View metadata, citation and similar papers at core.ac.uk brought to you by CORE
provided by Elsevier - Publisher Connector
Virology 319 (2004) 94–106 www.elsevier.com/locate/yviro
Avian reovirus nonstructural protein ANS forms viroplasm-like inclusions and recruits protein jNS to these structures
Fernando Touris-Otero,a Jose´ Martı´nez-Costas,a Vikram N. Vakharia,b and Javier Benaventea,*
a Departamento de Bioquı´mica y Biologı´a Molecular, Facultad de Farmacia, Universidad de Santiago de Compostela, 15782 Santiago de Compostela, Spain b Center for Biosystems Research, University of Maryland Biotechnology Institute and VA-MD Regional College of Veterinary Medicine, University of Maryland, College Park, MD 20742, USA
Received 23 September 2003; returned to author for revision 24 October 2003; accepted 28 October 2003
Abstract
The M3 genome segment of avian reovirus 1733, which encodes the nonstructural protein ANS, is 1996 nucleotides long and contains a long open reading frame that is predicted to encode a polypeptide of 635 amino acid residues. Examination of the deduced amino acid sequence of ANS revealed the presence of two regions near its carboxyl terminus with a high probability of forming a-helical coiled coils. Expression of the M3 gene in both infected and transfected cells revealed that this gene specifies two protein isoforms that are recognized by a ANS-specific antiserum. Only the larger ANS isoform, but not the smaller one, interacts with the nonstructural protein jNS in infected cells, suggesting that the two isoforms play different roles during avian reovirus infection. In the second part of this study, we show that ANS and the nonstructural protein jNS colocalize throughout the viral life cycle in large and small phase-dense globular cytoplasmic inclusions, which are believed to be the sites of viral replication and assembly. Individual expression of these proteins in transfected cells of avian and mammalian origin revealed that while ANS is able to form inclusions in the absence of other viral proteins, jNS distributes diffusely throughout the cytoplasm in the absence of ANS. These data suggest that ANS is the minimal viral factor required for inclusion formation during avian reovirus infection. On the other hand, our findings that jNS associates with ANS in infected cells, and that jNS colocalizes with ANS in viroplasm-like inclusions when the two proteins are coexpressed in transfected cells, suggest that ANS mediates the association of jNS to inclusions in avian reovirus-infected cells. D 2003 Elsevier Inc. All rights reserved.
Keywords: Avian reovirus; Transfected cells; Nonstructural protein
Introduction rus are divided into three size classes, designated L (large), M (medium), and S (small) from their electrophoretic Avian reoviruses belong to the genus Orthoreovirus, one mobility (Gouvea and Schnitzer, 1982; Spandidos and of the 10 genera of the Reoviridae family (Attoui et al., Graham, 1976; Varela and Benavente, 1994).Reoviral 2000; Robertson and Wilcox, 1986). These viruses are the genome segments are transcribed by a virion-associated causal agent of viral arthritis syndrome and transient diges- RNA polymerase to produce messenger RNAs (mRNAs) tive system disorder in young chickens, respectively, char- with a nucleotide sequence identical to the positive strand of acterized by lesions in the gastrocnemius tendons and the dsRNA segments (Banerjee and Shatkin, 1970; Li et al., stunted growth (Rosenberger et al., 1989). Avian reoviruses 1980). Viral mRNAs exert a dual function in the infected lack a lipid envelope, replicate in the cytoplasm of infected cell: they program viral protein synthesis on ribosomes, and cells, and have a genome comprising 10 segments of serve as templates for synthesis of dsRNA minus-strands. double-stranded RNA (dsRNA) encased by a double con- The avian reovirus genome has been shown to encode at centric capsid shell of 70–80 nm in diameter (Spandidos least 12 primary translation products, of which 8 are struc- and Graham, 1976). The genomic segments of avian reovi- tural components of the viral particle and 4 of which are nonstructural (NS) proteins, which are synthesized in infected cells but do not incorporate into mature virus * Corresponding author. Fax: +34-981-599157. particles (Bodelon et al., 2001; Varela et al., 1996). Protein E-mail address: [email protected] (J. Benavente). coding assignment of the avian reovirus strain S1133
