'Ofe Akwu' Soup Spoilage

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Microbiology Research Journal International 19(3): 1-8, 2017; Article no.MRJI.32554 Previously known as British Microbiology Research Journal ISSN: 2231-0886, NLM ID: 101608140 SCIENCEDOMAIN international www.sciencedomain.org Inhibitory Potential of Ocimum gratissimum L on Bacterial Implicated in ‘Ofe Akwu’ Soup Spoilage O. C. Eruteya 1* , F. S. Ire 1 and C. C. Aneke 1 1Department of Microbiology, University of Port Harcourt, Port Harcourt, Nigeria. Authors’ contributions This work was carried out in collaboration between all authors. Authors OCE and FSI designed the study. All authors participated in the laboratory analysis. Author OCE wrote the first draft of the manuscript. All authors read and approved the final manuscript. Article Information DOI: 10.9734/MRJI/2017/32554 Editor(s): (1) Ana Cláudia Coelho, Department of Veterinary Sciences, University of Trás-os-Montes and Alto Douro, Portugal. Reviewers: (1) Vishwanadham Yerragunta, JNTU-Hydrabad, India. (2) P. Rameshthangam, Alagappa University, Karaikudi, Tamilnadu, India. (3) Julius Tibyangye, St. Augustine International University/Kampala International University, Uganda. Complete Peer review History: http://www.sciencedomain.org/review-history/18590 Received 1st March 2017 Accepted 29 th March 2017 Original Research Article th Published 11 April 2017 ABSTRACT Aims: The study evaluated the proximate composition, the bacteria present in freshly spoilt ‘ofe akwu’ soup and inhibitory potential of crude ethanol, methanol and aqueous leaf extract of Ocimum gratissimum on the resulting bacteria. Study Design: This was an analytical study in duplicate. Place and Duration of Study: Department of Microbiology, University of Port Harcourt, Niger Delta University, Amasoma, and South Africa, between July 2015 and December 2016. Methodology: Isolation was done using Nutrient agar medium. Conventional and molecular methods were employed in the identification of the isolates. Proximate analysis and antibacterial activity of O. gratissimum against the bacteria were done using standard methods. Results: The proximate analysis shows the chemical composition such as moisture (66.40%), ash (1.42%), carbohydrate (2.74%), protein (6.50%), lipid (14.39%) and fibre (8.55%). The resulting bacteria on the basis of conventional and molecular characterization were identified as Bacillus pumilus strain m414, B. subtilis strain AIMST 2ME1, B. cereus strain CF7 and Sphingobacterium mizutaii strain AUMC b-161. The ethanol extract (50 to 250 mg/mL) inhibited Bacillus pumilus strain m414 and B. cereus strain CF7 with zones ranging from 7 to 13 mm while the methanol extract (50 _____________________________________________________________________________________________________ *Corresponding author: E-mail: [email protected]; Eruteya et al.; MRJI, 19(3): 1-8, 2017; Article no.MRJI.32554 to 250 mg/mL) inhibited Bacillus pumilus strain m414, B. subtilis strain AIMST 2ME1 and Sphingobacterium mizutaii strain AUMC b-161 with zones ranging from 5 to 13 mm. None of the isolates was susceptible to the aqueous extract. Conclusion: The study has shown that bacteria inhibition by O. gratissimum crude extract may be of use in the preservation of the soup. Keywords: Bacillus sp; Ocimum gratissimum; ofe akwu; Sphingobacterium sp; spice; spoilage bacterial. 1. INTRODUCTION parts of Nigeria includes: (Ncho-anwu, Ahuji) Igbo, (Efinrin,) Yoruba, (Aramogbo) or Nigeria is rich in foods and diets that are good (Ebavbokho) Edo and (Daidoya) or (Aai doya ta sources of micronutrients and supplements in a gida) Hausa [11,12]. world faced with problem of food scarcity [1]. The Nigerian ‘banga soup’ or ‘ofe akwu’ is native to The antibacterial activities of Ocimum the Niger Delta and the South Eastern parts of gratissimum have been reported against a Nigeria. In these regions, the soup is commonly number of gram positive ( Staphylococcus eaten with starch, pounded yam, semolina, garri, aureus, Bacillus spp.; Listeria spp.) and gram cassava fufu and rice. A major difference negative ( Esherichia coli, Pseudomonas between ‘banga’ soup and ‘ofe akwu’ is the spice aeruginosa, Salmonella typhi, Klebsiella used for its preparation. pneumonia, Proteus mirabilis, Shigella flexineri ) bacteria [8,13-18]. Foods, by their very nature, are nutritious and metabolizable hence serve as suitable substrates The study was undertaken to determine the for the growth and metabolism of a vast proximate composition and evaluate the population of microorganisms [2], leading to the antibacterial activity of Ocimum gratissimum , a spoilage of contaminated foods. spice used in the preparation of ‘ofe akwu’ against bacteria likely responsible for its To curtail growth of spoilage and pathogenic spoilage. microorganisms in foods, several preservation techniques, such as heat treatment, salting, 2. MATERIALS AND METHODS acidification, and drying have been employed in the food industry [3,4]. Numerous efforts are 2.1 Sample Collection conducted to find natural alternatives to prevent bacterial and fungal growth in foods. In recent The soup ingredients comprising palm kernel years, because of the great consumer fruits ( Elaeis guinensis ), scent leaves ( Ocimum awareness and concern regarding synthetic gratissimum ), stock fish, crayfish, pepper and chemical additives, foods preserved with salt were purchased at the Choba market, Port natural additives have become very Harcourt. popular [5]. 