'Ofe Akwu' Soup Spoilage

Microbiology Research Journal International 19(3): 1-8, 2017; Article no.MRJI.32554 Previously known as British Microbiology Research Journal ISSN: 2231-0886, NLM ID: 101608140

SCIENCEDOMAIN international

www.sciencedomain.org

Inhibitory Potential of Ocimum gratissimum L on Bacterial Implicated in ‘Ofe Akwu’ Soup Spoilage

O. C. Eruteya 1* , F. S. Ire 1 and C. C. Aneke 1

1Department of Microbiology, University of Port Harcourt, Port Harcourt, Nigeria.

Authors’ contributions

This work was carried out in collaboration between all authors. Authors OCE and FSI designed the study. All authors participated in the laboratory analysis. Author OCE wrote the first draft of the manuscript. All authors read and approved the final manuscript.

Article Information

DOI: 10.9734/MRJI/2017/32554 Editor(s): (1) Ana Cláudia Coelho, Department of Veterinary Sciences, University of Trás-os-Montes and Alto Douro, Portugal. Reviewers: (1) Vishwanadham Yerragunta, JNTU-Hydrabad, India. (2) P. Rameshthangam, Alagappa University, Karaikudi, Tamilnadu, India. (3) Julius Tibyangye, St. Augustine International University/Kampala International University, Uganda. Complete Peer review History: http://www.sciencedomain.org/review-history/18590

Received 1st March 2017 Accepted 29 th March 2017 Original Research Article Published 11 th April 2017

ABSTRACT

Aims: The study evaluated the proximate composition, the bacteria present in freshly spoilt ‘ofe akwu’ soup and inhibitory potential of crude ethanol, methanol and aqueous leaf extract of Ocimum gratissimum on the resulting bacteria. Study Design: This was an analytical study in duplicate. Place and Duration of Study: Department of Microbiology, University of Port Harcourt, Niger Delta University, Amasoma, and South Africa, between July 2015 and December 2016. Methodology: Isolation was done using Nutrient agar medium. Conventional and molecular methods were employed in the identification of the isolates. Proximate analysis and antibacterial activity of O. gratissimum against the bacteria were done using standard methods. Results: The proximate analysis shows the chemical composition such as moisture (66.40%), ash (1.42%), carbohydrate (2.74%), protein (6.50%), lipid (14.39%) and fibre (8.55%). The resulting bacteria on the basis of conventional and molecular characterization were identified as Bacillus pumilus strain m414, B. subtilis strain AIMST 2ME1, B. cereus strain CF7 and Sphingobacterium mizutaii strain AUMC b-161. The ethanol extract (50 to 250 mg/mL) inhibited Bacillus pumilus strain m414 and B. cereus strain CF7 with zones ranging from 7 to 13 mm while the methanol extract (50

______

*Corresponding author: E-mail: [email protected];

Eruteya et al.; MRJI, 19(3): 1-8, 2017; Article no.MRJI.32554

to 250 mg/mL) inhibited Bacillus pumilus strain m414, B. subtilis strain AIMST 2ME1 and Sphingobacterium mizutaii strain AUMC b-161 with zones ranging from 5 to 13 mm. None of the isolates was susceptible to the aqueous extract. Conclusion: The study has shown that bacteria inhibition by O. gratissimum crude extract may be of use in the preservation of the soup.

Keywords: Bacillus sp; Ocimum gratissimum; ofe akwu; Sphingobacterium sp; spice; spoilage bacterial.