0042-6822/$ - see front matter D 2003 Elsevier Inc. All rights reserved. doi:10.1016/j.virol.2003.10.034 F. Touris-Otero et al. / Virology 319 (2004) 94–106 95 genome has been achieved by in vitro translation of indi- Results vidual genome segments (Varela and Benavente, 1994). Three E polypeptides are encoded by the L genes [EA, Sequence analysis of the avian reovirus M3 gene EB, and EC; molecular weights (MW) 130–150 kDa], three A polypeptides by the M genes (AA, AB, and ANS; MW 70– The M3 genome segment of purified 1733 avian reovi- 80 kDa), and four j polypeptides by the S genes (jA, jB, rions was cloned into the pUC18 plasmid, and the nucleotide jNS, and jC; MW 40–50 kDa) (Schnitzer, 1985; Varela sequences from both strands of all overlapping cDNA clones and Benavente, 1994). Two small nonstructural proteins, were determined to obtain the complete sequence of the M3 p10 and p17, are also encoded by the avian reovirus genome gene. Examination of the sequencing data revealed that the segment S1 (Bodelon et al., 2001; Shmulevitz et al., 2002). M3 gene is 1996 nucleotides long and contains a long open The structural polypeptide AB is intracellularly modified by reading frame, starting at nucleotide 25 and ending at both myristoylation and proteolysis, yielding a large car- nucleotide 1929 (Fig. 1A). This cistron is predicted to boxy-terminal fragment (ABC) and a myristoylated amino- encode full-length ANS, a polypeptide of 635 amino acid terminal peptide (ABN). Both AB and its cleavage products residues with a calculated MW of 70.8 kDa and an isoelectric are structural components of the reovirion (Varela et al., point of 6.19. Its initiation codon is in an optimal context for 1996). translation initiation because it is positioned at the appropri- Rather, little is known about the activities and properties ate distance from the 5V end of the mRNA and it is bounded of most of the avian reovirus proteins. Regarding the by an A in position 3 and a G in position +4 (Fig. 1A) structural proteins, EC is the viral capping enzyme that (Kozak, 1991). The first six nucleotides (GCTTTTT) of the catalyzes the addition of a type-1 cap to the 5V end of the 5V end and the last five nucleotides (TCATC) of the 3V end viral mRNAs (Hsiao et al., 2002; Martinez-Costas et al., of the M3 gene are present in all 10 avian reovirus genome 1995). Protein jC, which is encoded by the third open segments sequenced so far (Vakharia et al., unpublished reading frame of the S1 genome segment, is the cell- results and Fig. 1A). attachment protein (Martı´nez-Costas et al., 1997; Shapouri Examination of the deduced amino acid sequence of et al., 1996). Protein jA is a dsRNA-binding protein that ANS, using the MultiCoil program (Wolf et al., 1997), appears to protect avian reovirus against the antiviral effects revealed the existence of two heptapeptide repeat motifs of interferon, by preventing PKR activation (Gonza´lez- between positions 451–472 and 540–599, with primarily Lo´pez et al., 2003; Martı´nez-Costas et al., 2000; Yin et hydrophobic amino acids in the first and fourth positions, as al., 2000). This protein has also been recently shown to characteristic of a-helical regions of proteins that associate display nucleotidyl phosphatase activity (Yin et al., 2002). In addition to the structural proteins, avian reoviruses encode four nonstructural proteins: ANS, which is encoded by the M3 gene; jNS, encoded by the S4 gene; and p10 and p17, encoded by the first two cistrons of the tricistronic S1 genome segment (Bodelon et al., 2001; Shmulevitz et al., 2002; Varela and Benavente, 1994). Some data have been published about the activities and properties of two of these nonstructural proteins. Protein p10 is an integral membrane protein that causes cell–cell fusion and permeabilizes cell membranes (Bodelon et al., 2001; Shmulevitz and Duncan, 2000),andjNS has been reported to display ssRNA- binding activity (Yin and Lee, 1998). In the present study, we focused on the avian reovirus M3 gene encoding the nonstructural protein ANS. We have cloned, sequenced, and expressed the M3 genome segment of avian reovirus strain 1733. We show that this gene expresses two isoforms of protein ANS, apparently produced by translation initiation at two different in-frame AUG codons. Analysis of the intracellular distribution of the nonstructural proteins ANS and jNS revealed that although Fig. 1. (A) Schematic representation of the avian reovirus 1733 M3 gene these two proteins colocalize in viral inclusions of avian and of the ANS open reading frame. The nucleotide sequences of the 5V- reovirus-infected cells, only ANS is associated with these and 3V-most pentanucleotides are indicated in the lower part of the figure, structures in the absence of any other viral protein. We also while the nucleotide sequences that surround the underlined initiator and A j stop codons are shown in the upper part of the figure. (B) a-Helical coiled- show that NS interacts with NS and that this interaction is coil predictions for avian reovirus ANS protein, using the MultiCoil responsible for the presence of jNS in viral inclusions of program (Genetics Computer Group) with an averaging window of 28 infected cells. amino acid residues (Wolf et al., 1997). 