2.2 Extraction of Palm Concentrate Plant essential oils are gaining a wide interest in food industry for their potential as Palm concentrate was extracted from cooked decontaminating agents, as they are Generally palm fruits using the mortar and pistil and put in a Recognized as Safe (GRAS) [5]. The active cooking pot. This was allowed to boil at high components are commonly found in the essential temperature before adding other ingredients to oil fractions and it is well established that most of taste. them have a wide spectrum of antimicrobial activity, against food-borne pathogens and spoilage bacteria [6,7]. 2.3 Proximate Analysis Ocimum gratissimum L. is a shrub belonging to The moisture, crude protein, crude fibre, crude the family Lamiaceae. It is commonly known as fat, carbohydrate and total ash contents of the Scent leaf or Clove basil and is found in many soup was analysed using the method described tropical and warm temperature countries such as by Association of Official Analytical Chemists' India and Nigeria [8-10]. Its local names in some [19]. 2 Eruteya et al.; MRJI, 19(3): 1-8, 2017; Article no.MRJI.32554 2.4 Isolation Procedure elution buffer was added to the column matrix and centrifuged at 10,000xg microlitre for 30 s to Ten milliliter (10 mL) of an overnight and elude the DNA. The ultra pure DNA was then deteriorating soup (after 24 h) was aseptically stored at -20°C for other downstream reaction. transferred to 90 mL sterile peptone water and homogenized. After a ten-fold serial dilution, 0.1 2.7 Amplification of 16S rRNA mL was spread plated on Nutrient agar plates and incubated at room temperature (29±2°C) for The 16S rRNA regions of the rRNA genes of the 24 h. Distinct colonies were purified in fresh isolates were amplified using the 27F Nutrient agar and stored in slants for further (AGAGTTTGATCMTGGCTCAG): and 1492R analysis. (CGGTTACCTTGTTACGACTT): primers on an ABI 9700 Applied Bio-systems thermal cycler at 2.5 Identification of Bacterial Isolates a final volume of 50 µL for 35 cycles. The PCR mix included: the X2 Dream taq Master mix The isolates were identified using standard supplied by Inqaba, South Africa (taq conventional (Gram staining, catalase, indole, polymerase, DNTPs, MgCl), the primers at a motility, citrate, Methyl red, Voges Proskauer, concentration of 0.4M and the extracted DNA as oxidase, starch hydrolysis, H 2S production, sugar template. The PCR conditions were as follows: utilization) and molecular methods (Polymerase Initial denaturation, 95°C for 5 min; denaturation, Chain Reaction and sequencing). 95°C for 30 s; annealing, 52°C for 30s; extension, 72°C for 30s for 35 cycles and 2.6 DNA Extraction final extension, 72°C for 5 min. The product was resolved on a 1% agarose gel at 120V Extraction was done using a ZR fungal/bacterial for 15 min and visualized on a UV DNA mini prep extraction kit supplied by Inqaba transilluminator. South Africa. A heavy growth of the pure culture of the isolates were suspended in 200 µL of 2.8 Sequencing of 16S rRNA isotonic buffer into a ZR Bashing Bead Lysis tubes, 750 microlitre of lysis solution was added The amplified 16S products were sequenced on to the tube. The tubes were secured in a bead a 3500 genetic analyzer using the Bigdye- beater fitted with a 2 mL tube holder assembly Termination technique by Inqaba South Africa. and processed at maximum speed for 5 min. The ZR bashing bead lysis tubes were centrifuged at 2.9 Phylogenetic Analysis 10,000xg for 1 min. The sequences were edited using the Four hundred (400) microlitres of supernatant bioinformatics algorithm Bioedit, similar was transferred to a Zymo-Spin IV spin Filter sequences were downloaded from the National (orange top) in a collection tube and centrifuged Biotechnology Information Center (NCBI) data at 7000 xg for 1 min. One thousand two hundred base using BlastN, these sequences were (1200) microlitres of fungal/bacterial DNA binding aligned using ClustalX. The evolutionary history buffer was added to the filtrate in the collection was inferred using the Neighbor-Joining method tubes bringing the
Recommended publications
  • Show Activity

