DOCSLIB.ORG

Characterization of a Thyroid Hormone Receptor Expressed in Human Kidney and Other Tissues AKIRA NAKAI, SUSUMU SEINO, AKIHIRO SAKURAI, ILLYA SZILAK, GRAEME I

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Characterization of a Thyroid Hormone Receptor Expressed in Human Kidney and Other Tissues AKIRA NAKAI, SUSUMU SEINO, AKIHIRO SAKURAI, ILLYA SZILAK, GRAEME I Proc. Nail. Acad. Sci. USA Vol. 85, pp. 2781-2785, April 1988 Medical Sciences Characterization of a thyroid hormone receptor expressed in human kidney and other tissues AKIRA NAKAI, SUSUMU SEINO, AKIHIRO SAKURAI, ILLYA SZILAK, GRAEME I. BELL, AND LESLIE J. DEGROOT* Thyroid Study Unit, Department of Medicine, Howard Hughes Medical Institute, and Department of Biochemistry and Molecular Biology, The University of Chicago, Chicago, IL 60637 Communicated by Donald F. Steiner, December 18, 1987 ABSTRACT A cDNA encoding a specific form of thyroid brary, which, although clearly related to the thyroid hormone hormone receptor expressed in human liver, kidney, placenta, receptor type a that has been described by others, is a distinct and brain was isolated from a human kidney library. Identical molecule.t In addition, we have demonstrated that the protein clones were found in human placenta and HepG2 cDNA encoded by this cDNA corresponds to a high-affinity triiodo- libraries. The cDNA encodes a 490-amino acid protein (Mr, thyronine (T3) receptor and that its mRNA is expressed in 54,824). When expressed and translated in vitro, the protein several human tissues. product binds triiodothyronine with Ka of 2.3 X 109 M-1. This protein, designated human thyroid hormone receptor type a2 (hTRa2), has the same domain structure as other MATERIALS AND METHODS members of the v-erbA-related superfamily of receptor genes. It is similar to thyroid hormone receptor type a described in cDNA Cloning and Sequencing. Human adult kidney and chicken and rat and less similar to human thyroid hormone hepatoblastoma (HepG2) cDNA libraries in AgtlO were receptor type (3 (formerly referred to as c-erbA.8) from prepared as described (14). A human placenta cDNA library placenta. However, it is distinguished from these receptors by in Agtll was kindly provided by Mark R. Hughes (Baylor an extension of the C-terminal hormone binding domain College of Medicine). Phage encoding thyroid hormone making it 80 amino acids longer than rat thyroid hormone receptor-like sequences were identified by cross-hybridiza- receptor type al [Thompson, C. C., Weinberger, C., Lebo, tion with a 32P-labeled human c-erbA cDNA clone isolated R. & Evans, R. M. (1987) Science 237, 1610-1614]. Different his col- sizes of mRNA found in liver (2.5 kilobases) and kidney (2 from a K562 cDNA library by Carlo Croce and kilobases) suggest there may be tissue-specific processing of leagues (Wistar Institute, Philadelphia, PA) (13). Hybridiz- the primary transcript of this gene. Identification of human ing clones were plaque-purified, and their EcoRI inserts thyroid hormone receptor type a2 indicates that two or more were sequenced by using the Sanger dideoxy chain-termina- forms of thyroid hormone receptor exist in human tissues and tion procedure (15). Synthetic oligonucleotide primers were may explain the normal variation in thyroid hormone respon- used for sequencing some portions of the cDNA. siveness of various organs and the selective tissue abnormali- RNA Isolation and Blotting. RNA was isolated from human ties found in the thyroid hormone resistance syndromes. tissues obtained at surgery, with permission of the Commit- tee on Human Investigation, by using the guanidinium Thyroid hormone is believed to regulate gene expression thiocyanate procedure (16). Poly(A) + RNA was prepared by through binding of a hormone-receptor complex to the oligo(dT) chromatography. Poly(A)+ RNA was denatured promoter region of target genes (1-4). The receptor, which is with glyoxal and, after electrophoresis through a 1.0% located in the nucleus of