96 F. Touris-Otero et al. / Virology 319 (2004) 94–106 to form coiled-coil super helices (Fig. 1B) (Lupas, 1996, protein ANS from avian reovirus-infected cells (Fig. 4) and 1997). Comparison of the deduced amino acid sequence of from in vitro expression of the M3 gene (data not shown). avian reovirus ANS with the recently available sequence of The identity of this protein was further confirmed by its Muscovy duck reovirus counterpart (accession no. immunoassays (see below). AJ293969) revealed that they are very similar as regards To produce specific antisera, the recombinant ANS their 5V-most 547 nucleotides (80.6% identity; 86.6% sim- (rANS) was purified from infected Sf9 cells (Fig. 3B). ilarity) (Fig. 2A). However, avian reovirus 1733 ANS is Specifically, AcNPV-ANS-infected cells were lysed in cy- predicted to end at the C-terminal Leu-635 residue, while its toskeletal buffer and the cell extract was centrifuged. duck reovirus counterpart ends at Arg-552. Although these Analysis of the supernatant (lane 1) and pellet (lane 2) data apparently suggest that duck reovirus ANS lacks the fractions by SDS-PAGE revealed that rANS was more last 83 C-terminal residues of its avian reovirus counterpart abundant in the pellet fraction, which was thus resuspended due to the presence of a premature stop codon, and although in Triton X-100-containing buffer and centrifuged again. we do not have experimental information about the molec- While most proteins, including some rANS, remained in the ular mass of duck reovirus ANS, we believe that this final pellet (lane 4), most rANS and small amounts of few deletion is not real, but rather than an extra nucleotide has other proteins were found in the supernatant fraction (lane been inserted by error between positions 1666ACACA- 3). The rANS band in lane 3 was excised from the poly- ATCCCC1675 of the submitted duck reovirus M3 sequence. acrylamide gel and used as immunogen for antiserum Removal of one nucleotide from this region allows the stop production in a rabbit. codon 1681TGA1683 to be skipped and translation to continue until Leu-635. The resulting 83-residue extra region The avian reovirus M3 gene expresses two lNS isoforms matches well with the corresponding region of avian reovi- and the larger isoform interacts with rNS rus ANS (78.3% sequence identity with no internal gaps), and both ANS proteins would now contain the two hepta- The capacity and specificity of the anti-rANS antiserum peptide repeat motifs at their carboxyl terminus (Fig. 2A). to recognize M3-gene products was next assessed by both Comparison of the deduced amino acid sequence of avian immunoblotting and immunoprecipitation. The Western blot reovirus ANS with that of its mammalian reovirus type 3 analysis shown in Fig. 4A revealed that while the anti-rANS counterpart (Dearing strain; accession no. AF174384; ref- antiserum did not recognize any polypeptide in extracts of erence: McCutcheon et al., 1999) revealed that the avian mock-infected cells (lanes 1 and 3), it recognized two reovirus protein is 86 residues shorter (635 vs. 721 amino polypeptides in both avian reovirus- and AcNPV-ANS- acid residues) because of several internal gaps and a gap infected cells (lanes 2 and 4, respectively). The major near its amino terminus (mammalian reovirus ANS residues (slower-migrating) polypeptide has the same electrophoretic 8–28 are apparently missing in its avian reovirus coun- mobility as the in vitro-translated protein ANS (70 kDa) terpart) (Fig. 2B). Avian and mammalian reovirus ANS (data not shown), suggesting that it is full-length ANS. The proteins show 28.3% deduced-sequence identity (179 posi- minor (faster-migrating) polypeptide (60 kDa) is probably a tions) and 38.4% sequence similarity. Furthermore, the C- shorter version of ANS, arising either by initiation of terminal third of ANS of the three serotypes of mammalian translation at an in-frame downstream initiation codon or reoviruses also contain two regions, between residues 518– by cleavage of full-length ANS. Similarly, a shorter version 561 and 620–692, with high probability of coiled-coil of mammalian reovirus ANS protein, designated ANSC, and structure (McCutcheon et al., 1999),andtheseregions thought to initiate translation at Met-41 of ANS and there- overlap with the avian and duck reovirus coiled-coil motifs fore to lack 40 residues from the amino terminus of ANS, (Fig. 2B). has been detected by expression of the mammalian reovirus M3 gene, in both mammalian reovirus- and recombinant Expression of lNS in insect cells, purification, and antibody baculovirus-infected cells (Broering et al., 2000; Wiener et generation al., 1989). We therefore similarly designated the small isoform encoded by the avian reovirus M3 gene as ANSC. To obtain high-level expression of protein ANS for The capacity