    Show Activity

    A Cytochrome-P450-Inhibitor *Unless otherwise noted all references are to Duke, James A. 1992. Handbook of phytochemical constituents of GRAS herbs and other economic plants. Boca Raton, FL. CRC Press. Plant # Chemicals Total PPM Acacia farnesiana Huisache; Cassie; Popinac; Sweet Acacia; Opopanax 2 Achillea millefolium Yarrow; Milfoil 1 Acorus calamus Flagroot; Sweetroot; Sweet Calamus; Myrtle Flag; Calamus; Sweetflag 1 384.0 Agastache rugosa 1 Ageratum conyzoides Mexican ageratum 1 Aloysia citrodora Lemon Verbena 1 Alpinia officinarum Lesser Galangal; Chinese Ginger 1 800.0 Alpinia galanga Siamese Ginger; Languas; Greater Galangal 1 24000.0 Ammi majus Bishop's Weed 2 16000.0 Anacardium occidentale Cashew 1 Anethum graveolens Garden Dill; Dill 1 Angelica dahurica Bai Zhi 2 Angelica archangelica Angelica; Wild Parsnip; Garden Angelica 2 5050.0 Apium graveolens Celery 3 Artemisia dracunculus Tarragon 2 141.0 Boronia megastigma Scented Boronia 1 Calamintha nepeta Turkish Calamint 1 Camellia sinensis Tea 2 Cananga odorata Cananga; Ylang-Ylang 1 Capsicum frutescens Tabasco; Cayenne; Chili; Hot Pepper; Spur Pepper; Red Chili 1 35800.0 Capsicum annuum Cherry Pepper; Cone Pepper; Paprika; Bell Pepper; Sweet Pepper; Green Pepper 2 8000.0 Centaurea calcitrapa Star-Thistle 1 Chenopodium album Lambsquarter 1 Cinnamomum verum Ceylon Cinnamon; Cinnamon 1 20320.0 Cinnamomum camphora Camphor; Ho Leaf 1 Cinnamomum aromaticum Cassia Lignea; Chinese Cassia; Chinesischer Zimtbaum (Ger.); Canela de la China (Sp.); 1 Saigon Cinnamon; Chinazimt (Ger.); Kashia-Keihi
  • Seasonal Incidence of Ocimum Tingid Bug, Cochlochila Bullita Stal

    Seasonal Incidence of Ocimum Tingid Bug, Cochlochila Bullita Stal

    Journal of Pharmacognosy and Phytochemistry 2020; 9(4): 3138-3144 E-ISSN: 2278-4136 P-ISSN: 2349-8234 www.phytojournal.com Seasonal incidence of Ocimum tingid bug, JPP 2020; 9(4): 3138-3144 Received: 07-05-2020 Cochlochila bullita Stal (Heteroptera: Tingidae) Accepted: 09-06-2020 on three different species of Ocimum viz. Ocimum Vishav Prakash Rahul basilicum L., Ocimum sanctum L. and Ocimum CSIR-Indian Institute of Integrative Medicine, Canal kilimandscharicum Guerke Road, Jammu, Jammu and Kashmir, India Vishav Prakash Rahul, Bhumika Kapoor, Sougata Sarkar and Sabha Jeet Bhumika Kapoor Project Assistant, CSIR-Indian Institute of Integrative DOI: https://doi.org/10.22271/phyto.2020.v9.i4ae.12093 Medicine, Canal Road, Jammu, Jammu and Kashmir, India Abstract The field experiment was conducted on the seasonal incidence Ocimum lace bug on three different Sougata Sarkar species of Ocimum viz. Ocimum basilicum L., Ocimum sanctum L. and Ocimum kilimandscharicum Research Associate, Scientist, Guerke at CSIR- IIIM, Chatha Farm, Jammu. The data on seasonal fluctuations of Ocimum tingid bug, CSIR-Indian Institute of Cochlochila bullita on various species of Ocimum such as Ocimum basilicum L., Ocimum sanctum L. Integrative Medicine, Canal and Ocimum kilimandscharicum Guerke were first observed during 33rd standard week of August i.e. Road, Jammu, Jammu and 0.40 Mean insect/ plant, 0.2 mean insect/plant and 0.20 mean insect/plant, respectively. The maximum Kashmir, India lace bug population was recorded on sweet basil during 39th standard week i.e. 52.60 mean insect/ plant when weekly mean maximum temperature 29.7 oC, minimum temperature 23.1 oC, morning relative Sabha Jeet Scientist, CSIR-Indian Institute humidity 93.1% and evening relative humidity 75.90 %, rainfall 93.40 mm, and wind speed 2.00 km/hr, of Integrative Medicine, Canal respectively.
  • Honey Bee Suite © Rusty Burlew 2015 Master Plant List by Scientific Name United States