responsive cells, is of similar size in agarose gel, transferred to a nylon membrane (GeneScreen- all the tissues that have been examined and may exist in two Plus, DuPont). The membranes were hybridized with a forms of -47 and 56 kDa (5-7). However, the low abun- nick-translated insert from Akel2 (see below) in a solution of dance of the thyroid hormone receptor has hampered its 50% (vol/vol) formamide, 5 x SSC, 1 x Denhardt's solution, isolation and characterization from various tissues by con- sonicated and denatured salmon testes DNA at 100 ,ug/ml, ventional biochemical procedures (7), and it is unknown if a 0.1% NaDodSO4, and 10% (wt/vol) dextran sulfate at 42°C single protein mediates the actions of thyroid hormone or if for 14-24 hr. (1 x SSC = 0.15 M NaCl/0.015 M sodium there are a family of receptors. Clinical studies of thyroid- citrate, pH 7.0, and 1 x Denhardt's solution = 0.02% hormone-resistant subjects have indicated apparent differ- polyvinylpyrrolidone/0.02% Ficoll/0.02% bovine serum ences in hormone responsiveness in various tissues, suggest- albumin.) Membranes were washed in 0.1 x SSC/0.1% ing that there is a family of proteins that can function as NaDodSO4 at 60°C before autoradiography. thyroid hormone receptors (8). The demonstrations that the In Vito Expression of the Cloned Thyroid Hormone Recep- thyroid hormone receptor was the protooncogene of v-erbA tor. The insert in the kidney cDNA clone Ake7 was isolated (9-12) and that there indeed appears to be a family ofthyroid by partial EcoRI digestion and cloned into the EcoRI site of hormone receptors prompted us to isolate and characterize pGEM4Z (Promega Biotec, Madison, WI). This plasmid, cDNA clones that cross-hybridized with a c-erbA probe pke711, was linearized with HindIII and used as a template isolated from a human leukemia cell line (13) and was for SP6 polymerase-catalyzed synthesis of RNA (17). mapped to human chromosome 17, for sequences that might represent forms of the thyroid hormone receptor. In this Abbreviation: T3, triiodothyronine. report, we describe the isolation and sequence of a distinct *To whom reprint requests should be addressed at: The University thyroid hormone receptor from a human kidney cDNA li- of Chicago, Thyroid Study Unit-Box 138, 5841 South Maryland Avenue, Chicago, IL 60637. tThe sequence reported in this paper is being deposited in the The publication costs of this article were defrayed in part by page charge EMBL/GenBank data base (Bolt, Beranek, and Newman Labora- payment. This article must therefore be hereby marked "advertisement" tories, Cambridge, MA, and Eur. Mol. Biol. Lab., Heidelberg) in accordance with 18 U.S.C. §1734 solely to indicate this fact. (accession no. J03239). 2781 Downloaded by guest on September 30, 2021 2782 Medical Sciences: Nakai et al. Proc. Natl. Acad. Sci. USA 85 (1988) H H c H H 1 - O. , =n 0 0 u 51 a.ox am WU) cl) t 3' ATG I II I I ITGAI Xkel2 .. I -AAAAn Xke7 I AAAAn Xke6 I Xpe43 Ahe2 i lQObp FIG. 1. Restriction map and schematic representation of human thyroid hormone receptor a2 cDNA clones. Common restriction endonuclease cleavage sites are indicated above the linear map. The Akel2, Ake7, and Ake6 clones were isolated from a human kidney library; the Ape43 clone was from a human placenta library; and the Ahe2 was from a HepG2 library. Capped RNA was translated in a micrococcal nuclease- cDNA libraries (Fig. 1). The sequences of the inserts from treated rabbit reticulocyte lysate (Promega Biotec). The each of these indicated that they were identical in overlap- translated proteins were denatured and reduced, and their ping areas and encoded various portions ofthe same mRNA. sizes were determined by electrophoresis in a 10% NaDod- Two clones, Ake7 and -12, contained a long opening reading S04/polyacrylamide gel. The thyroid hormone binding ac- frame of 1470 base pairs (bp) preceded by a short 5'-un- tivity of the translated proteins was assayed at 0°C as translated region and an inframe stop