACAM3 (CEACAM3-mKate) were used for western blotting and stained as indicated. CEACAM3-mKate (55 KDa), mKate (26 KDa).

In this context, we carried out experiments with bacteria expressing a CEACAM-binding

Opa protein (Ngo OpaCEA) or a non-CEACAM binding strain (Ngo Opa-) for bacterial uptake mediated by CEACAM3. Since mouse neutrophils isolated from peripheral blood are limited due to the low amount of blood, we performed functional assays with neutrophils isolated from bone marrow, which are also reported to have a longer survival in culture (Boxio et al., 2004). Bacteria were fluorescently stained with CFSE prior to infection. CEACAM3-mediated phagocytosis is recognized for a fast bacterial ingestion but to ensure the bacterial uptake of mouse neutrophils, they were infected for 30 and 60 min. Internalized bacteria were measured by flow cytometry after quenching of bound extracellular bacteria with trypan blue (Figure 4.9A). In addition, granulocytes were fixed after 1 hour of infection and cells were stained for fluorescence microscopy (Figure 4.9B). Flow cytometry and confocal analysis showed no bacterial uptake of isolated granulocytes infected with OpaCEA or non-Opa expressing Neisseria. As expected, using the same

Chapter II

experimental setup only a clear uptake of OpaCEA-expressing N. gonorrrhoeae was measured in isolated human neutrophils by flow cytometry (Figure 4.10A). These results were also visualized by confocal microscopy (Figure 4.10B). Neutrophils as professional phagocytes are commonly known for their antimicrobial response. One feature of neutrophil response against bacteria is the production ROS, termed oxidative burst. Activation of the neutrophil NADPH oxidase, which catalyzes the early step of ROS production by superoxide formation has been reported to be coordinated by CEACAM3- signaling effector proteins (Buntru et al., 2011). To further elucidate whether neutrophils from transgenic mice are able to generate an oxidative burst in response to gonococcal infection, isolated neutrophils were infected with Ngo OpaCEA or Opa- at different multiplicity of infection (MOI 50 or 100). Cells were also stimulated with the inducer PMA as CEACAM3-independent to ensure proper cell response (Figure 4.11A). Surprisingly, only mouse neutrophils stimulated by PMA showed oxidative response. In contrast, human neutrophils trigger an OpaCEA-dependent ROS production in response to N. gonorrhoeae increased at higher MOI 100 (Figure 4.11B). Taken together, previous experiments confirmed that our humanized CEACAM3 mouse model did not functionally expressed CEACAM3 in mouse granulocytes.

 The generated transgenic mouse model do not functionally express CEACAM3 According to previous data, mouse neutrophils were correctly isolated but CEACAM3 protein expression could not be detected in transgenic mice, although a successful insertion of the gene was confirmed. These results suggest an eventual misregulation of protein transcription or a misfolding of the CEACAM3-mKate fusion protein, which could result in an inactive protein conformation. First, to investigate if our transgenic mice are able to produce mRNA but failed in protein synthesis, we performed a reverse transcription PCR (RT-PCR) with extracted total RNA from mouse and human neutrophils (Figure 4.12). Intact mRNA extraction was confirmed by mRNA expression of GAPDH as a housekeeping gene. However, by using a predesigned Taqman-probe specific for CEACAM3 (Life Technologies), no CEACAM3 mRNA expression could be detected in transgenic mice.

Chapter II

Figure 4.9 Transgenic mouse neutrophils do not exhibit phagocytic activity upon gonococcal infection. Mouse granulocytes isolated from bone marrow were infected with N. gonorrhoeae expressing or non- expressing Opa protein (Ngo OpaCEA or Ngo Opa-) at MOI 30. (A) Bacterial uptake of CFSE-stained bacteria was measure by flow cytometry at 30 min or 60 min after infection. Trypan blue was added to the cell suspension previously before measurements for quenching fluorescence of extracellular bacteria. (B) Confocal microscopy of fixed cells after 30 min of infection with PacificBlue-stained bacteria (blue channel). Granulocytes were stained with mAb anti-Gr-1 antibody (green channel) and extracellular bacteria were stained with mAb anti-Opa antibody (red channel). Scale bar 10µm.

Chapter II

Figure 4.10 Phagocytosis of OpaCEA-expressing N. gonorrhoeae by human neutrophils. Isolated granulocytes from human peripheral blood were infected with OpaCEA or non-Opa expressing N. gonorrhoeae (Ngo OpaCEA, Ngo Opa-) at MOI 30. (A) Bacteria were stained with CFSE and infection was conducted for 30 min or 60 min. Bacterial uptake was measured by flow cytometry after quenching of extracellular bacteria with trypan blue. (B) Cells were fixed after 30 min of infection with PacificBlue-stained bacteria (blue channel). Granulocyte staining was performed with mAb anti-CD66b (green channel) and extracellular bacteria with mAb anti-Opa (red channel). Intra or extracellular bacteria are indicated with arrows or arrowheads respectively. Scale bar 10 µm.

Chapter II

Figure 4.11 Gonococci do not trigger oxidative burst in transgenic mouse neutrophils. Isolated polymorphonuclear leukocytes (PMNs) from wildtype (Wt) and transgenic (Tg) mouse bone marrow (A) or human peripheral blood (B) were infected at MOI 50 or 100 with OpaCEA or non-Opa expressing N. gonorrhoeae (Ngo OpaCEA, Ngo Opa-) or exposed to PMA. ROS released by PMNs were measured every 2 min over 100 min, by using a luminol-dependent chemiluminescence. ROS production is showed as counts of absorbance units (a.u.). Graphs show mean values from one representative experiment done in triplicate. Total oxidative burst was calculated by the area under the curve.

Figure 4.12 No detection of CEACAM3 mRNA in transgenic mice. Reverse transcription PCR (RT-PCR) was performed with total RNA extracted from isolated granulocytes. Lanes (from left to right): DNA marker

Chapter II

(M), mouse neutrophils from wildtype (mWt) or transgenic (mTg) animals and human neutrophils (h). Synthesized cDNA was used for amplification of housekeeping gene GAPDH or human CEACAM3. 2 % agarose gels show PCR products of CEACAM3 (65 bp), hGAPDH (117 bp) and mGAPDH (177 bp).

4.5 Discussion

CEACAM3 is a single chain decoy receptor, which not only recognizes a particular set of human-adapted bacteria, initiating the opsonin-independent phagocytosis, but also mediates the bacterial response by human granulocytes. Up to date, humanized mice allow the investigation of human infectious diseases and a better understanding of gene function, genetic pathways, cellular mechanisms or biochemical properties of the immune response (Brehm et al., 2010). Humanized mice have been used in the last decades to study in vivo multiple types of human immune responses and test potential therapeutics that modulate human immunity. In this context, a transgenic mouse model expressing CEACAM3 has been already reported (CEABAC mice) however, the multi-CEACAM expression (CEACAM3, CEACAM6, CEACAM7) on granulocytes has not allowed the investigation of individual CEACAM contributions to the immune response upon infection (Chan and Stanners, 2004). To address in vivo the specific function of CEACAM3 we generated a transgenic mouse, which integrated a transgenic cassette containing a mKate-tagged CEACAM3 coding sequence downstream of a considered 4 Kb promoter region from the human CEACAM3 gene. We have previously confirmed the promoter activity of this region in vitro, which was shown to harbor important transcription binding sites for gene regulation in the granulocytic lineage. Unexpectedly, mice carrying the human transgene integrated in the germ line did not show detectable expression of CEACAM3 or expression of the fluorescent reporter mKate. The generated CEACAM3 transgenic mice failed to transduce an immune response against gonococcal infection. Functional stimulation of transgenic neutrophils, like phagocytosis or oxidative burst, could not be observed. Using the Sleeping beauty transposon system, routinely around 40-70% of transgenic efficiency is reached after injections with the hyperactive transposase (Mates et al., 2009). Unexpectedly, the ratio of born animals was very low and only two animals resulted to have successfully integrated the human transgene. We suspect that CEACAM3 could lead to lethality because of the unexpectedly low frequency of obtained founder animals and since the only founder which survived (male Nr. 9) did not express the transgene. Unfortunately, the second animal died prematurely and due to the unexpected situation

Chapter II organs or tissue samples from this female founder animal could not be kept or preserved before damage, so further analysis into the cause(s) of this animal’s death could not be performed. Breeding of the single remaining male founder animal demonstrated a successful germ line transmission of the transgene; however, mating heterozygous offspring males with wildtype female mice generated a low transgene transmission with less than 50% (~39%). The low transmission rate of the gene could again indicate that the human transgene has a detrimental effect during embryonic development. However, since no protein expression of CEACAM3 as well as no activation of mouse granulocytes in response to human-restricted bacteria was detectable, we can only envision a scenario, where the CEACAM3 transgene in this mouse line is integrated into a silent gene locus, which can be activated in a non- predictable manner in a low proportion of transgenic animals, and when it is transcribed leads to developmental problems in the affected animals. The idea of a silent CEACAM3 locus in the surviving CEACAM3 transgenic animals is in line with our finding that, CEACAM3 mRNA could not be detected via RT-PCR in blood cells from the transgenic mouse line. On one hand, we suspect that CEACAM3 expression affected the survival of transgenic mice. On the other hand, despite the functional activity of the selected 4 Kb CEACAM3 promoter fragment observed in vitro in 293 cells, we cannot rule out that this promoter region might have been insufficient to drive expression of human CEACAM3 in vivo. In this study, we expected to avoid artificial effects and mimic the normal expression pattern of human granulocytes by using an intact promoter region of 4 Kb out of 24 Kb intergenic region upstream of the CEACAM3 coding sequence. Although promoters are generally located upstream of the transcription start site in about 0.1-1 Kb long (Ignatieva et al., 2014), we cannot rule out that the considered promotor could lack critical regulatory regions required for tissue-specific CEACAM3 regulation. Chromatin immunoprecipitation sequencing (ChIP-seq) is currently used for analysis of protein-DNA interactions to determine locations of binding sites for almost any protein of interest. Interestingly, between 20 Kb upstream and 10 Kb downstream of the CEACAM3 open reading frame, ten transcription factors were identified (DECODE ChIP-seq, Qiagen). They include AREB6, Elk-1, GCNF, GCNF-1, GCNF-2, NRSF form 1, NRSF form 2, Nkx5-1 together with binding sites of GATA-1 and FOXF2. Based on these predictions, TFs and regulatory elements importantly to drive an endogenous-like expression were not

Chapter II included in our strategy, as well as regulatory elements within the CEACAM3 intronic sequence were excluded. In addition, it has been reported that expression of neighboring CEACAM genes, which are naturally expressed in human granulocytes, are required for proper CEACAM gene regulation (Chan and Stanners, 2004). Therefore, any eventual misregulation of CEACAM3 expression, due to the lack of neighboring CEACAMs in our transgenic mice cannot be excluded. Recently, gene targeting techniques have been extensively improved by using engineered clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 in mouse transgenesis (Cho et al., 2006; Kaneko and Mashimo, 2015; Platt et al., 2014; Shen et al., 2013). Together with strategies using homologous recombination in embryonic stem (ES) cells, these methodologies allow nowadays the insertion of a transgene at a selected locus. In Knockin mice the insert is flanked by DNA sequences from a non-critical locus, which through homologous recombination are specifically integrated as a single copy. This is important because the gene will achieve biological (i.e. natural) expression patterns and levels. However, specific locus for granulocyte-restricted expression has not been reported. Because BAC vectors are able to encompass most mammalian genes including open reading frame and most regulatory sequences (Copeland et al., 2001; Yu et al., 2000), BAC recombineering has been widely used to generate transgenic mice expressing a variety of reporters (Gong et al., 2003; Lobo et al., 2006) or epitope tagged-proteins (Bateup et al., 2008) driven by speciﬁc endogenous promoters. This transgenic models use random integration, meaning that the desired gene could end up anywhere in the host genome. However, the advantage is that the desired gene might be placed under its own promoter, leading to an endogenous-like expression and phenotype, which can is ideally for disease models. For future studies, in order to achieve a more reliable expression pattern and circumvent possible negative effects of the transgene in embryonic development we propose to use novel technologies for the generation of conditional transgenic mice. Conditional and inducible gene modifications, which offer a temporal and cell-specific control, could be beneficial in order to circumvent lethal effects (Fang et al., 2012; Henry et al., 2009; Muthusamy et al., 2014; Thorens et al., 2015).

4.6 Acknowledgments

We thank T.F. Meyer (MPI for Infection Biology, Berlin, Germany) for the N. gonorrhoeae MS11 strains used in this study, W. Zimmermann (Ludwig-Maximilians-

Chapter II

Universität, München, Germany) for providing CEACAM cDNA, D. Chudakov (Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry, Moscow, Russia) for mKate cDNA, J. Brosius (Center of Molecular Biology of Inflammation -ZMBE, Westfälische Wilhelms-Universität Münster, Germany) for providing the SB transposon vector pT2/BH, and S. Feindler-Boeckh and P. Zoll-Kiewitz for expert technical assistance. This study was supported by funds from the Deutsche Forschungsgemeinschaft (DFG) to CRH. JDT acknowledges the support by the International Office - Universität Konstanz.

Chapter III

5 Chapter III

The granulocyte orphan receptor CEACAM4 is able to trigger phagocytosis of bacteria

Julia Delgado Tascón1,2*, Jonas Adrian1*, Kathrin Kopp1, Philipp Scholz1, Mario P. Tschan3, Katharina Kuespert1, and Christof R. Hauck1,2,4

1 Lehrstuhl für Zellbiologie, Universität Konstanz, 78457 Konstanz, Germany 2 Graduate School Biological Sciences; Universität Konstanz, 78457 Konstanz, Germany 3 Division of Experimental Pathology, Institute of Pathology, Universität Bern, 3012 Bern, Switzerland 4 Konstanz Research School Chemical Biology, Universität Konstanz, 78457 Konstanz, Germany *both authors contributed equally

J Leukoc Biol. 2015 Mar;97(3):521-31. Epub 2015 Jan 7.

Chapter III

5.1 Abstract

Human granulocytes express several glycoproteins of the carcinoembryonic antigen-related cell adhesion molecule (CEACAM) family. One family member, CEACAM3, operates as a single chain phagocytic receptor initiating the detection, internalization, and destruction of a limited set of gram-negative bacteria. In contrast, the function of CEACAM4, a closely related protein, is completely unknown. This is mainly due to a lack of a specific ligand for CEACAM4. By generating chimeric proteins containing the extracellular bacteria-binding domain of CEACAM3 and the transmembrane and cytoplasmic part of CEACAM4 (CEACAM3/4) we demonstrate that this chimeric receptor can trigger efficient phagocytosis of attached particles. Uptake of CEACAM3/4-bound bacteria requires the intact immunoreceptor tyrosine-based activation motif (ITAM) of CEACAM4 and this motif is phosphorylated by Src family protein tyrosine kinases (PTKs) upon receptor clustering. Furthermore, SH2-domains derived from Src PTKs, phosphatidylinositol 3’ kinase, and the adapter molecule Nck are recruited and directly associate with the phosphorylated CEACAM4 ITAM. Deletion of this sequence motif or inhibition of Src PTKs block CEACAM4-mediated uptake. Together, our results suggest that this orphan receptor of the CEACAM family has phagocytic function and prompt efforts to identify CEACAM4 ligands.

5.2 Introduction

The innate immune system provides early detection and elimination of potentially harmful microbes. It has become clear that evolutionary conserved, germ-line encoded factors respond to molecular patterns generally associated with microorganisms (Pinheiro and Ellar, 2006). One important family of pattern recognition molecules are the Toll-like receptors (TLRs) that are not only expressed by hematopoietic cells, but also found on cells outside of the immune system including epithelial or endothelial cells (Takeda et al., 2003). TLRs allow both immune and non-immune cells to generate danger signals, which direct innate and acquired immune defenses to infected locations within the body. Another set of recognition molecules allows specialized cells of the innate immune system not only to recognize, but also to phagocytose and eliminate a broad range of microbes. These include scavenger receptors, C-type lectins, and Siglecs, which are found on professional phagocytes and which bind to carbohydrate and protein structures found on the surface of

Chapter III diverse parasites, bacteria, and fungi (Areschoug and Gordon, 2008, 2009). Besides these broadly responsive systems, it has become clear that innate immune cells also express additional germ-line encoded receptors that are tailored toward particular subsets of host- associated pathogens. An example is found in a group of mammalian receptors of the immunoglobulin family, the carcinoembryonic antigen-related cell adhesion molecules (CEACAMs) (Kuespert et al., 2006). Due to multiple gene duplication and gene conversion events, the CEACAM family displays extraordinary diversity between the different mammalian lineages (Kammerer et al., 2007). This diversity becomes most evident, when comparing the number of CEACAM genes encoded in published genomes (Kammerer and Zimmermann, 2010). In humans, there are 12 members of the CEACAM family, which are expressed in several tissues (Hammarstrom, 1999; Kuespert et al., 2006). Some family members such as CEACAM1, CEA, CEACAM6 or CEACAM7 are either expressed exclusively on epithelia or found on epithelial cells and a variety of additional cell types. In contrast, several members are restricted to hematopoietic cells, e.g. CEACAM3, CEACAM4, and CEACAM8 have only been reported from human myeloid cells. In particular, CEACAM3 (initially termed CGM1 or CD66d) is known to mediate the opsonin-independent recognition and phagocytosis of a limited set of human-restricted bacterial pathogens. For example, strains of Neisseria gonorrhoeae, which express

CEACAM-binding adhesins of the opacity associated protein family (OpaCEA proteins), are recognized by this glycoprotein (Chen and Gotschlich, 1996; Hauck et al., 1998; Schmitter et al., 2004). Therefore, CEACAM3 functions as a single-chain phagocytic receptor that provides the innate immune system with a means to specifically detect and eliminate CEACAM-binding bacteria (Buntru et al., 2012). CEACAM3 is characterized by a cytoplasmic domain containing an immunoreceptor tyrosine-based activation motif (ITAM)-like sequence (McCaw et al., 2003; Schmitter et al., 2004). Previous work has demonstrated that this motif is critical to provide CEACAM3 with efficient phagocytic and bactericidal properties (Buntru et al., 2011; Schmitter et al., 2007b). Interestingly, the human genome encodes an additional CEACAM family member with a domain structure closely resembling CEACAM3 (Kuroki et al., 1991). During the revision of the CEA family nomenclature this CEACAM3-related protein, that had been initially designated W236 or CGM7 (Kuroki et al., 1991; Kuroki et al., 1995), has been renamed into CEACAM4 (Beauchemin et al., 1999). CEACAM4 seems to be exclusively expressed by myeloid cells, as its cDNA has been initially cloned from a human leukocyte cDNA library (Kuroki et al., 1991) and its mRNA has not been detected in a variety of different

Chapter III epithelial, neuronal or mesenchymal tumor cells (Thompson et al., 1993). Similar to

CEACAM3, CEACAM4 has a single IgV-like extracellular domain and its cytoplasmic part contains an ITAM sequence (Pils et al., 2008). However, the physiological function of CEACAM4 is unclear due to the lack of known ligands for this membrane protein. Here, we provide evidence that CEACAM4 can function as a phagocytic receptor. By domain swapping with the bacteria-binding extracellular domain of CEACAM3, the intact transmembrane and intracellular domains of CEACAM4 mediate efficient uptake of

OpaCEA protein-expressing N. gonorrhoeae into transfected cells. Bacterial internalization is accompanied by tyrosine phosphorylation of CEACAM4 and depends on the integrity of the cytoplasmic ITAM sequence. Upon Src family kinase-mediated phosphorylation, tyrosine residues of the CEACAM4 ITAM associate with SH2 domain containing cytoplasmic proteins involved in signaling processes during phagocytosis. Our results suggest that the orphan receptor CEACAM4 serves a phagocytic function in human granulocytes and they provide impetus to identify CEACAM4 ligands.

5.3 Material and Methods

 Cell culture and differentiation of HL60 cells Human embryonic kidney epithelial 293T cells (293 cells) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10 % CS. Human promyelocytic leukemia HL-60 cells were grown in RPMI 1640 medium supplemented with 10 % fetal bovine serum (10 % FCS). Cells were grown at 37 °C in 5 % CO2 and subcultured every 2-3 days. For in vitro differentiation, HL60 cells at a density of 5 x 105 - 1 x 106 cells/ml were cultured in the presence of 1 µM all-trans retinoic acid for 6 days with the medium replaced once after three days.

 Bacteria Neisseria gonorrhoeae non-piliated MS11 strains expressing a CEACAM-binding Opa protein (strain N309; Ngo OpaCEA), or non-CEACAM binding (strain N302; Ngo Opa-) variants (Kupsch et al., 1993a), and Neisseria meningitidis H44/76 (serotype B strain N687) (de Vries et al., 1996) were kindly provided by Thomas Meyer (Max-Planck-Institut für Infektionsbiologie, Berlin, Germany). Neisseria were grown on GC agar plates (Difco

BRL, Paisley, UK) supplemented with vitamins at 37 °C, 5 % CO2 and subcultured every day using a binocular microscope. Moraxella catarrhalis (strain 9143) and Haemophilus

100

Chapter III aegyptius (strain 21187) were obtained from the DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany). Moraxella and

Haemophilus were grown on BHI agar plates at 37 °C, 5 % CO2. For infection, overnight grown bacteria were taken from GC agar plates, suspended in PBS, and colony forming units (cfu) were estimated by OD550 readings according to a standard curve. In some cases, bacteria were labeled prior to infection with 0.2 µg/ml of PacificBlue- or CFSE (Invitrogen Carlsbad, CA) in PBS for 15 min at 37 °C under dark and washed three times with PBS before use.

 Recombinant DNA constructs Mammalian expression plasmids encoding GFP-tagged and mKate-tagged versions of CEACAM3 have been described previously (Buntru et al., 2011; Pils et al., 2012). Constructs encoding GFP, mKate, v-Src, the SH2-domains of human SLP76, c-Yes, Nck2, as well as the N-terminal SH2 domain of PI3K regulatory subunit γ (PI3KR3) fused to mKate have been described (Buntru et al., 2011; Kopp et al., 2012; Pils et al., 2012). The purified recombinant GST-fusion proteins encoding the SH2 domains of human Hck, Lck, c-Yes, Tec, Syk (the isolated N-terminal and C-terminal SH2 domains; Syk-N, Syk-C), PI3KR3 (the isolated N-terminal and C-terminal SH2 domains; PI3KR3-N, PI3KR3-C), Vav, Nck1, Nck2, Grb2, Grb14, and Slp76 have been used before (Kopp et al., 2012; Schmitter et al., 2007a). The human monocytic M-CSF receptor promoter (pMCSFR) and its mutated version as well as the PU.1 expression vector were described before (Tschan et al., 2008; Zhang et al., 1994). The primer sequences used for cloning procedures are summarized in Table 5.1. The human CEACAM3 and CEACAM4 promoters were amplified from human genomic DNA cloned in pBAC e3.6 vectors (Osoegawa et al., 2001), which were obtained from the BACPAC Resource Center (Children's Hospital Oakland Research Institute, Oakland, CA). Using pBAC e3.6 clone RP11-343B1 as a template, the CEACAM3 promoter region including a 5’-located KpnI site was amplified with primers promoter-CC3-sense and promoter-CC3-antiNheI. The CEACAM4 promoter region was amplified from pBAC e3.6 clone RP11-976L23 with primers promoter-CC4-senseKpnI and promoter-CC4-antiNheI. The promoter sequences were cloned via KpnI/NheI restriction sites into the luciferase reporter vector pGL4.10 (Promega, Mannheim, Germany). The human CEACAM4 cDNA originally cloned by M. Kuroki (Kuroki et al., 1991) was kindly provided by W. Zimmermann (Ludwig-Maximilians-Universität, München, Germany). The CEACAM4

101

Chapter III coding sequence was amplified with primers CEA4-IF-sense and CEA4-IF-w/oSTOP-anti and inserted into pDNR-Dual using the In-Fusion Dry-down PCR Cloning Kit (Clontech, Mountain View, CA). Via Cre-mediated recombination, the CEACAM4 cDNA was transferred into the mammalian expression vector pLPS-3′EGFP (Clontech) allowing expression of CEACAM4-GFP fusion protein (CEACAM4-GFP). To generate a chimera of the CEACAM4 transmembrane and cytoplasmic domain fused to the amino-terminal

IgV-like domain of CEACAM3, the coding sequence of CEACAM3 was amplified with primers CEACAM3-IF-sense and CEA3-NT(-CEA4-TM-cyto)-antisense. In parallel, the CEACAM 4 cDNA was amplified with primers CEA4-TM-cyto-sense and CEA4-IF- w/oSTOP-antisense. The two resulting PCR fragments were fused by soeingPCR using CEACAM3-IF-sense and CEA4-IF-w/oSTOP-antisense primers. The soeingPCR product was cloned into pDNR-Dual via the Infusion cloning kit to yield the wild-type CEACAM3/4 chimera (CEACAM3/4 WT). Furthermore, to construct CEACAM3/4 chimera lacking the cytoplasmic domain, we used pDNR-Dual CEACAM3/4 WT for PCR amplification with primers CEACAM3-IF-sense and CEA4-deltaCT-IF-antisense. The resulting PCR fragments was cloned into pDNR-Dual to yield the CEACAM3/4 CT. Point mutations by substitution of tyrosine residues located in the amino-acid positions 222 and 233 of chimera CEACAM3/4 WT were introduced sequentially by site-directed mutagenesis using primer pairs: chimCC3/4-Y222F-sense and chimCC3/4-Y222F- antisense as well as chimCC3/4-Y233F-sense and chimCC3/4-Y233F-antisense to generate the double mutant CEACAM3/4 Y222/233F. Subsequently, all the constructs were sequence verified and transferred into pLPS-3’mKate or pLPS-3’EGFP by Cre/Lox recombination as described previously (Muenzner et al., 2010).