    Honey Bee Suite © Rusty Burlew 2015 Master Plant List by Scientific Name United States

    Honey Bee Suite Master Plant List by Scientific Name United States © Rusty Burlew 2015 Scientific name Common Name Type of plant Zone Full Link for more information Abelia grandiflora Glossy abelia Shrub 6-9 http://plants.ces.ncsu.edu/plants/all/abelia-x-grandiflora/ Acacia Acacia Thorntree Tree 3-8 http://www.2020site.org/trees/acacia.html Acer circinatum Vine maple Tree 7-8 http://www.nwplants.com/business/catalog/ace_cir.html Acer macrophyllum Bigleaf maple Tree 5-9 http://treesandshrubs.about.com/od/commontrees/p/Big-Leaf-Maple-Acer-macrophyllum.htm Acer negundo L. Box elder Tree 2-10 http://www.missouribotanicalgarden.org/PlantFinder/PlantFinderDetails.aspx?kempercode=a841 Acer rubrum Red maple Tree 3-9 http://www.missouribotanicalgarden.org/PlantFinder/PlantFinderDetails.aspx?taxonid=275374&isprofile=1&basic=Acer%20rubrum Acer rubrum Swamp maple Tree 3-9 http://www.missouribotanicalgarden.org/PlantFinder/PlantFinderDetails.aspx?taxonid=275374&isprofile=1&basic=Acer%20rubrum Acer saccharinum Silver maple Tree 3-9 http://en.wikipedia.org/wiki/Acer_saccharinum Acer spp. Maple Tree 3-8 http://en.wikipedia.org/wiki/Maple Achillea millefolium Yarrow Perennial 3-9 http://www.missouribotanicalgarden.org/PlantFinder/PlantFinderDetails.aspx?kempercode=b282 Aesclepias tuberosa Butterfly weed Perennial 3-9 http://www.missouribotanicalgarden.org/PlantFinder/PlantFinderDetails.aspx?kempercode=b490 Aesculus glabra Buckeye Tree 3-7 http://www.missouribotanicalgarden.org/PlantFinder/PlantFinderDetails.aspx?taxonid=281045&isprofile=1&basic=buckeye
  • Herb List Gardens

    Herb List Gardens

    NORTH HAVEN Herb List Gardens Common Name Botanical Name UsesCat Light Color Height Soil Symbolism ALOE VERA Aloe barbadensis M TT SUNOrangeWD12"-18" Healing ANISE Pimpinella anisum CMTA S/PSH White12"-18" MWD APPLE MINT Mentha suaveolens CFr MTP S/PSHWhite12"-18" MWD Virtue APPLE MINT Mentha rotundifolia S/PSH Mauve4"-6" M ARUGULA Eruca vesicara CM A SUNCream18"-24" MWD Enthusiasm ARUGULA, DWARF Diplotaxis erucoides C A SUNYellow10"-12" WD Straightforward BASIL, AFRICAN BLUE Ocimum kilimandscharicum CFr O A SUNPurple24"-36" M Affection BASIL, AROMA 2 Ocimum basilicum CFr Fl M O A S/PSHWhite18"-24" WD Good Luck BASIL,' AUSSIE SWEETIE' Ocimum basilicum CFr A SUN18"-24" WD Good Wishes BASIL, BOXWOOD Ocimum basilicum CFr Fl O A S/PSH White8"-10" WD BASIL, CINNAMON Ocimum basilicum CFr A SUNLavender 18"-24" MWD Good Wishes BASIL, 'CITRIODORUM' LEMON Ocimum basilicum CFr A SUNWhite18"-24" MWD Good Wishes BASIL, DARK OPAL Ocimum basilicum COA SUNPurple18"-24" MWD Good Wishes BASIL, 'GENOVESE' Ocimum basilicum CFr Fl A S/PSHWhite18"-24" MWD Good Wishes BASIL, 'GREEK COLUMNAR' OR 'AU Ocimum xcitriodorum 'Lesbos' CFr MO A S/PSH 24"-36" MWD BASIL, HOLY Ocimum sanctum Fr Fl A S/PSHWhite or Laven18"-24" MWD Good Luck BASIL, LETTUCE LEAF Ocimum basilicum COA SUNWhite18"-24" MWD Good Wishes BASIL, LIME Ocimum americanum CFr A SUNWhite18"-24" MWD Good Wishes BASIL, 'MAGICAL MICHAEL' Ocimum basilicum CFr Fl O A S/PSHWhite18"-24" WD Good Wishes BASIL, 'MINETTE' Ocimum basilicum CFr O A SUNWhite12"-18" MWD Good Wishes BASIL, MINI PURPLE Ocimum basilicum
  • Plant List 2021-08-25 (12:18)