codon just before the described (7, 18). Briefly, 7 ul of lysate (from a total of 210 beginning ofthe long open reading frame. The insert in Akel2 ,ul) was incubated in 0.3 ml of KMPD (0.3 M KCI/1 mM is 2015 bp exclusive of the poly(A) tract (Fig. 2). The larger MgCl2/10 mM potassium phosphate, pH 7.85/1 mM dithio- 5' EcoRI fragment, from the insert in Akel2 spanning the threitol) and 6 pg of [1251]T3 (DuPont) for 2 hr. Bound and region from the 5' EcoRI linker to the internal EcoRI site, free T3 were separated with Dowex resin, and 30 ,l ofboiled hybridizes to a prominent adult kidney transcript of =z2 rat liver nuclear extract was added to reduce nonspecific kilobases (kb), and thus it is likely that this cDNA sequence binding of thyroid hormone receptor to resin (7). represents most of the mRNA (Fig. 3). The open reading frame encodes a protein of 490 amino acids and a molecular weight of 54,824 (Fig. 2). Comparison of this sequence, with RESULTS those of other thyroid hormone receptors, indicates 89% Isolation and Characterization of cDNA Clones Encoding DNA similarity and 99o amino acid similarity in the region the Thyroid Hormone Receptor. Phage hybridizing to the coding residues 1-370 of the receptor derived from rat brain human c-erbA clone isolated by Dayton and coworkers (13) designated rat thyroid hormone receptor type al (Figs. 4 and were isolated from human kidney, placenta, and HepG2 5); however, interestingly, the C-terminal regions of the two 1 GTGGCCCACCCCAGTCTCTTGGCGTGCTGGAGGGCATCCTGGhMGAATTGAAGTGA 838 CTGCGGGCGGCTGTCCGCTACGACCCTGAGAGCGACACCCTGACGCTGAGTGGGGAGATG 1 281 MetGl uGlnLysProSerLysValGl uCysGlySerAspProGluGluAsnSerAlaArg AlaValLysArgGluGlnLeuLysAsnGlyGlyLeuGlyValValSerAspAlaIlePhe 58 ATGGAACAGAAGCCAAGCAAGGTGGAGTGTGGGTCAGACCCAGAGGAGAACAGTGCCAGG 898 GCTGTCAAGCGGGAGCAGCTCAAGAATGGCGGCCTGGGCGTAGTCTCCGACGCCATCTTT 21 301 Se rProAspGlyLysArgLysArgLysAsnGlyGlnCysSerLeuLysTh rSerMetSer GluLeuGlyLysSerLeuSerAlaPheAsnLeuAspAspThrGluValAlaLeuLeuGln
Load more

Recommended publications
  • The Role of Signal Transducer and Activator of Transcription 5 in the Inhibitory Effects of GH on Adipocyte Differentiation
    139 The role of signal transducer and activator of transcription 5 in the inhibitory effects of GH on adipocyte differentiation H E Richter1, T Albrektsen2 and N Billestrup1,3 1Department of Signal Transduction, Novo Nordisk A/S, Novo Allé, DK-2880 Bagsvaerd, Denmark 2Department of Transcription Biology, Novo Nordisk A/S, Novo Allé, DK-2880 Bagsvaerd, Denmark 3Steno Diabetes Centre, Niels Steensensvej 6, DK-2820 Gentofte, Denmark (Requests for offprints should be addressed to N Billestrup, Steno Diabetes Centre, Niels Steensensvej 6, NSK2·023, DK-2820 Gentofte, Denmark; Email:[email protected]) Abstract GH inhibits primary rat preadipocyte differentiation and expression of late genes required for terminal differentiation. Here we show that GH-mediated inhibition of fatty acid-binding protein aP2 gene expression correlates with the activation of the Janus kinase-2/signal transducer and activator of transcription (STAT)-5 signalling pathway. Within minutes of treatment, GH induced the tyrosine phosphorylation, nuclear localization and DNA binding of STAT5. Importantly, there was no evidence that STAT5 acted via an interaction with peroxisome proliferator-activated receptor γ. To further understand the mechanism of STAT5 action, we reconstituted the inhibition of aP2 in a non-adipogenic cell line. Using this system, we showed that the ability of GH to inhibit a 520 bp aP2 reporter was largely dependent upon the presence of either STAT5A or STAT5B. Mutant analysis confirmed that the tyrosine phosphorylation of STAT5 was essential for this signalling. However, STAT5’s C-terminal transactivation domain was fully dispensable for this inhibition. Taken together, these data confirm a key regulatory role of STAT5 in adipose tissue and point to STAT5 as the repressing modulator of GH-mediated inhibition in primary preadipocytes.
