'Ofe Akwu' Soup Spoilage
Total Page：16
File Type：pdf, Size：1020Kb
Microbiology Research Journal International 19(3): 1-8, 2017; Article no.MRJI.32554 Previously known as British Microbiology Research Journal ISSN: 2231-0886, NLM ID: 101608140 SCIENCEDOMAIN international www.sciencedomain.org Inhibitory Potential of Ocimum gratissimum L on Bacterial Implicated in ‘Ofe Akwu’ Soup Spoilage O. C. Eruteya 1* , F. S. Ire 1 and C. C. Aneke 1 1Department of Microbiology, University of Port Harcourt, Port Harcourt, Nigeria. Authors’ contributions This work was carried out in collaboration between all authors. Authors OCE and FSI designed the study. All authors participated in the laboratory analysis. Author OCE wrote the first draft of the manuscript. All authors read and approved the final manuscript. Article Information DOI: 10.9734/MRJI/2017/32554 Editor(s): (1) Ana Cláudia Coelho, Department of Veterinary Sciences, University of Trás-os-Montes and Alto Douro, Portugal. Reviewers: (1) Vishwanadham Yerragunta, JNTU-Hydrabad, India. (2) P. Rameshthangam, Alagappa University, Karaikudi, Tamilnadu, India. (3) Julius Tibyangye, St. Augustine International University/Kampala International University, Uganda. Complete Peer review History: http://www.sciencedomain.org/review-history/18590 Received 1st March 2017 Accepted 29 th March 2017 Original Research Article th Published 11 April 2017 ABSTRACT Aims: The study evaluated the proximate composition, the bacteria present in freshly spoilt ‘ofe akwu’ soup and inhibitory potential of crude ethanol, methanol and aqueous leaf extract of Ocimum gratissimum on the resulting bacteria. Study Design: This was an analytical study in duplicate. Place and Duration of Study: Department of Microbiology, University of Port Harcourt, Niger Delta University, Amasoma, and South Africa, between July 2015 and December 2016. Methodology: Isolation was done using Nutrient agar medium. Conventional and molecular methods were employed in the identification of the isolates. Proximate analysis and antibacterial activity of O. gratissimum against the bacteria were done using standard methods. Results: The proximate analysis shows the chemical composition such as moisture (66.40%), ash (1.42%), carbohydrate (2.74%), protein (6.50%), lipid (14.39%) and fibre (8.55%). The resulting bacteria on the basis of conventional and molecular characterization were identified as Bacillus pumilus strain m414, B. subtilis strain AIMST 2ME1, B. cereus strain CF7 and Sphingobacterium mizutaii strain AUMC b-161. The ethanol extract (50 to 250 mg/mL) inhibited Bacillus pumilus strain m414 and B. cereus strain CF7 with zones ranging from 7 to 13 mm while the methanol extract (50 _____________________________________________________________________________________________________ *Corresponding author: E-mail: [email protected]; Eruteya et al.; MRJI, 19(3): 1-8, 2017; Article no.MRJI.32554 to 250 mg/mL) inhibited Bacillus pumilus strain m414, B. subtilis strain AIMST 2ME1 and Sphingobacterium mizutaii strain AUMC b-161 with zones ranging from 5 to 13 mm. None of the isolates was susceptible to the aqueous extract. Conclusion: The study has shown that bacteria inhibition by O. gratissimum crude extract may be of use in the preservation of the soup. Keywords: Bacillus sp; Ocimum gratissimum; ofe akwu; Sphingobacterium sp; spice; spoilage bacterial. 1. INTRODUCTION parts of Nigeria includes: (Ncho-anwu, Ahuji) Igbo, (Efinrin,) Yoruba, (Aramogbo) or Nigeria is rich in foods and diets that are good (Ebavbokho) Edo and (Daidoya) or (Aai doya ta sources of micronutrients and supplements in a gida) Hausa [11,12]. world faced with problem of food scarcity [1]. The Nigerian ‘banga soup’ or ‘ofe akwu’ is native to The antibacterial activities of Ocimum the Niger Delta and the South Eastern parts of gratissimum have been reported against a Nigeria. In these regions, the soup is commonly number of gram positive ( Staphylococcus eaten with starch, pounded yam, semolina, garri, aureus, Bacillus spp.; Listeria spp.) and gram cassava fufu and rice. A major difference negative ( Esherichia coli, Pseudomonas between ‘banga’ soup and ‘ofe akwu’ is the spice aeruginosa, Salmonella typhi, Klebsiella used for its preparation. pneumonia, Proteus mirabilis, Shigella flexineri ) bacteria [8,13-18]. Foods, by their very nature, are nutritious and metabolizable hence serve as suitable substrates The study was undertaken to determine the for the growth and metabolism of a vast proximate composition and evaluate the population of microorganisms [2], leading to the antibacterial activity of Ocimum gratissimum , a spoilage of contaminated foods. spice used in the preparation of ‘ofe akwu’ against bacteria likely responsible for its To curtail growth of spoilage and pathogenic spoilage. microorganisms in foods, several preservation techniques, such as heat treatment, salting, 2. MATERIALS AND METHODS acidification, and drying have been employed in the food industry [3,4]. Numerous efforts are 2.1 Sample Collection conducted to find natural alternatives to prevent bacterial and fungal growth in foods. In recent The soup ingredients comprising palm kernel years, because of the great consumer fruits ( Elaeis guinensis ), scent leaves ( Ocimum awareness and concern regarding synthetic gratissimum ), stock fish, crayfish, pepper and chemical additives, foods preserved with salt were purchased at the Choba market, Port natural additives have become very Harcourt. popular [5]. 