    Plant List 2021-08-25 (12:18)

    Plant List 2021-09-24 (14:25) Plant Plant Name Botanical Name in Price Stock Per Unit AFRICAN DREAM ROOT - 1 Silene capensis Yes R92 AFRICAN DREAM ROOT - 2 Silene undulata Yes R92 AFRICAN POTATO Hypoxis hemerocallidea Yes R89 AFRICAN POTATO - SILVER-LEAFED STAR FLOWER Hypoxis rigidula Yes R89 AGASTACHE - GOLDEN JUBILEE Agastache foeniculum No R52 AGASTACHE - HYSSOP, WRINKLED GIANT HYSSOP Agastache rugosa Yes R59 AGASTACHE - LICORICE MINT HYSSOP Agastache rupestris No R59 AGASTACHE - PINK POP Agastache astromontana No R54 AGRIMONY Agrimonia eupatoria No R54 AJWAIN Trachyspermum ammi No R49 ALFALFA Medicago sativa Yes R59 ALOE VERA - ORANGE FLOWER A. barbadensis Yes R59 ALOE VERA - YELLOW FLOWER syn A. barbadensis 'Miller' No R59 AMARANTH - ‘LOVE-LIES-BLEEDING’ Amaranthus caudatus No R49 AMARANTH - CHINESE SPINACH Amaranthus species No R49 AMARANTH - GOLDEN GIANT Amaranthus cruentas No R49 AMARANTH - RED LEAF Amaranthus cruentas No R49 ARTICHOKE - GREEN GLOBE Cynara scolymus Yes R54 ARTICHOKE - JERUSALEM Helianthus tuberosus Yes R64 ARTICHOKE - PURPLE GLOBE Cynara scolymus No R54 ASHWAGANDA, INDIAN GINSENG Withania somniferia Yes R59 ASPARAGUS - GARDEN Asparagus officinalis Yes R54 BALLOON FLOWER - PURPLE Platycodon grandiflorus 'Apoyama' Yes R59 BALLOON FLOWER - WHITE Platycodon grandiflorus var. Albus No R59 BASIL - CAMPHOR Ocimum kilimandscharicum Yes R59 BASIL HOLY - GREEN TULSI, RAM TULSI Ocimum Sanctum Yes R54 BASIL HOLY - TULSI KAPOOR Ocimum sanctum Linn. No R54 BASIL HOLY - TULSI TEMPERATE Ocimum africanum No R54 BASIL HOLY - TULSI
  • Show Activity