    [Show full text]
  • Nuclear Hormone Receptor Antagonism with AP-1 by Inhibition of the JNK Pathway
    Downloaded from genesdev.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press Nuclear hormone receptor antagonism with AP-1 by inhibition of the JNK pathway Carme Caelles,1 Jose´M. Gonza´lez-Sancho, and Alberto Mun˜oz2 Instituto de Investigaciones Biome´dicas, Consejo Superior de Investigaciones Cientı´ficas, E-28029 Madrid, Spain The activity of c-Jun, the major component of the transcription factor AP-1, is potentiated by amino-terminal phosphorylation on serines 63 and 73 (Ser-63/73). This phosphorylation is mediated by the Jun amino-terminal kinase (JNK) and required to recruit the transcriptional coactivator CREB-binding protein (CBP). AP-1 function is antagonized by activated members of the steroid/thyroid hormone receptor superfamily. Recently, a competition for CBP has been proposed as a mechanism for this antagonism. Here we present evidence that hormone-activated nuclear receptors prevent c-Jun phosphorylation on Ser-63/73 and, consequently, AP-1 activation, by blocking the induction of the JNK signaling cascade. Consistently, nuclear receptors also antagonize other JNK-activated transcription factors such as Elk-1 and ATF-2. Interference with the JNK signaling pathway represents a novel mechanism by which nuclear hormone receptors antagonize AP-1. This mechanism is based on the blockade of the AP-1 activation step, which is a requisite to interact with CBP. In addition to acting directly on gene transcription, regulation of the JNK cascade activity constitutes an alternative mode whereby steroids and retinoids may control cell fate and conduct their pharmacological actions as immunosupressive, anti-inflammatory, and antineoplastic agents.
    [Show full text]
  • The Histone Acetylase PCAF Is a Nuclear Receptor Coactivator
    Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press The histone acetylase PCAF is a nuclear receptor coactivator Jorge C.G. Blanco,1,4 Saverio Minucci,1 Jianming Lu,1 Xiang-Jiao Yang,1 Kristen K. Walker,3 Hongwu Chen,3 Ronald M. Evans,2,3 Yoshihiro Nakatani,1 and Keiko Ozato1,5 1Laboratory of Molecular Growth Regulation, National Institute of Child Health and Human Development, National Institutes of Health (NIH), Bethesda, Maryland 20892-2753 USA; 2Howard Hughes Medical Institute; 3The Salk Institute for Biological Studies, La Jolla, California 92037 USA Whereas the histone acetylase PCAF has been suggested to be part of a coactivator complex mediating transcriptional activation by the nuclear hormone receptors, the physical and functional interactions between nuclear receptors and PCAF have remained unclear. Our efforts to clarify these relationships have revealed two novel properties of nuclear receptors. First, we demonstrate that the RXR/RAR heterodimer directly recruits PCAF from mammalian cell extracts in a ligand-dependent manner and that increased expression of PCAF leads to enhanced retinoid-responsive transcription. Second, we demonstrate that, in vitro, PCAF directly associates with the DNA-binding domain of nuclear receptors, independently of p300/CBP binding, therefore defining a novel cofactor interaction surface. Furthermore, our results show that dissociation of corepressors enables ligand-dependent PCAF binding to the receptors. This observation illuminates how a ligand-dependent receptor function can be propagated to regions outside the ligand-binding domain itself. On the basis of these observations, we suggest that PCAF may play a more central role in nuclear receptor function than previously anticipated.