of this antiserum to recognize ANS was next generation of specific antiserum, we constructed a recom- assessed by immunoprecipitation assays. Mock-infected binant baculovirus, AcNPV-ANS, containing the entire cod- cells or avian reovirus-infected cells were metabolically ing region of the avian reovirus M3 gene under the labeled with [35S]amino acids, lysed in Triton X-100-con- transcriptional control of the baculovirus polyhedrin pro- taining buffer, and the resulting cell extracts were subjected moter. Expression of this recombinant baculovirus in Sf9 to immunoprecipitation and SDS-PAGE analysis (Fig. 4B). insect cells (Fig. 3A) produced a major protein of approx- While the anti-rANS antiserum did not recognize any poly- imately 70 kDa (lane 3) that was not present in extracts from peptides in extracts from mock-infected cells (lane 2), in either mock-infected cells (lane 1) or cells infected with extracts from avian reovirus-infected cells it immunopreci- wild-type virus (lane 2). This protein migrated on SDS- pitated ANS, ANSC, and a protein with similar electropho- PAGE gels identically to the nonstructural avian reovirus retic mobility to the nonstructural viral protein jNS (lane 5). F. Touris-Otero et al. / Virology 319 (2004) 94–106 97
Fig. 2. Comparison of the deduced amino acid sequence of avian reovirus 1733 ANS with its Muscovy duck reovirus (A) and mammalian reovirus type 3 (B) counterparts. The amino acid sequence of Muscovy duck reovirus ANS was deduced from the nucleotide sequence of its M3 gene (GenBank accession no. AJ293969), after removal of nucleotide 1675. Amino acids are designated by single-letter codes. Identical residues are indicated by (j) and similar residues are indicated by : or . (depending on the threshold). Amino acids considered to be similar are A, S and T; D and E; N and Q; R and K; I, L, M, and V; F, Y and W. Gaps in the sequences are indicated by dashes (-). Amino acid residues marked a or d occupy the first and fourth positions, respectively, of the heptapeptide pattern found in the two putative a-helical coiled-coil motifs predicted by the MultiCoil program. 98 F. Touris-Otero et al. / Virology 319 (2004) 94–106
Fig. 3. Expression of rANS in insect cells. (A) Sf9 cells either mock-infected (lane 1) or infected with wild-type baculovirus (lane 2) or recombinant baculovirus AcNPV-ANS (lane 3) were lysed in Laemmli sample buffer at 72 hpi. (B) AcNPV-ANS-infected Sf9 cells were lysed in cytoskeletal buffer at 48 hpi, and the resulting cell extract was fractionated by centrifugation into supernatant (lane 1) and pellet (lane 2) fractions. The pellet was subsequently resuspended in Triton X-100-containing buffer and fractionated again by centrifugation into supernantant (lane 3) and pellet (lane 4) fractions. All samples were resolved by 10% SDS-PAGE and protein bands were visualized by Coomassie blue staining. Positions of recombinant ANS are indicated on the right and positions of protein markers on the left.
Fig. 4. Immunoassays of the polypeptides expressed by the avian reovirus M3 gene. (A) Extracts of mock-infected CEF (lane 1), avian reovirus-infected CEF (lane 2), mock-infected Sf9 cells (lane 3), or AcNPV-ANS-infected Sf9 cells (lane 4) were subjected to Western blot analysis. The membrane filter was probed with antiserum raised against gel-purified rANS protein. (B) Mock-infected CEF (lanes 1–3) and avian reovirus-infected CEF (lanes 4–6) were metabolically labeled with [35S]amino acids for 1 h at 12 hpi. Cells were then lysed in Triton X-100-containing buffer. The resulting extracts (lanes 1 and 4) were immunoprecipitated with ANS-specific antiserum (lanes 2 and 5) or with jNS-specific antiserum (lanes 3 and 6). All samples were analyzed by 10% SDS- PAGE and protein bands were visualized by autoradiography. Positions of protein markers are indicated on the left of panel A, and positions of nonstructural viral proteins between the two panels. F. Touris-Otero et al. / Virology 319 (2004) 94–106 99
To confirm the identity of this protein and to assess whether sions is not dependent on the virus strain or the host cell there is an association between ANS and jNS, we next type. performed immunoprecipitations with a jNS-specific anti- serum. The results showed that although this antiserum did Protein lNS, but not rNS, forms globular inclusions in the not recognize any proteins in extracts of mock-infected cells absence of any other viral protein, and is able to recruit (lane 3), it coimmunoprecipitated jNS and ANS, but not rNS to these structures ANSC, from extracts of avian reovirus-infected cells (lane 6). Coimmunoprecipitation of the two nonstructural proteins To test whether the observed localization of jNS and was not due to cross-reactivity of the antisera because each ANS in globular inclusions of infected cells requires the antiserum