1. INTRODUCTION parts of Nigeria includes: (Ncho-anwu, Ahuji) Igbo, (Efinrin,) Yoruba, (Aramogbo) or Nigeria is rich in foods and diets that are good (Ebavbokho) Edo and (Daidoya) or (Aai doya ta sources of micronutrients and supplements in a gida) Hausa [11,12]. world faced with problem of food scarcity [1]. The Nigerian ‘banga soup’ or ‘ofe akwu’ is native to The antibacterial activities of Ocimum the Niger Delta and the South Eastern parts of gratissimum have been reported against a Nigeria. In these regions, the soup is commonly number of gram positive ( Staphylococcus eaten with starch, pounded yam, semolina, garri, aureus, Bacillus spp.; Listeria spp.) and gram cassava fufu and rice. A major difference negative ( Esherichia coli, Pseudomonas between ‘banga’ soup and ‘ofe akwu’ is the spice aeruginosa, Salmonella typhi, Klebsiella used for its preparation. pneumonia, Proteus mirabilis, Shigella flexineri ) bacteria [8,13-18]. Foods, by their very nature, are nutritious and metabolizable hence serve as suitable substrates The study was undertaken to determine the for the growth and metabolism of a vast proximate composition and evaluate the population of microorganisms [2], leading to the antibacterial activity of Ocimum gratissimum , a spoilage of contaminated foods. spice used in the preparation of ‘ofe akwu’ against bacteria likely responsible for its To curtail growth of spoilage and pathogenic spoilage. microorganisms in foods, several preservation techniques, such as heat treatment, salting, 2. MATERIALS AND METHODS acidification, and drying have been employed in the food industry [3,4]. Numerous efforts are 2.1 Sample Collection conducted to find natural alternatives to prevent bacterial and fungal growth in foods. In recent The soup ingredients comprising palm kernel years, because of the great consumer fruits ( Elaeis guinensis ), scent leaves ( Ocimum awareness and concern regarding synthetic gratissimum ), stock fish, crayfish, pepper and chemical additives, foods preserved with salt were purchased at the Choba market, Port natural additives have become very Harcourt. popular [5]. 2.2 Extraction of Palm Concentrate Plant essential oils are gaining a wide interest in food industry for their potential as Palm concentrate was extracted from cooked decontaminating agents, as they are Generally palm fruits using the mortar and pistil and put in a Recognized as Safe (GRAS) [5]. The active cooking pot. This was allowed to boil at high components are commonly found in the essential temperature before adding other ingredients to oil fractions and it is well established that most of taste. them have a wide spectrum of antimicrobial activity, against food-borne pathogens and spoilage bacteria [6,7]. 2.3 Proximate Analysis

Ocimum gratissimum L. is a shrub belonging to The moisture, crude protein, crude fibre, crude the family Lamiaceae. It is commonly known as fat, carbohydrate and total ash contents of the Scent leaf or Clove basil and is found in many soup was analysed using the method described tropical and warm temperature countries such as by Association of Official Analytical Chemists' India and Nigeria [8-10]. Its local names in some [19].

Eruteya et al.; MRJI, 19(3): 1-8, 2017; Article no.MRJI.32554

2.4 Isolation Procedure elution buffer was added to the column matrix and centrifuged at 10,000xg microlitre for 30 s to Ten milliliter (10 mL) of an overnight and elude the DNA. The ultra pure DNA was then deteriorating soup (after 24 h) was aseptically stored at -20°C for other downstream reaction. transferred to 90 mL sterile peptone water and homogenized. After a ten-fold serial dilution, 0.1 2.7 Amplification of 16S rRNA mL was spread plated on Nutrient agar plates and incubated at room temperature (29±2°C) for The 16S rRNA regions of the rRNA genes of the 24 h. Distinct colonies were purified in fresh isolates were amplified using the 27F Nutrient agar and stored in slants for further (AGAGTTTGATCMTGGCTCAG): and 1492R analysis. (CGGTTACCTTGTTACGACTT): primers on an ABI 9700 Applied Bio-systems thermal cycler at 2.5 Identification of Bacterial Isolates a final volume of 50 µL for 35 cycles. The PCR mix included: the X2 Dream taq Master mix The isolates were identified using standard supplied by Inqaba, South Africa (taq conventional (Gram staining, catalase, indole, polymerase, DNTPs, MgCl), the primers at a motility, citrate, Methyl red, Voges Proskauer, concentration of 0.4M and the extracted DNA as oxidase, starch hydrolysis, H 2S production, sugar template. The PCR conditions were as follows: utilization) and molecular methods (Polymerase Initial denaturation, 95°C for 5 min; denaturation, Chain Reaction and sequencing). 95°C for 30 s; annealing, 52°C for 30s; extension, 72°C for 30s for 35 cycles and 2.6 DNA Extraction final extension, 72°C for 5 min. The product was resolved on a 1% agarose gel at 120V Extraction was done using a ZR fungal/bacterial for 15 min and visualized on a UV DNA mini prep extraction kit supplied by Inqaba transilluminator. South Africa. A heavy growth of the pure culture of the isolates were suspended in 200 µL of 2.8 Sequencing of 16S rRNA isotonic buffer into a ZR Bashing Bead Lysis tubes, 750 microlitre of lysis solution was added The amplified 16S products were sequenced on to the tube. The tubes were secured in a bead a 3500 genetic analyzer using the Bigdye- beater fitted with a 2 mL tube holder assembly Termination technique by Inqaba South Africa. and processed at maximum speed for 5 min. The ZR bashing bead lysis tubes were centrifuged at 2.9 Phylogenetic Analysis 10,000xg for 1 min.