    [Show full text]
  • Mutant Thyroid Hormone Receptor Represses the Expression And
    [CANCER RESEARCH 63, 5274–5280, September 1, 2003] Mutant Thyroid Hormone Receptor ␤ Represses the Expression and Transcriptional Activity of Peroxisome Proliferator-activated Receptor ␥ during Thyroid Carcinogenesis Hao Ying, Hideyo Suzuki, Li Zhao, Mark C. Willingham, Paul Meltzer, and Sheue-Yann Cheng1 Laboratory of Molecular Biology, Center for Cancer Research, National Cancer Institute, Bethesda, Maryland 20892-4264 [H. Y., H. S., L. Z., S-Y. C.]; National Human Genome Research Institute, NIH, Bethesda, Maryland 20892-4264 [P. M.]; and Department of Pathology, Wake Forest University School of Medicine, Winston-Salem, North Carolina 27157-1072 [M. C. W.] ABSTRACT not in 10 papillary carcinomas. This unique genetic rearrangement in follicular carcinoma was further confirmed by subsequent analyses The molecular genetics underlying thyroid carcinogenesis is not clear. using a larger number of samples (8). When fused to PAX8, PPAR␥1 Recent identification of a PAX8-peroxisome proliferator-activated receptor ␥ ␥ not only loses its capability to stimulate thiazolidinedione-induced (PPAR ) fusion gene in human thyroid follicular carcinoma suggests a ␥ tumor suppressor role of PPAR␥ in thyroid carcinogenesis. Mice harbor- transcription but also acts to inhibit PPAR 1 transcriptional activity ␥ ing a knockin mutant thyroid hormone ␤ receptor (TR␤PV) spontaneously (7). However, how the loss of PPAR 1 transcriptional activity im- develop thyroid follicular carcinoma through pathological progression of pacts the normal functions of thyroid follicular cells is unclear. hyperplasia, capsular invasion, vascular invasion, anaplasia, and eventu- We have recently created a mutant mouse by targeting a mutation ally, distant organ metastasis. This mutant mouse (TR␤PV/PV mouse) (PV)totheTR␤ gene locus (TR␤PV mice; Ref.
    [Show full text]
  • Mutation of Thyroid Hormone Receptor-&Beta
    Oncogene (2011) 30, 3381–3390 & 2011 Macmillan Publishers Limited All rights reserved 0950-9232/11 www.nature.com/onc ORIGINAL ARTICLE Mutation of thyroid hormone receptor-b in mice predisposes to the development of mammary tumors CJ Guigon1, DW Kim1, MC Willingham2 and S-y Cheng1 1Laboratory of Molecular Biology, Center for Cancer Research, National Cancer Institute, Bethesda, MD, USA and 2Department of Pathology, Wake Forest University, Winston-Salem, NC, USA Correlative data suggest that thyroid hormone receptor-b Introduction (TRb) mutations could increase the risk of mammary tumor development, but unequivocal evidence is still Thyroid hormone receptors (TRs) belong to the lacking. To explore the role of TRb mutants in vivo in superfamily of nuclear receptors that are ligand- breast tumor development and progression, we took dependent transcription factors. Two TR genes, THRA advantage of a knock-in mouse model harboring a and THRB, located on chromosomes 17 and 3, respec- mutation in the Thrb gene encoding TRb (ThrbPV mouse). tively, encode four thyroid hormone (T3)-binding Although in adult nulliparous females, a single ThrbPV receptors: TRa1, TRb1, TRb2 and TRb3. They bind allele did not contribute to mammary gland abnormalities, T3 that has critical roles in differentiation, growth and the presence of two ThrbPV alleles led to mammary metabolism (Yen, 2001). hyperplasia in B36% ThrbPV/PV mice. The ThrbPV Several findings support the notion that mutations of mutation further markedly augmented the risk of TRs can be associated with cancer. Early evidence mammary hyperplasia in a mouse model with high suggested that mutated TRs could be involved in susceptibility to mammary tumors (Pten þ /À mouse), as carcinogenesis came from the discovery that v-erbA, a demonstrated by the occurrence of mammary hyperplasia highly mutated chicken THRA1 that has lost the ability in B60% of ThrbPV/ þ Pten þ /À and B77% of ThrbPV/PV to activate gene transcription, leads to neoplastic trans- Pten þ /À mice versus B33% of Thrb þ / þ Pten þ /À mice.