    Show Activity

    A (-)-Chronotropic *Unless otherwise noted all references are to Duke, James A. 1992. Handbook of phytochemical constituents of GRAS herbs and other economic plants. Boca Raton, FL. CRC Press. Plant # Chemicals Total PPM Abies spectabilis 1 Abies sachalinensis Shin-Yo-Yu; Japanese Fir 1 7560.0 Abies balsamea Balsam Fir 1 4090.0 Achillea moschata Iva 2 4536.0 Achillea millefolium Yarrow; Milfoil 3 3190.0 Acinos suaveolens 2 Acinos alpinus Te de Sierra Nevada 1 Acorus calamus Sweetflag; Myrtle Flag; Sweetroot; Calamus; Flagroot; Sweet Calamus 2 200.0 Aframomum melegueta Alligator Pepper; Grains-of-Paradise; Malagettapfeffer (Ger.); Malagueta (Sp.); Guinea Grains; Melegueta 1 Pepper Ageratum conyzoides Mexican ageratum 1 Ajuga reptans Common Bugle; Bugle; Bugleherb; Blue Bugle; Bugleweed 1 Ajuga iva Ivy Bugle 1 Aloysia citrodora Lemon Verbena 2 840.0 Alpinia officinarum Chinese Ginger; Lesser Galangal 1 Alpinia galanga Greater Galangal; Siamese Ginger; Languas 3 Amomum xanthioides Malabar Cardamom; Chin Kousha; Bastard Cardamom; Tavoy Cardamom 2 Amomum compactum Chester Cardamom; Siam Cardamom; Java Cardamom; Round Cardamom 2 Angelica archangelica Angelica; Wild Parsnip; Garden Angelica 2 150.0 Annona squamosa Sugar-Apple; Sweetsop 1 Aristolochia serpentaria Serpentaria; Virginia Snakeroot 1 Artemisia vulgaris Mugwort 2 Artemisia salsoloides 3 Artemisia herba-alba Desert Wormwood 3 638.0 Artemisia dracunculus Tarragon 1 1000.0 Artemisia cina Levant Wormseed 1 48000.0 Artemisia annua Annual Wormwood (GRIN); Annual Mugwort (GRIN); Sweet Wormwood
  • Dr. Duke's Phytochemical and Ethnobotanical Databases List of Plants for Candidistat

    Dr. Duke's Phytochemical and Ethnobotanical Databases List of Plants for Candidistat

    Dr. Duke's Phytochemical and Ethnobotanical Databases List of Plants for Candidistat Plants with Activity Synergy Chemical Count Total PPM Abies alba 1 2394.0 Abies balsamea 1 3100.0 Abies spectabilis 2 Acacia farnesiana 1 Achillea millefolium 2 340.0 Acinos suaveolens 3 Acorus calamus 3 27820.0 Aeolanthus myriantha 1 Aesculus hippocastanum 2 Agastache foeniculum 1 Agastache nepetoides 1 Agastache rugosa 1 Agastache urticifolia 1 4928.0 Ageratum conyzoides 1 Allium sativum var. sativum 2 Aloysia citrodora 2 2100.0 Alpinia galanga 2 Alpinia officinarum 2 Amomum compactum 2 Anacardium occidentale 1 Ananas comosus 1 Anethum graveolens 4 Angelica archangelica 3 2640.0 Annona squamosa 1 Apium graveolens 3 1438152.0 Armoracia rusticana 1 Artemisia annua 4 Plants with Activity Synergy Chemical Count Total PPM Artemisia dracunculus 3 Artemisia salsoloides 1 Artemisia vulgaris 1 Asarum canadense 1 Asiasarum sieboldii 1 Asimina triloba 1 1.096 Avena sativa 1 Ballota nigra 1 Boswellia sacra 1 Brassica oleracea var. capitata l. 1 Bursera delpechiana 1 720.0 Calamintha nepeta 1 Callicarpa americana 2 Camellia sinensis 2 Cananga odorata 1 Canarium indicum 1 1000.0 Capsicum annuum 2 Capsicum frutescens 2 Carica papaya 1 Carthamus tinctorius 1 0.04 Carum carvi 3 156060.0 Centella asiatica 2 Chamaemelum nobile 1 Chenopodium ambrosioides 1 Chrysanthemum balsamita 1 Chrysanthemum parthenium 1 Chrysanthemum x morifolium 1 2 Plants with Activity Synergy Chemical Count Total PPM Cinnamomum aromaticum 3 Cinnamomum camphora 1 240.0 Cinnamomum verum 3 384.0 Cistus
  • Micropropagation of Ocimum Kilimandscharicum Guerke (Labiatae)

    Micropropagation of Ocimum Kilimandscharicum Guerke (Labiatae)

    ACTA BIOLOGICA CRACOVIENSIA Series Botanica 52/2: 50–58, 2010 DOI: 10.2478/v10182-010-0023-7 MICROPROPAGATION OF OCIMUM KILIMANDSCHARICUM GUERKE (LABIATAE) SOUMEN SAHA, TULSI DEY, AND PARTHADEB GHOSH* Cytogenetics and Plant Biotechnology Research Unit, Department of Botany, University of Kalyani, Kalyani-741235, West Bengal, India Received March 13, 2010; revision accepted November 3, 2010 An efficient plant regeneration protocol has been developed from nodal explants of Ocimum kilimandscharicum Guerke, a medicinally important herbaceous plant species belonging to the family Lamiaceae. Axillary shoot bud proliferation was initiated from nodal explants cultured on MS medium supplemented with various concentra- tions of 6-benzyladenine (BA) (0.5–3.0 mg/l), kinetin (KN) (0.5–3.0 mg/l) and 2-isoPentenyladenine (2-iP) (0.5–3.0 mg/l). The maximum number of shoots (6.09±0.05), with average length 3.83±0.11 cm, was achieved with medi- um containing 1.0 mg/l BA. Shoot culture was established by repeated subculturing of the original nodal explants on shoot multiplication medium after each harvest of newly formed shoots. In this way, 20–30 shoots were obtained from a single nodal explant after 5 months. Rooting of shoots was achieved on half-strength MS medi- um supplemented with 1.5 mg/1 Indole-3-butyric acid (IBA) and 2% sucrose. Well-developed plantlets transferred to plastic pots containing soil and vermiculite (1:1) showed 81.13% survival. The genetic fidelity of in-vitro-raised field-grown plants to the donor plant was ascertained from random amplified polymorphic DNA (RAPD) markers.
  • Eco Friendly Flora