The sequences were edited using the Four hundred (400) microlitres of supernatant bioinformatics algorithm Bioedit, similar was transferred to a Zymo-Spin IV spin Filter sequences were downloaded from the National (orange top) in a collection tube and centrifuged Biotechnology Information Center (NCBI) data at 7000 xg for 1 min. One thousand two hundred base using BlastN, these sequences were (1200) microlitres of fungal/bacterial DNA binding aligned using ClustalX. The evolutionary history buffer was added to the filtrate in the collection was inferred using the Neighbor-Joining method tubes bringing the final volume to 1600 µL; 800 in MEGA 6.0 [20]. The bootstrap consensus tree µL was then transferred to a Zymo-Spin IIC inferred from 500 replicates is taken to represent column in a collection tube and centrifuged at the evolutionary history of the taxa analyzed [21]. 10,000xg for 1 min, the flow through was Branches corresponding to partitions reproduced discarded from the collection tube. The in less than 50% bootstrap replicates were remaining volume was transferred to the same collapsed. The evolutionary distances were Zymo-spin and spun. Two hundred (200) computed using the Jukes-Cantor method [22] microlitre of the DNA Pre-Wash buffer was and are in the units of the number of base added to the Zymo-spin IIC in a new collection substitutions per site. tube and spun at 10,000xg for 1 minute followed by the addition of 500 µL of fungal/bacterial DNA Wash Buffer and centrifuged at 10,000xg for 1 2.10 Preparation of Crude Extract min. The methanol and ethanol crude extracts of The Zymo-spin IIC column was transferred to a Ocimum gratissimum were prepared according to clean 1.5 µL centrifuge tube, 100 µL of DNA the method of Akujobi et al. [23]. The spice crude

Eruteya et al.; MRJI, 19(3): 1-8, 2017; Article no.MRJI.32554

extracts were diluted with 30% of moisture (66.56%), ash (3.23%), carbohydrate dimethylsulphoxide (DMSO) to obtain 250 mg/mL (7.79%), protein (5.99%), lipid (8.89%) and fibre (0.5 g in 2 mL), 200 mg/mL (0.5 g in 2.5 mL), 150 (7.53%) in ‘banga’ soup cooked with ‘shaki’ mg/mL (0.3 g in 2 mL), 100 mg/mL (0.5 g in 5 (Offals) meat by Kolawole and Obueh [1]. The mL) and 50 mg/mL (0.25 g in 5 mL). Aqueous proximate composition results have shown a crude extract was diluted in sterile deionised reasonable distribution of the basic food nutrients water at same ratio. confirming the nutritive nature of the soup.