only recognized its corresponding immunogen in presence of the other or of any other viral component, we cells transfected with the M3 or S4 genes (data not shown). next investigated their intracellular localization in trans- These results indicate that there is an association between fected cells. To this end, their genes were cloned into the jNS and ANS in avian reovirus-infected cells. Conversely, pCINeo vector, and the resulting recombinant plasmids, our observation that the jNS-specific antiserum does not pCINeo-M3 and pCINeo-S4 were lipofected into avian coimmunoprecipitate ANSC from extracts of infected cells and mammalian cells. strongly suggests that, contrary to ANS, ANSC does not Examination by fluorescence microscopy of mammalian interact with jNS. (Fig. 6A) and avian (Fig. 6B) cells that had been lipofected with either pCINeo-M3 or pCINeo-S4 revealed that while Avian reovirus nonstructural proteins rNS and lNS protein ANS continued to localize in the same type of colocalize in cytoplasmic viral inclusions inclusions that we had previously observed in infected cells, protein jNS was distributed diffusely throughout the cyto- To study the subcellular localization of jNS and ANS, as plasm. These results demonstrate that protein ANS, but not well as to further confirm that these two nonstructural jNS, is able to form inclusions in the absence of other viral proteins interact with each other, avian reovirus-infected components. These findings also suggest that in avian cells were observed by immunofluorescence microscopy. reovirus-infected cells, protein jNS localizes to inclusions For this, semiconfluent monolayers of CEF were infected through its association with ANS. To confirm this hypoth- with 10 PFU/cell of avian reovirus and, at different infec- esis, we next examined the intracellular distribution of these tion times, the cells were immunostained for jNS and ANS. two nonstructural proteins in avian cells cotransfected with To visualize the sites of viral assembly, DIC images of the the two recombinant plasmids (Fig. 6B). The results show cells were also obtained. Examination of the immunostained that while protein jNS exhibits a diffuse distribution cells by confocal microscopy (Fig. 5A) revealed that jNS throughout the cytoplasm when expressed alone, it is and ANS were first detectable at 6 hpi, scattered throughout recruited to ANS inclusions when the two proteins are the cell cytoplasm in an identical punctuate pattern. As coexpressed in the same cell. Neither of the two nonstruc- infection progressed, jNS and ANS continued to colocalize, tural proteins were found within the nucleus, either when in large perinuclear phase-dense globular inclusions that expressed individually or when expressed together. These were clearly visible by DIC microscopy. These structures results provide compelling evidence that jNS associates closely resembled the ‘‘viral factories’’ described for mam- with ANS and that jNS localizes to inclusions in avian malian reovirus-infected cells, which are believed to be the reovirus-infected cells via its interaction with ANS. sites of viral replication and assembly (Rhim et al., 1962). Our finding that the two nonstructural proteins colocalize in avian reovirus-infected cells further supports the view that Discussion they associate during viral infection. These two nonstruc- tural proteins also colocalized in perinuclear globular inclu- All members of the Reoviridae family encode nonstruc- sions in CEF infected with the nonpathogenic avian tural proteins, suggesting that such proteins play key roles at reovirus strain S1133 (data not shown), as well as in two different stages in the viral life cycle, although their precise different mammalian cell lines infected with avian reovirus function in infected cells is not well understood. The experi- 1733 (Fig. 5B), indicating that their location within inclu- ments described in the present report were designed to
Fig. 5. Subcellular localization of ANS and jNS proteins in avian reovirus-infected cells. (A) Semiconfluent monolayers of CEF were infected with 10 PFU/cell of avian reovirus 1733 and, at the infection times indicated on the left, the cells were stained for ANS with ANS-specific polyclonal rabbit antiserum as the first antibody and FITC-conjugated goat anti-rabbit antiserum as the secondary antibody (Sigma-Aldrich, Spain). The ANS protein is colored green (ANS panels). The same cells were also stained for jNS with a primary jNS-specific monoclonal antibody (Annadata and Vakharia, 1994) and with a TRITC-conjugated goat anti-mouse antibody (Sigma-Aldrich, Spain). The jNS protein is colored red (jNS panels). A DIC image of each field was also obtained (DIC panels). In the merged image, colocalization of ANS and ANS is indicated by yellow color. (B) Semiconfluent monolayers of mouse L929 cells and of monkey Vero cells were infected with 20 PFU/cell of avian reovirus 1733, and at 18 hpi the cells were processed for immunofluorescence microscopy as for Fig. 5A. All images were obtained with a confocal microscope. 