    [Show full text]
  • Thyroid Hormones and Their Receptors in the Regulation of Cell Proliferation
    Vol. 53 No. 4/2006, 641–650 on-line at: www.actabp.pl Review Thyroid hormones and their receptors in the regulation of cell proliferation Monika Puzianowska-Kuznicka1,2*, Maciej Pietrzak1, Olga Turowska2 and Alicja Nauman2 1Department of Endocrinology, Medical Research Center, Polish Academy of Sciences, Warszawa, Poland; 2De- partment of Biochemistry and Molecular Biology, Medical Center of Postgraduate Education, Warszawa, Poland; *e-mail: [email protected] Received: 25 October, 2006; revised: 07 November, 2006; accepted: 08 November, 2006 available on-line: 19 November, 2006 In the present work, we have reviewed data showing that triiodothyronine and its nuclear recep- tors modify expression of different genes/proteins involved in cell cycle control beginning from growth factors (such as EGF and TGF-β), to cell surface receptors (EGFR), as well as proteins act- ing at the cell membrane (Ras), various transcription factors (c-Fos, c-Myc, E2F1), cyclins, Cip/Kip family of cdk2 inhibitors, and p53 inhibitor Mdm2 (Table 1). We have shown how TRs are also able to modify the fate of a cell, thanks to their ability to form complexes with other transcrip- tion factors such as p53 — a key regulator of apoptosis and proliferation. Available data show that the function of thyroid hormones and of their receptors on cell proliferation is not homog- enous. In fact, it strongly depends on the cell type, its developmental state (progenitor or dif- ferentiated), its patho-physiological state (normal or tumor cell), and the so-called ‘cellular con- text’. Therefore, it is not possible to uniformly recommend T3 treatment or T3 depletion to stop or initiate proliferation of all cell types.
    [Show full text]
  • Retinoid X Receptor Is Necessary to Establish the S-Opsin Gradient In
    Retinoid X Receptor ␥ Is Necessary to Establish the S-opsin Gradient in Cone Photoreceptors of the Developing Mouse Retina Melanie R. Roberts,1,2 Anita Hendrickson,2 Christopher R. McGuire,2 and Thomas A. Reh2 PURPOSE. The retinoid X receptors (RXRs) are members of the tion, they also have demonstrated some isoform-specific family of ligand-dependent nuclear hormone receptors. One of functions. For example, RXR␣ heterodimerizes with retinoic these genes, RXR␥, is expressed in highly restricted regions of acid receptors (RARs) to regulate retinal growth and cardiac the developing central nervous system (CNS), including the development.4 retina. Although previous studies have localized RXR␥ to de- Although all three isoforms are expressed in the developing veloping cone photoreceptors in several species, its function nervous system, RXR␥ has the most restricted and develop- in these cells is unknown. A prior study showed that thyroid mentally regulated expression. It is expressed in the develop- hormone receptor ␤2 (TR␤2) is necessary to establish proper ing striatum, part of the tegmentum, the pituitary, the ventral cone patterning in mice by activating medium-wavelength (M) horns of the spinal cord,3,5 and the retina.6 RXR␥-null mice cone opsin and suppressing short-wavelength (S) cone opsin. show isoform-specific defects in both striatal and hippocampal Thyroid hormone receptors often regulate gene transcription function, although RXR␤ can partially compensate for the loss as heterodimeric complexes with RXRs. of RXR␥ in the striatum.2,7,8 RXR␥ has also been identified in 6,9,10 METHODS. To determine whether RXR␥ cooperates with TR␤2 the developing retina of Xenopus, chicks, and mice.