2.11 Antibacterial Activity of Crude 3.2 Bacteria Isolated O. gratissimum Extracts Food spoilage is a gradual process resulting from Agar diffusion method was employed. From an poor sanitation, enzymatic or chemical reactions, overnight broth culture of the various bacterial improper storage temperature and microbial isolated in nutrient broth, a 0.5 McFarland growth. The main single cause of food spoilage standard was prepared (by first centrifuging the is invasion by microorganisms such as moulds, overnight broth at 4,000 rpm for 10 min and yeast and bacteria; with bacteria mostly supernatant decanted. Sterile deionized water (2 implicated. The resulting bacteria on the basis of mL) was then added, vortexed and centrifuged conventional and molecular characterization again at 4,000 rpm for 10 min. The resulting were identified as Bacillus pumilus strain m414, pellets were transferred to a physiological saline B. subtilis strain AIMST 2ME1, B. cereus strain while comparing with McFarland standards) and CF7 and Sphingobacterium mizutaii strain AUMC 0.1 ml aseptically transferred to sterile Petri b-161 (Fig. 1). A number of authors have dishes before adding 20 mL molten Mueller reported the role of Bacillus spp. in food spoilage Hinton agar cooled to 50°C. The content was confirming the finding of this study [24-28] thoroughly mixed and then allowed to solidify. reported the isolation of B. cereus and B. subtilis Five wells (5.0 mm) were made in each plate from ‘egusi’ soup also very popular in Nigeria. using a cup borer and 0.2 mL of the spice Bacillus cereus, B. pumilus and B. subtilis have concentrations of the methanol, ethanol and been isolated from fermented products used as aqueous extracts aseptically transferred into soup condiments in Nigeria [29,30]. There are no each well using a pipette. Plates were allowed to reports of isolation of Sphingobacterium mizutaii stand for pre-diffusion for 1 h before incubation at from foods in available literatures. 29 ±2°C for 24 h. Average zones of inhibition were calculated. 3.3 Antibacterial Activity of O. gratissimum 2.12 Determination of Spoilage Time The result of the antibacterial activity indicated Fifty milliliter of freshly prepared soup were that ethanol extract of Ocimum gratissimum (50- aseptically dispensed into pre-sterilized bowl, 250 mg/mL) inhibited Bacillus pumilus strain and 0.1 mL of 0.5 McFarland standard of m414 and B. cereus strain CF7 (Plate 1) with individual and a mixed bacteria culture was zones ranging from 8 to 13 mm (Table 1) while added to each bowl and observed at 15min the methanol extract (50-250 mg/mL) inhibited interval for spoilage signs at room temperature Bacillus pumilus strain m414, B. cereus strain CF (29±2°C). 7 and Sphingobacterium mizutaii strain AUMC b- 161 with zones ranging from 6 to 13 mm 3. RESULTS AND DISCUSSION (Table 2). None of the isolates was susceptible to the aqueous extract. Bacillus subtilis strain 3.1 Proximate Composition AIMST 2ME1 was not susceptible to both the ethanol and methanol extracts of O. gratissimum . The nutritional and quality of the soup was Adebolu and Oladimeji [8] and Alo et al. [18] assessed through the comparative evaluation of have reported the inability of cold water extract of the proximate composition of the ‘ofe akwu’ O. gratissimum to inhibit the growth of soup. The proximate analysis shows the Staphylococcus aureus, Escherichia coli, chemical composition such as moisture Salmonella typhi, S. typhimurium and Klebsiella (66.40%), ash (1.42%), carbohydrate (2.74%), pneumoniae unlike ethanol and methanol protein (6.50%), lipid (14.39%) and fibre (8.55%). extracts. Matasyoh et al. have reported the The finding of this study is comparable to report activity of the essential oil of O. gratissimum L

Eruteya et al.; MRJI, 19(3): 1-8, 2017 ; Article no. MRJI.32554

Fig. 1. Phylogenic tree of isolated bacteria from 13 population zones in Kenya against Bacillus sp. Contrary to the findings of this research; a number of authors have reported antibacterial activity of ethanol and methanol extract of O. gratissimum against B. subtilis and B. subtilis MTCC 441 [31-33]. Londhe et al. [34] have reported the inability of O. gratissimum to inhibit B. subtilis and B. cereus . There are no reports of antibacterial activity of spices against Sphingobacterium mizutaii in available literatures.

Table 1. Effects of ethanol extract of Plate 1. Inhibition of Bacillus cereus strain CF O. gratissimum on Bacillus species 7 by Ocimum gratissimum No. 1- 5 represents the extract concentrations Extract Average zones of of 250-50 mg/mL respectively concentration inhibition (mm) (mg/mL) B. cereus B. pumilus 3.4 Spoilage of Soup by Individual and a strain CF 7 strain m414 Combination of Bacteria 250 13 12

200 13 11 The challenge of food preservation in developing 150 12 10 countries like Nigeria has made the shelf -life of 100 12 8 soup relatively short. The results of the spoilage 50 11 7 time of a freshly prepared soup by individual and

Eruteya et al.; MRJI, 19(3): 1-8, 2017; Article no.MRJI.32554

Table 2. Effects of methanol extract of O. gratissimm on Bacillus and Sphingobacterium species