Table 5.1 Primer sequences

Construct Primer Sequence Promoter CEACAM3 Promoter-CC3-sense 5’-CTCCTGTGTCTCAGGCATTG-3’ (pGL4.10) Promoter-CC3-antisense NheI 5’-ATAGCTAGCGGTCTCTGCTG CCTGCTCTT-3’ Promoter CEACAM4 Promoter-CC4-sense KpnI 5’-ATAGGTACCCCCTGCATCTA (pGL4.10) TAGGGTGG-3’ Promoter-CC4-antisense NheI 5’-ATAGCTAGCGTCTCTGCTGC CTGCTTGTC-3’ CEACAM4 CEA4-IF-sense 5’-GAAGTTATCAGTCGACACCA (pDNR-Dual) TGGGCCCCCCCTCAGCC-3’

102

Chapter III

CEA4-IF-w/oSTOP-antisense 5’-ATGGTCTAGAAAGCTTGAGA CCACATCTGCTTTGTGG-3’ CEACAM4-GFP Cre-lox recombination pDNR-Dual-CEACAM4 (pLPS-3′EGFP) CEACAM3/4-WT CEACAM3-IF-sense 5’-GAAGTTATCAGTCGATACCA (pDNR-Dual) TGGGGCCCCCCTCAGCC-3’

Soeing PCR CEA3-NT(-CEA4-TM-cyto)- 5’-ACCAGGACCCCAGTCACGAT antisense GCCGGCGACGGCCCCC-3’ CEA4-TM-cyto-sense 5’-GGGGGCCGTCGCCGGCATCG TGACTGGGGTCCTGGT-3’ CEA4-IF-w/oSTOP-antisense 5’-ATGGTCTAGAAAGTCTGAGA CCACATCTGCTTTGTG-3’ CEACAM3/4-ΔCT CEACAM3-IF-sense 5’-GAAGTTATCAGTCGATACCA (pDNR-Dual) TGGGGCCCCCCTCAGCC-3’ CEA4-deltaCT-IF-antisense 5’-ATGGTCTAGAAAGCTTCCAG TCCTGGAGAG-3’ CEACAM3/4-Y222/233F chimCC3/4-Y222F-DpnI-sense 5’-GAACAGCCACTCCCATTTTC (pDNR-Dual) GAAGAATTGCTATACTCTG-3’

Site directed mutagenesis chimCC3/4-Y222F-DpnI-antisense 5’-CAGAGTATAGCAATTCTTCG AAAATGGGAGTGGCTGTTC-3’ chimCC3/4-Y233F-DpnI-sense 5’-GCTATACTCTGATGCAAATA TTTTCTGCCAGATCGACCAC-3’ chimCC3/4-Y233F-DpnI-antisense 5’-GTGGTCGATCTGGCAGAAAA TATTTGCATCAGAGTATAGC-3’ CEACAM3/4-GFP Cre-lox recombination pDNR-Dual-CEACAM3/4 (pLPS-3′EGFP) CEACAM3/4-mKate Cre-lox recombination pDNR-Dual-CEACAM3/4 (pLPS-3'-mKate) CEACAM3/4-ΔCT-mKate Cre-lox recombination pDNR-Dual-CEACAM3/4-ΔCT (pLPS-3'-mKate) CEACAM3/4-Y222/233F- Cre-lox recombination pDNR-Dual-CEACAM3/4-Y222/233F mKate (pLPS-3'-mKate)

 Antibodies and Reagents Monoclonal antibody (mAb) D14HD11 (cross-reactive with CEACAM3) was from GENOVAC (Freiburg, Germany). The mAb against green fluorescent protein (GFP) (clone JL-8) was from BD Biosciences (Palo Alto, CA), mAb against v-Src (clone EC10) and against phosphotyrosine (pTyr; clone 4G10) were from Upstate Biotechnology (Lake Placid, NY) and mAb against glutathione S-transferase (GST) (clone B-14) was from Santa Cruz Biotechnology (Santa Cruz, CA). Src inhibitor PP2 was obtained from Calbiochem (La Jolla, CA, USA). The mAb anti-Opa protein antibody (clone 4B12/C11) was a

103

Chapter III generous gift of Marc Achtman (MPI für Infektionsbiologie, Berlin, Germany). A rabbit polyclonal antibody was generated against formaldehyde-fixed N. gonorrhoeae and N. meningitidis (IG-511) by Immunoglobe (Himmelstadt, Germany). A rabbit polyclonal antibody against recombinant mKate was custom generated and affinity purified (Animal Research Facility, Universität Konstanz, Germany). The mAb against tubulin (clone E-7) was purified from hybridoma cell supernatants obtained from DSHB (University of lowa, IA). Protein A/G sepharose was obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

 Detection of human CEACAM3 and CEACAM4 mRNA by qPCR analysis Total RNA from differentiated or non-differentiated HL-60 cells and CEACAM transfected or non-transfected 293 cells was extracted (Qiagen RNeasy Mini kit, Qiagen, Hilden, Germany) and DNase digested (RNase-free DNase, Qiagen). Complementary DNA (cDNA) was synthesized from 2 μg of total RNA in a 20 μl reaction using the MMuLV reverse transcriptase and Oligo-dT primers. As a control for chromosomal DNA contamination, RNA was used directly for PCR amplification. The expression of human CEACAMs was assessed using predesigned TaqMan® assays for CEACAM3 (ID: Hs00926316_m1) or CEACAM4 (assay ID: Hs00156509_m1) from Life Technologies. PCR amplification was performed using TaqMan Fast Advanced Master Mix (Life Technologies). Primers for glyceraldehyde 3-phosphate dehydrogenase (5′- GAAGGTGAAGGTCGGAGTCA-3′ and 5′-TTGAGGTCAATGAAGGGGTC-3′) were employed to amplify GAPDH cDNA in the presence of SYBR Green (Sigma-Aldrich). All reactions were subjected to 40 PCR cycles (Mastercycler realplex, Eppendorf, Hamburg, Germany) with 95 ˚C for 10 s, 60 ˚C for 20 s, and 72 ˚C for 15 s. Quantification of PCR data was done by the comparative CT method (Schmittgen and Livak, 2008).

 Transfection of cells, Cell lysis, Immunoprecipitation, Western blotting 293 cells were transfected by the standard calcium phosphate co-precipitation method. Cells were employed in infection experiments 48 hours after the transfection. Cell lysis in modified RIPA buffer and Western blotting were performed as described previously (Agerer et al., 2003; Schmitter et al., 2004). For immunoprecipitations, whole cell lysates were incubated with 3 µg of polyclonal rabbit anti-GFP or anti-mKate antibody overnight followed by 1 hour incubation with protein A/G sepharose, all at 4 °C. After three washes

104

Chapter III with Triton buffer, precipitates were taken up in SDS sample buffer and analyzed by western blotting.

 Detection of CEACAM-binding by bacterial Pull-down assays Expression of the soluble amino-terminal domains of human CEACAMs in 293 cells and binding studies with different microorganisms were performed as described previously (Kuespert and Hauck, 2009; Kuespert et al., 2007). Bacteria were added to CEACAM N- domain containing cell culture supernatant in a total volume of 1 ml and incubated for 1 hour. After incubation, the bacteria were washed twice with PBS and boiled in SDS sample buffer prior to SDS-PAGE and western blotting with a GFP-directed monoclonal antibody.

 Gentamicin protection assay Gentamicin protection assays were conducted as described previously (Schmitter et al., 2004). 4 x 105 cells were seeded in 24 well plates coated with fibronectin (4 µg/ml) and poly-L-lysine (10 µg/ml). A multiplicity of infection (MOI) of 30 bacteria per cell was routinely used, and after 1 hour of infection, extracellular bacteria were killed by 45 min incubation with 50 µg/ml gentamicin in DMEM. Then, cells were lysed with 1 % saponin in PBS for 15 min. The samples were diluted with PBS, and the number of viable bacteria was determined by plating suitable dilutions on GC agar. For inhibition studies, cells were treated with the Src inhibitor PP2 (Calbiochem) 15 min prior to infection.

 Bacterial adherence assay Cells were seeded and infected as described for gentamicin protection assays. After the infection, cells were gently washed before they were lysed by addition of 1 % saponin in PBS for 15 min. Total cell-associated bacteria were suspended by vigorous pipetting, and colony forming units were determined by plating of serial dilutions on GC agar.

 GST-pull down and Probing of peptide spot membranes For GST-pull downs, 4 µg of purified GST or GST-fusion protein attached to glutathione- sepharose beads (Amersham Biosciences) were added to whole cell lysates (WCLs) of transfected 293 cells. In some cases, 293 cells were co-transfected with a v-Src-encoding plasmid to ensure maximal tyrosine phosphorylation of CEACAM4. Samples were incubated for 4 hours at 4 °C under constant rotation. After four washes with PBS containing 0.01 % Tween, precipitates were boiled in 2x SDS sample buffer before SDS- PAGE and western blot analysis. Generation and probing of peptide spot membranes was

105

Chapter III conducted as described previously using 20 µg of GST-SH2 domains or GST alone (Schmitter et al., 2007a).

 Preparation and use of SH2 domain microarrays Protein domain microarrays containing recombinant, GST-tagged SH2 domains derived from various human proteins were prepared on aldehyde modified glass slides as previously reported (Kopp et al., 2012). Arrays were incubated overnight at 4 °C with cell lysates from CEACAM4-GFP and v-Src expressing cells (p-CEACAM4) or CEACAM4- GFP only expressing cells (CEACAM4). After incubation, the arrays were washed and probed with anti-GFP monoclonal antibody for 1 hour at RT followed by Cy3-labeled secondary antibody. After washing, the slides were dried by centrifugation. Binding signals for a particular SH2 domain obtained for unphosphorylated CEACAM4 were subtracted from the signals obtained for p-CEACAM4. The resulting intensities were normalized to the amount of array-bound SH2 domains as measured by probing arrays with anti-GST antibody allowing comparison in binding strength between different SH2 domains.

 Differential staining of intracellular bacteria for confocal microscopy To discriminate between intra- and extracellular bacteria, a differential immunofluorescence staining protocol was applied as described (Kuespert et al., 2011). Briefly, transfected 293 cells were seeded on glass coverslips in 24 well plates and infected for 60 min with OpaCEA protein-expressing N. gonorrhoeae at an MOI of 30. Samples were fixed with 4 % paraformaldehyde and after three washes with PBS, samples were incubated in blocking buffer (PBS, 10 % fetal CS) for 5 min. Extracellular bacteria were stained with a rabbit polyclonal N. gonorrhoeae antibody (IG-511) for 1 hour, followed by incubation for 45 min with Cy5-coupled goat-anti-rabbit antibody in blocking buffer. Following two PBS washes, samples were incubated for 20 min with 0.1 % Triton-X100 to permeabilize cellular membranes. After three further PBS washes and 5 min in blocking buffer, samples were again incubated for 1 hour with the rabbit polyclonal anti-N. gonorrhoeae antibody (IG-511) to detect intracellular and extracellular bacteria. Samples were washed 3 times with PBS, they were treated with blocking buffer for 5min, and then incubated for 45 min with Cy2-coupled goat-anti-rabbit antibody. Following last three PBS washes, samples were embedded in mounting medium (Dako, Glostrup, Denmark). Fixed samples were analyzed with a Leica TCS SP5 confocal laser scanning microscope (Leica Microsystems, Wetzlar, Germany). Fluorescence signals of triple-labeled specimens

106

Chapter III were serially recorded to avoid bleed-through. Images were digitally processed with NIH ImageJ and merged to yield pseudocolored pictures.

5.4 Results and Discussion

 CEACAM4 is under the control of a myeloid-specific promoter CEACAM3 is expressed by human granulocytes and mediates the opsonin-independent phagocytosis of OpaCEA protein-expressing N. gonorrhoeae (Schmitter et al., 2004). CEACAM4, another CEACAM family member, perfectly matches the domain structure of CEACAM3 (Kuroki et al., 1991; Pils et al., 2008). Both proteins are highly homologous in the carboxy-terminal intracellular part (amino acid identity 73 %) (Suppl. Figure 5.1A). However, they display less sequence identity in the microbe-binding extracellular Igv-like domain (amino acid identity 49 %) (Suppl. Figure 5.1A), in particular in the CFG-face of the immunoglobulin fold (Suppl. Figure 5.1B). Strikingly, these two membrane proteins harbor an ITAM-like sequence close to the carboxy-terminus suggesting that CEACAM4 might function to transduce signals into the cell (Suppl. Figure 5.1A). CEACAM4 was originally cloned from a pooled human leukocyte cDNA library (Kuroki et al., 1991). This suggests that, similar to CEACAM3, CEACAM4 might also be expressed by phagocytic cells. As CEACAM4-specific antibodies are not available, we utilized a TacMan probe based qRT-PCR analysis, which discriminates between the CEACAM3 and the CEACAM4 cDNA (Suppl. Figure 5.1C). This assay was used to analyze the presence of the CEACAM4 mRNA in the promyeloid cell line HL60, which can be differentiated in vitro by retinoic acid towards a granulocyte phenotype. Importantly, there was a slight increase in CEACAM3 mRNA and a clear 6- to 7-fold rise in CEACAM4 mRNA in HL60 cells during the course of in vitro differentiation (Figure 5.1A). To further investigate the myeloid-specific regulation of these two receptors, we performed luciferase reporter assays using ~3 Kb fragments derived from the promoter regions of the CEACAM3 or the CEACAM4 gene, respectively. As a comparison, the human M-CSF receptor promoter (pMCSFR) was used, which is known to respond to the myeloid transcription factor PU.1 (Figure 5.1B) (DeKoter et al., 1998; Zhang et al., 1994). In agreement with its myeloid- specific expression, wildtype pMCSFR showed 4- to 9-fold increase in activity in the presence of PU.1, whereas the M-CSF receptor promoter with mutated PU.1 binding site (pMCSFR mutated) did not respond.

107

Chapter III

Figure 5.1 CEACAM4 is expressed in human phagocytes, but does not recognize CEACAM-binding bacteria. (A) HL60 cells were differentiated in vitro and CEACAM3 or CEACAM4 RNA levels were quantified by real-time PCR. Samples were normalized according to expression of GAPDH and are shown as -fold increase in mRNA compared to undifferentiated HL60 cells. (B) Luciferase reporter assays with 293 cells transfected with plasmids encoding the M-CSF receptor promoter (pMCSFR), the MCSFR promoter with a mutated PU.1 binding site (pMCSFR mutated), the CEACAM3 promoter, or the CEACAM4 promoter. Plasmids were transfected together with an empty control vector or with an expression plasmid encoding the myeloid transcription factor PU.1, respectively. Each point represents luciferase activity in independent samples and is given as n–fold activity of PU.1-transfected cells compared to the control vector samples. (C) 293 cells were transfected with the empty pLPS-3’-EGFP vector or the same plasmid encoding CEACAM3 or CEACAM4, respectively. Cells were infected for 1 hour with either N. gonorrhoeae - expressing an OpaCEA protein adhesin (Ngo OpaCEA) or lacking OpaCEA protein expression (Ngo Opa ) at a MOI of 30. Values represent the mean ± standard deviations (n=3) of the total cell-associated bacteria (top graph) or internalized bacteria (bottom graph). (D) The indicated secreted CEACAM-GFP fusion proteins were expressed in 293 cells and cell culture supernatants were analyzed by Western blotting with anti-GFP antibody (Supe; left panel). The indicated GFP-fusion proteins were incubated with non-opaque N. gonorrhoeae (Ngo Opa-), OpaCEA protein-expressing gonococci (Ngo OpaCEA), N. meningitidis, Haemophilus aegyptius, or Moraxella catarrhalis. After washing, bacteria-associated fusion proteins were detected by western blotting with a monoclonal anti-GFP antibody (Pull-down; right panels).

108

Chapter III

Similarly, PU.1 enhanced CEACAM3 and CEACAM4 promoter activity 4- or 10-fold, respectively, explaining the expression of the encoded receptor proteins in the myeloid lineage (Figure 5.1B). These results are in line with findings from unbiased screens in myeloid precursor cells, which have identified the CEACAM4 promoter as a target of the promyelocytic leukemia-retinoic acid receptor  oncogene (Wang et al., 2010), and suggest that CEACAM4 is expressed in human myeloid cells.

 CEACAM4 does not recognize known CEACAM-binding bacteria Based on the known interaction of several human restricted pathogens with other members of the CEACAM family (Chen and Gotschlich, 1996; Chen et al., 1997), we initially attempted to identify CEACAM4 ligands by a candidate approach using strains of N. gonorrhoeae, N. meningitidis, H. aegyptius, and M. catarrhalis with documented binding properties for CEACAM1, CEACAM3, CEA, or CEACAM6 (Brooks et al., 2008; Hill and Virji, 2003; Kuespert et al., 2007; Virji et al., 2000). Therefore, human 293 cells were transfected with cDNA encoding GFP, GFP-tagged CEACAM3, or GFP-tagged CEACAM4. To verify the expression of the transfected constructs, cell lysates were probed with GFP-directed antibodies (Suppl. Figure 5.2A). Next, cells were infected for 1 hour with either non-opaque Neisseria gonorrhoeae (Ngo Opa-), which do not bind to any

CEACAM, or an isogenic OpaCEA-protein expressing strain (Ngo OpaCEA) at an MOI of 30. Opa protein expression by the used strains was detected by western blotting (Suppl. Figure 5.2B). Infected samples were employed in bacterial adhesion assays and gentamicin protection assays to measure the cell association and internalization of the bacteria by the transfected cells. As shown before, 293 cells transfected with the control vector did not bind or internalize non-opaque or OpaCEA protein-expressing bacteria (Figure 5.1C). In contrast, CEACAM3 expression allowed efficient binding and uptake of pathogens (Figure 5.1C). Importantly, CEACAM4-expressing cells did not show enhanced association with non-opaque or OpaCEA protein-expressing bacteria and did not internalize the microorganisms (Figure 5.1C). To directly test CEACAM4 binding of different pathogenic bacteria, we employed the amino-terminal, extracellular domains of CEACAM3, CEACAM4, and CEACAM8 in the form of soluble GFP-fusion proteins in bacterial pull-downs. As seen previously (Kuespert et al., 2011; Kuespert et al., 2007),

OpaCEA protein-expressing strains of N. gonorrhoeae or N. meningitidis as well as selected strains of Haemophilus aegyptius and Moraxella catarrhalis associated with CEACAM3, but not with CEACAM8 (Figure 5.1D). Importantly, none of these strains showed binding

109

Chapter III to the CEACAM4 extracellular domain (Figure 5.1D). This is in line with a previous report by Popp and colleagues, who also did not detect binding of CEACAM4 to different laboratory strains of N. gonorrhoeae (Popp et al., 1999). However, the failure to detect CEACAM4-binding bacteria in this limited set of known CEACAM-binding pathogens does not rule out the possibility that CEACAM4 could function as a receptor for microorganisms.

 The cytoplasmic domain of CEACAM4 is able to induce phagocytosis Despite the lack of binding and internalization of known CEACAM-binding bacteria, CEACAM4 could nevertheless have phagocytic activity. To test the functionality of the CEACAM4 cytoplasmic domain in the absence of a known ligand, we constructed chimeric receptors based on the bacteria-binding Igv-like domain of CEACAM3 fused to the transmembrane and cytoplasmic domain of CEACAM4 (CEACAM3/4). In addition to the wildtype intracellular domain of CEACAM4, we generated a truncated receptor lacking cytoplasmic amino acids (CEACAM3/4 ∆CT) or exchanged the critical tyrosine residues in the CEACAM4 ITAM sequence for phenylalanine (CEACAM3/4 Y222/233F) to abrogate tyrosine phosphorylation (Figure 5.2A). To allow detection of the transfected cells, all receptor constructs were fused to a C-terminal mKate or GFP tag (Figure 5.2A). 293 cells were transfected with the mKate-tagged constructs or left untransfected and expression of the chimeric receptor proteins was analyzed by flow cytometry and western blotting (Suppl. Figure 5.3A-B). Transient transfection resulted in equivalent levels of the CEACAM3/4 chimeras; with transfection efficiencies ranging around 60 % of the cell population (Suppl. Figure 5.3A). Transfected cells were infected with fluorescein-labeled

OpaCEA protein-expressing N. gonorrhoeae for 1 hour (MOI 30) and bacterial binding and uptake by the transfected cells was quantified (Suppl. Figure 5.3C, Figure 5.2B). Importantly, the CEACAM3/4 chimera was able to mediate binding and uptake of the bacteria to a similar extent as CEACAM3 (Suppl. Figure 5.3C, Figure 5.2B). In contrast, the receptor lacking the cytoplasmic domain (CEACAM3/4 ∆CT) as well as the chimeric receptor with mutated ITAM-like sequence (CEACAM3/4 Y222/233F) showed similar association with bacteria, but failed to internalize the microbes (Suppl. Figure 5.3C, Figure 5.2B). These data demonstrate that the CEACAM4 cytoplasmic domain is able to trigger efficient internalization of bacteria and that this process depends on the tyrosine residues within the ITAM-like sequence.

110

Chapter III

 CEACAM4-initiated signals trigger internalization of bacteria To further verify that the CEACAM3/4 chimera is able to mediate bacterial uptake, we investigated infected cells by confocal laser scanning microscopy. Accordingly, 293 cells were transfected with the indicated mKate-tagged constructs or mKate alone and two days later the cells were infected for 1 hour with OpaCEA protein-expressing N. gonorrhoeae. Samples were fixed and extracellular bacteria were labeled with a polyclonal anti- gonococcal antiserum and Cy5-coupled goat-anti rabbit antibodies. Next, samples were permeabilized and bacteria were again stained with a polyclonal anti-gonococcal antiserum. In this case, a Cy2-coupled goat-anti rabbit antibody was chosen as secondary reagent allowing discrimination between intracellular (labeled with Cy2 only) and extracellular bacteria (labeled with Cy2 and Cy5). As expected, mKate transfected cells did not harbor intracellular bacteria and only very few bacteria were associated with the eukaryotic cells (Figure 5.2C). CEACAM3-transfected cells, in contrast, showed increased numbers of cell-associated bacteria and contained intracellular bacteria (Figure

5.2C). Similarly, OpaCEA protein-expressing bacteria were detected inside cells transfected with CEACAM3/4 demonstrating that the cytoplasmic domain of CEACAM4 is able to trigger bacterial phagocytosis. The chimeric receptor co-localized with cell-associated bacteria in agreement with the notion that OpaCEA protein-expressing gonococci bind to the extracellular, CEACAM3-derived IgV-like domain (Figure 5.2C). Importantly, neither cells expressing CEACAM3/4 ∆CT (lacking the CEACAM4 cytoplasmic domain) nor cells expressing CEACAM3/4 Y222/233F (with compromised CEACAM4 ITAM-like sequence) supported internalization of OpaCEA protein-expressing bacteria, while bacteria were associated with the cell membrane (Figure 5.2C). These results support the findings obtained by gentamicin protection assays and provide evidence that the CEACAM4 cytoplasmic domain can initiate the internalization of receptor-bound microorganisms. Similar to other phagocytic receptors such as the Fcγ receptor (FcγR), Dectin-1, or CEACAM3, the phagocytic properties of the chimeric receptor depend on a tyrosine-based motif in the cytoplasmic domain of CEACAM4.

111

Chapter III

Figure 5.2 The cytoplasmic domain of CEACAM4 is able to trigger efficient internalization of bacteria. (A) Schematic representation of CEACAM3 and CEACAM4, as well as the chimeric receptors. CEACAM3-

112

Chapter III derived regions are indicated by white bars, CEACAM4-derived regions are indicated by black and dark gray bars. Tyrosine residues and their mutations in the cytoplasmic domain are highlighted. Stars indicate the C- terminal fluorescent protein tag. (B) 293 cells were transfected with vectors encoding mKate or mKate- tagged CEACAM3, CEACAM3/4, CEACAM3/4 Y222/233F, or CEACAM3/4 ∆CT, respectively. Two days later, cells were infected with OpaCEA protein-expressing N. gonorrhoeae (MOI 30) for 1 hour and viable intracellular bacteria were measured by gentamicin protection assays. Bars represent mean ± standard deviations (n=3) of the internalized bacteria. (C) 293 cells were transfected as in (B) and infected with OpaCEA protein-expressing N. gonorrhoeae. Differential staining before and after cell permeabilization allowed the discrimination between extracellular bacteria as well as extra- and intracellular bacteria (total bacteria). Arrows highlight intracellular bacteria, which were only detected in cells expressing CEACAM3 or CEACAM3/4 WT. Arrowheads point to cell-associated, extracellular bacteria. Scale bars 10 µm.

 The ITAM-like sequence of CEACAM4 is tyrosine phosphorylated and mediates interaction with several SH2-domain containing proteins As the ITAM-like sequence derived from CEACAM4 was instrumental to drive phagocytosis by the CEACAM3/4 fusion protein, we wondered if this motif of CEACAM4 becomes tyrosine phosphorylated. Previously, CEACAM3 has been shown to be a substrate of Src family PTKs expressed by human granulocytes (McCaw et al., 2003; Schmitter et al., 2004; Schmitter et al., 2007a). In vitro, the CEACAM3 ITAM-like motif is efficiently phosphorylated by active viral Src (v-Src) (Buntru et al., 2011; Pils et al., 2012). Therefore, we transfected 293 cells with constructs encoding GFP-tagged CEACAM3, CEACAM4, or the CEACAM3/4 chimera together with or without a v-Src expression plasmid. Western blotting with a phospho-tyrosine specific monoclonal antibody confirmed that CEACAM3 is tyrosine phosphorylated upon co-expression with v- Src (Figure 5.3A). Likewise, CEACAM3/4 and CEACAM4 were tyrosine phosphorylated in 293 cells in the presence of v-Src (Figure 5.3A). Western Blotting of the lysates with antibodies directed against GFP or against v-Src confirmed comparable expression levels of the transfected constructs (Figure 5.3A). The phosphorylated ITAM-like sequence might connect stimulated CEACAM4 with downstream signaling molecules to drive phagocytosis. To screen for potential SH2-domain containing binding partners, we used a custom made SH2 domain microarray (Kopp et al., 2012). The microarray contained a variety of purified, recombinant GST-fused SH2 domains and was probed with lysates containing unphosphorylated or phosphorylated CEACAM4 generated by co-expression of v-Src. Western Blotting demonstrated that the used lysates contained equivalent levels of CEACAM4-GFP or GFP, yet CEACAM4-GFP was only tyrosine phosphorylated upon co- expression of v-Src (Suppl. Figure 5.3D). Detection of CEACAM4 bound to the array with an anti-GFP antibody revealed that phosphorylated CEACAM4 associated with the SH2 domains of several Src family PTKs

113

Chapter III

(Hck, Lck, and Yes), the amino-terminal SH2 domain of the PI3K regulatory domain γ (PI3KR3-N), and the Nck2 SH2 domain, whereas no binding was seen for the SH2 domains of the adapter proteins Grb2, Grb14, or Slp76 (Figure 5.3B). To confirm these potential binding interactions, classical GST-pull-down assays were performed and the precipitates were probed with anti-GFP antibodies to detect SH2-domain bound CEACAM4. In agreement with the results of the protein domain microarray, only phosphorylated CEACAM4-GFP, but not the unphosphorylated receptor, associated with the SH2 domains of Src PTKs, with the amino-terminal SH2 domain of PI3K, and with the Nck2 SH2 domain, whereas no binding was seen for the adapter proteins Grb14 and Slp-76 (Figure 5.3C). GST alone was not able to pull-down phosphorylated CEACAM4 from the lysates (Figure 5.3C). To ascertain that the receptor can directly interact with the different SH2 domains and to identify the involved tyrosine residues, we employed synthetic peptides spanning either the membrane proximal (Tyr222) or the membrane distal (Tyr233) tyrosine residue of the CEACAM4 ITAM-like sequence (Figure 5.3D). The corresponding peptides were synthesized either in the unphosphorylated or in the phosphorylated form on nitrocellulose filters (Frank, 1992), and probed with the purified SH2 domains or GST alone. Importantly, whereas GST was unable to bind, the purified SH2 domains of Yes, Nck2, and the amino-terminal SH2 domain of PI3K associated with synthetic CEACAM4 phospho-peptides, indicating that binding of these SH2 domains is based on a direct protein-protein interaction (Figure 5.3D). In line with the GST-pull- down analyses, binding did not occur for the unphosphorylated peptides (Figure 5.3D). Interestingly, both phosphotyrosine residues of the CEACAM4 ITAM sequence served as binding sites for multiple SH2 domains (Figure 5.3D). These results demonstrate that the phosphorylated ITAM sequence of CEACAM4 is able to directly associate with a set of SH2-domain containing proteins, including Src family PTKs, the adapter protein Nck2 as well as PI3KR3 and that this interaction is supported by both tyrosine residues (pTyr222 and pTyr233) of the CEACAM4 ITAM sequence. This situation is clearly distinct from CEACAM3, where SH2 domain-mediated binding of protein and lipid kinases or adaptor proteins has only been reported for the membrane proximal tyrosine residue (CEACAM3 pTyr230) (Buntru et al., 2011; Kopp et al., 2012; Schmitter et al., 2007a). Indeed, similar to the previous observations, the SH2 domain of the Src PTK Yes only associated with phosphorylated Tyr230 of CEACAM3 (Figure 5.3E).