100 F. Touris-Otero et al. / Virology 319 (2004) 94–106 provide initial information on the activity of the avian most AUG codon located at nucleotides 25–28 and ending reovirus nonstructural protein ANS. Examination of the at the stop codon at nucleotides 1930–1932. We believe that sequence of the avian reovirus 1733 M3 gene revealed the this open reading frame specifies full-length ANS, because it presence of a long open reading frame, starting at the 5V- encodes a 635-residue polypeptide with a calculated molec- F. Touris-Otero et al. / Virology 319 (2004) 94–106 101
Fig. 6. Intracellular distribution of ANS and jNS in transfected cells. Semiconfluent monolayers of either mouse L929 cells or monkey Vero cells (panel A) or CEF (panel B) were transfected with the plasmids shown on top of the figures. Following incubation at 37 jC for 36 h, cells were immunostained for ANS (a-ANS) and for jNS (a-jNS) as indicated in the legend to Fig. 5A. A DIC image was also obtained for the transfected mammalian cells (middle row in panel A), and the nuclei of the transfected avian cells were stained blue with DAPI (bottom row in panel B). All images were obtained with a confocal microscope. ular mass of 70.8 kDa, which is consistent with the mobility dation analysis, but unfortunately no sequence was of ANS in SDS-PAGE gels, and because its AUG start obtained, suggesting that ANS has a blocked amino-terminal codon has an optimal context for translation initiation. We residue, as do most avian reovirus proteins (Varela et al., tried to assess experimentally whether the 5V-most AUG is 1996; F. T-O. and J. B., unpublished results). in fact the ANS initiation codon, by subjecting the ANS Examination of the deduced amino acid sequence of avian protein from avian reovirus-infected cells to Edman degra- reovirus ANS protein revealed the presence of two high-score 102 F. Touris-Otero et al. / Virology 319 (2004) 94–106 coiled-coil motifs near its carboxyl terminus, which show (357 and 402 nucleotides, respectively), and the presence of homology with coiled-coil motifs reported to be present at eight AUG codons upstream of the codon encoding Met- the carboxyl terminus of several proteins, including mam- 112, four of them with a strong initiation context (Kozak, malian reovirus ANS proteins (accession nos. AF174382, 2002). Other alternative mechanisms such as cap-dependent AF174383, and AF174384; reference: McCutcheon et al., shunting (Futterer et al., 1993; Ryabova and Hohn, 2000) or 1999), paramyosin (accession nos. P35417 and P35418; cap-independent internal ribosome entry (Jackson and references: Landa et al., 1993; Muhlschlegel et al., 1993), Kaminski, 1995; Pelletier and Sonenberg, 1988) may thus myosin heavy chain (accession nos. P02567, P10587, account for initiation of protein ANSC translation, and we P12844, P12845, and Q99323; references: Dibb et al., are currently investigating these possibilities. 1989; Ketchum et al., 1990; Yanagisawa et al., 1987), and Our finding that the M3 gene expresses two different kinesin-like protein B (accession no. P46864; reference: proteins allows us to expand the previously reported coding Mitsui et al., 1994). These regions have the potential to form capacity of the avian reovirus genome to 15 proteins, of homo-oligomers and to associate with coiled-coil regions of which 10 are structural (EA, EB, EC, AA, AB, ABC, ABN, jA, other proteins to form hetero-oligomers (Lupas, 1996),soit jB, jC) and 5 are nonstructural (ANS, ANSC, jNS, p10 and remains possible that ANS exists as an oligomeric protein or p17). Furthermore, if ANSC originates by internal translation that it forms hetero-oligomers with host proteins bearing initiation, avian reovirus thus contains at least two functional coiled-coil motifs. polycistronic genes, the tricistronic gene S1 (Bodelon et al., In addition to ANS, the avian reovirus M3 gene also 2001) and the bicistronic gene M3 reported here. encodes a polypeptide about 10 kDa smaller than ANS, Replication and assembly of members of the Reoviridae which we have designated ANSC. The fact that the two ANS family are thought to take place in discrete structures within isoforms are recognized by ANS-specific antibodies indi- the cytoplasm of infected cells, called viroplasms or viral cates that ANSC must originate either by cleavage of full- factories, and several nonstructural viral proteins have been length ANS or by initiation of translation at an in-frame implicated in the formation of these structures (Brookes et internal initiation codon of the m3 mRNA. Several lines of al., 1993; Dales, 1963; Nilson et al., 1998; Petrie