    [Show full text]
  • Non-Canonical Dimerization of the Androgen Receptor and Other Nuclear Receptors: Implications for Human Disease
    26 8 Endocrine-Related A Jiménez-Panizo et al. Androgen receptor 26:8 R479–R497 Cancer dimerization in disease REVIEW Non-canonical dimerization of the androgen receptor and other nuclear receptors: implications for human disease Alba Jiménez-Panizo1, Paloma Pérez2, Ana M Rojas3, Pablo Fuentes-Prior4 and Eva Estébanez-Perpiñá1 1Department of Biochemistry and Molecular Biomedicine, Institute of Biomedicine (IBUB) of the University of Barcelona (UB), Barcelona, Spain 2Instituto de Biomedicina de Valencia (IBV)-CSIC, Valencia, Spain 3Computational Biology and Bioinformatics Group, Andalusian Center for Developmental Biology (CABD-CSIC), Sevilla, Spain 4Molecular Bases of Disease, Biomedical Research Institute Sant Pau (IIB Sant Pau), Barcelona, Spain Correspondence should be addressed to P Fuentes-Prior or E Estébanez-Perpiñá: [email protected] or [email protected] Abstract Nuclear receptors are transcription factors that play critical roles in development, Key Words homeostasis and metabolism in all multicellular organisms. An important family of f androgen receptor nuclear receptors comprises those members that respond to steroid hormones, and f glucocorticoid receptor which is subdivided in turn into estrogen receptor (ER) isoforms α and β (NR3A1 and f protein structure A2, respectively), and a second subfamily of so-called oxosteroid receptors. The latter f ligand-binding domain includes the androgen receptor (AR/NR3C4), the glucocorticoid receptor (GR/NR3C1), f multimerization the mineralocorticoid receptor (MR/NR3C2) and the progesterone receptor (PR/NR3C3). f prostate cancer Here we review recent advances in our understanding of the structure-and-function f androgen insensitivity relationship of steroid nuclear receptors and discuss their implications for the etiology syndromes (AIS) of human diseases.
    [Show full text]
  • Thyroid Hormone Regulated Genes in Cerebral Cortex Development
    232 2 J BERNAL Thyroid hormones and cortex 232:2 R83–R97 Review development Thyroid hormone regulated genes in cerebral cortex development Juan Bernal Correspondence Instituto de Investigaciones Biomédicas, Consejo Superior de Investigaciones Científicas y Universidad should be addressed Autónoma de Madrid, and Center for Biomedical Research on Rare Diseases, Instituto de Salud Carlos to J Bernal III, Madrid, Spain Email [email protected] Abstract The physiological and developmental effects of thyroid hormones are mainly due to Key Words the control of gene expression after interaction of T3 with the nuclear receptors. To f brain understand the role of thyroid hormones on cerebral cortex development, knowledge f development of the genes regulated by T3 during specific stages of development is required. In our f fetus laboratory, we previously identified genes regulated by 3T in primary cerebrocortical f gene expression cells in culture. By comparing these data with transcriptomics of purified cell types from f thyroid hormone the developing cortex, the cellular targets of T3 can be identified. In addition, many of metabolism the genes regulated transcriptionally by T3 have defined roles in cortex development, from which the role of T3 can be derived. This review analyzes the specific roles of Endocrinology T -regulated genes in the different stages of cortex development within the of 3 physiological frame of the developmental changes of thyroid hormones and receptor concentrations in the human cerebral cortex during fetal development. These data Journal indicate an increase in the sensitivity to T3 during the second trimester of fetal development. The main cellular targets of T3 appear to be the Cajal-Retzius and the subplate neurons.
    [Show full text]
  • Retinoid X Receptors: X-Ploring Their (Patho)Physiological Functions