Interestingly, the CEACAM4 tyrosine-based motif (YxxLx(7)YxxI) strictly corresponds to the canonical ITAM signature (YxxL/Ix(6–12)YxxL/I) (Reth, 1989) found in the T-cell

114

Chapter III receptor ζ-chain or the activating FcγRs. In contrast, the membrane distal tyrosine residue

(CEACAM3 Tyr-241) in the ITAM-like sequence of CEACAM3 (YxxLx(7)YxxM) deviates from this consensus and only the membrane proximal tyrosine residue of CEACAM3, Tyr230 corresponds strictly to the ITAM consensus. In this respect, CEACAM3 shares similarities with the phagocytic receptor Dectin-1, where a single, membrane-proximal tyrosine-based motif is sufficient for Dectin-1-induced signal transduction (Rogers et al., 2005; Underhill et al., 2005).

Figure 5.3 CEACAM4 is tyrosine phosphorylated and directly binds to specific SH2 domains. (A) 293 cells were transfected with plasmids encoding GFP-tagged CEACAM3, CEACAM4, or CEACAM3/4 WT. As indicated, cells were co-transfected with v-Src. Phosphorylated CEACAMs were detected with a monoclonal anti-phosphotyrosine antibody (upper panel). Equivalent expression of the receptors (second

115

Chapter III panel), v-Src (third panel), and protein content (bottom panel) were verified by western blotting of whole cell lysates (WCL) with mAbs against GFP, v-Src, or tubulin, respectively. (B) 293 cells were transfected with CEACAM4-GFP with or without v-Src as in (A). Lysates containing p-CEACAM4 or CEACAM4 were prepared and used to probe protein domain microarrays encompassing the indicated SH2 domains spotted in the form of GST fusion proteins. pCEACAM4-GFP or CEACAM4-GFP bound to individual spots were detected by anti-GFP antibodies and quantified. Extent of pCEACAM4-binding versus CEACAM4-binding was calculated and the values were normalized to the amount of immobilized GST-SH2 domains at individual spots as detected by a monoclonal anti-GST antibody. Bars represent the mean ± standard deviations of four determinations. (C) Lysates as in (B) were employed in GST-pull-down assays with the indicated SH2 domains fused to GST or with GST alone. Precipitates were probed with a monoclonal anti- GFP antibody for the presence of CEACAM4 (upper panel). Equal amounts of the GST-fusion proteins used in the pull down were verified by Coomassie staining of the membrane (lower panel). (D) Peptide spot membranes harboring synthetic 15-mer peptides surrounding the indicated tyrosine residues of the CEACAM4 cytoplasmic domain in the un-phosphorylated (Y) or the tyrosine-phosphorylated (pY) form were probed with GST-PI3K-N-SH2, GST-PI3K-C-SH2, GST-cYes-SH2, GST-Nck2-SH2, or GST only. Bound GST-fusion proteins were detected with monoclonal anti-GST antibody. (E) Spot membranes harboring the indicated 15-mer peptides derived from the CEACAM3 cytoplasmic domain were probed with GST or GST-cYes-SH2 as in (D).

It will be interesting to evaluate in the future, which signaling connections are shared between CEACAM3, CEACAM4, and potentially Dectin-1, and which are not. For example, CEACAM3 has the peculiarity to directly associate with Vav, a guanine nucleotide exchange factor for the small GTPase Rac (Schmitter et al., 2007a). Via this direct link to Vav, CEACAM3 has a pronounced effect on cellular Rac-GTP levels in response to bacterial binding (Schmitter et al., 2004). The direct association of Vav with the phosphorylated receptor might also explain, why CEACAM3-initiated phagocytosis is independent of phosphatidylinositol 3’ kinase activity (Buntru et al., 2011), which is an essential element in phagocytosis via FcγRs (Araki et al., 1996; Indik et al., 1995). Therefore, it remains to be seen, if and how CEACAM4 is connected to additional cellular components known to mediate signaling downstream of CEACAM3.

 The CEACAM4 ITAM recruits specific SH2-domain containing proteins upon bacterial engagement Our biochemical analysis demonstrated association of various SH2 domains with the phosphorylated cytoplasmic domain of CEACAM4 in vitro. To analyze if this interaction also occurs in the context of the intact cell and if it can occur upon bacterial ligation of the receptor, 293 cells were transfected with CEACAM3/4-GFP together with different SH2 domains fused to the red-fluorescent protein mKate or with mKate alone. Two days later, the transfected cells were infected with PacificBlue-labeled OpaCEA protein-expressing N. gonorrhoeae and the bacteria-triggered clustering of the receptor and the potential recruitment of the SH2 domains was monitored by confocal microscopy. Clearly, no

116

Chapter III recruitment of mKate alone was observed, when bacteria engaged the chimeric receptor (Figure 5.4A). Similarly and in line with the results obtained by GST-pull-down assays, the Slp76-SH2 domain was also not recruited to the subcellular contact sites between the bacteria and CEACAM3/4 (Figure 5.4A). In striking contrast, a strong local enrichment of the Yes-SH2 domain, the PI3KR3 amino-terminal SH2 domain, and the Nck2 SH2 domain was observed at the sites, where gonococci co-localized with the receptor (Figure 5.4A). These results not only demonstrated that CEACAM-binding bacteria are able to locally cluster the chimeric receptor, but the clear subcellular recruitment of selected SH2 domains also suggested that the clustered receptor is tyrosine phosphorylated and interacts with specific SH2 domains in intact cells.

 Src family kinases mediate phosphorylation of the CEACAM4 ITAM, which is required for phagocytosis To further investigate, if tyrosine phosphorylation and the recruitment of particular enzymes are of functional relevance for a potential CEACAM4-mediated phagocytosis, we first analyzed the phosphorylation of the CEACAM3/4 chimera in response to bacterial engagement. Therefore, we infected cells expressing CEACAM3-GFP or CEACAM3/4-

GFP for 60 min with OpaCEA protein-expressing N. gonorrhoeae or left the cells uninfected. Upon immunoprecipitation with anti-GFP antibodies, we observed tyrosine phosphorylation of both proteins in response to infection with CEACAM-binding bacteria (Figure 5.4B). Additionally, probing of the precipitates with anti-CEACAM antibodies confirmed that similar amounts of the receptors were precipitated from uninfected and infected cells (Figure 5.4B). Together, these results provide evidence that the ITAM of CEACAM4 can become tyrosine phosphorylated upon bacterial engagement and clustering of the receptor. Next, we focused on Src family PTKs, which have been shown to be critical downstream signaling elements in CEACAM3-mediated uptake (Hauck et al., 1998; McCaw et al., 2004; Schmitter et al., 2007b) and applied the Src PTK inhibitor PP2 during in vitro infection with N. gonorrhoeae. In line with the known role of Src family

PTKs, the pharmacological inhibitor severely reduced uptake of OpaCEA protein-expressing gonococci by CEACAM3-expressing 293 cells (Figure 5.4C). In a similar manner, PP2 treatment strongly impaired bacterial internalization via the CEACAM3/4 chimera (Figure 5.4C). These results demonstrate that Src family PTKs not only associate with the cytoplasmic domain of phosphorylated CEACAM4, but are of functional relevance for the opsonin-independent uptake, which can be triggered by the CEACAM4 ITAM sequence.

117

Chapter III

Figure 5.4 The CEACAM4 cytoplasmic domain is phosphorylated following bacterial engagement, recruits SH2 domains, and requires Src kinase activity for phagocytosis. (A) 293 cells were co- transfected with CEACAM3/4-GFP together with plasmids encoding mKate or the mKate-tagged SH2

118

Chapter III domains derived from PI3K regulatory subunit 3 (PI3KR3), c-Yes, Nck2, or Slp76, respectively. Cells were infected with PacificBlue-labeled OpaCEA protein-expressing N. gonorrhoeae (Ngo OpaCEA) at MOI 30 for 30 min, fixed, and analyzed by confocal microscopy. Bacterial binding to the clustered receptor is indicated by white arrowheads. Specific SH2 domains are recruited to bacteria-engaged, clustered receptor (arrowheads). Insets depict magnifications of selected bacteria-CEACAM3/4 clusters in the mKate channel to highlight SH2 domain recruitment. Scale bars 10 µm. (B) 293 cells were transfected with vectors encoding GFP, CEACAM3-GFP, or CEACAM3/4-GFP, respectively, and infected or not for 1 hour with OpaCEA protein- expressing N. gonorrhoeae (Ngo OpaCEA). Lysates were used in immunoprecipitations (IP) with a polyclonal anti-GFP-antibody. Precipitates were sequentially probed with a monoclonal anti-phosphotyrosine antibody (upper panel) and a monoclonal anti-GFP antibody (middle panel). Equivalent protein content in the used whole cell lysates (WCL) was verified by blotting with monoclonal anti-tubulin antibody (lower panel). (C) 293 cells were transfected with plasmids encoding mKate, CEACAM3-mKate, or CEACAM3/4-mKate. As indicated, cells were infected for 1 hour with OpaCEA protein-expressing gonococci at MOI 30. 15 min before infection, cells were treated or not with the Src kinase inhibitor PP2 (10 µM). Uptake of the bacteria was analyzed by gentamicin protection assays. The bars show mean values ± standard deviations (n=3) relative to the uptake observed for CEACAM3 in the absence of PP2 treatment.

Together, our results suggest that tyrosine phosphorylation of CEACAM4 by Src family PTKs allows this receptor to initiate phagocytosis of bound bacteria.

5.5 Conclusion

In this study, we have taken advantage of the modular nature of CEACAMs and created chimeric proteins to study the function of the orphan receptor CEACAM4. Up to date, the absence of the CEACAM4 gene in rodents and the lack of a known ligand have been the major roadblocks for an in-depth study of this membrane protein. To address this problem, we exchanged the extracellular, amino-terminal IgV-like domain of CEACAM4 with the corresponding domain of CEACAM3. Therefore, the resulting chimeric CEACAM3/4 fusion protein consisted of the bacteria-binding domain of CEACAM3 fused to the transmembrane and cytosolic parts of CEACAM4 and allowed us to probe cellular processes initiated by CEACAM4. Using this chimeric protein, we were able to demonstrate that the cytoplasmic ITAM-like sequence of CEACAM4 becomes tyrosine phosphorylated upon ligand-mediated receptor clustering. Furthermore, we identified several potential direct binding partners of phosphorylated CEACAM4, and we provide evidence that Src family PTKs play a critical role in orchestrating receptor-triggered signaling. Together, our in vitro data indicate that the orphan receptor CEACAM4 can support efficient phagocytosis of particulate ligands. Due to the exclusive presence of the CEACAM4 gene in the primate lineage and due to the expression of this gene in professional phagocytes, we hypothesize that this receptor provides an interesting, primate-

119

Chapter III specific contribution to the function and/or regulation of our species’ immune system. The identification of a physiological ligand, be it an endogenous structure or a human- associated microorganism, could be the next step in elucidating the fascinating biology behind this protein.

5.6 Supplementary figures

Suppl. Figure 5.1 Alignment of the primary structure of CEACAM3 and CEACAM4 and mRNA expression of CEACAM3 / CEACAM4 in transfected 293 cells. (A) The amino acid sequences of CEACAM3 (UniProt: P40198) and CEACAM4 (UniProt: O75871) were aligned using CLUSTALW. Identical amino acids are indicated by “.”, whereas “-“ mark spaces introduced to maximize homology. The amino-terminal signal peptide, the extracellular IgV-like domain, the transmembrane domain, and the

120

Chapter III cytoplasmic part are indicated as shown in the box. Both proteins harbour an intracellular immunoreceptor tyrosine-based activation motif (ITAM)-like sequence (underlined) that in the case of CEACAM4 closely resembles the indicated ITAM-consensus sequence. (B) The predicted beta-strands (A-G) of the extracellular IgV-like domain (according to the crystal structure of murine CEACAM1; Tan K. et al. (2002) EMBO J. 21: 2076-86) are marked. Amino acid differences between CEACAM3 and CEACAM4 are highlighted by yellow color. (C) 293 cells were transfected with the empty pLPS-3’-EGFP vector or the same plasmid encoding CEACAM3 or CEACAM4, respectively. Total RNA was isolated and mRNA was reverse transcribed using OligodT primers. Quantitative Real-time PCR using Tacman probes specific for either CEACAM3 or CEACAM4 gene sequences was performed to demonstrate the specificity of the used primer sets. Indeed, CEACAM3-specific primers only yielded a PCR fragment in CEACAM3-transfected, but not CEACAM4-transfected cells, whereas CEACAM4-specific primers did not amplify a PCR product in CEACAM3-transfected 293 cells.

Suppl. Figure 5.2 CEACAM3 and CEACAM4 protein expression in transfected 293 cells. Opa protein expression by Neisseria gonorrhoeae. (A) 293 cells were transfected with vectors encoding GFP, CEACAM3-GFP, or CEACAM4-GFP, respectively. and two days later, whole cell lysates (WCLs) were prepared. WCLs were separated by SDS-PAGE and CEACAM expression was confirmed by western blotting with a monoclonal anti-GFP antibody. (B) Opa protein expression by the bacteria was verified by western blotting using a monoclonal anti-Opa antibody with lysates derived from N. gonorrhoeae (Ngo), - expressing OpaCEA protein (Ngo OpaCEA) or lacking Opa protein expression (Ngo Opa ).

121

Chapter III

Suppl. Figure 5.3 Expression of CEACAM3/4 chimeric proteins and v-Src-mediated tyrosine phosphorylation of CEACAM4. (A) 293 cells were transfected with pcDNA or pLPS3’mKate encoding CEACAM3, CEACAM3/4 WT, CEACAM3/4 ∆CT, and CEACAM3/4 Y222/233F or left untransfected. Two days later, cells were analyzed by flow cytometry (10000 cells per sample) for CEACAM-mKate expression. Values represent the percentage of mKate-positive cells. In all cases, transfection efficiency of the mKate fusion proteins was higher than 50 %. (B) Cells were transfected as in (A). An additional sample was transfected with an mKate encoding plasmid. Whole cell lysates (WCL) of the transfected cells were prepared and analyzed for mKate expression by western blotting with anti-mKate antibodies. Multiple faster migrating bands appear in the sample containing CEACAM3/4 ∆CT, which are recognized by the mKate antibody. These bands presumably represent immature (un- or hypo-glycosylated) forms of the protein, which do not seem to occur for the wildtype chimera or the ITAM-mutant, indicating a role for the cytoplasmic domain of CEACAM4 in passage through secretory compartments. (C) 293 cells were transfected with vectors encoding mKate or mKate-tagged CEACAM3, CEACAM3/4, CEACAM3/4 Y222/233F, or CEACAM3/4 ∆CT, respectively. Two days later, cells were infected with OpaCEA protein- expressing N. gonorrhoeae (MOI 30) for 1 hour and total cell-associated bacteria were measured by bacterial binding assays. Bars represent mean ± standard deviations (n=3) of total cell-associated bacteria. (D) 293 cells were transfected with vectors encoding GFP or CEACAM4-GFP and cotransfected as indicated with v- Src. WCL were analyzed for expression of GFP or CEACAM4-GFP by western blotting using a monoclonal anti-GFP antibody (upper panel). The same samples were probed with an antibody against phosphotyrosine (anti-pY72; lower panel). The results demonstrate that CEACAM4 is strongly tyrosine phosphorylated in the presence of v-Src. In contrast, tyrosine phosphorylation of CEACAM4 is not detectable under these conditions in the absence of v-Src

122

Chapter III

5.7 Acknowledgments

We thank T.F. Meyer (MPI for Infection Biology, Berlin, Germany) for the Neisseria strains used in this study, W. Zimmermann (Ludwig-Maximilians-Universität, München, Germany) for providing CEACAM cDNA, R. Frank (Leibniz-Institut für Molekulare Pharmakologie, Berlin, Germany) for synthesis of peptide spot membranes, and R. Hohenberger-Bregger and S. Feindler-Boeckh for expert technical assistance. This study was supported by funds from the DFG (Ha2568/6-2) to CRH and the Swiss National Science Foundation (31003A_143739) to MPT. JGDT acknowledges support by the DAAD (Deutscher Akademischer Austauschdienst).

123

Chapter IV

6 Chapter IV

Finding bacterial ligand of the orphan receptor CEACAM4

Julia Delgado Tascón1, Tancred Frickey2, and Christof R. Hauck1,3

1 Lehrstuhl für Zellbiologie, Universität Konstanz, 78457 Konstanz, Germany 2 Lehrstuhl für angewandte Bioinformatik, Universität Konstanz, 78457 Konstanz, Germany 3 Konstanz Research School Chemical Biology, Universität Konstanz, 78457 Konstanz, Germany

In preparation

124

Chapter IV

6.1 Abstract

The human CEACAM family comprises a particular receptor, CEACAM4, for which no ligand is currently known. Due to the absence of the CEACAM4 gene in rodents and the lack of a bona fide ligand, the function of this CEACAM remains to be elusive. CEACAM family members are mostly expressed on epithelial or endothelial cells, where they can be exploited by different pathogenic bacteria to successfully colonize the human body. However, CEACAMs can also be expressed in the myeloid lineage and help innate immune cells to phagocytose and eliminate invading bacteria. Interestingly, CEACAMs are not only able to bind pathogenic bacteria, but also to commensal bacteria including Neisseria lactamica and, recently, Prevotella species. The fact that pathogenic CEACAM- binding bacteria so far have not be able to bind CEACAM4, open the question whether CEACAM4 could instead interact with commensal bacteria. This study aimed to screen for a CEACAM4 bacterial ligand within the human intestinal flora. For this purpose, human stool samples from 10 healthy volunteers were pooled. A soluble GFP fusion protein of the N-terminal domain of CEACAM4 was utilized to capture and enrich putative CEACAM4- binding bacteria, which were subsequently isolated by affinity isolation. From the isolated bacterial population, next generation 16S rRNA sequencing was conducted followed by cluster analysis of sequences (CLANS) and SILVA database searches for identification of potential CEACAM4 binding bacteria. Bioinformatic analyses identified two phyla (Firmicutes and Bacteroidetes) with a meaningful enrichment in the CEACAM4-associated bacteria. Therefore, isolated species of Prevotella, Clostridiales and Selenomonadales were tested in CEACAM4-pull downs. However, a specific binding of commensal bacteria to CEACAM4 could not be confirmed biochemically. Therefore, improvements of the used setup are suggested to be implemented for futures efforts in the search for a ligand of the orphan receptor CEACAM4.

6.2 Introduction

The CEACAM gene-encoding proteins are widely expressed and display a big diversity between the different mammalian lineages. Genes of the human CEACAM family are encoded on the chromosome 19 and belong to the 139 fastest evolving human genes most likely due to a species-specific coevolution between hosts and bacteria. (Kammerer and Zimmermann, 2010; Zid and Drouin, 2013). The human CEACAM family Members are

125

Chapter IV prominently expressed in epithelial, endothelial cells and leukocytes, therefore, they have a wide range of biological functions including general cellular processes such as cell adhesion, differentiation, proliferation, survival as well as mediating innate immune responses (Kuespert et al., 2006). CEACAMs can be exploited for bacterial pathogens to enter and successfully colonize mucosal surfaces of the human body (Barnich et al., 2007; Chen and Gotschlich, 1996; Gray-Owen et al., 1997a; Hill et al., 2001; Hill and Virji, 2003; Sauter et al., 1993; Schmitter et al., 2004; Tchoupa et al., 2014; Virji et al., 1996). However, similar to pattern recognition receptors (PRRs) like Toll-like receptors (TLRs), CEACAMs expressed on leukocytes can recognize invading microorganisms and initiate an opsonin independent immune response to combat infection. Apart from human-specific bacterial pathogens like Neisseria gonorrhoeae, Neisseria meningitidis, Haemophilus influenzae, Moraxella catarrhalis as well as some strains of pathogenic Escherichia coli, CEACAMs are also able to recognize non-pathogens microbes like Neisseria lactamica which provides a protective mechanism against Neisseria meningitidis (Evans et al., 2011; Toleman et al., 2001). Moreover, a recent study has reported that human CEACAMs can also bind commensal bacteria like Prevotella species (Roth, 2013). In this line, it is proposed that PRRs may have evolved to mediate the bidirectional crosstalk between commensals and their hosts to maintain beneficial, symbiotic coexistence with the microbiota (Chu and Mazmanian, 2013). It is known that humans contains over 10 times more microbial cells than human cells, so our body is host to a wide variety of microbial communities (called microbiota or commensal microflora) important for the normal development of the immune system (Qin et al., 2010). Remarkably, bacterial receptors not only recognize pathogens, but rather (besides virulence factors) they can recognize other bacterial patterns that are shared by entire classes of bacteria, which can be produced by commensal microorganisms as well. However, differences between these two groups of microorganisms or how exactly the host distinguishes receptor- activation between pathogenic and commensal bacteria, are not well understood. Members of the human CEACAM family share high similarities in protein structure as well as bacterial ligands in a species-specific manner (Kammerer et al., 2007; Kammerer and Zimmermann, 2010; Voges et al., 2010). CEACAM4 is an orphan receptor of the human CEACAM family and exclusively expressed by human granulocytes. The study of this CEACAM had been neglected during the last decades mainly due to the lack of CEACAM4 in rodents or a bona fide ligand for this membrane protein. Interestingly, CEACAM3 is a closely related receptor which is also restrictedly expressed on granulocytes and acts as a

126

Chapter IV single chain phagocytic receptor initiating the detection, internalization, and destruction of a limited set of human-restricted bacteria (Buntru et al., 2012). However, so far no CEACAM-binding bacteria are known to bind to CEACAM4, opening the question whether CEACAM4 can promote beneficial interactions between host and engaged microbes from normal microbiota or commensal bacteria. Since gastrointestinal tract is the primary site of interaction, between the host immune system and microorganisms (symbiotic or pathogenic), gut microbiota play a crucial role to shape immune responses during health and disease (Round and Mazmanian, 2009). In the present study we aimed to identify a bacterial ligand of CEACAM4 from human gut microbiota by next generation sequencing of 16S rRNA genes. For this purpose, soluble proteins of the amino N-terminal domain of CEACAM4 was used to pull-down potential CEACAM4-binding bacteria from human stool samples of 10 healthy volunteers. 16S rRNA gene pyrosequencing was employed for bacterial identification. From around 600.000 sequences, cluster analysis of sequences (CLANS) and SILVA database identified sequences enriched in CEACAM4 samples compared to the input and sequences from two bacterial phyla (Firmicutes and Bacteroidetes) were identified. Unfortunately, subsequent biochemical analysis of bacterial candidates could not show any significant binding to N- terminal domain of CEACAM4. Therefore, our data could not provide further insight on the CEACAM4 binding profile under the conducted set-up. For futures studies, an adaptation of the used approach is needed to successfully identify potential microbial ligands of CEACAM4.

6.3 Material and Methods

 Cell culture Human embryonic kidney epithelial 293T cells (293 cells) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10 % CS. Cells were grown at 37 °C in 5

% CO2 and subcultured every 2-3 days.

 Recombinant DNA constructs Mammalian expression plasmids encoding soluble GFP-tagged N-terminal domains of human CEACAM1, CEACAM3, CEACAM4 CEACAM5 (CEA), CEACAM6 or CEACAM8, as well as canine CEACAM1 were described previously (Kuespert et al., 2007; Voges et al., 2010). Plasmid pRc/CMV encoding cDNA of human CEACAM7

127

Chapter IV

(provided by W. Zimmermann, Universitätsklinikum Grosshadern, München, Germany) was used as a template for PCR amplification of the N-terminal domain of CEACAM7 with primers CEA7-NT-IF-sense 5’- GAAGTTATCAGTCGACACCATGGGTTCCCCTTCAGCC-3’ and primer CEA7-NT- IF-anti 5’- ATGGTCTAGAAAGCTTTGCTTGAAGTACTCTGGGTGCGAGAATACGTAGAATT GTCTGG-3’. The resulting PCR fragment were cloned into pDNR-Dual using the In- Fusion PCR Cloning Kit (Clontech, Mountain View, CA), verified by sequencing and transferred by Cre-mediated recombination into pLPS-3′EGFP (Clontech), resulting in a GFP fused protein to the carboxy-terminus of CEACAM7 (N-CEACAM7).

 Expression of CEACAM soluble N-terminal domains Expression of the soluble GFP fusion proteins in 293 cells were performed as described previously (Kuespert et al., 2007; Schmitter et al., 2004). Briefly, 293 cells were transfected by standard calcium-phosphate co-precipitation with 7 µg of plasmid DNA in 10 cm culture dish and 24 hour later, culture medium was replaced by OptiMem (Gibco BRL). After 72 hours, the cell culture medium (supernatant) containing the GFP-tagged N- terminal domain of CEACAMs (N-CEACAM) was collected and kept at 4 °C or for long term storage at -20 °C.