    Eco Friendly Flora

    Eco Friendly Flora Parandwadi,Somatane Phata, NH4, Tal-Maval, Dist-Pune 410 506 Contact - 9225104384 / 9422224384 / 8390257511 / 7875695036 Email - [email protected] / [email protected] | Website - www.efshub.com Sr No Common Name Botanical Name Habit Variety Category Aromatic 1 Bhim Kappor Clausena heptaphylla Herb A 2 Chandan Santalum album Tree A 3 Citronela Cymbopogon sp Herb A 4 Dhup (Black Dammer) Canarium strictum Tree A 5 Dhup (RAL) Shorea robusto Tree A 6Dhup uad Vateria indica Tree A 7 Dongri dauna Artemisia pallens Shrub A 8 Lemon grass / Gavti chaha Cymbopogon citratum Grass A 9 Hirwa chafa Artabotrys odoratissimus Shrub A 10 Kapoor Cinnamomum camphora Tree A 11 Kapur Tulas Ocimum kilimandscharicum Herb A 12 Kavthi chafa white Magnolia coco Shrub A 13 Kavthi chafa Yellow Magnolia liliifera Tree A 14 Magnolia (kavthi chafa) Magnolia grandiflora Tree A 15 Kewada Pandanus odorrattissimus Shrub A 16 Krushnagaru Aquilaria agallocha Tree A 17 Lemon bamm Melissa officinalis Herb A 18Lodhra Symplocos racemosa Tree A 19Marwa origanum majorana Herb A 20 Mini Badam Terminalia metalica tree A 21 Nilgiri sented Eucalyptus citriodora Tree A 22 Odomas Pelargonium 'citrosum' Herb A 23Pan Kapur Piper betel Shrub A 24 Ratrani Cestrum nocturnum Shrub A 25 Rosewood Dalbergia latifolia Tree A 26 Rosha grass Cymbopogon sp. Grass A 27 Satap Ruta chalapensis Herb A 28 Sonchapha (Saundaraya) Michelia champaca Tree A 29 Sontakka White Hedychium coronarium Grass A 30 Sontakka Yellow Hedychium flavescens Grass A 31 Vanila Vanilla planifolia Climber
  • Ethnoknowledge of Bukusu Community on Livestock Tick Prevention and Control

    Ethnoknowledge of Bukusu Community on Livestock Tick Prevention and Control

    Journal of Ethnopharmacology 140 (2012) 298–324 Contents lists available at SciVerse ScienceDirect Journal of Ethnopharmacology jo urnal homepage: www.elsevier.com/locate/jethpharm Ethnoknowledge of Bukusu community on livestock tick prevention and control in Bungoma district, western Kenya a,b,∗ c d e b,f Wycliffe Wanzala , Willem Takken , Wolfgang R. Mukabana , Achola O. Pala , Ahmed Hassanali a School of Pure and Applied Sciences, Department of Biological Sciences, South Eastern University College (A Constituent College of the University of Nairobi), P.O. Box 170-90200, Kitui, Kenya b Behavioural and Chemical Ecology Department (BCED), International Centre of Insect Physiology and Ecology (ICIPE), P.O. Box 30772-00100 GPO, Kasarani, Nairobi, Kenya c Wageningen University and Research Centre, Laboratory of Entomology, P.O. Box 8031, 6700 EH Wageningen, The Netherlands d School of Biological Sciences, University of Nairobi, P.O. Box 30197-00100, Nairobi, Kenya e Technology Transfer Unit, International Centre of Insect Physiology and Ecology (ICIPE), P.O. Box, 30772-00100 GPO, Kasarani, Nairobi, Kenya f School of Pure and Applied Sciences, Kenyatta University, P.O. Box 43844-00100 GPO, Nairobi, Kenya a r t i c l e i n f o a b s t r a c t Article history: Ethnopharmacological relevance: To date, nomadic communities in Africa have been the primary focus Received 24 August 2011 of ethnoveterinary research. The Bukusu of western Kenya have an interesting history, with nomadic Received in revised form lifestyle in the past before settling down to either arable or mixed arable/pastoral farming systems. 14 December 2011 Their collective and accumulative ethnoveterinary knowledge is likely to be just as rich and worth Accepted 13 January 2012 documenting.
  • Pharmacognostical and Biochemical Investigation of Ocimum Kilimandscharicum Plants Available in Western Himalayan Region