et al., evidence suggest that ANSC arises by translation initiation 1984; Rhim et al., 1962; Silverstein and Schur, 1970). In the at a downstream methionine codon in the ANS open reading present study, we show that in avian reovirus-infected cells frame, which in turn suggests that ANSC lacks amino acid jNS and ANS colocalize in phase-dense globular inclusions residues from the amino terminus of ANS. First, no se- or viroplasm-like structures that become perinuclear as quence was obtained when the ANSC protein synthesized in infection progresses. These results, together with the obser- AcNPV-ANS-infected insect cells was subjected to Edman vations that (i) jNS is a RNA-binding protein (Yin and Lee, degradation. Second, pulse-chase experiments performed 1998), (ii) that ANS attaches to viral particles and associates with CEF infected with avian reovirus and with insect cells with the structural matrix of infected cells (manuscript in infected with AcNPV-ANS baculovirus failed to provide preparation), and (iii) that the cytoskeleton is the site of evidence for a precursor–product relationship between ANS reovirus assembly (Mora et al., 1987), suggest that these and ANSC (data not shown). Furthermore, a situation similar two nonstructural proteins may act as a scaffold that links to that reported here has been found in mammalian reovi- viral mRNA metabolism and unassembled viral structural ruses. Thus, the mammalian reovirus M3 gene of three proteins to viral factories and to the cell matrix during virus different strains has been previously shown to encode two replication or assembly. On the other hand, the possibility ANS isoforms of 80 and 75 kDa, and the smaller ANSC exists that these proteins might be involved in anterograde isoform is thought to arise by translation initiation at the transport of viral particles from the perinuclear region to the conserved AUG codon specifying Met-41 of ANS, and is periphery of the cell, by a cytoskeleton-dependent mecha- therefore thought to lack the first 40 amino-terminal resi- nism, as has been reported for the intracellular transport of dues of ANS (Broering et al., 2002; McCutcheon et al., herpes virus and vaccinia virus (Miranda-Saksena et al., 1999; Wiener et al., 1989). 2000; Ro¨ttger et al., 1999). In view of the size difference between avian reovirus Individual expression of these two proteins in transfected ANS and ANSC (10 kDa), and if translation of ANSC cells further revealed that ANS, but not jNS, has the ability initiates at an internal AUG codon, candidate residues for to form viroplasm-like inclusions when expressed in the the initiation of ANSC are the methionine residues at absence of any other viral protein. These data suggest that positions 84, 112, and 127. However, initiation at Met-84 ANS is a key factor in inclusion nucleation during avian seems unlikely because its AUG does not contain a purine at reovirus infection, and that this protein is the minimal viral position +4, and because Met-84 is not present in the component required for inclusion formation. Thus, it deduced amino acid sequence of Muscovy duck reovirus appears that ANS plays important roles in the early stages ANS. It also seems unlikely that the small ribosome subunits of the avian reovirus life cycle, by forming sites of viral can gain access to the Met-112 or -127 AUG-encoding replication, and by recruiting components necessary for codons by a cap-dependent leaky scanning mechanism, in viral replication and assembly. Like ANS, several nonstruc- view of the length of the sequence upstream of these codons tural proteins of other members of the Reoviridae family F. Touris-Otero et al. / Virology 319 (2004) 94–106 103 have been reported to induce the formation of viroplasm- were grown in monolayers in medium 199 supplemented like structures in the absence of other viral components. with 10% fetal bovine serum (FBS). Sf9 cells were grown in Thus, viral inclusions are formed in cells infected with a suspension culture in serum-free Sf-900 II media at 27 jC. recombinant baculovirus that expresses nonstructural blue- Strains S1133 and 1733 of avian reovirus were grown in tongue virus protein NS2, and in cells transfected either with semiconfluent monolayers of primary CEFs as previously rotavirus nonstructural proteins NSP5 and NSP2 or with described (Grande and Benavente, 2000). The recombinant mammalian reovirus protein ANS (Broering et al., 2002; baculovirus AcNPV-AN was grown in Sf9 cells as previ- Fabbretti et al., 1999; Thomas et al., 1990). ously described (Hsiao et al., 2002). Our observations that jNS is distributed diffusely throughout the cytoplasm when expressed alone, but Cloning and sequencing of the M3 and S4 genome segments becomes associated with ANS inclusions in cells cotrans- of avian reovirus 1733 fected with the M3 + S4 genes and