 Bacterial strains and Growth conditions Gram-negative bacteria, Neisseria gonorrhoeae non-piliated MS11 strains: CEACAM- binding Opa protein strain N309 (Ngo OpaCEA) or non-CEACAM binding strain N302 (Ngo Opa-) (Kupsch et al., 1993a) were kindly provided by Thomas Meyer (Max-Planck- Institut für Infektionsbiologie, Berlin, Germany) and cultured as described previously (Schmitter et al. 2004). Anaerobic Gram-negative Prevotella strains: Prevotella intermedia (DSM-20706), Prevotella nigrescens (DSM-13386), Prevotella timonensis (DSM-22865) and Prevotella copri (DSM-18205) were obtained from the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ). Prevotella strains were grown anaerobically at 37°C in Hungate Anaerobic tubes (16 x 125 mm complete tubes, Dunn Labortechnik, Germany) with modified peptone yeast based medium (104 PYG medium, DSMZ) supplemented with sodium thioglycolate (500 mg/ml) or in chopped meat carbohydrate broth (pre-reduced

128

Chapter IV medium in Hungate tubes, BD) for Prevotella timonensis. Prevotella were subcultured every 3 days. Gram-positive bacteria, Megasphaera cerevisiae (DSM-20462), Megasphaera elsdenii (DSM-20460), Flavonifractor plautii (DSM-4000) and Eubacterium siraeum (DSM- 15702) were obtained from the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ). Megasphaera strains were grown anaerobically at 37 °C in Hungate Anaerobic tubes (16 x 125 mm complete tubes, Dunn Labortechnik, Germany) with peptone yeast based medium (104b PY +X medium, DSMZ). Flavonifractor plautii, Eubacterium siraeum and clostridium strains were grown anaerobically at 37°C in Hungate Anaerobic tubes (16 x 125 mm complete tubes, Dunn Labortechnik, Germany) with modified peptone yeast based medium (104 PYG medium, DSMZ). DSMZ mediums were supplemented with sodium thioglycolate (500 mg/ml) and bacteria were subcultured every 3 days.

 Coupling of soluble GFP fusion CEACAM proteins to micro-magnetic GFP beads Anti-GFP magnetic beads were coupled with soluble GFP fusion proteins by a fast magnetic immunoprecipitation using the µMACS GFP Isolation Kit (Miltenyi Biotec). 50 µl of micro-magnetic bead suspension was incubated with soluble CEACAM domains or only GFP as a control (1:20 dilution) for 30 min on ice. Samples were loaded onto an equilibrated MACS column (200 µl lysis buffer in a MS 25 column, Miltenyi Biotec) placed in the magnetic field of a miniMACS separator. Each sample-bead solution was retained in the column during the washing steps (five times with 200 µl of wash buffer 1 and once with 200 µl of wash buffer 2). Columns were removed from the separators and samples were eluted with 50 µl PBS. After elution, CEACAMs and control-bead solution was stored at 4 °C for a maximum of 2 hour prior to use.

 Enrichment of CEACAM-binding bacteria by magnetic bead isolation 1 gr of fresh human stool samples from healthy volunteers were diluted in 10 ml PBS and filtrated through an acrodisc PSF syringe filter (PALL Corporation) with a pore size of 10 µm. The filtrated stool samples were incubated with protein-coupled beads (1:20 dilution) for 30 min at RT under rotation. A MACS column (MS 25, Miltenyi Biotec) was placed in the MiniMACS separator and equilibrated with 200 µl of lysis buffer. Afterwards, the stool sample-protein-bead solution was applied onto the column. The column was washed three times with 200 µl PBS-T and two times with 200 µl PBS. The column was removed from

129

Chapter IV

the separator and the bound bacteria were eluted with 50 µl double distilled water (ddH2O). Samples were boiled for 10 min. Cell debris was precipitated (1400 x g, 10 min) and supernatants were collected.

 454 next generation sequencing of microbial 16S rRNAs The universal primer pair 8F-338R covering the hypervariable regions V1 and V2 of the 16S ribosomal RNA (16S rRNA) gene were used to amplify short amplicons (fragments of 368 bp) of bacterial DNA from 16S rRNA. These primers are fused with multiplex identifier (MID) adaptors for the GS FLX Titanium sequencing. DNA libraries were prepared with amplicon fusion primers MID-labelled (10-nuleotide sequence tag) (Table 6.1). Reverse primers contained the 454 Life Sciences GS FLX Titanum primer A sequences, followed by the MID-10-base barcode; a CA nucleotide-linker and the broad- range bacterial primer 338R (bold letters). Forward primer contained the 454 Life Sciences GS FLX Titanum primer B sequence, a TC nucleotide-linker and the broadly conserved bacterial primer 8F (bold letters). Aapproximately 100 ng of DNA template was added to a PCR reaction mix containing 1 µl Pfu polymerase, 5 µl of 10x buffer, dNTPs and 10 µM of the 16S rRNA primers to a final volume of 50 µl. Following an initial denaturation step at 94 °C for 3 min, PCR was cycled 30 times at 94 °C / 20 s, 55 °C / 30 s and 72 °C / 60 s, and a final extension at 72 °C for 5 min. Negative controls were run on both, bacterial DNA enrichment and 16S rRNAs PCR. The amplified amplicons were purified with the QIAquick gel extraction kit (Qiagen) and quantified using the PicoGreen Assay Kit (Invitrogen). Subsequently, DNA libraries were immobilized onto beads, clonally amplified by emulsion PCR (emPCR amplification) and pooled for sequencing in a multiplex fashion on the genome sequencer FLX instrument (454 FLX Titanum pyrosequencer, Genomic Center, University of Konstanz). Samples were pooled in two regions of the PicoTiterPlate (PTP) device (GS FLX Titanium PicoTiterPlate Kit 70x75, Roche) and sequencing reads were done in duplicates. Following sequencing, pooled libraries were identified by their MID tag and correctly assigned.

Table 6.1 16S rRNA fusion primers

Amplicon Primer Sequence

Reverse PrimerA-MiD1-338R CCATCTCATCCCTGCGTGTCTCCGACTCA GACGAGTGCGTCATGCTGCCTCCCGTA GGAGT

130

Chapter IV

Control PrimerA-MiD10-338R CCATCTCATCCCTGCGTGTCTCCGACTCA GFP GTCTCTATGCGCATGCTGCCTCCCGTA GGAGT CEACAM1- PrimerA-MiD11-338R CCATCTCATCCCTGCGTGTCTCCGACTCA GFP GTGATACGTCTCATGCTGCCTCCCGTA GGAGT CEACAM3- PrimerA-MiD13-338R CCATCTCATCCCTGCGTGTCTCCGACTCA GFP GCATAGTAGTGCATGCTGCCTCCCGTA GGAGT CEACAM4- PrimerA-MiD14-338R CCATCTCATCCCTGCGTGTCTCCGACTCA GFP GCGAGAGATACCATGCTGCCTCCCGTA GGAGT CEACAM5- PrimerA-MiD15-338R CCATCTCATCCCTGCGTGTCTCCGACTCA GFP GATACGACGTACATGCTGCCTCCCGTA GGAGT CEACAM6- PrimerA-MiD16-338R CCATCTCATCCCTGCGTGTCTCCGACTCA GFP GTCACGTACTACATGCTGCCTCCCGTA GGAGT CEACAM7- PrimerA-MiD17-338R CCATCTCATCCCTGCGTGTCTCCGACTCA GFP GCGTCTAGTACCATGCTGCCTCCCGTA GGAGT CEACAM8- PrimerA-MiD18-338R CCATCTCATCCCTGCGTGTCTCCGACTCA GFP GTCTACGTAGCCATGCTGCCTCCCGTA GGAGT Input PrimerA-MiD19-338R CCATCTCATCCCTGCGTGTCTCCGACTCA GTGTACTACTCCATGCTGCCTCCCGTA GGAGT Forward PrimerB-F8 CCTATCCCCTGTGTGCCTTGGCAGTCTCA GTCAGAGTTTGATCCTGGCTCAG

 Sequence analysis SILVA ribosomal RNA database were used to analyze the 454 sequencing reads in order to identify CEACAM-enriched bacteria. The replicates of pooled samples resulted in 600.000 sequences with an average length of 368 bp, for a total of more than 212 Million bases. 16S rRNA library sequences were analysed and sorted by fold-change, which showed significant differences in abundance of experimental conditions over control (CEACAM4- enriched bacteria vs. stool sample input and GFP-enriched bacteria). All sequences were clustered using the cluster database at high identity with tolerance (cd-hit).cd-hit at 97 % of identity (dataset). Number of sequences combined in each cluster provides the respective abundance of each fragment-type (cluster representative). By taking into account the respective abundances of fragments over the experimental conditions and replicate experiments (SET1 referring to plate-1 samples and SET2 to plate-2 samples), a standard T-test (using the Statistics::TTest module in Perl, testing for unequal variance) was used to

131

Chapter IV assign each change in abundance a p-value. A significant difference of 5 % in abundance was used between the control and experimental conditions (sequences of interest). Using the 16S rRNA sequences present in the SILVA database (V104, Quast et al. 2013) we attempted to identify which bacteria was found to be associated. First, all SILVA small subunit (SSU)-rRNA sequences were clustered using cd-hit at 97 % identity. The cluster representatives (18 sequences) were combined with our fragment sequences of interest and the combined set was then analysed using cluster analysis of sequences (CLANS). Afterwards, we checked whether any of our sequences of interest were not in the bacterial group. After this step, we only used bacterial sequences from the SILVA database. Taking the full set of bacterial sequences from the SILVA database, we then excluded sequences annotated as 'unidentified', 'environmental sample', 'unknown', 'metagenome' or 'uncultured' (363 sequences). Subsequently, the set was sorted using cd-hit at 97% identity, resulting in a total of 4167 sequences. The combined set of sequences was then clustered using CLANS. CLANS performs an all-against-all BLAST comparison of sequences and represents them as dots in 3D-space. By using this 3D CLANS map, all major bacterial families/groupings from the SILVA database were able to be identified and placed into a taxonomic context. Each sequence is assigned an 'attraction' value to every other sequence based on their reciprocal BLAST hits. The score of the hit was divided by the length of the hit to provide us with a score-per-column value. The score-per-column value was used as the similarity metric and determined the respective attraction of sequences to each other. By equilibrating the graph in 2D or 3D space, sequences similar to each other move into close proximity while sequences of lesser similarity are located more distantly from each other. This leads to a clustered representation of sequence-space, with large clouds of dots representing large groups of sequences with greater than average similarity to each other.

 Pull-down assays of CEACAM-associated bacteria Associated-CEACAM bacteria identified by SILVA analysis were used for binding studies as described before (Kuespert et al., 2007). Briefly, overnight grown Neisseria were taken from a GC agar plate, or 48 hours grown anaerobic bacteria were taken from respective growing mediums and suspended in PBS. Colony forming units (cfu) were estimated by optical density (OD) readings according to their standard growth curve (Neisseria OD550; anaerobic bacteria OD600). Bacteria were added to cell culture supernatants containing CEACAM N-terminal domains in a total volume of 1 ml. After 1 hour of incubation at 20 °C under constant rotation, the bacteria were washed twice with PBS and boiled in SDS

132

Chapter IV sample buffer prior to SDS-PAGE and western blotting. To detect GFP fusion proteins, a monoclonal antibody against GFP (clone JL-8, Clontech) was used. Secondary antibody was from Jackson ImmunoResearch (West Grove, PA).

6.4 Results

 Enrichment of human gut microbiota for novel CEACAM-binding bacteria To identify possible bacterial ligands of the CEACAM4 orphan receptor, we used human stool samples from 10 healthy volunteers as source of commensal intestinal bacteria. To produce soluble GFP fusion CEACAM proteins (expressing only the bacterial binding N- terminal domain) transfected 293 cells were used as described before (Kuespert et al., 2007). For enrichment of CEACAM-binding bacteria, we coupled the soluble GFP- CEACAMs to micro-magnetic anti-GFP beads using a fast magnetic immunoprecipitation (µMACS GFP Isolation Kit, Miltenyi Biotec). Anti-GFP magnetic beads couple to CEACAMs were incubated with the fresh pooled stool samples for 30 min. After incubation, solution of microbial sample and CEACAM-magnetic beads were loaded onto a column placed in a high-gradient magnetic field (MiniMACS separator, Miltenyi Biotec) to retain the CEACAM proteins coupled to anti-GFP magnetic beads. Columns were washed extensively to separate the non-bound bacteria and only allow the elution of associated bacteria or CEACAM-binding bacteria (Figure 6.1). For identification of enriched bacterial population to the human CEACAM family, we have used GFP-fused soluble N-terminal domain of the main CEACAM family members (CEACAM1-8) besides a soluble protein of GFP along as experimental control (Figure 6.2A). Bacteria bound to these CEACAMs were analyzed by pyrosequencing-based profiling of 16S rRNA gene sequences. Bacterial DNA was extracted with primers of the variable regions V1-V2 of the 16S rRNA genes by using amplicon fusion primers (8F-338R) (Table 6.1). They consist of a directional 5´ GS FLX Titanium Primer A or Primer B sequence portion followed by the 4 base library ‘key’ (TCAG) and a Multiplex Identifier (MID) sequence (10-nuleotide sequence tag). These primers help to determine the source of the read and the template- specific sequence, allowing automated identification of pooled samples through ‘bar- coded’ multiplex sequencing, and throughput maximization from a single sequencing run. 16S rRNA amplicons from enriched bacteria of soluble proteins as well as input from pooled stool samples were used for next generation sequencing (454 Sequencing, Roche 454 FLX Titanum instrument) (Figure 6.3B). Samples were loaded in two sets of the

133

Chapter IV sequencing plate for replicates. 454 analyses gave about 600.000 sequences with an average length of 368bp, for a total of more than 212 Million bases (Genomics Center, University of Konstanz, Germany).

Figure 6.1 Enrichment of CEACAM-binding bacteria by anti-GFP magnetic bead-based isolation. GFP-fused soluble N-terminal domain of CEACAMs (N-CEACAM) or GFP along (as control) were coupled to anti-GFP antibody labeled magnetic beads and incubated with a pool of fresh human stool samples. The magnetic beads solution (CEACAM/microbial sample) was loaded onto a column, placed in a magnetic field, and extensively washed to only elute CEACAM-binding bacteria.

134

Chapter IV

Figure 6.2 N-terminal domain of human CEACAMs. (A) Expression of soluble GFP fusion proteins of N- CEACAMs (supernatants) was verified by western blotting. (B) The variable regions (V1-V2) of the 16S rRNA genes from CEACAM-enriched bacteria as well from bacteria present in the pooled human stool samples were amplified for further pyrosequencing. Agarose gel showed PCR fragments of 368 bp.

 Bioinformatics analyses of 454-sequencing from enriched bacteria as potential CEACAM4-binding bacteria Since the sequencing of the ribosomal RNA gene (rRNA) is the method of choice for nucleic acid-based detection and identification of microbes, vast amounts of rRNA gene sequence data have been accumulated and are publicly available (Cochrane et al., 2011). SILVA is a widely used database of aligned ribosomal RNA (rRNA) gene sequences from the Bacteria, Archaea and Eukaryota domains, providing an ideal reference for high- throughput classification of data from next-generation sequencing approaches (Quast et al., 2013). To identify CEACAM4-enriched bacteria, after 454-sequencing of the 16S rRNA fragments (V1-V2) sequences were analyzed by SILVA database in combination with a program for DNA sequence clustering (cd-hit). This program produces a set (cluster) of closely related sequences from a given fasta sequence and help to reduce the overall size of the database without elimination of any sequence information but only removing 'redundant' (or highly similar) sequences. For SILVA small subunit (SSU)-rRNA sequences identification of enriched bacteria we used cd-hit at 97% identity. We identified which sequences showed significant differences in the abundance by comparing CEACAM4-enriched sequences (data set) against the control set (stool sample input and GFP-enriched sequences) using the giving MID number and sequences in replicates. MID number counts provided info about how often a given sequence was found associated with a given MID. Extracted sequences from CEACAM4 were process by SYLVA database for identification of cluster representatives. The selected combination was sorted by fold-change using a minimum count of a sequence present in

135

Chapter IV data set 10-fold higher than the control set (fold-change) and additionally by using counts as an index of abundance (counts of data set over the control set). The unaligned Fasta format sequences from CEACAM4 (18 sequences) were analysed using CLANS. Accordingly to the 3D CLANs, the cluster representatives of CEACAM4 were grouped in two phyla, resolved into a 3D map for Firmicutes (2623 enriched sequences) (Figure 6.3A) and Bacteroidetes (1544) (Figure 6.3B). CLANS displayed the pairwise similarities in a 3D graph by all-against-all BLAST. The clustered representation of sequence-space showed different bacterial families or other taxonomic categories within the phyla Firmicutes and Bacteroidetes. CEACAM4-enriched sequences (pink stars) clustered heterogeneously in the phylum Firmicutes, mainly clostridiales (orange dots) and veillonellaceae (purple dots); whereas within the phylum Bacteroidetes the sequences were homogeneously distributed and grouped into the families Prevotellaceae and Bacteroidaceae (Blue and light blue dots).

 Identified bacterial species from the phyla Firmicutes and Bacteroidetes do not interact with CEACAM4 According to the CEACAM4 enriched sequences, they were clustered mainly into two groups, belonging to the phyla Clostridia and Bacteroidetes. Further analysis by SYLVA database determined specific taxonomic categories to the extracted sequences. Some sequences could not be identified as similar to any known species. However, they were mainly grouped within three taxonomic groups of bacteria (Clostridiales, Selemonadales or Bacteroidales). Firmicutes bacteria were very heterogeneous but mainly clustered in the order Clostridiales (Clostridium, Flavonifractor and Eubacterium species) followed by Selemonadales (Megasphaera species). In contrast, the Bacteroidales order of bacteria was homogeneously clustered in the genus Prevotella (Table 6.2). Identified bacteria species as potential CEACAM4 ligands were obtained from DSMZ (The Leibniz institute DSMZ, German collection of microorganisms and cell Cultures GmbH). Bacterial pull-down assays were performed in order to confirm associated- bacteria to CEACAM4. Gram-positive or gram-negative anerobic bacteria (Firmicutes and Bacteroidetes, respectively) were culture 48 hours before infection in liquid medium. Firmicutes (Figure 6.4A) or Bacteroidetes (Figure 6.4B) bacteria species were incubated with GFP soluble fusion proteins of N-CEACAM4 or GFP along as negative control. The unbound bacteria were washed extensively, and bacteria-associated with the receptor domains were probed by western blotting. In addition, known Opa-dependant bacterial

136

Chapter IV

interaction of CEACAM3 with N. gonorrhoeae was employed as positive (OpaCEA) or negative (non Opa expression, Opa-) controls (Figure 6.4C).

Figure 6.3 CEACAM4-enriched sequences of the phylum Firmicutes and Bacteroidetes. After 16S rRNA sequencing of CEACAM4-binding bacteria, enriched sequences were identified by SILVA database and were clustered in a 3D-CLANS map. SILVA SSU-rRNA sequences were clustered using cd-hit at 97% identity and the cluster of representatives were combined with the CEACAM4 enriched 16S rRNA fragment sequences. The combined set was then analyzed using CLANS. All-against-all BLAST comparisons of sequences are represented as dots in a 3D-space. The space shape of the 3D graph represents clustered sequences by similarity located into close proximity while sequences of lesser similarity are more distantly located. The 16S rRNA sequences of the CEACAM4 enriched sequences are indicated by pink stars. (A) CLANS of the phylum Firmicutes. (B) CLANS of the phylum Bacteroidetes. Numbers in parenthesis refer to the count of enriched sequences.

137

Chapter IV

Table 6.2 Bacteria used in pull-down assays

Firmicutes Bacteroidetes

Clostridia/Clostridiales: Bacteroidetes/Bacteroidales/Prevotella Clostridium beijerinckii, Clostridium saccharobutylicum, ceae: Clostridium lactatifermentans Prevotella Intermedia Flavonifractor plautii Prevotella nigrescens Eubacterium siraeum Prevotella timonensis Prevotella copri

Negativicutes/Selenomonadales/Veillonellaceae: Megasphaera elsdenii, Megasphaera cerevisiae

Figure 6.4 No Biochemical interaction of potential CEACAM4-binding bacteria. Indicated Gram-positive anerobic bacteria (class Clostridia) (A) or Gram-negative anaerobic bacteria (genus Prevotella) (B) were used in pull-downs with soluble proteins of N-CEACAM4-GFP or only GFP as control. (C) Soluble GFP fusion protein of N-CEACAM3 and N- CEACAM4 were employed for bacterial pull-down with N. gonorrhoeae strains expressing an Opa CEACAM-binding protein (Ngo OpaCEA) or non-Opa expressing bacteria (Ngo Opa -). Precipitates were probed with a monoclonal anti-GFP antibody to detect CEACAMs co-precipitating with the bacteria (A-C). (D) Similar amounts of soluble proteins were used in bacterial pull- downs as input.

138

Chapter IV

Moreover, protein expression of freshly produced N-terminal domains was tested and used in equally amounts (Figure 6.4D). As expected, only N. gonorrhoeae OpaCEA (but not non- Opa expressing bacteria) interacted with human CEACAM3 (Figure 6.4C). In sharp contrast, neither Clostridiales, Selemonadales nor Prevotella species were able to specifically interact with the N-terminal domain of CEACAM4 (Figure 6.4A-B). These results showed no association of tested bacteria with the receptor, therefore, N-terminal domain of CEACAM4 could not be precipitated. The GFP signal from some tested samples reflected inappropriate washes of input GFP signal (N-CEACAM4 supernatant) in handling procedures. In constrast, a clear interaction between N. gonorrhoeae OpaCEA and the N-terminal domain of CEACAM3 was detected (Figure 6.4C). Taken together, western blotting of pull-down assays could not show a biochemical interaction of identified bacteria with the N-terminal domain of CEACAM4.

6.5 Discussion

In this study we screened for a bacterial ligand of CEACAM4 in the human intestinal microbiota. The gut bacteria from stool samples of 10 healthy volunteers were used to enrich for microbes binding to the N-terminal domain of CEACAM4 by GFP-affinity isolation. 16S rRNA gene pyrosequencing were employed for bacterial isolation and identification using the SILVA database in combination with CLANS. We identified several members of the genus Clostridium, Flavonifractor, Eubacterium, Megasphaera and Prevotella to be potential CEACAM4 bacterial ligands. However, bacterial pull-down assays with species of these genera did not confirm any biochemical CEACAM4- interaction of potential ligands. Although bacterial pull-downs were rigorously conducted they did not show any binding to CEACAM4. Nevertheless, some of these bacteria (Clostridium beijerinckii and Megasphaera cerevisiae) have shown binding to other CEACAM family members (Bonsignore, 2015), as well as some Prevotella species have also been previously reported to interact with CEACAM3, CEACAM5 (CEA) and CEACAM8 (Roth, 2013). In our dataset, samples displayed relatively high microbial richness and diversity. Like other microbial ecosystems, human intestinal microflora is distinctively shaped by diverse microorganisms and their mutual interactions. The human gastrointestinal tract consists of an extremely complex and dynamic microbial community which vary greatly between individuals, but also, they have been indicated to fall into distinct enterotypes defined by

139

Chapter IV their bacterial composition which remain similar in humans (Arumugam et al., 2011; Eckburg et al., 2005). Previous studies have shown that human gut microbial community is predominatly composed for members of Bacteroidetes and Firmicutes phyla (Mahowald et al., 2009). Commensal Clostridia consist of gram-positive, rod-shaped bacteria in the phylum Firmicutes and make up a substantial part of the total bacteria in the gut microbiota. They are known to colonize the human intestine since the first month of life (as breastfed infants) and play a crucial role in the maintenance of overall gut function (Lopetuso et al., 2013). However, Clostridia as sporeforming bacilli found in soil as well as in normal intestinal flora of humans and animals, play an important role in human disease including gas gangrene and related clostridial wound infections, tetanus, botulism, or antibiotic-associated diarrhea (colitis) (Aronoff, 2013; Lapinski et al., 1996; Maselli, 1998; Wells and Wilkins, 1996). Prevotella are Gram-negative rods that are anaerobic and non- spore-forming bacteria. Species of the genus Prevotella are typically inhabiting the gastrointestinal tract, oral cavity and genital areas of human and other mammals (Avgustin et al., 2001). Recently it has been indicated to play an important role in the conversion of plant lignans into human health beneficial antioxidants (Schogor et al., 2014), also in line with previous studies, Prevotella spp. were particularly abundant in rural African children consuming a high fiber diet (De Filippo et al., 2010; Pop et al., 2014; Yatsunenko et al., 2012). In contrast, intestinal Prevotella copri has been reported to have a potential role in the pathogenesis of rheumatoid arthritis (Scher et al., 2013), oas well as Prevotella intermedia has been associated with periodontal disease (Nadkarni et al., 2012). Accordingly, the endogenous gastrointestinal microbial flora plays a fundamental role in health and disease, but the adaptive coevolution of humans and bacteria remains not well understood. The CEACAM family shows a complex expression pattern in normal and cancerous tissues with notably selective epithelial expression as well as in cells of the immune system. Interestingly, human CEACAM family members are also able to interact with commensal bacteria which can provide beneficial interaction between host and engaged bacteria (Bonsignore, 2015; Evans et al., 2011; Roth, 2013). Since previous studies have shown the binding of commensal bacteria to human CEACAMs it suggests a possible contribution to the sculpting of the human microbiota. We believe that not only bacteria have evolved different mechanisms to efficiently colonize different ecological niches but the coevolution of the host-bacteria along with receptor ability to recognize and trigger independent mechanism help to maintain an microbial equilibrium. It has been indicated

140

Chapter IV that bacterial receptors are able to not only recognize pathogens but they also can recognize other bacteria like TLRs by microbial-associated molecular patterns (MAMPs) (Chu and Mazmanian, 2013). Therefore, previous studies agree that certain bacterial factors and properties (apart from virulence) can be distinguished by the host’s receptors, to specifically coordinate independent cascades of the innate and acquired immune responses controlling infection. Several factors could influence the detection of binding to some obligate anaerobic bacteria, although after 454 sequencing some anaerobic bacteria could be identified to possibly bind CEACAM4, handling and preparation of samples could affect proper anaerobic conditions to keep the suitable environment for bacterial binding. Taken into account that the majority of ordered bacteria from DSMZ appeared to not be isolated from humans but from different sources (e.g. animal or natural sources), it could also explain undetectable binding by bacterial pull-downs. Moreover, we could not exclude possible non-specific associations of bacteria to CEACAM4 (e.g. by carbohydrate moieties) resulted in the presence of Firmicutes and Bacteroidetes bacteria as they form the main composition of human gut microbiota. However, many other methodological difficulties could explain the problems in identifying specific species, which possibly interact with CEACAM4. Discrepancies among high-throughput 16S rDNA sequencing studies are common and could result from several reasons. Mostly coverage of microbes by different PCR primers and the number of sequence reads are important contributors for discrepancies. In theory, based on 16S rDNA-based PCR primer sets which are commonly used to target different variable regions of the bacterial 16S rRNA gene, cover only a partial percentage of known genera (Mao et al., 2012). Thus, primer-template mismatches is an important issue since target sequences that cannot precisely match the primers will be amplified to a lesser extent, possibly even below the detection limit. However, since pyrosequencing has extended the read length from 100 bp to 800 bp (Miller et al., 2011), more hypervariable regions in 16S rDNA could be covered and sequenced in future analysis. In addition to the differences in the experimental setup, the type and stringency of statistical tests, such as consideration of false discovery rates for multiple testing conditions, might affect the interpretation of data and result in either a false negative or false positive selection. In general, different statistical techniques have to be taken into account to produce more accurate and robust estimates, with greater sensitivity and

141

Chapter IV statistical power. Particularly, there are new statistical analyses tuned for next generation sequencing and improved methods to interpret collected output which can provide accurate detection and identification of very low-abundance organisms (Chen et al., 2013; Li et al., 2012; Reveillaud et al., 2014; Tseng et al., 2013). Along with the identification of CEACAM-binding bacteria, further studies are required to continue the search for a ligand of the orphan CEACAM4 receptor. It would be interesting to screen for CEACAM4-binding with an improvement of the used cultivation-independent enrichment technique by using protein oligomerization (clustering of receptor) together with a sequential multistep bacterial enrichment to identify and assess low-affinity interactions between soluble CEACAM proteins and binding-bacteria. On the other hand, CEACAM-binding bacteria could also be isolated directly from stool samples by bacterial colony dot blot providing a reliable source of the human intestinal flora. Thus, stool samples can be cultivated in a broad culture condition, or if it is possible on selective media, and bacterial colonies can be identified by 16S rRNA gene-sequencing and used in further experiments for CEACAM4-binding capacity. The human gut is known to represent a complex ecosystem composed by a large microbial community including also a rich fungal community. Moreover, a wide range of protozoans are common parasites of the human gastro-intestinal tract. Therefore, analysis of a broader spectrum of microorganisms could open a novel source of potential ligands of the orphan receptor CEACAM4. It is also possible that an undefined endogenous ligand exist for CEACAM4. Since immunoglobulins mediate different biological processes, CEACAM4 could help in the regulation of the immune system by binding to specific structures within the human body.