2.2 Extraction of Palm Concentrate Plant essential oils are gaining a wide interest in food industry for their potential as Palm concentrate was extracted from cooked decontaminating agents, as they are Generally palm fruits using the mortar and pistil and put in a Recognized as Safe (GRAS) [5]. The active cooking pot. This was allowed to boil at high components are commonly found in the essential temperature before adding other ingredients to oil fractions and it is well established that most of taste. them have a wide spectrum of antimicrobial activity, against food-borne pathogens and spoilage bacteria [6,7]. 2.3 Proximate Analysis Ocimum gratissimum L. is a shrub belonging to The moisture, crude protein, crude fibre, crude the family Lamiaceae. It is commonly known as fat, carbohydrate and total ash contents of the Scent leaf or Clove basil and is found in many soup was analysed using the method described tropical and warm temperature countries such as by Association of Official Analytical Chemists' India and Nigeria [8-10]. Its local names in some [19]. 2 Eruteya et al.; MRJI, 19(3): 1-8, 2017; Article no.MRJI.32554 2.4 Isolation Procedure elution buffer was added to the column matrix and centrifuged at 10,000xg microlitre for 30 s to Ten milliliter (10 mL) of an overnight and elude the DNA. The ultra pure DNA was then deteriorating soup (after 24 h) was aseptically stored at -20°C for other downstream reaction. transferred to 90 mL sterile peptone water and homogenized. After a ten-fold serial dilution, 0.1 2.7 Amplification of 16S rRNA mL was spread plated on Nutrient agar plates and incubated at room temperature (29±2°C) for The 16S rRNA regions of the rRNA genes of the 24 h. Distinct colonies were purified in fresh isolates were amplified using the 27F Nutrient agar and stored in slants for further (AGAGTTTGATCMTGGCTCAG): and 1492R analysis. (CGGTTACCTTGTTACGACTT): primers on an ABI 9700 Applied Bio-systems thermal cycler at 2.5 Identification of Bacterial Isolates a final volume of 50 µL for 35 cycles. The PCR mix included: the X2 Dream taq Master mix The isolates were identified using standard supplied by Inqaba, South Africa (taq conventional (Gram staining, catalase, indole, polymerase, DNTPs, MgCl), the primers at a motility, citrate, Methyl red, Voges Proskauer, concentration of 0.4M and the extracted DNA as oxidase, starch hydrolysis, H 2S production, sugar template. The PCR conditions were as follows: utilization) and molecular methods (Polymerase Initial denaturation, 95°C for 5 min; denaturation, Chain Reaction and sequencing). 95°C for 30 s; annealing, 52°C for 30s; extension, 72°C for 30s for 35 cycles and 2.6 DNA Extraction final extension, 72°C for 5 min. The product was resolved on a 1% agarose gel at 120V Extraction was done using a ZR fungal/bacterial for 15 min and visualized on a UV DNA mini prep extraction kit supplied by Inqaba transilluminator. South Africa. A heavy growth of the pure culture of the isolates were suspended in 200 µL of 2.8 Sequencing of 16S rRNA isotonic buffer into a ZR Bashing Bead Lysis tubes, 750 microlitre of lysis solution was added The amplified 16S products were sequenced on to the tube. The tubes were secured in a bead a 3500 genetic analyzer using the Bigdye- beater fitted with a 2 mL tube holder assembly Termination technique by Inqaba South Africa. and processed at maximum speed for 5 min. The ZR bashing bead lysis tubes were centrifuged at 2.9 Phylogenetic Analysis 10,000xg for 1 min. The sequences were edited using the Four hundred (400) microlitres of supernatant bioinformatics algorithm Bioedit, similar was transferred to a Zymo-Spin IV spin Filter sequences were downloaded from the National (orange top) in a collection tube and centrifuged Biotechnology Information Center (NCBI) data at 7000 xg for 1 min. One thousand two hundred base using BlastN, these sequences were (1200) microlitres of fungal/bacterial DNA binding aligned using ClustalX. The evolutionary history buffer was added to the filtrate in the collection was inferred using the Neighbor-Joining method tubes bringing the