Extract Average zones of inhibition (mm) concentration B. cereus strain CF 7 B. pumilus strain Sphingobacterium mizutaii (mg/mL) m414 strain AUMC b-161 250 10 9 13 200 10 7 13 150 9 7 11 100 8 6 10 50 7 5 8 mixed culture of the bacteria isolated is chemical preservatives which consumers now presented in Table 3. All treated soup developed shy away from due to their negative health spoilage signs before the control. It is established effects, thus, the outcome of this current study from this study that the spoilage of the treated portends great natural potential in the samples before the control samples can only be preservation of the soup. attributed to the activities of the bacteria inoculated. The spoilage were first observed with ACKNOWLEDGEMENT B. cereus strain CF 7, Sphingobacterium mizutaii strain AUMC b-161 and the mixed bacteria The Authors are grateful to Prof. Tatfeng of the culture before Bacillus subtilis strain AIMST Niger Delta University, Bayelsa State and the 2ME1 and B. pumilus strain m414. This, in our Staff of the Plant Physiology Laboratory, opinion is the first reported investigation of Department of Plant Science and Biotechnology, spoilage time of these bacteria individually or in University of Port Harcourt. combination. COMPETING INTERESTS Table 3. Spoilage time for individual and mixed culture Authors have declared that no competing interests exist. Bacteria Spoilage time (Hrs) REFERENCES Bacillus subtilis strain AIMST 14¼ 2ME1 1. Kolawole SE Obueh HO. Proximate and B. pumilus strain m414 14¼ micronutrient compositions of some B. cereus strain CF 7 13½ selected foods and diets in South-South Sphingobacterium mizutaii 13½ Nigeria. Scholarly J Biotechnol. 2012;1(3): strain AUMC b-161 45-48. Mixed culture 13½ 2. Adam MR, Moss MO. Food microbiology. Control 15¼ London: The Royal Society of Chemistry, Cambridge University Press; 1999. 4. CONCLUSION 3. Davidson PM, Taylor MT. Chemical preservatives and natural antimicrobial This study which was aimed at determining the compounds. In: Doyle P, Beuchat LR, proximate composition and antibacterial activity Montville TJ, editors. Food Microbiology: of Ocimum gratissimum (a spice used in the Fundamentals and Frontiers. Washington, preparation of ‘ofe akwu’ soup) against bacteria DC: American Society for Microbiology implicated in its spoilage. The result obtained Press; 2007. revealed an acceptable distribution of it nutrients 4. Farkas J. Physical methods of food which makes it an ideal delicacy for human preservation. In: Doyle P, Beuchat LR, nutritional needs, the spoilage bacteria, mostly Montville TJ, editors. Food microbiology: Bacillus species known for their spoilage and Fundamentals and frontiers. Washington, food poisoning activity and the potential of DC: American Society for Microbiology extending the shelf-life of this soup using Press; 2007. O. gratissimum active component. Spices are 5. Lucera A, Costa C, Conte A, Del Nobile natural preservatives, and have advantage over MA. Food applications of natural