6.6 Acknowledgments

We thank T.F. Meyer (MPI for Infection Biology, Berlin, Germany) for the N. gonorrhoeae MS11 strains used in this study, W. Zimmermann (Ludwig-Maximilians- Universität, München, Germany) for providing CEACAM cDNA, P. Franchini (Genomic center, Universität Konstanz, Germany) for 454 sequencing analysis, and S. Feindler- Boeckh for expert technical assistance. This study was supported by funds from the Deutsche Forschungsgemeinschaft (DFG) to CRH. JDT acknowledges the support by the International Office - Universität Konstanz.

142

Concluding remarks

7 Concluding remarks

CEACAMs belong to the immunoglobulin superfamily and contribute to a variety of cellular functions as cell-cell-adhesion molecules and signaling modulators on different cell types (mostly epithelia, endothelia, and leukocytes). CEACAM3 and CEACAM4 are type 1 transmembrane proteins of the human CEACAM family, exclusively expressed on human neutrophils. These two CEACAMs share a high similarity in the overall domain structure and particularly encompass an immunoreceptor tyrosine-based activation motif (ITAM)-like sequence within the cytoplasmic domain, which is not present in other human CEACAM family members (Kuroki et al., 1991; Pils et al., 2008). Phosphorylation of ITAM tyrosine residues is critical for protein activation and signal transduction. However, while CEACAM3 has been well-studied as opsonin-independent phagocytic receptor of human-restricted pathogens, CEACAM4 is an orphan receptor of the human CEACAM family, which study has been neglected. A major aspect of this investigation was to open the door for a broader appreciation of CEACAM3 and CEACAM4 as interesting primate proteins. Members of the CEACAM family can be exploited by several human-adapted bacterial pathogens including Neisseria gonorrhoeae, Neisseria meningitidis, Moraxella catarrhalis and Haemophilus influenza, to colonize mucosal surfaces of the human body (Barnich et al., 2007; Chen and Gotschlich, 1996; Chen et al., 1997; Gray-Owen et al., 1997b; Hill et al., 2001; Hill and Virji, 2003; Tchoupa et al., 2014; Virji et al., 1996). However, the innate immune system is equipped with a specific granulocyte receptor, CEACAM3, which allows the opsonin-independent recognition and killing of CEACAM-binding bacteria. CEACAM3 appears to have evolved in the primate lineage to provide a short- wired connection to cellular factors, which are critical for actin skeleton rearrangements and antimicrobial immune response in granulocytes (Buntru et al., 2011; Schmitter et al., 2007a). Besides their exclusive expression in human granulocytes, the overall domain structure of CEACAM3 and CEACAM4 is peculiar within the human CEACAM family and differs from epithelial bacteria-binding CEACAMs by the lack of extracellular IgC2- like domains (Kuroki et al., 1991; Pils et al., 2008). Furthermore, CEACAM3 has been found to have a modified signal transduction compared to canonical ITAM-bearing receptors. While encompassing two tyrosine resides (Tyr230 and Tyr241) within an ITAM-like sequence, after Src phosphorylation, downstream association with cytoplasmic

143

Concluding remarks proteins takes only place at the phosphorylated membrane proximal tyrosine residue (pTyr230). Direct binding of multiple SH2 domain bearing proteins to pTyr230 of the ITAM-like sequence of CEACAM3 results in an efficient and fast CEACAM3-mediated phagocytosis of CEACAM-binding bacteria (Buntru et al., 2012; Schmitter et al., 2004; Schmitter et al., 2007a). Interesting, the membrane distal tyrosine residue (Tyr241; YxxM) does not correspond to the canonical ITAM consensus (YxxL/I) derived from T-cell receptor subunits or Fc receptors, a situation that resembles the hem-ITAM sequence of the innate immune receptor Dectin-1. The membrane distal tyrosine residue of this type II transmembrane protein also does not conform to the ITAM consensus (Aderem and Underhill, 1999; Buntru et al., 2012), and only the membrane proximal tyrosine residue of Dectin-1 is involved in triggering signal transduction processes in macrophages. Thus, CEACAM3 is nowadays considered to possess a functional hem-ITAM (Aderem and Underhill, 1999; Buntru et al., 2012; Fuller et al., 2007). In contrast, the CEACAM4

ITAM-like sequence (YxxLx(7)YxxI) perfectly matches with the amino acid sequence of canonical ITAMs (YxxL/Ix(6-12)YxxL/I) found in immune receptors such as the T-cell receptor ζ-chain or the activating Fcγ receptors (Reth, 1989). Since CEACAM4 was originally cloned from human leukocytes which expression appears restricted to the granulocyte lineage (Kuroki et al., 1991), the absence of the CEACAM4 gene in rodents together with the lack of a bona fide ligand have limited the study of this membrane protein during the last decades. Up to date, no binding to CEACAM4 has been detected among CEACAM-binding pathogens, therefore, we have taken the advantage of bacteria- recognizing CEACAMs to gain an insight to the so far unknown function of CEACAM4. By fusing the N-terminal binding domain of CEACAM3 (as the closest related-CEACAM to CEACAM4) with the transmembrane and cytoplasmic domains of CEACAM4, we have created chimeric proteins. The CEACAM3-CEACAM4 chimera (CEACAM3/4) allowed us to investigate intra-cellular processes mediated by CEACAM4. Using this chimera, we could prove that the cytoplasmic ITAM-like sequence of CEACAM4 is getting phosphorylated upon ligand-mediated receptor clustering. Indeed, our in vitro data could show that the orphan receptor CEACAM4 can support efficient phagocytosis of particulate ligands like Neisseria gonorrhoeae. We provided evidence that Src family PTKs play a critical role in the activation of signaling cascade by the phosphorylated ITAM of CEACAM4. Comparable to CEACAM3, phosphorylation as well as bacterial uptake by CEACAM3/4-transfected cells were clearly affected by Src kinase-specific inhibitors, which confirm the necessity of Src-family kinases for CEACAM-mediated opsonin-

144

Concluding remarks independent phagocytosis of bacteria (McCaw et al., 2003; Schmitter et al., 2007b). Moreover, we identified several binding partners including Src-PTKs Yes and Hck as well as PI3K, which were recruited and associated via their SH2 domains to the phosphorylated CEACAM4-ITAM. In contrast to CEACAM3, SH2 domain binding of associated proteins occurred on both phosphorylated tyrosine residues within the ITAM-like sequence of CEACAM4, a situation that resembles canonical ITAM-bearing receptors. CEACAM4 harbours an almost identical molecular structure with CEACAM3, especially within their cytoplasmic domains with a striking identity of 73% at the amino acid level (Pils et al., 2008). This situation had been explained by the fact that CEACAM3 appears to be a natural chimera, with the IgV-like domain derived from bacteria-binding CEACAMs (CEACAM1, CEA, or CEACAM6), but the cytoplasmic tail, which enables the receptor to induce phagocytosis via an ITAM-like sequence, is presumable inherited from a CEACAM4 ancestor. In this line, the granulocyte CEACAM3 is considered to emerge as a specific adaptation of the primate innate immune system as a germline-encoded death trap for CEACAM-binding pathogens (Pils et al., 2008; Sarantis and Gray-Owen, 2011; Schmitter et al., 2007a), and might be due to a selective pressure of host-pathogen (Kammerer and Zimmermann, 2010). Due to the exclusive presence of the CEACAM4 gene in the primate lineage and due to the expression of this gene in professional phagocytes, we considered that this receptor provides an interesting, primate-specific contribution to the function and/or regulation of our species’ immune system. To elucidate the biological function behind this potential phagocytic receptor, identification of a bacterial ligand, was the next step of our study. Since no CEACAM-binding bacteria are able to bind CEACAM4, it suggested to possibly promote beneficial interactions between host and engaged microbes from normal microbiota or commensal bacteria. Gastrointestinal tract is the primary site of interaction, between the host immune system and microorganisms (symbiotic or pathogenic), therefore, gut microbiota play a crucial role to shape immune responses during health and disease (Round and Mazmanian, 2009). In the present study we aimed to identify a bacterial ligand of CEACAM4 from human gut microbiota by next generation sequencing of the 16S rRNA gene. Bacteria from human stool samples of 10 healthy volunteers were pooled and enriched by anti-GFP magnetic bead-isolation, using soluble GFP fusion proteins of the N- terminal domain of CEACAM4 to pull-down associated bacteria. 454 pyrosequencing of the CEACAM4-enriched bacteria were analyzed by cluster analysis of sequences (CLANS) and SILVA database. Bioinformatic analyses identified two main phyla:

145

Concluding remarks

Firmicutes and Bacteroidetes. Species of the genus Clostridium, Flavonifractor, Eubacterium, Megasphaera and Prevotella appeared to be potential CEACAM4-binding bacteria. Unexpectedly, biochemical analyses by bacterial pull-downs could not confirm the interaction between CEACAM4 and the tested commensal bacteria. Previous studies have shown that human gut microbial community is predominantly composed of bacteria from the Bacteroidetes and the Firmicutes phyla (Mahowald et al., 2009). Commensal Clostridia consist of gram-positive sporeforming bacilli in the phylum Firmicutes and Prevotella are Gram-negative non-spore-forming bacteria of the class and phylum Bacteroidetes. However, species of both classes of anaerobic bacteria can also be associated with different human diseases. Interesting, Prevotella and Clostridiales species have been recently identified to bind to several human CEACAMs, suggesting a possible contribution of CEACAMs to help in the sculpting of the human microbiota (Roth, 2013). Several factors could influence the detection of binding to some obligate anaerobic bacteria, although after 16S rRNA gene sequencing some anaerobic bacteria could be identified to possibly bind CEACAM4. Handling and preparation of samples could affect proper anaerobic conditions to keep the suitable environment for bacterial binding as well as further pull-downs were mostly performed with non-human isolated bacteria. However, many other inconvenient could have affected the identification of specific species as possible CEACAM4 ligands as selection of16S rRNA primers (Mao et al., 2012) or the type and stringency of statistical tests. For futures studies, we suggest a robust and multiple-sequential bacterial enrichment together with receptor oligomerization which could ensure detection of low profile binding-bacteria and optionally, it could be combined with a direct bacterial isolation from human stool samples (e.g. by colony dot blot) and cultivation in 100 % anoxic conditions. Since interactions between intestinal microbiota, immune system, and pathogens describe the human gut as a complex ecosystem, a large fungal community and a wide range of protozoans (intestinal parasites) are also part of the human gut. Therefore, in the search for a ligand of the orphan CEACAM4 receptor, a broader spectrum of possible ligands including fungi or protozoans should be considered. Moreover, immunoglobulin-like receptors play an important role in the innate immunity by recognizing a variety of exogenous but also endogenous ligands. In this regard, CEACAM4 could also be receptor of an endogenous structure helping in the regulation of the immune system (e.g. leukocyte extravasation, CEACAM-CEACAM interaction, removal of death cells, or perhaps amplifying inflammatory responses). Thus, one can also

146

Concluding remarks aspire to generate a CEACAM4 mouse model to dig up the function of this protein in the immune system. CEACAM3 function as a phagocytic receptor responsible for initiating the opsonin- independent recognition, internalization and destruction of a limited set of human gram- negative bacteria. Different intracellular signaling molecules have been found associated to the Hem-ITAM signaling of CEACAM3, therefore, particular protein-protein connections are of interest to explain the fast immune response mediated by CEACAM3. Immunoreceptors also rely on signaling through the second largest family of non-receptor PTKs Tec (Schmidt et al., 2004). The Bruton’s tyrosine kinase (Btk) has been reported to be involved in TLR signaling upon LPS stimulation (Jefferies et al., 2003), or Listeria monocytogenes infection (Koprulu et al., 2013), as well as in Dectin-1-mediated phagocytosis of Candida albicans (Strijbis et al., 2013). Moreover, Btk and Tec are involved in FcγR-mediated phagocytosis of IgG-RBC (Jongstra-Bilen et al., 2008). Recently, Tec kinase has been also reported to play a role in the inflammatory immune response of macrophages upon Candida albicans infection regulated via Dectin-1 (Zwolanek et al., 2014). Because the tyrosine phosphorylated Hem-ITAM-like sequence of CEACAM3 provides a docking site for several SH2-domain containing proteins, including the Src family kinases Hck, Fgr and c-Src (Kopp et al., 2012; McCaw et al., 2003; Schmitter et al., 2007b), the regulatory subunit p55 of PI3K (Buntru et al., 2011), or adaptor proteins such as Nck1 and Nck2 (Pils et al., 2012); SH2-domain binding of Tec family kinases was tested by biochemical analyses. The Tec kinase is discovered in this study as new CEACAM3 interaction partner. FRET analysis could show that Tec kinase co-localized with CEACAM3 in transfected epithelial cells. Biochemically, our data demonstrated a specific binding of the Tec kinase to the phosphorylated Hem-ITAM- of CEACAM3 by pull-downs of GST-SH2 fusion proteins and cell-free based assays. The SH2-domain of Tec kinase is directly recruited to the site of bacterial phagocytosis presumably in a PIP3-independent manner by binding to the phosphorylated Hem-ITAM- motif of CEACAM3. Accordingly to a Hem-ITAM signaling, binding of the Tec kinase was specific to the proximal tyrosine residue (Tyr230) within the ITAM-like sequence of CEACAM3, phosphorylated by Src family PTKs. After CEACAM3 engagement by CEACAM-binding N. gonorrhoeae, Tec is phosphorylated within 15 to 30 min at critical tyrosine residues within the kinase domain indicating rapid activation of Tec. Moreover, Tec activation and downstream events after gonococcal infection was found to be Src- dependent during CEACAM3-mediated Hem-ITAM signaling. Interestingly, a distinctive

147

Concluding remarks granulocyte phenotype was found after treatment with LFM-A13 as specific inhibitor of the Tec family kinases where surface of the phagocytic cells were completely surrounded by filipodium-like protrusions counteracting the lack of lamellipodium formation. Since the Hem-ITAM-like sequence of CEACAM3 short-wires bacterial recognition by Rac stimulation via a direct association with the GEF Vav, this interaction promotes rearrangements of the actin cytoskeleton, phagocytosis and elimination of CEACAM- binding bacterial pathogens (Pils et al., 2012; Schmitter et al., 2007a). We showed that Tec inhibition blocked almost completely the phosphorylation of the Vav kinase, revealing a clear Tec-dependent activation of this kinase. Therefore, impairment of the actin reorganization could be explained by inhibition of CEACAM3 signaling activators, like the Rac GTPase, in dependency of Vav. Based on pharmacological inhibition, Tec not only contribute to the reorganization of the actin cytoskeleton for N.gonorrhoeae uptake but also to the generation of ROS as killing response by human granulocytes. Our study summarizes the involvement of Tec in the CEACAM3-mediated Hem-ITAM signaling as well as other possible protein-interaction during the infection process (Suppl. Figure 3.2). In addition, it would be also of interest to follow the direct binding of Tec to CEACAM3 in live infected cells. However, acceptor photobleaching is limited to fixed samples because the acceptor fluorophore is destroyed. Therefore, additional advanced fluorescence microscopy techniques such as fluorescence lifetime imaging microscopy (FLIM) would be required. Measuring FRET by the decrease of the donor lifetime is independent of fluorophore concentrations and is non-destructive. Previous studies have successfully applied FLIM-FRET to study the interaction of CEACAM3 with Grb14 (Kopp et al., 2012). In this context, the technique would also provide a quantitative information about the stoichiometry of the interaction, which is an advantage over intensity based FRET- methods where quantification of interaction partners is highly sophisticated and requires the availability of appropriate controls. However, the acquisition time for the time- correlated single photon-counting-FLIM setup used in this study was in the range of minutes to obtain reliable donor lifetimes. Therefore, for future experiments we recommend to use frequency domain wide field FLIM to study the kinetic recruitment of full length CEACAM3 binding proteins in living cells. Together, our data demonstrate that in human granulocytes Tec kinase maximizes Hem-ITAM signaling and reveal for the first time a prominent role of Tec in opsonin-independent phagocytosis of bacteria by the granulocyte receptor CEACAM3. Since a transgenic animal model with specific expression of CEACAM3 is not available, experimentation in vitro with knock out Tec in

148

Concluding remarks granulocyte-like cells will contribute to the investigation of this kinase during the innate immune response to bacterial infection mediated by CEACAM3. In addition to more distantly related CEACAMs (CEACAM16, CEACAM18, CEACAM19 and CEACAM20) murine homologues of human CEACAM family members as pathogen receptors so far had been only identified for CEACAM1 (Zebhauser et al., 2005). Several Gram-negative bacterial pathogens exclusively for humans can strategically colonize human mucosal surfaces by binding to CEACAM family members through specific adhesins (Tchoupa et al., 2014). However, bacterial adhesins of human pathogens cannot bind mouse CEACAM1 (Voges et al., 2010). This selective interaction of several human- adapted bacterial pathogens with human CEACAM family members had suggested a specific co-evolution of microbial adhesins with host receptors (Kammerer and Zimmermann, 2010). The lack of CEACAM3 in rodents as well as a suitable standard model organism expressing solely CEACAM3 experimentation with this protein had been restricted to ex vivo or in vitro assays. On the other hand, studies of the innate immune response to bacterial infection by granulocytes had been addressed with the generated transgenic CEABAC mouse line co-expressing CEACAM3, CEACAM6 and CEACAM7 in granulocytes (Chan and Stanners, 2004; Gu et al., 2010). However, the fact of an existing transgenic mouse line co-expressing multiple CEACAMs had made it difficult to break off specific CEACAM functions in vivo (Sintsova et al., 2014). Therefore, to elucidate an individual contribution of CEACAM3 upon bacterial infection, we aimed to generate a novel transgenic mouse model expressing exclusively CEACAM3. Since promoters are generally located near the transcription start sites of genes and can be about 0.1-1 Kb long upstream of the gene (Ignatieva et al., 2014). We generated a humanized mouse model of CEACAM3 coding sequence and a C-terminal mKate-fusion under a 4Kb long intact promoter region upstream of the CEACAM3 gene, the promotor region showed to harbor important transcription binding sites for gene regulation in the granulocytic lineage and promotor activity was confirmed in vitro (Delgado Tascón et al., 2015). The sleeping beauty transposon vector pT2/BH-CEACAM3 in combination with a hyperactive transposase was used as an efficient and fast transgenic system in mice (Fischer et al., 2001; Ivics and Izsvak, 2004; Ivics et al., 2014; Izsvak et al., 2000; Mates et al., 2009). Unexpectedly, the ratio of born animals was too low and only 10-15% of tested animal could integrate the transgene. Moreover, breeding was possible only from one founder mouse due to the premature death of the second animal. Although the transgene resulted in a successful germ line transmission to the first generation (39 %), the percentage was much

149

Concluding remarks lower than a frequency of 0.5. Strikingly, subsequently expression analysis of CEACAM3 or mKate by flow cytometry or western blotting could not be detected. Furthermore, bacterial uptake and oxidative response by transgenic mouse neutrophils (hallmark functions of CEACAM3-mediated signaling) confirmed no functional expression of the generated humanized CEACAM3 mice. Although promotor activity of the putative promotor region of this study was previously tested in vitro analysis, our results could also suggest the lack of a proper CEACAM3 transcription by using only the coding sequence of the gene together with an short promotor sequence out of 24 Kb intergenic region upstream of the CEACAM3 start site. Since no protein expression of CEACAM3 as well as no activation of mouse granulocytes in response to human bacteria was detectable, we can only speculate that CEACAM3 transgene was presumably integrated into a silent gene locus, which can be activated in a non-predictable manner in a low proportion of transgenic animals, and when it is transcribed leads to developmental problems in the affected animals. Unfortunately, organs or tissue samples from the second founder which died prematurely could not be kept or preserved before damaged, therefore, we could not confirmed a functional CEACAM3 expression or gain any hint into the cause(s) of its death. We assumed that the survivor founder which was bred and characterized encompassing the transgene could have inserted the transgene cassette at a silent locus and therefore, allowing it to live by repressing transcription of CEACAM3. The idea of a silent CEACAM3 locus in the surviving CEACAM3 transgenic animals is in line with our finding that, CEACAM3 mRNA could not be detected via RT-PCR in blood cells from the transgenic mouse line. In order to solve the problems faced by our transgenesis approach: 1) Eventual lethality provoked by CEACAM3 expression. 2) Exclusion of TFs from our considered promoter region, which could have been necessary to achieve a endogenous-like expression. We propose to use the Cre/lox system to conditionally express CEACAM3 and, on the second hand, to use BAC recombineering approaches to include the complete CEACAM3 gene. The conditional Cre/lox system has been widely used for mouse transgenesis (Sauer, 1998), and temporal control and site-specific recombination has been successfully achieved by using the ligand-inducible CreERT2 (Feil et al., 1997; Jaisser, 2000; Metzger and Chambon, 2001). Moreover, site-specific recombination has been shown only to occur upon administration of the drug tamoxifen (TAM). This technology would allow the generation of humanized mice conditionally expressing CEACAM3 in granulocytes. CreERT2 mediated recombination could be used to express CEACAM3 only at adult stages

150

Concluding remarks and therefore, exclude any potential effect on the survival of the mouse. In principle, CEACAM3 expression can be repressed by expressing a reporter gene upstream of the CEACAM3 coding sequence. This reporter gene, flanked by loxp sites, would conditionally silence the expression of CEACAM3. Moreover, BACs can be easily modified by homologous recombination (Poser et al., 2008), making it possible to exclude neighbour genes and insert a loxp-reporter/stop-loxp cassette before the start codon of CEACAM3. By crossing a mouse line expressing CreERT2 in granulocytes (e.g. under control of the myeloperoxidase promoter) with a line conditionally-silencing CEACAM3, we could expect, upon TAM treatment, CreERT2 mediated excision of the reporter gene and subsequently a successful CEACAM3 expression. The generation of condition and inducible humanized mice will allow us to study the in vivo function of CEACAM3 during neutrophil response to bacteria. The in vivo model of infection would confirm the opsonin- independent phagocytosis and killing of human-adapted pathogens mediated by CEACAM3 but also would decipher the specific role of this protein in other immune responses of granulocytes such as the pathogenic inflammatory process. In addition, by crossing CEACAM3 transgenic mice with available knock out mice of different kinases (e.g Tec or Syk) it will provide a novel genetic tool to unravel the complex organization of CEACAM3-dependent signaling processes during infection.

151

Declaration of author’s contributions

8 Declaration of author’s contributions

Chapter I: Delgado Tascón, J., Buntz, A., Wiens O., Pils, S., Kopp, K., Zumbusch, A., and Hauck, C.R. 2015. “Tec kinase contributes to CEACAM3-initated Hem-ITAM signaling to promote bacterial phagocytosis and destruction by human granulocytes”. Under submission. The study was designed by Christof R. Hauck, Julia Delgado Tascón and Stefan Pils. Experiments were performed by Julia Delgado Tascón (Figure 3.3A-C, 3.3F, 3.4, 3.5, 3.6 and Suppl. 3.2), Annette Buntz (Figure 3.2, 3.6A and Suppl. 3.1), Kathrin Kopp (Figure 3.1C), Olga Wiens and Stefan Pils (Figure 3.1A-B and 3.3 D-E). The manuscript was written by Julia Delgado Tascón and Christof R. Hauck.

Chapter II: Delgado Tascón, J., Hörmann, L., Skryabin B.V., and Hauck, C.R. “Generation of a CEACAM3 transgenic mouse model for in vivo analysis of protein function”. In preparation. Christof Hauck and Julia Delgado Tascón designed the study. Figure 4.6 and 4.7A-B were performed by Lisa Hörmann and together with Julia Delgado Tascón (Figure 4.5). All other experiments were done by Julia Delgado Tascón. Pronuclear microinjections of fertilized mouse oocytes and southern blot analysis were performed by Boris V. Skryabin. The manuscript was written by Julia Delgado Tascón.