    Pharmacognostical and Biochemical Investigation of Ocimum Kilimandscharicum Plants Available in Western Himalayan Region

    Available online a t www.pelagiaresearchlibrary.com Pelagia Research Library Asian Journal of Plant Science and Research, 2012, 2 (4):446-451 ISSN : 2249-7412 CODEN (USA): AJPSKY Pharmacognostical and biochemical investigation of Ocimum kilimandscharicum plants available in western Himalayan region Devesh Tewari* a, H. K. Pandey b, A. N. Sah a, H. S. Meena b and A. Manchanda b a Department of Pharmaceutical Sciences Kumaun University Bhimtal Campus Nainital, Uttarakhand, India bDefence Institute of Bio-Energy Research (DIBER), DRDO, Field Station, Pithoragarh, (Uttarakhand) India _____________________________________________________________________________________________ ABSTRACT India has a rich heritage of plants as medicines; Indian systems of medicines utilize 80 percent of the material derived from the plants. Himalaya are a rich repository of tradition, culture and heritage. The diversified topography, soil and microclimatic zones of Himalayan regions have resulted occurrence of several valuable and economically important medicinal and aromatic plants of great therapeutic value. The use of plants as sources of medicines are human substance has been in vogue since antiquity. Large numbers of plants are utilized in various systems of medicine practiced in India and local health traditions for the treatment of human diseases since time immemorial. Ocimum kilimandscharicum Gurke. is used for thousands of years in Ayurveda for its diverse healing properties. Tulsi is the legendary ‘Incomparable one’ of India, is one of the holiest and most cherished of the many healing and healthy giving herbs of the orient. The paper comprises to determine the pharmacognostical parameters and elemental evaluation along with nutritional components and preliminary phytochemical investigation of the Ocimum kilimandscharicum available in western Himalayan region.
  • Black Cohosh Adulteration Herbs for Female US/CAN $6.95

    Black Cohosh Adulteration Herbs for Female US/CAN $6.95

    HerbalGram 98 • May - July 2013 2013 July - May • 98 HerbalGram Holy Basil Profile • Garlic and Blood Pressure • 100+ Year-Old Phytomedicine Company Artichoke and Cholesterol • ABC Celebration • Chocolate and Stroke Risk Holy Basil Profile • Garlic and Blood Pressure • Herbs Reproductive for Female Health Company Phytomedicine • • Year-Old Herbal 100+ Insect Repellents • Chocolate and Stroke Risk The Journal of the American Botanical Council Number 98 | May - July 2013 Black Cohosh Adulteration Herbs for Female US/CAN $6.95 Reproductive Health www.herbalgram.org www.herbalgram.org Herbal Insect Repellents Herb Profile Holy Basil Ocimum tenuiflorum (syn. O. sanctum) Family: Lamiaceae (formerly Labiatae) INTRODUCTION or “pleasing basil”), is known as Forest or Vana Tulsi. Even Holy basil is a perennial or annual in the mint family though it is a different species, O. gratissimum also is consid- ered sacred in India and is used in the same ways as the O. that exhibits the square stem and volatile oils characteristic 2 of its family.1 It is erect, very branched, strongly aromatic, tenuiflorum varieties. and mildly hairy.2 Holy basil is native to India and parts of Tulsi is one of the principal herbs used in the Ayurvedic M I S S I O N D R I V E N : northern and eastern Africa, Hainan Island, and Taiwan, medicine system, in which it is known alternately as “The Queen of Herbs,” “The Incomparable One,” and “The and grows wild throughout India and up to an altitude of 9 5,900 feet (1,800 meters) in the Himalayas.3-5 In China, Mother Medicine of Nature.” It holds a supreme place in it occurs in dry, sandy areas of Hainan and Sichuan, as the ancient Vedic scriptures and is integrated into daily life well as in Cambodia, Indonesia, Laos, Malaysia, Myan- by Hindus through religious worship.