Eruteya et al.; MRJI, 19(3): 1-8, 2017; Article no.MRJI.32554

antimicrobial compounds. Frontiers Antimicrobial activity of essential oils of Microbiol. 2012;3(287):1-13. Ocimum gratissimum L. from different 6. Gutierrez J, Barry-Ryan C, Bourke P. The populations of Kenya. Afr J Trad Compl Alt antimicrobial efficacy of plant essential oil Med. 2008;5(2):187-193. combinations and interactions with food 17. Nwinyi OC, Chinedu NS, Ajani OO, Ikpe ingredients. Int J Food Microbiol. 2008; CO, Ogunniran KO. Antibacterial effects of 124(1):91–97. extracts of Ocimum gratissimum and Piper 7. Gutierrez J, Barry-Ryan C, Bourke P. guineense on Escherichia coli and Antimicrobial activity of plant essential oils Staphylococcus aureus . Afr J Food Sci. using food model media: Efficacy, 2009;3(3):77-81. synergistic potential and interaction with 18. Alo MN, Anyim C, Igwe JC, Elom M, food components. Food Microbiol. 2009; Uchenna DS. Antibacterial activity of 26(2):142–150. water, ethanol and methanol extracts of 8. Adebolu TT, Oladimeji SA. Antimicrobial Ocimum gratissimum, Vernonia activity of leaf extracts of Ocimum amygdalina and Aframomum melegueta . gratissimum on selected diarrhoea causing Adv Appl Sci Res. 2012;3(2):844-848. bacteria in southwestern Nigeria. Afr J 19. AOAC. Official methods of analysis. 17th Biotechnol. 2005;4(7):682-684. ed. Washington, DC, USA: Association of 9. Okigbo RN, Ogbonnanya OU. Antifungal Official Analytical Chemists. 2000;2. effects of two tropical plants extracts 20. Saitou N, Nei M. The neighbor-joining Ocimum gratissimum and Afromaomum method: A new method for reconstructing melegueta on post harvest yam Discorea phylogenetic trees. Molecular Biol Evol. spp. rot. Afr J Biotechnol. 2006;5(9):727- 1987;4(4):406-425. 731. 21. Felsenstein J. Confidence limits on 10. Mbakwem-Aniebo C, Onianwa O, Okonko phylogenies: An approach using the IO. Effects of Ocimum gratissimum leaves bootstrap. Evol. 1985;39(4):783-791. on common dermatophytes and causative 22. Jukes TH, Cantor CR. Evolution of protein agent of Pityriasis versicolor in Rivers molecules. In: Munro HN, editor. State, Nigeria. J Microbiol Res. 2012;2(4): Mammalian Protein Metabolism, New 108-113. York: Academic Press; 1969. 11. Effraim ID, Salami HA, Osewa TS. The effect of aqueous leaf extract of Ocimum 23. Akujobi C, Anyanwu BN, Onyeze C, gratissimum on haematological and Ibekwe VI. Antibacterial and preliminary biochemical parameters in rabbits. Afr J phytochemical screening of four medicinal Biomed Res. 2000;3:175-179. plants. J Appl Sci. 2004;7(3):4328–4338. 12. Owulade MO. Handbook African medicinal 24. Jansen E, Ascheloug V. Bacillus as plants. Florida, USA: CRC Press, Boca spoilage organisms in canned foods. J. Raton; 2004. Food Sci. 1951;16(1-6):457-461. 13. Nakamura CV, Ueda-Nakamura T, Bando 25. Hanlin JH. Spoilage of acidic products by E, Melo AFN, Cortez DAG, Filho BPD. Bacillus species. Dairy Foods Environ Antibacterial activity of Ocimum Sanitation. 1998;18(10):655-659. gratissimum L essential oil. Memórias do 26. Setlow P. Germination of spores of Instituto Oswaldo Cruz. 1999;94:675-678. Bacillus species: What we know and what 14. Nguefack J, Budde BB, Jakobsen M. Five we do not know. J Bacteriol. 2014;196(7): essential oils from aromatic plants of 1297-1305. Cameroon: Their antibacterial activity and 27. Rawat S. Food spoilage: Microorganism ability to permeabilize the cytoplasmic and their prevention. Asian J. Plant Sci. membrane of Listeria innocua examined by Res. 2015;5(4):47-56. flow cytometry. Lett Appl Microbiol. 28. Akpomie OO, Akpan I. Multidrug 2004;39(5):395-400. resistance among bacteria isolated from 15. Mbata T, Saikia A. Antibacterial activity some foods sold in restaurants in Abraka, and phytochemical screening of crude Nigeria. Int J Microbiol Res Rev. 2013; ethanolic extract of leaves of Ocimum 2(6):97-102. gratissimum L on Listeria monocytogenes . 29. Sanni AI, Ayemo GS, Sakyi-Dawson E, The Internet J Microbiol. 2007;4. Sefa-Dedeh S. Aerobic spore-forming 16. Matasyoh LG, Matasyoh JC, Wachira FN, bacteria and chemical composition of Kinyua MG, Muigai AWT, Mukiama TK. some Nigeria fermented soup condiments.

Eruteya et al.; MRJI, 19(3): 1-8, 2017; Article no.MRJI.32554

Plant Foods Human Nutr. 2000;55(2):111- against pathogenic bacteria. Czech J Food 118. Sci. 2013;31(2):194-202. 30. Enujiugha VA. Major fermentative 33. Mishra RP, Javed I. In vitro activity of organisms in some Nigerian soup medicinal plants against some bacterial condiments. Pakistan J Nutr. 2009; and fungal isolates. Asian J Pharm. Clin 8(3):279-283. Res. 2015;8(1):225-230. 31. Mabekoje OO, Bello OO, Egberongbe HO. 34. Londhe AM, Kulkarni AS, Lawand RV. In- Antimicrobial efficacy of Ocimum vitro comparative study of antibacterial and gratissimum and Vernonia amygdalina on antifungal activities: A case study of gastrointestinal bacteria. Canadian J Pure Ocimum kilimandscharicum , Ocimum Appl Sci. 2013;7(2):2341-2345. tenuiflorum and Ocimum gratissimum . Int. 32. Saha S, Dhar TN, Sengupta C, Ghosh P. J. Pharmacog. Phytochem. Res. 2015; Biological activities of essential oils and 7(1):104-110. methanol extracts of five Ocimum species ______© 2017 Eruteya et al.; This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Peer-review history: The peer review history for this paper can be accessed here: http://sciencedomain.org/review-history/18590