Chapter III: Delgado Tascón, J., Adrian, J., Kopp, K., Scholz, P., Tschan, M.P., Kuespert, K., and Hauck, C.R. (2015). “The granulocyte orphan receptor CEACAM4 is able to trigger phagocytosis of bacteria”. Journal of Leukocyte Biology 97, 521-531. Christof Hauck designed the study. Experiments were performed by Julia Delgado Tascón (Figure 5.1A/C-D, 5.2, 5.3A, 5.4B, Suppl. 5.1, Suppl.5.2A and suppl. 5.3A7C), Jonas Adrian (Figure 5.1B-C, 5.4C, Suppl. 5.2B and Suppl. 5.3B), and Kathrin Kopp (Figure 5.3B-E, 5.4A and Suppl. 5.3D). Philipp Scholz cloned all the constructs. The initial manuscript was written by Julia Delgado Tascón and finalized by Christof Hauck.

152

Declaration of author’s contributions

Chapter IV: Delgado Tascón, J., Frickey T, and Hauck CR. “Finding bacterial ligand of the orphan receptor CEACAM4”. In preparation. Christof Hauck and Julia Delgado Tascón designed the study. All experiments were performed by Julia Delgado Tascón. Bioinformatical analyses were conducted by Tancred Frickey. The manuscript was written by Julia Delgado Tascón.

153

List of publications

8.1 Publications part of this thesis or ongoing to be submitted

Delgado Tascón, J., Adrian, J., Kopp, K., Scholz, P., Tschan, M.P., Kuespert, K., and Hauck, C.R. (2015). The granulocyte orphan receptor CEACAM4 is able to trigger phagocytosis of bacteria. Journal of Leukocyte Biology 97, 521-531.

Delgado Tascón, J., Buntz, A., Wiens O., Pils, S., Kopp, K., Zumbusch, A., and Hauck, C.R. (2015). Tec kinase contributes to CEACAM3-initated Hem-ITAM signaling to promote bacterial phagocytosis and destruction by human granulocytes. Under submission.

8.2 External publications

Pils, S., Kopp, K., Peterson, L., Delgado Tascón, J., Nyffenegger-Jann, N.J., and Hauck, C.R. (2012). The adaptor molecule Nck localizes the WAVE complex to promote actin polymerization during CEACAM3-mediated phagocytosis of bacteria. PloS one 7, e32808.

154

Abbreviations

% percent °C degree celsius µl microliter µm micrometer µM micromolar BCR B-cell receptors bp basepairs BSA bovine serum albumin CEA carcinoembryonic antigen CEACAM carcinoembryonic antigen-related cell adhesion molecule CFSE carboxyfluorescein succhinimidyl ester CS calf serum CTCF CCCTC-binding factor DAG diacylglycerol DMSO dimethyl sulfoxide DNA deoxyribonucleic acid e.g. for example EDTA ethylenediaminetetraacetic acid EGFP enhanced green fluorescent protein et al et alii; and others FACS fluorescence activated cell sorting f-actin filamentary actin Fc fragment crystallizable FcRs Fc receptors FCS fetal CS FcγR Fc gamma receptor FRET fluorescence resonance energy transfer g gram GEF guanine nucleotide exchange factor GFP green fluorescent protein GPI glycosylphosphatidylinositol GST glutathione S-transferase GTP guanosine triphosphate HBSS Hanks' balanced salt solution HEK human embryonic kidney iC3b inactive complement component 3 Ig immunoglobulin Igv-like domain immunoglobuline variable-like domain IP3 inositol (1,4,5)-trisphosphate ITAM immunoreceptor tyrosine-based activation motif ITIM immunoreceptor tyrosine-based inhibitory motif kDa kilo Dalton l liter LPS lipopolysaccharides

155

Abbreviations

M molar mAb monoclonal antibody mg milligramm min minutes ml milliliter mM millimolar MOI multiplicity of infection NADPH nicotinamide adenine dinucleotide phosphate hydrogen NFκB nuclear factor kappaB Ngo Neisseria gonorrhoeae NK natural killer cells nm nanometer NOX nicotinamide adenine dinucleotide phosphate oxidase NT N-terminal or amino-terminal domain Opa- non opa-expressing bacteria unable to bind CEACAMs Opa opacity protein

OpaCEA colony opacity protein binding to CEACAMs PAMPs pathogen-associated molecular patterns PBS phosphate buffered saline PCR polymerase chain reaction PH pleckstrin homology domain PI3K phosphatidylinositol 3’-kinase PIP3 phosphatidylinositol (3,4,5)-trisphosphate PMNs polymorphonuclear neutrophils PRR proline-rich regions PSG pregnancy-specific glycoproteins PTK protein tyrosine kinase pTyr phosphotyrosine RIPA radioimmunoprecipitation assay buffer ROS reactive oxygen species RT room temperature s seconds SD standard deviation SDS sodium dodecylsulfate SEM standard error of the mean SH2 Src-homology 2 domain SH3 Src-homology 3 domain Siglecs Sialic acid-binding immunoglobulin-type lectins SRF serum response factor TCR T-cell receptors Tg Transgenic TLR Toll-like receptors USF1 upstream transcription factor 1 WCL whole cell lysate WT wildtype YY1 Yin Yang 1 transcription factor

156

References

Aderem, A., and Underhill, D.M. (1999). Mechanisms of phagocytosis in macrophages. Annu Rev Immunol 17, 593-623. Agerer, F., Michel, A., Ohlsen, K., and Hauck, C.R. (2003). Integrin-mediated invasion of Staphylococcus aureus into human cells requires Src family protein tyrosine kinases. The Journal of biological chemistry 278, 42524-42531. Agerer, F., Waeckerle, S., and Hauck, C.R. (2004). Microscopic quantification of bacterial invasion by a novel antibody- independent staining method. Journal of microbiological methods 59, 23-32. Akuthota, P., Wang, H.B., Spencer, L.A., and Weller, P.F. (2008). Immunoregulatory roles of eosinophils: a new look at a familiar cell. Clinical and experimental allergy : journal of the British Society for Allergy and Clinical Immunology 38, 1254-1263. Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (2002). Innate immunity. In Molecular biology of the cell, N.Y. Garland Science, ed. Ambrose, C.T. (2006). The Osler slide, a demonstration of phagocytosis from 1876 Reports of phagocytosis before Metchnikoff's 1880 paper. Cellular immunology 240, 1-4. Ammar, I., Gogol-Doring, A., Miskey, C., Chen, W., Cathomen, T., Izsvak, Z., and Ivics, Z. (2012). Retargeting transposon insertions by the adeno-associated virus Rep protein. Nucleic acids research 40, 6693-6712. Amoras, A.L., Kanegane, H., Miyawaki, T., and Vilela, M.M. (2003). Defective Fc-, CR1- and CR3-mediated monocyte phagocytosis and chemotaxis in common variable immunodeficiency and X-linked agammaglobulinemia patients. Journal of investigational allergology & clinical immunology 13, 181-188. Anderson, C.L., Shen, L., Eicher, D.M., Wewers, M.D., and Gill, J.K. (1990). Phagocytosis mediated by three distinct Fc gamma receptor classes on human leukocytes. The Journal of experimental medicine 171, 1333-1345. Araki, N., Johnson, M.T., and Swanson, J.A. (1996). A role for phosphoinositide 3-kinase in the completion of macropinocytosis and phagocytosis by macrophages. The Journal of cell biology 135, 1249-1260. Areschoug, T., and Gordon, S. (2008). Pattern recognition receptors and their role in innate immunity: focus on microbial protein ligands. Contributions to microbiology 15, 45-60. Areschoug, T., and Gordon, S. (2009). Scavenger receptors: role in innate immunity and microbial pathogenesis. Cellular microbiology 11, 1160-1169. Arina, A., Murillo, O., Dubrot, J., Azpilikueta, A., Alfaro, C., Perez-Gracia, J.L., Bendandi, M., Palencia, B., Hervas- Stubbs, S., and Melero, I. (2007). Cellular liaisons of natural killer lymphocytes in immunology and immunotherapy of cancer. Expert opinion on biological therapy 7, 599-615. Aronoff, D.M. (2013). Clostridium novyi, sordellii, and tetani: mechanisms of disease. Anaerobe 24, 98-101. Aronovich, E.L., McIvor, R.S., and Hackett, P.B. (2011). The Sleeping Beauty transposon system: a non-viral vector for gene therapy. Human molecular genetics 20, R14-20. Arumugam, M., Raes, J., Pelletier, E., Le Paslier, D., Yamada, T., Mende, D.R., Fernandes, G.R., Tap, J., Bruls, T., Batto, J.M., et al. (2011). Enterotypes of the human gut microbiome. Nature 473, 174-180. Avgustin, G., Ramsak, A., and Peterka, M. (2001). Systematics and evolution of ruminal species of the genus Prevotella. Folia microbiologica 46, 40-44. Baba, Y., Nonoyama, S., Matsushita, M., Yamadori, T., Hashimoto, S., Imai, K., Arai, S., Kunikata, T., Kurimoto, M., Kurosaki, T., et al. (1999). Involvement of wiskott-aldrich syndrome protein in B-cell cytoplasmic tyrosine kinase pathway. Blood 93, 2003-2012. Banchereau, J., and Steinman, R.M. (1998). Dendritic cells and the control of immunity. Nature 392, 245-252. Barnich, N., Carvalho, F.A., Glasser, A.L., Darcha, C., Jantscheff, P., Allez, M., Peeters, H., Bommelaer, G., Desreumaux, P., Colombel, J.F., et al. (2007). CEACAM6 acts as a receptor for adherent-invasive E. coli, supporting ileal mucosa colonization in Crohn disease. The Journal of clinical investigation 117, 1566-1574. Bateup, H.S., Svenningsson, P., Kuroiwa, M., Gong, S., Nishi, A., Heintz, N., and Greengard, P. (2008). Cell type- specific regulation of DARPP-32 phosphorylation by psychostimulant and antipsychotic drugs. Nature neuroscience 11, 932-939. Beauchemin, N., and Arabzadeh, A. (2013). Carcinoembryonic antigen-related cell adhesion molecules (CEACAMs) in cancer progression and metastasis. Cancer metastasis reviews 32, 643-671. Beauchemin, N., Draber, P., Dveksler, G., Gold, P., Gray-Owen, S., Grunert, F., Hammarstrom, S., Holmes, K.V., Karlsson, A., Kuroki, M., et al. (1999). Redefined nomenclature for members of the carcinoembryonic antigen family. Experimental cell research 252, 243-249. Billker, O., Popp, A., Brinkmann, V., Wenig, G., Schneider, J., Caron, E., and Meyer, T.F. (2002). Distinct mechanisms of internalization of Neisseria gonorrhoeae by members of the CEACAM receptor family involving Rac1- and Cdc42- dependent and -independent pathways. The EMBO journal 21, 560-571. Bjerregaard, M.D., Jurlander, J., Klausen, P., Borregaard, N., and Cowland, J.B. (2003). The in vivo profile of transcription factors during neutrophil differentiation in human bone marrow. Blood 101, 4322-4332. Blumenthal, R.D., Leon, E., Hansen, H.J., and Goldenberg, D.M. (2007). Expression patterns of CEACAM5 and CEACAM6 in primary and metastatic cancers. BMC cancer 7, 2. Bokoch, G.M., and Diebold, B.A. (2002). Current molecular models for NADPH oxidase regulation by Rac GTPase. Blood 100, 2692-2696. Bonsignore, P. (2015). Investigating the host receptor binding capacity of anaerobic commensal bacteria from human gut. In Cell biology (Master thesis, University of Konstanz).

157

References

Booth, J.W., Telio, D., Liao, E.H., McCaw, S.E., Matsuo, T., Grinstein, S., and Gray-Owen, S.D. (2003). Phosphatidylinositol 3-kinases in carcinoembryonic antigen-related cellular adhesion molecule-mediated internalization of Neisseria gonorrhoeae. The Journal of biological chemistry 278, 14037-14045. Borregaard, N. (2010). Neutrophils, from marrow to microbes. Immunity 33, 657-670. Borregaard, N., and Cowland, J.B. (1997). Granules of the human neutrophilic polymorphonuclear leukocyte. Blood 89, 3503-3521. Borregaard, N., Lollike, K., Kjeldsen, L., Sengelov, H., Bastholm, L., Nielsen, M.H., and Bainton, D.F. (1993). Human neutrophil granules and secretory vesicles. European journal of haematology 51, 187-198. Bos, M.P., Kuroki, M., Krop-Watorek, A., Hogan, D., and Belland, R.J. (1998). CD66 receptor specificity exhibited by neisserial Opa variants is controlled by protein determinants in CD66 N-domains. Proceedings of the National Academy of Sciences of the United States of America 95, 9584-9589. Boxio, R., Bossenmeyer-Pourie, C., Steinckwich, N., Dournon, C., and Nusse, O. (2004). Mouse bone marrow contains large numbers of functionally competent neutrophils. Journal of leukocyte biology 75, 604-611. Boyton, R.J., and Openshaw, P.J. (2002). Pulmonary defences to acute respiratory infection. British medical bulletin 61, 1-12. Bradshaw, J.M. (2010). The Src, Syk, and Tec family kinases: distinct types of molecular switches. Cellular signalling 22, 1175-1184. Brandriff, B.F., Gordon, L.A., Tynan, K.T., Olsen, A.S., Mohrenweiser, H.W., Fertitta, A., Carrano, A.V., and Trask, B.J. (1992). Order and genomic distances among members of the carcinoembryonic antigen (CEA) gene family determined by fluorescence in situ hybridization. Genomics 12, 773-779. Brehm, M.A., Shultz, L.D., and Greiner, D.L. (2010). Humanized mouse models to study human diseases. Current opinion in endocrinology, diabetes, and obesity 17, 120-125. Brinkmann, V., Reichard, U., Goosmann, C., Fauler, B., Uhlemann, Y., Weiss, D.S., Weinrauch, Y., and Zychlinsky, A. (2004). Neutrophil extracellular traps kill bacteria. Science 303, 1532-1535. Brooks, M.J., Sedillo, J.L., Wagner, N., Wang, W., Attia, A.S., Wong, H., Laurence, C.A., Hansen, E.J., and Gray-Owen, S.D. (2008). Moraxella catarrhalis binding to host cellular receptors is mediated by sequence-specific determinants not conserved among all UspA1 protein variants. Infection and immunity 76, 5322-5329. Brown, G.D. (2006). Dectin-1: a signalling non-TLR pattern-recognition receptor. Nature reviews. Immunology 6, 33-43. Brown, S., Heinisch, I., Ross, E., Shaw, K., Buckley, C.D., and Savill, J. (2002). Apoptosis disables CD31-mediated cell detachment from phagocytes promoting binding and engulfment. Nature 418, 200-203. Buntru, A., Kopp, K., Voges, M., Frank, R., Bachmann, V., and Hauck, C.R. (2011). Phosphatidylinositol-3' kinase activity is critical for initiating the oxidative burst and bacterial destruction during CEACAM3-mediated phagocytosis. The Journal of biological chemistry 286, 9555-9566. Buntru, A., Roth, A., Nyffenegger-Jann, N.J., and Hauck, C.R. (2012). HemITAM signaling by CEACAM3, a human granulocyte receptor recognizing bacterial pathogens. Archives of biochemistry and biophysics 524, 77-83. Buntru, A., Zimmermann, T., and Hauck, C.R. (2009). FRET-based subcellular visualization of pathogen-induced host receptor signalling. BMC Biol 7, 81. Bustelo, X.R. (2001). Vav proteins, adaptors and cell signaling. Oncogene 20, 6372-6381. Casadevall, A., and Pirofski, L.A. (2014). Microbiology: Ditch the term pathogen. Nature 516, 165-166. Chan, C.H., and Stanners, C.P. (2004). Novel mouse model for carcinoembryonic antigen-based therapy. Molecular therapy : the journal of the American Society of Gene Therapy 9, 775-785. Chang, C.L., Semyonov, J., Cheng, P.J., Huang, S.Y., Park, J.I., Tsai, H.J., Lin, C.Y., Grutzner, F., Soong, Y.K., Cai, J.J., et al. (2013). Widespread divergence of the CEACAM/PSG genes in vertebrates and humans suggests sensitivity to selection. PloS one 8, e61701. Chang, Y.C., and Nizet, V. (2014). The interplay between Siglecs and sialylated pathogens. Glycobiology 24, 818-825. Chen, T., Bolland, S., Chen, I., Parker, J., Pantelic, M., Grunert, F., and Zimmermann, W. (2001a). The CGM1a (CEACAM3/CD66d)-mediated phagocytic pathway of Neisseria gonorrhoeae expressing opacity proteins is also the pathway to cell death. The Journal of biological chemistry 276, 17413-17419. Chen, T., and Gotschlich, E.C. (1996). CGM1a antigen of neutrophils, a receptor of gonococcal opacity proteins. Proceedings of the National Academy of Sciences of the United States of America 93, 14851-14856. Chen, T., Grunert, F., Medina-Marino, A., and Gotschlich, E.C. (1997). Several carcinoembryonic antigens (CD66) serve as receptors for gonococcal opacity proteins. Journal of Experimental Medicine 185, 1557-1564. Chen, T., Zimmermann, W., Parker, J., Chen, I., Maeda, A., and Bolland, S. (2001b). Biliary glycoprotein (BGPa, CD66a, CEACAM1) mediates inhibitory signals. Journal of leukocyte biology 70, 335-340. Chen, W., Zhang, C.K., Cheng, Y., Zhang, S., and Zhao, H. (2013). A comparison of methods for clustering 16S rRNA sequences into OTUs. PloS one 8, e70837. Chevinsky, A.H. (1991). CEA in tumors of other than colorectal origin. Seminars in surgical oncology 7, 162-166. Cho, B.K., Knight, E.M., and Palsson, B.O. (2006). Transcriptional regulation of the fad regulon genes of Escherichia coli by ArcA. Microbiology 152, 2207-2219. Cho, I., and Blaser, M.J. (2012). The human microbiome: at the interface of health and disease. Nature reviews. Genetics 13, 260-270. Chu, H., and Mazmanian, S.K. (2013). Innate immune recognition of the microbiota promotes host-microbial symbiosis. Nature immunology 14, 668-675. Cochrane, G., Karsch-Mizrachi, I., and Nakamura, Y. (2011). The International Nucleotide Sequence Database Collaboration. Nucleic acids research 39, D15-18. Copeland, N.G., Jenkins, N.A., and Court, D.L. (2001). Recombineering: a powerful new tool for mouse functional genomics. Nature reviews. Genetics 2, 769-779.

158

References

Coussens, L.M., and Werb, Z. (2001). Inflammatory cells and cancer: think different! The Journal of experimental medicine 193, F23-26. Cowland, J.B., and Borregaard, N. (1999). Isolation of neutrophil precursors from bone marrow for biochemical and transcriptional analysis. Journal of immunological methods 232, 191-200. Cox, D., Chang, P., Zhang, Q., Reddy, P.G., Bokoch, G.M., and Greenberg, S. (1997). Requirements for both Rac1 and Cdc42 in membrane ruffling and phagocytosis in leukocytes. The Journal of experimental medicine 186, 1487- 1494. Crespo, P., Schuebel, K.E., Ostrom, A.A., Gutkind, J.S., and Bustelo, X.R. (1997). Phosphotyrosine-dependent activation of Rac-1 GDP/GTP exchange by the vav proto-oncogene product. Nature 385, 169-172. De Filippo, C., Cavalieri, D., Di Paola, M., Ramazzotti, M., Poullet, J.B., Massart, S., Collini, S., Pieraccini, G., and Lionetti, P. (2010). Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proceedings of the National Academy of Sciences of the United States of America 107, 14691-14696. de Vries, F.P., van Der Ende, A., van Putten, J.P., and Dankert, J. (1996). Invasion of primary nasopharyngeal epithelial cells by Neisseria meningitidis is controlled by phase variation of multiple surface antigens. Infection and immunity 64, 2998-3006. Deckert, M., Tartare-Deckert, S., Couture, C., Mustelin, T., and Altman, A. (1996). Functional and physical interactions of Syk family kinases with the Vav proto-oncogene product. Immunity 5, 591-604. DeKoter, R.P., Walsh, J.C., and Singh, H. (1998). PU.1 regulates both cytokine-dependent proliferation and differentiation of granulocyte/macrophage progenitors. The EMBO journal 17, 4456-4468. Delgado Tascón, J., Adrian, J., Kopp, K., Scholz, P., Tschan, M.P., Kuespert, K., and Hauck, C.R. (2015). The granulocyte orphan receptor CEACAM4 is able to trigger phagocytosis of bacteria. Journal of leukocyte biology 97, 521-531. Diekmann, D., Abo, A., Johnston, C., Segal, A.W., and Hall, A. (1994). Interaction of Rac with p67((phox)) and regulation of phagocytic NADPH oxidase activity. Science 265, 531-533. Dinauer, M.C. (2003). Regulation of neutrophil function by Rac GTPases. Curr Opin Hematol 10, 8-15. Dranoff, G. (2004). Cytokines in cancer pathogenesis and cancer therapy. Nature reviews. Cancer 4, 11-22. Ducker, T.P., and Skubitz, K.M. (1992). Subcellular localization of CD66, CD67, and NCA in human neutrophils. Journal of leukocyte biology 52, 11-16. Dussurget, O., Bierne, H., and Cossart, P. (2014). The bacterial pathogen Listeria monocytogenes and the interferon family: type I, type II and type III interferons. Frontiers in cellular and infection microbiology 4, 50. Dzik, J.M. (2010). The ancestry and cumulative evolution of immune reactions. Acta biochimica Polonica 57, 443-466. Eckburg, P.B., Bik, E.M., Bernstein, C.N., Purdom, E., Dethlefsen, L., Sargent, M., Gill, S.R., Nelson, K.E., and Relman, D.A. (2005). Diversity of the human intestinal microbial flora. Science 308, 1635-1638. Eddy, R., Pierini, L., and Maxfield, F. (2002). Microtubule Asymmetry during Neutrophil Polarization and Migration. Molecular Biology of the Cell Vol. 13, 4470 – 448. Ellmeier, W., Jung, S., Sunshine, M.J., Hatam, F., Xu, Y., Baltimore, D., Mano, H., and Littman, D.R. (2000). Severe B cell deficiency in mice lacking the tec kinase family members Tec and Btk. The Journal of experimental medicine 192, 1611-1624. Evans, C.M., Pratt, C.B., Matheson, M., Vaughan, T.E., Findlow, J., Borrow, R., Gorringe, A.R., and Read, R.C. (2011). Nasopharyngeal colonization by Neisseria lactamica and induction of protective immunity against Neisseria meningitidis. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 52, 70-77. Ezekowitz, R.A., Sastry, K., Bailly, P., and Warner, A. (1990). Molecular characterization of the human macrophage mannose receptor: demonstration of multiple carbohydrate recognition-like domains and phagocytosis of yeasts in Cos-1 cells. The Journal of experimental medicine 172, 1785-1794. Fang, J., Zhang, W.C., Yamashita, T., Gao, J., Zhu, M.S., and Zuo, J. (2012). Outer hair cell-specific prestin-CreERT2 knockin mouse lines. Genesis 50, 124-131. Feil, R., Wagner, J., Metzger, D., and Chambon, P. (1997). Regulation of Cre recombinase activity by mutated estrogen receptor ligand-binding domains. Biochemical and biophysical research communications 237, 752-757. Ferencik, M., and Stvrtinova, V. (1996). Endogenous control and modulation of inflammation. Folia biologica 42, 47-55. Ferencik, M., Stvrtinova, V., Hulin, I., and Novak, M. (2007). Inflammation--a lifelong companion. Attempt at a non- analytical holistic view. Folia microbiologica 52, 159-173. Fernandes, M.J., Lachance, G., Pare, G., Rollet-Labelle, E., and Naccache, P.H. (2005). Signaling through CD16b in human neutrophils involves the Tec family of tyrosine kinases. Journal of leukocyte biology 78, 524-532. Fischer, S.E., Wienholds, E., and Plasterk, R.H. (2001). Regulated transposition of a fish transposon in the mouse germ line. Proceedings of the National Academy of Sciences of the United States of America 98, 6759-6764. Flannagan, R.S., Cosio, G., and Grinstein, S. (2009). Antimicrobial mechanisms of phagocytes and bacterial evasion strategies. Nature reviews. Microbiology 7, 355-366. Flannagan, R.S., Jaumouille, V., and Grinstein, S. (2012). The cell biology of phagocytosis. Annual review of pathology 7, 61-98. Fluckiger, A.C., Li, Z., Kato, R.M., Wahl, M.I., Ochs, H.D., Longnecker, R., Kinet, J.P., Witte, O.N., Scharenberg, A.M., and Rawlings, D.J. (1998). Btk/Tec kinases regulate sustained increases in intracellular Ca2+ following B-cell receptor activation. The EMBO journal 17, 1973-1985. Frank, R. (1992). Spot-Synthesis: An easy technique for the positionally addressable, parallel chemical synthesis on a membrane support. Tetrahedron 48, 9217-9232.