    Cell Death and Differentiation (2004) 11, S126–S143 & 2004 Nature Publishing Group All rights reserved 1350-9047/04 $30.00 www.nature.com/cdd Review Retinoid X receptors: X-ploring their (patho)physiological functions A Szanto1, V Narkar2, Q Shen2, IP Uray2, PJA Davies2 and aspects of metabolism. The discovery of retinoid receptors L Nagy*,1 substantially contributed to understanding how these small, lipophilic molecules, most importantly retinoic acid (RA), exert 1 Department of Biochemistry and Molecular Biology, Research Center for their pleiotropic effects.1,2 Retinoid receptors belong to the Molecular Medicine, University of Debrecen, Medical and Health Science family of nuclear hormone receptors, which includes steroid Center, Nagyerdei krt. 98, Debrecen H-4012, Hungary 2 hormone, thyroid hormone and vitamin D receptors, various Department of Integrative Biology and Pharmacology, The University of Texas- orphan receptors and also receptors activated by intermediary Houston Medical School, Houston, TX, USA * Corresponding author: L Nagy, Department of Biochemistry and Molecular metabolites: for example, peroxisome proliferator-activated Biology, University of Debrecen, Medical and Health Science Center, receptor (PPAR) by fatty acids, liver X receptor (LXR) by Nagyerdei krt. 98, Debrecen H-4012, Hungary. Tel: þ 36-52-416432; cholesterol metabolites, farnesoid X receptor (FXR) by bile Fax: þ 36-52-314989; E-mail: [email protected] acids and pregnane X receptor (PXR) by xenobiotics.3,4 Members of this family function as ligand-activated
    [Show full text]
  • Thyroid Hormone Receptor SS
    University of Vermont ScholarWorks @ UVM Graduate College Dissertations and Theses Dissertations and Theses 2017 Thyroid Hormone Receptor SS (trß) Regulation Of Runt-Related Transcription Factor 2 (runx2) In Thyroid Tumorigenesis: Determination Of The Trß Nuclear Protein Complexes That Associate With The Runx2 Gene. Thomas Howland Taber University of Vermont Follow this and additional works at: https://scholarworks.uvm.edu/graddis Part of the Cell Biology Commons, and the Oncology Commons Recommended Citation Taber, Thomas Howland, "Thyroid Hormone Receptor SS (trß) Regulation Of Runt-Related Transcription Factor 2 (runx2) In Thyroid Tumorigenesis: Determination Of The rT ß Nuclear Protein Complexes That Associate With The Runx2 Gene." (2017). Graduate College Dissertations and Theses. 820. https://scholarworks.uvm.edu/graddis/820 This Thesis is brought to you for free and open access by the Dissertations and Theses at ScholarWorks @ UVM. It has been accepted for inclusion in Graduate College Dissertations and Theses by an authorized administrator of ScholarWorks @ UVM. For more information, please contact [email protected]. THYROID HORMONE RECEPTOR ß (TRß) REGULATION OF RUNT-RELATED TRANSCRIPTION FACTOR 2 (RUNX2) IN THYROID TUMORIGENESIS: DETERMINATION OF THE TRß NUCLEAR PROTEIN COMPLEXES THAT ASSOCIATE WITH THE RUNX2 GENE. A Thesis Presented by Thomas Howland Taber to The Faculty of the Graduate College of The University of Vermont In Partial Fulfillment of the Requirements for the Degree of Master of Science Specializing in Pharmacology October, 2017 Defense Date: August 15th, 2017 Thesis Examination Committee: Frances E. Carr, Ph.D., Advisor Jeanne Harris, Ph.D., Chairperson George Wellman, Ph.D. Karen M. Lounsbury, Ph.D. Cynthia J.
    [Show full text]
  • Estrogen-Like E€Ects of Thyroid Hormone on the Regulation of Tumor
    Oncogene (2002) 21, 761 ± 768 ã 2002 Nature Publishing Group All rights reserved 0950 ± 9232/02 $25.00 www.nature.com/onc Estrogen-like eects of thyroid hormone on the regulation of tumor suppressor proteins, p53 and retinoblastoma, in breast cancer cells Sumi Dinda1, Amelita Sanchez1 and Virinder Moudgil*,1 1Department of Biological Sciences and Center for Biomedical Research, Oakland University, Rochester, Michigan, MI 48309, USA T47D cells represent an estrogen-responsive human Keywords: Estrogen; thyroid hormone; p53; retinoblas- ductal carcinoma cell line which expresses detectable toma protein; tumor suppressor proteins; breast cancer levels of estrogen receptor (ER). We have previously shown that estradiol (E2) treatment of T47D cells causes an increase in the level of p53 and a concomitant Introduction phosphorylation of retinoblastoma protein (pRb). In the present study, we have analysed the expression of p53 Dierent hormones in¯uence the development, growth and phosphorylation state of pRb and compared the and dierentiation of human breast tissue. The two eects of E2 and triiodothyronine (T3) on these steroid hormones, E2 and progesterone, impact phenomena. Cells were grown in a medium containing cellular functioning of the normal breast cells and charcoal-treated serum to deplete the levels of endogen- may continue to be active in its malignant state. It has ous steroids. Upon con¯uency, the cells were treated with been well established that nearly 30% of breast 712 77 T3 (10 to 10 M) for 24 h and the presence of p53 cancers are hormone-dependent and respond well to and pRb was detected by Western analysis. E2 treatment endocrine therapy (Clarke and Sutherland, 1990; of cells caused a 2 ± 3-fold increase in the level of p53.
    [Show full text]