159

References

Fuller, G.L., Williams, J.A., Tomlinson, M.G., Eble, J.A., Hanna, S.L., Pohlmann, S., Suzuki-Inoue, K., Ozaki, Y., Watson, S.P., and Pearce, A.C. (2007). The C-type lectin receptors CLEC-2 and Dectin-1, but not DC-SIGN, signal via a novel YXXL-dependent signaling cascade. The Journal of biological chemistry 282, 12397-12409. Furie, B., and Furie, B.C. (2007). In vivo thrombus formation. Journal of thrombosis and haemostasis : JTH 5 Suppl 1, 12-17. Ganz, T., Gabayan, V., Liao, H.I., Liu, L., Oren, A., Graf, T., and Cole, A.M. (2003). Increased inflammation in lysozyme M-deficient mice in response to Micrococcus luteus and its peptidoglycan. Blood 101, 2388-2392. Gerritsen, J., Smidt, H., Rijkers, G.T., and de Vos, W.M. (2011). Intestinal microbiota in human health and disease: the impact of probiotics. Genes & nutrition 6, 209-240. Gilbert, C., Levasseur, S., Desaulniers, P., Dusseault, A.A., Thibault, N., Bourgoin, S.G., and Naccache, P.H. (2003). Chemotactic factor-induced recruitment and activation of Tec family kinases in human neutrophils. II. Effects of LFM-A13, a specific Btk inhibitor. J Immunol 170, 5235-5243. Gilbert, C., Rollet-Labelle, E., and Naccache, P.H. (2002). Preservation of the pattern of tyrosine phosphorylation in human neutrophil lysates. II. A sequential lysis protocol for the analysis of tyrosine phosphorylation-dependent signalling. Journal of immunological methods 261, 85-101. Gong, S., Zheng, C., Doughty, M.L., Losos, K., Didkovsky, N., Schambra, U.B., Nowak, N.J., Joyner, A., Leblanc, G., Hatten, M.E., et al. (2003). A gene expression atlas of the central nervous system based on bacterial artificial chromosomes. Nature 425, 917-925. Goodridge, H.S., Underhill, D.M., and Touret, N. (2012). Mechanisms of Fc receptor and dectin-1 activation for phagocytosis. Traffic 13, 1062-1071. Gorbach, S.L. (1990). Lactic acid bacteria and human health. Annals of medicine 22, 37-41. Grabundzija, I., Irgang, M., Mates, L., Belay, E., Matrai, J., Gogol-Doring, A., Kawakami, K., Chen, W., Ruiz, P., Chuah, M.K., et al. (2010). Comparative analysis of transposable element vector systems in human cells. Molecular therapy : the journal of the American Society of Gene Therapy 18, 1200-1209. Gray-Owen, S.D., and Blumberg, R.S. (2006). CEACAM1: contact-dependent control of immunity. Nature reviews. Immunology 6, 433-446. Gray-Owen, S.D., Dehio, C., Haude, A., Grunert, F., and Meyer, T.F. (1997a). CD66 carcinoembryonic antigens mediate interactions between Opa-expressing Neisseria gonorrhoeae and human polymorphonuclear phagocytes. The EMBO journal 16, 3435-3445. Gray-Owen, S.D., Lorenzen, D.R., Haude, A., Meyer, T.F., and Dehio, C. (1997b). Differential Opa specificities for CD66 receptors influence tissue interactions and cellular response to Neisseria gonorrhoeae. Molecular microbiology 26, 971-980. Greenberg, S., and Grinstein, S. (2002). Phagocytosis and innate immunity. Current opinion in immunology 14, 136-145. Gringhuis, S.I., Kaptein, T.M., Wevers, B.A., Theelen, B., van der Vlist, M., Boekhout, T., and Geijtenbeek, T.B. (2012). Dectin-1 is an extracellular pathogen sensor for the induction and processing of IL-1beta via a noncanonical caspase-8 inflammasome. Nature immunology 13, 246-254. Groves, E., Dart, A.E., Covarelli, V., and Caron, E. (2008). Molecular mechanisms of phagocytic uptake in mammalian cells. Cellular and molecular life sciences : CMLS 65, 1957-1976. Gu, A., Zhang, Z., Zhang, N., Tsark, W., and Shively, J.E. (2010). Generation of human CEACAM1 transgenic mice and binding of Neisseria Opa protein to their neutrophils. PloS one 5, e10067. Guinamard, R., Aspenstrom, P., Fougereau, M., Chavrier, P., and Guillemot, J.C. (1998). Tyrosine phosphorylation of the Wiskott-Aldrich syndrome protein by Lyn and Btk is regulated by CDC42. FEBS letters 434, 431-436. Gurtner, G.C., Werner, S., Barrandon, Y., and Longaker, M.T. (2008). Wound repair and regeneration. Nature 453, 314- 321. Hager, M., Cowland, J.B., and Borregaard, N. (2010). Neutrophil granules in health and disease. Journal of internal medicine 268, 25-34. Halverson, T.W., Wilton, M., Poon, K.K., Petri, B., and Lewenza, S. (2015). DNA is an antimicrobial component of neutrophil extracellular traps. PLoS pathogens 11, e1004593. Hammarstrom, S. (1999). The carcinoembryonic antigen (CEA) family: structures, suggested functions and expression in normal and malignant tissues. Seminars in cancer biology 9, 67-81. Hankiewicz, J., and Swierczek, E. (1974). Lysozyme in human body fluids. Clinica chimica acta; international journal of clinical chemistry 57, 205-209. Hauck, C.R. (2002). Cell adhesion receptors - signaling capacity and exploitation by bacterial pathogens. Medical microbiology and immunology 191, 55-62. Hauck, C.R., Hunter, T., and Schlaepfer, D.D. (2001). The v-Src SH3 domain facilitates a cell adhesion-independent association with FAK. Journal of Biological Chemistry 276, 17653-17662. Hauck, C.R., Lorenzen, D., Saas, J., and Meyer, T.F. (1997). An in vitro-differentiated human cell line as a model system to study the interaction of Neisseria gonorrhoeae with phagocytic cells. Infection & Immunity 65, 1863-1869. Hauck, C.R., and Meyer, T.F. (2003). "Small"talk: Opa proteins as mediators of Neisseria-host cell communication. Current opinion in microbiology 6, 43-49.

Hauck, C.R., Meyer, T.F., Lang, F., and Gulbins, E. (1998). CD66-mediated phagocytosis of Opa52 Neisseria gonorrhoeae requires a Src-like tyrosine kinase- and Rac1-dependent signalling pathway. The EMBO journal 17, 443-454. Hawkins, P.T., Davidson, K., and Stephens, L.R. (2007). The role of PI3Ks in the regulation of the neutrophil NADPH oxidase. Biochem Soc Symp, 59-67. Hayashi, F., Means, T.K., and Luster, A.D. (2003). Toll-like receptors stimulate human neutrophil function. Blood 102, 2660-2669.

160

References

Henry, S.P., Jang, C.W., Deng, J.M., Zhang, Z., Behringer, R.R., and de Crombrugghe, B. (2009). Generation of aggrecan-CreERT2 knockin mice for inducible Cre activity in adult cartilage. Genesis 47, 805-814. Hickey, M.J., and Kubes, P. (2009). Intravascular immunity: the host-pathogen encounter in blood vessels. Nature reviews. Immunology 9, 364-375. Hill, D.J., Toleman, M.A., Evans, D.J., Villullas, S., Van Alphen, L., and Virji, M. (2001). The variable P5 proteins of typeable and non-typeable Haemophilus influenzae target human CEACAM1. Molecular microbiology 39, 850- 862. Hill, D.J., and Virji, M. (2003). A novel cell-binding mechanism of Moraxella catarrhalis ubiquitous surface protein UspA: specific targeting of the N-domain of carcinoembryonic antigen-related cell adhesion molecules by UspA1. Molecular microbiology 48, 117-129. Hirayama, T., Tamaki, Y., Takakubo, Y., Iwazaki, K., Sasaki, K., Ogino, T., Goodman, S.B., Konttinen, Y.T., and Takagi, M. (2011). Toll-like receptors and their adaptors are regulated in macrophages after phagocytosis of lipopolysaccharide-coated titanium particles. Journal of orthopaedic research : official publication of the Orthopaedic Research Society 29, 984-992. Hogan, B., Baddington, R., Costantini, F., and Lacy, E. (1994). Manipulating the Mouse Embryo (New York: Cold Spring Harbour Laboratory Press). Horst, A.K., Ito, W.D., Dabelstein, J., Schumacher, U., Sander, H., Turbide, C., Brummer, J., Meinertz, T., Beauchemin, N., and Wagener, C. (2006). Carcinoembryonic antigen-related cell adhesion molecule 1 modulates vascular remodeling in vitro and in vivo. The Journal of clinical investigation 116, 1596-1605. Huang, J., Hardy, J.D., Sun, Y., and Shively, J.E. (1999). Essential role of biliary glycoprotein (CD66a) in morphogenesis of the human mammary epithelial cell line MCF10F. Journal of cell science 112 ( Pt 23), 4193- 4205. Iannello, A., Debbeche, O., Samarani, S., and Ahmad, A. (2008). Antiviral NK cell responses in HIV infection: I. NK cell receptor genes as determinants of HIV resistance and progression to AIDS. Journal of leukocyte biology 84, 1-26. Ignatieva, E.V., Levitsky, V.G., Yudin, N.S., Moshkin, M.P., and Kolchanov, N.A. (2014). Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset. Frontiers in psychology 5, 247. Indik, Z.K., Park, J.G., Hunter, S., and Schreiber, A.D. (1995). The molecular dissection of Fc gamma receptor mediated phagocytosis. Blood 86, 4389-4399. Ivics, Z., Hackett, P.B., Plasterk, R.H., and Izsvak, Z. (1997). Molecular reconstruction of Sleeping Beauty, a Tc1-like transposon from fish, and its transposition in human cells. Cell 91, 501-510. Ivics, Z., and Izsvak, Z. (2004). Transposable elements for transgenesis and insertional mutagenesis in vertebrates: a contemporary review of experimental strategies. Methods Mol Biol 260, 255-276. Ivics, Z., Kaufman, C.D., Zayed, H., Miskey, C., Walisko, O., and Izsvak, Z. (2004). The Sleeping Beauty transposable element: evolution, regulation and genetic applications. Current issues in molecular biology 6, 43-55. Ivics, Z., Mates, L., Yau, T.Y., Landa, V., Zidek, V., Bashir, S., Hoffmann, O.I., Hiripi, L., Garrels, W., Kues, W.A., et al. (2014). Germline transgenesis in rodents by pronuclear microinjection of Sleeping Beauty transposons. Nature protocols 9, 773-793. Izsvak, Z., and Ivics, Z. (2004). Sleeping beauty transposition: biology and applications for molecular therapy. Molecular therapy : the journal of the American Society of Gene Therapy 9, 147-156. Izsvak, Z., Ivics, Z., and Plasterk, R.H. (2000). Sleeping Beauty, a wide host-range transposon vector for genetic transformation in vertebrates. Journal of molecular biology 302, 93-102. Jaisser, F. (2000). Inducible gene expression and gene modification in transgenic mice. Journal of the American Society of Nephrology : JASN 11 Suppl 16, S95-S100. Janeway, C.J., P., T., M, W., and al., E. (2001). Immunobiology: The Immune System in Health and Disease. In The complement system and innate immunity, N.Y. Garland Science, ed. Jefferies, C.A., Doyle, S., Brunner, C., Dunne, A., Brint, E., Wietek, C., Walch, E., Wirth, T., and O'Neill, L.A. (2003). Bruton's tyrosine kinase is a Toll/interleukin-1 receptor domain-binding protein that participates in nuclear factor kappaB activation by Toll-like receptor 4. The Journal of biological chemistry 278, 26258-26264. Jin, Z., Maiti, S., Huls, H., Singh, H., Olivares, S., Mates, L., Izsvak, Z., Ivics, Z., Lee, D.A., Champlin, R.E., et al. (2011). The hyperactive Sleeping Beauty transposase SB100X improves the genetic modification of T cells to express a chimeric antigen receptor. Gene therapy 18, 849-856. Johnson, S.A., Pleiman, C.M., Pao, L., Schneringer, J., Hippen, K., and Cambier, J.C. (1995). Phosphorylated immunoreceptor signaling motifs (ITAMs) exhibit unique abilities to bind and activate Lyn and Syk tyrosine kinases. J Immunol 155, 4596-4603. Johswich, K.O., McCaw, S.E., Islam, E., Sintsova, A., Gu, A., Shively, J.E., and Gray-Owen, S.D. (2013). In Vivo Adaptation and Persistence of Neisseria meningitidis within the Nasopharyngeal Mucosa. PLoS pathogens 9, e1003509. Jongstra-Bilen, J., Puig Cano, A., Hasija, M., Xiao, H., Smith, C.I., and Cybulsky, M.I. (2008). Dual functions of Bruton's tyrosine kinase and Tec kinase during Fcgamma receptor-induced signaling and phagocytosis. J Immunol 181, 288-298. Jutras, I., and Desjardins, M. (2005). Phagocytosis: at the crossroads of innate and adaptive immunity. Annual review of cell and developmental biology 21, 511-527. Kammerer, R., Popp, T., Hartle, S., Singer, B.B., and Zimmermann, W. (2007). Species-specific evolution of immune receptor tyrosine based activation motif-containing CEACAM1-related immune receptors in the dog. BMC Evol Biol 7, 196.

161

References

Kammerer, R., Ruttiger, L., Riesenberg, R., Schauble, C., Krupar, R., Kamp, A., Sunami, K., Eisenried, A., Hennenberg, M., Grunert, F., et al. (2012). Loss of mammal-specific tectorial membrane component carcinoembryonic antigen cell adhesion molecule 16 (CEACAM16) leads to hearing impairment at low and high frequencies. The Journal of biological chemistry 287, 21584-21598. Kammerer, R., and Zimmermann, W. (2010). Coevolution of activating and inhibitory receptors within mammalian carcinoembryonic antigen (CEA) families. BMC Biology 8, 12. Kaneko, T., and Mashimo, T. (2015). Creating knockout and knockin rodents using engineered endonucleases via direct embryo injection. Methods Mol Biol 1239, 307-315. Kennedy, A.D., Willment, J.A., Dorward, D.W., Williams, D.L., Brown, G.D., and DeLeo, F.R. (2007). Dectin-1 promotes fungicidal activity of human neutrophils. European journal of immunology 37, 467-478. Khanam, T., Rozhdestvensky, T.S., Bundman, M., Galiveti, C.R., Handel, S., Sukonina, V., Jordan, U., Brosius, J., and Skryabin, B.V. (2007). Two primate-specific small non-protein-coding RNAs in transgenic mice: neuronal expression, subcellular localization and binding partners. Nucleic acids research 35, 529-539. Kiefer, F., Brumell, J., Al-Alawi, N., Latour, S., Cheng, A., Veillette, A., Grinstein, S., and Pawson, T. (1998). The Syk protein tyrosine kinase is essential for Fcgamma receptor signaling in macrophages and neutrophils. Molecular and cellular biology 18, 4209-4220. Kitanaka, A., Mano, H., Conley, M.E., and Campana, D. (1998). Expression and activation of the nonreceptor tyrosine kinase Tec in human B cells. Blood 91, 940-948. Kline, J.B., Moore, D.J., and Clevenger, C.V. (2001). Activation and association of the Tec tyrosine kinase with the human prolactin receptor: mapping of a Tec/Vav1-receptor binding site. Mol Endocrinol 15, 832-841. Kolaczkowska, E., and Kubes, P. (2013). Neutrophil recruitment and function in health and inflammation. Nature reviews. Immunology 13, 159-175. Kopp, K., Buntru, A., Pils, S., Zimmermann, T., Frank, R., Zumbusch, A., and Hauck, C.R. (2012). GRB14 is a negative regulator of ceacam3-mediated phagocytosis of pathogenic bacteria. The Journal of biological chemistry 287, 39158-39170. Koprulu, A.D., Kastner, R., Wienerroither, S., Lassnig, C., Putz, E.M., Majer, O., Reutterer, B., Sexl, V., Kuchler, K., Muller, M., et al. (2013). The tyrosine kinase Btk regulates the macrophage response to Listeria monocytogenes infection. PloS one 8, e60476. Kuespert, K., and Hauck, C.R. (2009). Characterizing host receptor recognition by individual bacterial pathogens. In Methods in Molecular Biology, S. Rupp, K. Sohn, and N. Hauser, eds. (Totowa: Humana Press), pp. 57-65. Kuespert, K., Pils, S., and Hauck, C.R. (2006). CEACAMs - their role in physiology and pathophysiology. Current opinion in cell biology 18, 565-571. Kuespert, K., Roth, A., and Hauck, C.R. (2011). Neisseria meningitidis has two independent modes of recognizing its human receptor CEACAM1. PloS one 6, e14609. Kuespert, K., Weibel, S., and Hauck, C.R. (2007). Profiling of bacterial adhesin – host receptor recognition by soluble immunoglobulin superfamily domains. Journal of microbiological methods 68, 478-485. Kupsch, E.-M., Knepper, B., Kuroki, T., Heuer, I., and Meyer, T.F. (1993a). Variable opacity (Opa) outer membrane proteins account for the cell tropisms displayed by Neisseria gonorrhoeae for human leukocytes and epithelial cells. The EMBO journal 12, 641-650. Kupsch, E.M., Knepper, B., Kuroki, T., Heuer, I., and Meyer, T.F. (1993b). Variable opacity (Opa) outer membrane proteins account for the cell tropisms displayed by Neisseria gonorrhoeae for human leukocytes and epithelial cells. The EMBO journal 12, 641-650. Kuroki, M., Arakawa, F., Matsuo, Y., Oikawa, S., Misumi, Y., Nakazato, H., and Matsuoka, Y. (1991). Molecular cloning of nonspecific cross-reacting antigens in human granulocytes. The Journal of biological chemistry 266, 11810-11817. Kuroki, M., Matsuo, Y., Kinugasa, T., and Matsuoka, Y. (1992). Augmented expression and release of nonspecific cross- reacting antigens (NCAs), members of the CEA family, by human neutrophils during cell activation. Journal of leukocyte biology 52, 551-557. Kuroki, M., Matsuo, Y., and Matsuoka, Y. (1990). Nonspecific cross-reacting antigen (NCA) expressed by human granulocytes: six species with different peptide sizes and membrane anchoring forms. Biochemical & Biophysical Research Communications 166, 701-708. Kuroki, M., Yamanaka, T., Matsuo, Y., Oikawa, S., Nakazato, H., and Matsuoka, Y. (1995). Immunochemical analysis of carcinoembryonic antigen (CEA)- related antigens differentially localized in intracellular granules of human neutrophils. Immunological investigations 24, 829-843. Lachance, G., Levasseur, S., and Naccache, P.H. (2002). Chemotactic factor-induced recruitment and activation of Tec family kinases in human neutrophils. Implication of phosphatidynositol 3-kinases. The Journal of biological chemistry 277, 21537-21541. Lapinski, T.W., Prokopowicz, D., and Dare, A. (1996). Clostridium difficile colitis--diagnosis and therapy. Rocz Akad Med Bialymst 41, 176-182. Leung, N., Turbide, C., Olson, M., Marcus, V., Jothy, S., and Beauchemin, N. (2006). Deletion of the carcinoembryonic antigen-related cell adhesion molecule 1 (Ceacam1) gene contributes to colon tumor progression in a murine model of carcinogenesis. Oncogene 25, 5527-5536. Lewis, C.M., Broussard, C., Czar, M.J., and Schwartzberg, P.L. (2001). Tec kinases: modulators of lymphocyte signaling and development. Current opinion in immunology 13, 317-325. Ley, K., Laudanna, C., Cybulsky, M.I., and Nourshargh, S. (2007). Getting to the site of inflammation: the leukocyte adhesion cascade updated. Nature reviews. Immunology 7, 678-689.

162

References

Ley, R.E., Peterson, D.A., and Gordon, J.I. (2006). Ecological and evolutionary forces shaping microbial diversity in the human intestine. Cell 124, 837-848. Li, K., Bihan, M., Yooseph, S., and Methe, B.A. (2012). Analyses of the microbial diversity across the human microbiome. PloS one 7, e32118. Litman, G.W., Cannon, J.P., and Dishaw, L.J. (2005). Reconstructing immune phylogeny: new perspectives. Nature reviews. Immunology 5, 866-879. Lobo, M.K., Karsten, S.L., Gray, M., Geschwind, D.H., and Yang, X.W. (2006). FACS-array profiling of striatal projection neuron subtypes in juvenile and adult mouse brains. Nature neuroscience 9, 443-452. Lodoen, M.B., and Lanier, L.L. (2005). Viral modulation of NK cell immunity. Nature reviews. Microbiology 3, 59-69. Lopetuso, L.R., Scaldaferri, F., Petito, V., and Gasbarrini, A. (2013). Commensal Clostridia: leading players in the maintenance of gut homeostasis. Gut pathogens 5, 23. Machide, M., Mano, H., and Todokoro, K. (1995). Interleukin 3 and erythropoietin induce association of Vav with Tec kinase through Tec homology domain. Oncogene 11, 619-625. Mahajan, S., Ghosh, S., Sudbeck, E.A., Zheng, Y., Downs, S., Hupke, M., and Uckun, F.M. (1999). Rational design and synthesis of a novel anti-leukemic agent targeting Bruton's tyrosine kinase (BTK), LFM-A13 [alpha-cyano-beta- hydroxy-beta-methyl-N-(2, 5-dibromophenyl)propenamide]. The Journal of biological chemistry 274, 9587-9599. Mahowald, M.A., Rey, F.E., Seedorf, H., Turnbaugh, P.J., Fulton, R.S., Wollam, A., Shah, N., Wang, C., Magrini, V., Wilson, R.K., et al. (2009). Characterizing a model human gut microbiota composed of members of its two dominant bacterial phyla. Proceedings of the National Academy of Sciences of the United States of America 106, 5859-5864. Mangla, A., Khare, A., Vineeth, V., Panday, N.N., Mukhopadhyay, A., Ravindran, B., Bal, V., George, A., and Rath, S. (2004). Pleiotropic consequences of Bruton tyrosine kinase deficiency in myeloid lineages lead to poor inflammatory responses. Blood 104, 1191-1197. Mano, H., Yamashita, Y., Sato, K., Yazaki, Y., and Hirai, H. (1995). Tec protein-tyrosine kinase is involved in interleukin-3 signaling pathway. Blood 85, 343-350. Mao, D.P., Zhou, Q., Chen, C.Y., and Quan, Z.X. (2012). Coverage evaluation of universal bacterial primers using the metagenomic datasets. BMC microbiology 12, 66. Martin, S.J., Reutelingsperger, C.P., McGahon, A.J., Rader, J.A., van Schie, R.C., LaFace, D.M., and Green, D.R. (1995). Early redistribution of plasma membrane phosphatidylserine is a general feature of apoptosis regardless of the initiating stimulus: inhibition by overexpression of Bcl-2 and Abl. The Journal of experimental medicine 182, 1545-1556. Maselli, R.A. (1998). Pathogenesis of human botulism. Annals of the New York Academy of Sciences 841, 122-139. Mates, L., Chuah, M.K., Belay, E., Jerchow, B., Manoj, N., Acosta-Sanchez, A., Grzela, D.P., Schmitt, A., Becker, K., Matrai, J., et al. (2009). Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Nature genetics 41, 753-761. Mayer, G. (2006). Immunology-Chapter One: Innate (non-specific) Immunity. In Microbiology and Immunology On-line Textbook, U. USC School of Medicine, ed. McCaw, S.E., Liao, E.H., and Gray-Owen, S.D. (2004). Engulfment of Neisseria gonorrhoeae: revealing distinct processes of bacterial entry by individual carcinoembryonic antigen-related cellular adhesion molecule family receptors. Infection and immunity 72, 2742-2752. McCaw, S.E., Schneider, J., Liao, E.H., Zimmermann, W., and Gray-Owen, S.D. (2003). Immunoreceptor tyrosine-based activation motif phosphorylation during engulfment of Neisseria gonorrhoeae by the neutrophil-restricted CEACAM3 (CD66d) receptor. Molecular microbiology 49, 623-637. McCracken, J.M., and Allen, L.A. (2014). Regulation of human neutrophil apoptosis and lifespan in health and disease. Journal of cell death 7, 15-23. McKenna, K., Beignon, A.S., and Bhardwaj, N. (2005). Plasmacytoid dendritic cells: linking innate and adaptive immunity. Journal of virology 79, 17-27. Metzger, D., and Chambon, P. (2001). Site- and time-specific gene targeting in the mouse. Methods 24, 71-80. Michlewska, S., McColl, A., Rossi, A.G., Megson, I.L., and Dransfield, I. (2007). Clearance of dying cells and autoimmunity. Autoimmunity 40, 267-273. Miller, F.W., Pollard, K.M., Parks, C.G., Germolec, D.R., Leung, P.S., Selmi, C., Humble, M.C., and Rose, N.R. (2012). Criteria for environmentally associated autoimmune diseases. Journal of autoimmunity 39, 253-258. Miller, W., Hayes, V.M., Ratan, A., Petersen, D.C., Wittekindt, N.E., Miller, J., Walenz, B., Knight, J., Qi, J., Zhao, F., et al. (2011). Genetic diversity and population structure of the endangered marsupial Sarcophilus harrisii (Tasmanian devil). Proceedings of the National Academy of Sciences of the United States of America 108, 12348-12353. Miyake, K., and Kaisho, T. (2014). Homeostatic inflammation in innate immunity. Current opinion in immunology 30, 85-90. Moldovan, L., and Moldovan, N.I. (2005). Role of monocytes and macrophages in angiogenesis. Exs, 127-146. Moreau, J.M., Girgis, D.O., Hume, E.B., Dajcs, J.J., Austin, M.S., and O'Callaghan, R.J. (2001). Phospholipase A(2) in rabbit tears: a host defense against Staphylococcus aureus. Investigative ophthalmology & visual science 42, 2347-2354. Muenzner, P., Bachmann, V., Hentschel, J., Zimmermann, W., and Hauck, C.R. (2010). Human-specific bacterial pathogens block shedding of epithelial cells by stimulating integrin activation. Science 329, 1197-1201. Muenzner, P., Rohde, M., Kneitz, S., and Hauck, C.R. (2005). CEACAM engagement by human pathogens enhances cell adhesion and counteracts bacteria-induced detachment of epithelial cells. Journal of Cell Biology 170, 825-836.

163

References

Muller-Eberhard, H.J. (1988). Molecular organization and function of the complement system. Annual review of biochemistry 57, 321-347. Muthusamy, N., Vijayakumar, A., Cheng, G., Jr., and Ghashghaei, H.T. (2014). A knock-in Foxj1(CreERT2::GFP) mouse for recombination in epithelial cells with motile cilia. Genesis 52, 350-358. Nadkarni, M.A., Browne, G.V., Chhour, K.L., Byun, R., Nguyen, K.A., Chapple, C.C., Jacques, N.A., and Hunter, N. (2012). Pattern of distribution of Prevotella species/phylotypes associated with healthy gingiva and periodontal disease. European journal of clinical microbiology & infectious diseases : official publication of the European Society of Clinical Microbiology 31, 2989-2999. Nagel, G., Grunert, F., Kuijpers, T.W., Watt, S.M., Thompson, J., and Zimmermann, W. (1993). Genomic organization, splice variants and expression of CGM1, a CD66-related member of the carcinoembryonic antigen gene family. European Journal of Biochemistry 214, 27-35. Negrini Tde, C., Ferreira, L.S., Alegranci, P., Arthur, R.A., Sundfeld, P.P., Maia, D.C., Spolidorio, L.C., and Carlos, I.Z. (2013). Role of TLR-2 and fungal surface antigens on innate immune response against Sporothrix schenckii. Immunological investigations 42, 36-48. North, R.J. (1970). The relative importance of blood monocytes and fixed macrophages to the expression of cell- mediated immunity to infection. The Journal of experimental medicine 132, 521-534. O'Byrne, K.J., and Dalgleish, A.G. (2001). Chronic immune activation and inflammation as the cause of malignancy. British journal of cancer 85, 473-483. Obrink, B. (1997). CEA adhesion molecules: multifunctional proteins with signal-regulatory properties. Current opinion in cell biology 9, 616-626. Oikawa, S., Inuzuka, C., Kuroki, M., Arakawa, F., Matsuoka, Y., Kosaki, G., and Nakazato, H. (1991). A specific heterotypic cell adhesion activity between members of carcinoembryonic antigen family, W272 and NCA, is mediated by N-domains. The Journal of biological chemistry 266, 7995-8001. Oikawa, S., Inuzuka, C., Kuroki, M., Matsuoka, Y., Kosaki, G., and Nakazato, H. (1989). Cell adhesion activity of nonspecific cross-reacting antigen (NCA) and carcinoembryonic antigen (CEA) expressed on CHO cell surface: homophilic and heterophilic adhesion. Biochemical and biophysical research communications 164, 39-45. Osoegawa, K., Mammoser, A.G., Wu, C., Frengen, E., Zeng, C., Catanese, J.J., and de Jong, P.J. (2001). A bacterial artificial chromosome library for sequencing the complete human genome. Genome research 11, 483-496. Papayannopoulos, V., and Zychlinsky, A. (2009). NETs: a new strategy for using old weapons. Trends in immunology 30, 513-521. Peiser, L., Gough, P.J., Kodama, T., and Gordon, S. (2000). Macrophage class A scavenger receptor-mediated phagocytosis of Escherichia coli: role of cell heterogeneity, microbial strain, and culture conditions in vitro. Infection and immunity 68, 1953-1963. Petri, B., Phillipson, M., and Kubes, P. (2008). The physiology of leukocyte recruitment: an in vivo perspective. J Immunol 180, 6439-6446. Pils, S., Gerrard, D., Meyer, A., and Hauck.C.R. (2008). CEACAM3: an innate immune receptor directed against human- resticted bacterial pathogens. International Journal of Medical Microbiology 298, 553-560. Pils, S., Kopp, K., Peterson, L., Delgado Tascón, J., Nyffenegger-Jann, N.J., and Hauck, C.R. (2012). The adaptor molecule Nck localizes the WAVE complex to promote actin polymerization during CEACAM3-mediated phagocytosis of bacteria. PloS one 7, e32808. Pils, S., Schmitter, T., Neske, F., and Hauck, C.R. (2006). Quantification of bacterial invasion into adherent cells by flow cytometry. Journal of microbiological methods 65, 301-310. Pinet, F., Dupont, A., Bencherif, N., Guihot, A.L., Quatannens, B., and Amouyel, P. (2003). Morphology, homogeneity and functionality of human monocytes-derived macrophages. Cell Mol Biol (Noisy-le-grand) 49, 899-905. Pinheiro, V.B., and Ellar, D.J. (2006). How to kill a mocking bug? Cellular microbiology 8, 545-557. Platt, R.J., Chen, S., Zhou, Y., Yim, M.J., Swiech, L., Kempton, H.R., Dahlman, J.E., Parnas, O., Eisenhaure, T.M., Jovanovic, M., et al. (2014). CRISPR-Cas9 knockin mice for genome editing and cancer modeling. Cell 159, 440-455. Pop, M., Walker, A.W., Paulson, J., Lindsay, B., Antonio, M., Hossain, M.A., Oundo, J., Tamboura, B., Mai, V., Astrovskaya, I., et al. (2014). Diarrhea in young children from low-income countries leads to large-scale alterations in intestinal microbiota composition. Genome biology 15, R76. Popp, A., Dehio, C., Grunert, F., Meyer, T.F., and Gray-Owen, S.D. (1999). Molecular analysis of neisserial Opa protein interactions with the CEA family of receptors: identification of determinants contributing to the differential specificities of binding. Cellular microbiology 1, 169-181. Poser, I., Sarov, M., Hutchins, J.R., Heriche, J.K., Toyoda, Y., Pozniakovsky, A., Weigl, D., Nitzsche, A., Hegemann, B., Bird, A.W., et al. (2008). BAC TransgeneOmics: a high-throughput method for exploration of protein function in mammals. Nature methods 5, 409-415. Poy, M.N., Yang, Y., Rezaei, K., Fernstrom, M.A., Lee, A.D., Kido, Y., Erickson, S.K., and Najjar, S.M. (2002). CEACAM1 regulates insulin clearance in liver. Nature genetics 30, 270-276. Pruijt, J.F., Verzaal, P., van Os, R., de Kruijf, E.J., van Schie, M.L., Mantovani, A., Vecchi, A., Lindley, I.J., Willemze, R., Starckx, S., et al. (2002). Neutrophils are indispensable for hematopoietic stem cell mobilization induced by interleukin-8 in mice. Proceedings of the National Academy of Sciences of the United States of America 99, 6228-6233. Qin, J., Li, R., Raes, J., Arumugam, M., Burgdorf, K.S., Manichanh, C., Nielsen, T., Pons, N., Levenez, F., Yamada, T., et al. (2010). A human gut microbial gene catalogue established by metagenomic sequencing. Nature 464, 59-65. Qiu, Y., and Kung, H.J. (2000). Signaling network of the Btk family kinases. Oncogene 19, 5651-5661.

164

References

Quast, C., Pruesse, E., Yilmaz, P., Gerken, J., Schweer, T., Yarza, P., Peplies, J., and Glockner, F.O. (2013). The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic acids research 41, D590-596. Rawlings, D.J., Saffran, D.C., Tsukada, S., Largaespada, D.A., Grimaldi, J.C., Cohen, L., Mohr, R.N., Bazan, J.F., Howard, M., Copeland, N.G., et al. (1993). Mutation of unique region of Bruton's tyrosine kinase in immunodeficient XID mice. Science 261, 358-361. Reth, M. (1989). Antigen receptor tail clue. Nature 338, 383-384. Reveillaud, J., Maignien, L., Murat Eren, A., Huber, J.A., Apprill, A., Sogin, M.L., and Vanreusel, A. (2014). Host- specificity among abundant and rare taxa in the sponge microbiome. The ISME journal 8, 1198-1209. Rhee, S.G. (2001). Regulation of phosphoinositide-specific phospholipase C. Annual review of biochemistry 70, 281- 312. Rodero, M.P., and Khosrotehrani, K. (2010). Skin wound healing modulation by macrophages. International journal of clinical and experimental pathology 3, 643-653. Rogers, L.D., and Foster, L.J. (2009). Phosphoproteomics--finally fulfilling the promise? Molecular bioSystems 5, 1122- 1129. Rogers, N.C., Slack, E.C., Edwards, A.D., Nolte, M.A., Schulz, O., Schweighoffer, E., Williams, D.L., Gordon, S., Tybulewicz, V.L., Brown, G.D., et al. (2005). Syk-dependent cytokine induction by Dectin-1 reveals a novel pattern recognition pathway for C type lectins. Immunity 22, 507-517. Ross, G.D., Reed, W., Dalzell, J.G., Becker, S.E., and Hogg, N. (1992). Macrophage cytoskeleton association with CR3 and CR4 regulates receptor mobility and phagocytosis of iC3b-opsonized erythrocytes. Journal of leukocyte biology 51, 109-117. Roth, A. (2013). Exploring bacterial binding to receptors of the CEACAM family as a basis for translational approaches. In Cell biology (Doctoral dissertation, University of Konstanz). Roth, A., Mattheis, C., Münzner, P., Unemo, M., and Hauck, C.R. (2013). Innate recognition by neutrophil granulocytes differs between Neisseria gonorrhoeae strains causing local or disseminating infections. Infection and immunity 81(7), 2358-2370. Round, J.L., and Mazmanian, S.K. (2009). The gut microbiota shapes intestinal immune responses during health and disease. Nature reviews. Immunology 9, 313-323. Rutkowski, M.J., Sughrue, M.E., Kane, A.J., Ahn, B.J., Fang, S., and Parsa, A.T. (2010). The complement cascade as a mediator of tissue growth and regeneration. Inflammation research : official journal of the European Histamine Research Society ... [et al.] 59, 897-905. Sakuma, C., Sato, M., Takenouchi, T., and Kitani, H. (2015). Specific binding of the WASP N-terminal domain to Btk is critical for TLR2 signaling in macrophages. Molecular immunology 63, 328-336. Salminen, S.J., Gueimonde, M., and Isolauri, E. (2005). Probiotics that modify disease risk. The Journal of nutrition 135, 1294-1298. Sarantis, H., and Gray-Owen, S.D. (2007). The specific innate immune receptor CEACAM3 triggers neutrophil bactericidal activities via a Syk kinase-dependent pathway. Cellular microbiology 9, 2167-2180. Sarantis, H., and Gray-Owen, S.D. (2011). Defining the roles of human carcinoembryonic antigen-related cellular adhesion molecules during neutrophil responses to Neisseria gonorrhoeae. Infection and immunity 80, 345-358. Satterthwaite, A.B., Li, Z., and Witte, O.N. (1998). Btk function in B cell development and response. Seminars in immunology 10, 309-316. Satterthwaite, A.B., and Witte, O.N. (2000). The role of Bruton's tyrosine kinase in B-cell development and function: a genetic perspective. Immunological reviews 175, 120-127. Sauer, B. (1998). Inducible gene targeting in mice using the Cre/lox system. Methods 14, 381-392. Sauter, S.L., Rutherfurd, S.M., Wagener, C., Shively, J.E., and Hefta, S.A. (1993). Identification of the specific oligosaccharide sites recognized by type 1 fimbriae from Escherichia coli on nonspecific cross-reacting antigen, a CD66 cluster granulocyte glycoprotein. The Journal of biological chemistry 268, 15510-15516. Scharenberg, A.M., and Kinet, J.P. (1998). PtdIns-3,4,5-P3: a regulatory nexus between tyrosine kinases and sustained calcium signals. Cell 94, 5-8. Scher, J.U., Sczesnak, A., Longman, R.S., Segata, N., Ubeda, C., Bielski, C., Rostron, T., Cerundolo, V., Pamer, E.G., Abramson, S.B., et al. (2013). Expansion of intestinal Prevotella copri correlates with enhanced susceptibility to arthritis. eLife 2, e01202. Schmidt, U., Boucheron, N., Unter, B., and Ellmeier, W. (2004). The role of Tee family kinases in myeloid cells. Int. Arch. Allergy Immunol. 134. Schmitter, T., Agerer, F., Peterson, L., Muenzner, P., and Hauck, C.R. (2004). Granulocyte CEACAM3 is a phagocytic receptor of the innate immune system that mediates recognition and elimination of human-specific pathogens. Journal of Experimental Medicine 199, 35-46. Schmitter, T., Pils, S., Sakk, V., Frank, R., Fischer, K.D., and Hauck, C.R. (2007a). The granulocyte receptor CEACAM3 directly associates with Vav to promote phagocytosis of human pathogens. Journal of Immunology 178, 3797- 3805. Schmitter, T., Pils, S., Weibel, S., Agerer, F., Buntru, A., Kopp, K., and Hauck, C.R. (2007b). Opa proteins of pathogenic Neisseriae initiate Src-kinase-dependent or lipid raft-mediated uptake via distinct human CEACAM isoforms. Infection & Immunity 75, 4116-4126. Schmittgen, T.D., and Livak, K.J. (2008). Analyzing real-time PCR data by the comparative C(T) method. Nature protocols 3, 1101-1108.

165

References

Schogor, A.L., Huws, S.A., Santos, G.T., Scollan, N.D., Hauck, B.D., Winters, A.L., Kim, E.J., and Petit, H.V. (2014). Ruminal Prevotella spp. may play an important role in the conversion of plant lignans into human health beneficial antioxidants. PloS one 9, e87949. Schultz, M.J., Rijneveld, A.W., Florquin, S., Edwards, C.K., Dinarello, C.A., and van der Poll, T. (2002). Role of interleukin-1 in the pulmonary immune response during Pseudomonas aeruginosa pneumonia. American journal of physiology. Lung cellular and molecular physiology 282, L285-290. Scott, C.C., Dobson, W., Botelho, R.J., Coady-Osberg, N., Chavrier, P., Knecht, D.A., Heath, C., Stahl, P., and Grinstein, S. (2005). Phosphatidylinositol-4,5-bisphosphate hydrolysis directs actin remodeling during phagocytosis. The Journal of cell biology 169, 139-149. Serrander, L., Skarman, P., Rasmussen, B., Witke, W., Lew, D.P., Krause, K.H., Stendahl, O., and Nusse, O. (2000). Selective inhibition of IgG-mediated phagocytosis in gelsolin-deficient murine neutrophils. Journal of Immunology 165, 2451-2457. Shen, B., Zhang, X., Du, Y., Wang, J., Gong, J., Tate, P.H., Li, H., Huang, X., and Zhang, W. (2013). Efficient knockin mouse generation by ssDNA oligonucleotides and zinc-finger nuclease assisted homologous recombination in zygotes. PloS one 8, e77696. Shen, Y., Kawamura, I., Nomura, T., Tsuchiya, K., Hara, H., Dewamitta, S.R., Sakai, S., Qu, H., Daim, S., Yamamoto, T., et al. (2010). Toll-like receptor 2- and MyD88-dependent phosphatidylinositol 3-kinase and Rac1 activation facilitates the phagocytosis of Listeria monocytogenes by murine macrophages. Infection and immunity 78, 2857- 2867. Simeone, D.M., Ji, B., Banerjee, M., Arumugam, T., Li, D., Anderson, M.A., Bamberger, A.M., Greenson, J., Brand, R.E., Ramachandran, V., et al. (2007). CEACAM1, a novel serum biomarker for pancreatic cancer. Pancreas 34, 436-443. Sintsova, A., Sarantis, H., Islam, E.A., Sun, C.X., Amin, M., Chan, C.H., Stanners, C.P., Glogauer, M., and Gray-Owen, S.D. (2014). Global analysis of neutrophil responses to Neisseria gonorrhoeae reveals a self-propagating inflammatory program. PLoS pathogens 10, e1004341. Skaar, E.P. (2010). The battle for iron between bacterial pathogens and their vertebrate hosts. PLoS pathogens 6, e1000949. Skubitz, K.M., Campbell, K.D., and Skubitz, A.P. (1996). CD66a, CD66b, CD66c, and CD66d each independently stimulate neutrophils. Journal of leukocyte biology 60, 106-117. Skubitz, K.M., and Skubitz, A.P. (2008). Interdependency of CEACAM-1, -3, -6, and -8 induced human neutrophil adhesion to endothelial cells. Journal of translational medicine 6, 78. Smith, C.I., Islam, T.C., Mattsson, P.T., Mohamed, A.J., Nore, B.F., and Vihinen, M. (2001). The Tec family of cytoplasmic tyrosine kinases: mammalian Btk, Bmx, Itk, Tec, Txk and homologs in other species. BioEssays : news and reviews in molecular, cellular and developmental biology 23, 436-446. Stepensky, D. (2007). FRETcalc plugin for calculation of FRET in non-continuous intracellular compartments. Biochem Biophys Res Commun 359(3):752-8 Strijbis, K., Tafesse, F.G., Fairn, G.D., Witte, M.D., Dougan, S.K., Watson, N., Spooner, E., Esteban, A., Vyas, V.K., Fink, G.R., et al. (2013). Bruton's Tyrosine Kinase (BTK) and Vav1 contribute to Dectin1-dependent phagocytosis of Candida albicans in macrophages. PLoS pathogens 9, e1003446. Stvrtinova, V., Jahnova, E., Weissova, S., Horvathova, M., and Ferencik, M. (2001). Inflammatory mechanisms involving neutrophils in chronic venous insufficiency of lower limbs. Bratislavske lekarske listy 102, 235-239. Swanson, J.A., and Hoppe, A.D. (2004). The coordination of signaling during Fc receptor-mediated phagocytosis. Journal of leukocyte biology 76, 1093-1103. Takahashi-Tezuka, M., Hibi, M., Fujitani, Y., Fukada, T., Yamaguchi, T., and Hirano, T. (1997). Tec tyrosine kinase links the cytokine receptors to PI-3 kinase probably through JAK. Oncogene 14, 2273-2282. Takeda, K., Kaisho, T., and Akira, S. (2003). Toll-like receptors. Annu Rev Immunol 21, 335-376. Takesono, A., Finkelstein, L.D., and Schwartzberg, P.L. (2002). Beyond calcium: new signaling pathways for Tec family kinases. Journal of cell science 115, 3039-3048. Tampella, G., Kerns, H.M., Niu, D., Singh, S., Khim, S., Bosch, K.A., Garrett, M.E., Moguche, A., Evans, E., Browning, B., et al. (2015). The Tec Kinase-Regulated Phosphoproteome Reveals a Mechanism for the Regulation of Inhibitory Signals in Murine Macrophages. J Immunol 195, 246-256. Tan, S.Y., and Dee, M.K. (2009). Elie Metchnikoff (1845-1916): discoverer of phagocytosis. Singapore medical journal 50, 456-457. Tang, B., Mano, H., Yi, T., and Ihle, J.N. (1994). Tec kinase associates with c-kit and is tyrosine phosphorylated and activated following stem cell factor binding. Molecular and cellular biology 14, 8432-8437. Taylor, P.R., Tsoni, S.V., Willment, J.A., Dennehy, K.M., Rosas, M., Findon, H., Haynes, K., Steele, C., Botto, M., Gordon, S., et al. (2007). Dectin-1 is required for beta-glucan recognition and control of fungal infection. Nature immunology 8, 31-38. Tchoupa, A.K., Schuhmacher, T., and Hauck, C.R. (2014). Signaling by epithelial members of the CEACAM family - mucosal docking sites for pathogenic bacteria. Cell communication and signaling : CCS 12, 27. Terunuma, H., Deng, X., Dewan, Z., Fujimoto, S., and Yamamoto, N. (2008). Potential role of NK cells in the induction of immune responses: implications for NK cell-based immunotherapy for cancers and viral infections. International reviews of immunology 27, 93-110. Tetteroo, P.A., Bos, M.J., Visser, F.J., and von dem Borne, A.E. (1986). Neutrophil activation detected by monoclonal antibodies. J Immunol 136, 3427-3432. Thomas, J.D., Sideras, P., Smith, C.I., Vorechovsky, I., Chapman, V., and Paul, W.E. (1993). Colocalization of X-linked agammaglobulinemia and X-linked immunodeficiency genes. Science 261, 355-358.

166

References

Thompson, J., Mossinger, S., Reichardt, V., Engels, U., Beauchemin, N., Kommoss, F., von Kleist, S., and Zimmermann, W. (1993). A polymerase-chain-reaction assay for the specific identification of transcripts encoded by individual carcinoembryonic antigen (CEA)-gene-family members. International journal of cancer. Journal international du cancer 55, 311-319. Thompson, J., Zimmermann, W., Osthus-Bugat, P., Schleussner, C., Eades-Perner, A.M., Barnert, S., Von Kleist, S., Willcocks, T., Craig, I., Tynan, K., et al. (1992). Long-range chromosomal mapping of the carcinoembryonic antigen (CEA) gene family cluster. Genomics 12, 761-772. Thompson, J.A., Grunert, F., and Zimmermann, W. (1991). Carcinoembryonic antigen gene family: molecular biology and clinical perspectives. Journal of clinical laboratory analysis 5, 344-366. Thorens, B., Tarussio, D., Maestro, M.A., Rovira, M., Heikkila, E., and Ferrer, J. (2015). Ins1(Cre) knock-in mice for beta cell-specific gene recombination. Diabetologia 58, 558-565. Toleman, M., Aho, E., and Virji, M. (2001). Expression of pathogen-like Opa adhesins in commensal Neisseria: genetic and functional analysis. Cellular microbiology 3, 33-44. Tschan, M.P., Reddy, V.A., Ress, A., Arvidsson, G., Fey, M.F., and Torbett, B.E. (2008). PU.1 binding to the p53 family of tumor suppressors impairs their transcriptional activity. Oncogene 27, 3489-3493. Tseng, H.H., Hullar, M.A., Li, F., Lampe, J.W., Sandstrom, R., Johnson, A.K., Strate, L.L., Ruzzo, W.L., and Stamatoyannopoulos, J. (2013). A microbial profiling method for the human microbiota using high-throughput sequencing. Metagenomics (Cairo) 2, 235646. Uckun, F.M., Vassilev, A., Bartell, S., Zheng, Y., Mahajan, S., and Tibbles, H.E. (2003). The anti-leukemic Bruton's tyrosine kinase inhibitor alpha-cyano-beta-hydroxy-beta-methyl-N-(2,5-dibromophenyl) propenamide (LFM- A13) prevents fatal thromboembolism. Leukemia & lymphoma 44, 1569-1577. Underhill, D.M., Rossnagle, E., Lowell, C.A., and Simmons, R.M. (2005). Dectin-1 activates Syk tyrosine kinase in a dynamic subset of macrophages for reactive oxygen production. Blood 106, 2543-2550. Vareille, M., Kieninger, E., Edwards, M.R., and Regamey, N. (2011). The airway epithelium: soldier in the fight against respiratory viruses. Clinical microbiology reviews 24, 210-229. Virji, M., Evans, D., Griffith, J., Hill, D., Serino, L., Hadfield, A., and Watt, S.M. (2000). Carcinoembryonic antigens are targeted by diverse strains of typable and non-typable Haemophilus influenzae. Molecular microbiology 36, 784- 795. Virji, M., Evans, D., Hadfield, A., Grunert, F., Teixeira, A.M., and Watt, S.M. (1999). Critical determinants of host receptor targeting by Neisseria meningitidis and Neisseria gonorrhoeae: identification of Opa adhesiotopes on the N-domain of CD66 molecules. Molecular microbiology 34, 538-551. Virji, M., Makepeace, K., Ferguson, D.J.P., and Watt, S.M. (1996). Carcinoembryonic antigens (CD66) on epithelial cells and neutrophils are receptors for Opa proteins of pathogenic Neisseriae. Molecular microbiology 22, 941- 950. Vivier, E., Raulet, D.H., Moretta, A., Caligiuri, M.A., Zitvogel, L., Lanier, L.L., Yokoyama, W.M., and Ugolini, S. (2011). Innate or adaptive immunity? The example of natural killer cells. Science 331, 44-49. Voges, M., Bachmann, V., Kammerer, R., Gophna, U., and Hauck, C.R. (2010). CEACAM1 recognition by bacterial pathogens is species-specific. BMC microbiology 10, 117. Wakabayashi-Nakao, K., Hatakeyama, K., Ohshima, K., Ken Yamaguchi, K., and Mochizuki, T. (2014). Carcinoembryonic antigen-related cell adhesion molecule 4 (CEACAM4) is specifically expressed in medullary thyroid carcinoma cells. Biomed Res 35, 237-242. Wang, K., Wang, P., Shi, J., Zhu, X., He, M., Jia, X., Yang, X., Qiu, F., Jin, W., Qian, M., et al. (2010). PML/RARalpha targets promoter regions containing PU.1 consensus and RARE half sites in acute promyelocytic leukemia. Cancer cell 17, 186-197. Wells, C.L., and Wilkins, T.D. (1996). Clostridia: Sporeforming Anaerobic Bacilli. In Medical Microbiology, S. Baron, ed. (Galveston (TX)). Whitman, W.B., Coleman, D.C., and Wiebe, W.J. (1998). Prokaryotes: the unseen majority. Proceedings of the National Academy of Sciences of the United States of America 95, 6578-6583. Winterbourn, C.C. (2008). Reconciling the chemistry and biology of reactive oxygen species. Nature chemical biology 4, 278-286. Yamashita, Y., Miyazato, A., Shimizu, R., Komatsu, N., Miura, Y., Ozawa, K., and Mano, H. (1997). Tec protein- tyrosine kinase is involved in the thrombopoietin/c-Mpl signaling pathway. Experimental hematology 25, 211- 216. Yamashita, Y., Watanabe, S., Miyazato, A., Ohya, K., Ikeda, U., Shimada, K., Komatsu, N., Hatake, K., Miura, Y., Ozawa, K., et al. (1998). Tec and Jak2 kinases cooperate to mediate cytokine-driven activation of c-fos transcription. Blood 91, 1496-1507. Yang, W.C., Ghiotto, M., Barbarat, B., and Olive, D. (1999). The role of Tec protein-tyrosine kinase in T cell signaling. The Journal of biological chemistry 274, 607-617. Yatsunenko, T., Rey, F.E., Manary, M.J., Trehan, I., Dominguez-Bello, M.G., Contreras, M., Magris, M., Hidalgo, G., Baldassano, R.N., Anokhin, A.P., et al. (2012). Human gut microbiome viewed across age and geography. Nature 486, 222-227. Yokoyama, S., Chen, C.J., Nguyen, T., and Shively, J.E. (2007). Role of CEACAM1 isoforms in an in vivo model of mammary morphogenesis: mutational analysis of the cytoplasmic domain of CEACAM1-4S reveals key residues involved in lumen formation. Oncogene 26, 7637-7646. Yu, D., Ellis, H.M., Lee, E.C., Jenkins, N.A., Copeland, N.G., and Court, D.L. (2000). An efficient recombination system for chromosome engineering in Escherichia coli. Proceedings of the National Academy of Sciences of the United States of America 97, 5978-5983.

167

References

Zebhauser, R., Kammerer, R., Eisenried, A., McLellan, A., Moore, T., and Zimmermann, W. (2005). Identification of a novel group of evolutionarily conserved members within the rapidly diverging murine Cea family. Genomics 86, 566-580. Zhang, D.E., Hetherington, C.J., Chen, H.M., and Tenen, D.G. (1994). The macrophage transcription factor PU.1 directs tissue-specific expression of the macrophage colony-stimulating factor receptor. Molecular and cellular biology 14, 373-381. Zheng, J., Miller, K.K., Yang, T., Hildebrand, M.S., Shearer, A.E., DeLuca, A.P., Scheetz, T.E., Drummond, J., Scherer, S.E., Legan, P.K., et al. (2011). Carcinoembryonic antigen-related cell adhesion molecule 16 interacts with alpha- tectorin and is mutated in autosomal dominant hearing loss (DFNA4). Proceedings of the National Academy of Sciences of the United States of America 108, 4218-4223. Zhou, J., Zhang, L., Gu, Y., Li, K., Nie, Y., Fan, D., and Feng, Y. (2011). Dynamic expression of CEACAM7 in precursor lesions of gastric carcinoma and its prognostic value in combination with CEA. World journal of surgical oncology 9, 172. Zid, M., and Drouin, G. (2013). Gene conversions are under purifying selection in the carcinoembryonic antigen immunoglobulin gene families of primates. Genomics 102, 301-309. Zou, J., and Shankar, N. (2015). Roles of TLR/MyD88/MAPK/NF-kappaB Signaling Pathways in the Regulation of Phagocytosis and Proinflammatory Cytokine Expression in Response to E. faecalis Infection. PloS one 10, e0136947. Zwolanek, F., Riedelberger, M., Stolz, V., Jenull, S., Istel, F., Koprulu, A.D., Ellmeier, W., and Kuchler, K. (2014). The non-receptor tyrosine kinase Tec controls assembly and activity of the noncanonical caspase-8 inflammasome. PLoS pathogens 10, e1004525.

168