in avian reovirus- infected cells, strongly suggest that jNS is recruited to All manipulations of DNA were performed according to these structures through its association with ANS. Although standard cloning protocols (Sambrook et al., 1989). The jNS itself does not appear to be required for inclusion genomic RNA isolated from purified avian reovirus (strain formation, its capacity to bind RNA and to associate with 1733) by phenol/chloroform extraction was fractionated on viral inclusions in infected cells suggest that it may play an a 6% SDS-PAGE gel. Individual RNA segments, including important role in recruiting viral RNAs to these inclusions, M3 and S4 genome segments, were excised from the gel and and in controlling or complementing ANS activity. While the RNA was recovered after ethanol precipitation. Synthe- preparing the manuscript, similar observations regarding the sis of cDNAs was accomplished using the Riboclone cDNA capacity of mammalian reovirus ANS protein to form viral Synthesis System (Promega) and random primers as per inclusions and to recruit protein jNS to these structures Gu¨bler and Hoffman (1993) and the protocol supplied by have been reported (Becker et al., 2003; Miller et al., 2003). the manufacturer. Double-stranded cDNAs were introduced The results of one of these studies further revealed (i) that into the SmaI site of the pUC18 vector. The ligated mixtures residues 1–13 of mammalian reovirus ANS are necessary were used to transform competent Escherichia coli JM109 for association with jNS, (ii) that residues 1–11 of jNS, cells. Positive recombinants were identified by dot blot which are required for RNA binding, are also needed for hybridization using M3- and S4-gene-specific RNA probes maximal association with ANS, and (iii) that RNA contrib- and restriction endonuclease mapping. Overlapping cDNA utes to ANS–jNS association (Miller et al., 2003). Experi- clones were sequenced with an Applied Biosystem auto- ments are in progress in our laboratory to identify those mated DNA sequencer. Nucleotide sequences of the 5V- and domains of avian reovirus ANS and jNS that are important 3V-noncoding regions were determined as described by for their association, and to determine whether the RNA- Hsiao et al., 2002, using specific primers. The nucleotide binding activity of jNS is required for ANS binding. sequences of the avian reovirus 1733 genes have been Immunoprecipitation assays using extracts from avian submitted to the GenBank nucleotide sequence database reovirus-infected cells also revealed that during viral infec- and assigned accession nos. AY303992 for the S4 gene and tion, jNS associates with ANS, but not with ANSC, suggest- AY303993 for the M3 gene. ing that the fragment of ANS that is missing in ANSC is To construct a full-length cDNA clones of the S4 and M3 required for its association with jNS. This, and the fact that genes, two sets of primer pairs were designed for each gene the first 40 N-terminal residues of mammalian reovirus ANS and used in RT-PCR amplifications to obtain overlapping are required for association with jNS (Miller et al., 2003), cDNA clones with unique restriction sites. The resulting RT- further suggest that avian reovirus ANSC lacks residues PCR products were inserted into the pCR2.1 vector to from the amino terminus of ANS. Taken together, these data generate the recombinant plasmids pCR2.1-S4 and also suggest that the two isoforms encoded by the avian pCR2.1-M3. reovirus M3 gene play different roles during viral infection, as has been suggested for their mammalian reovirus counter- Construction of recombinant baculovirus parts (Broering et al., 2002; Miller et al., 2003). Plasmid pCR2.1-M3 was double digested with BamHI and Asp718 and the 2-kb insert subcloned in pBlueBac4. A Materials and methods recombinant baculovirus, harboring the M3 sequence be- hind the polyhedrin promoter, was generated by homolo- Cells and viruses gous recombination, using the Bac-N-Blue transfection kit in accordance with the supplier’s protocol (Invitrogen). Primary cultures of CEFs were prepared from 9- to 10- Putative recombinant baculoviruses were plaque-purified day-old chicken embryos and grown in monolayers in twice. The presence of the M3 gene in the recombinant medium 199 supplemented with 10% tryptose phosphate baculovirus AcNPV-ANS was confirmed by PCR, using a broth and 5% calf serum. The L-929 and Vero cell lines pair of M3-gene-specific primers. 104 F. Touris-Otero et al. / Virology 319 (2004) 94–106
Baculovirus expression, protein purification, and antibody bodies and DAPI for 1 h. Coverslips were then washed six generation times with PBS and mounted on glass slides. Images were obtained by sequential scanning with a Leica TCS SP2 Sf9 insect cells, growing in suspension, were infected confocal microscope using a 100 1.3 oil immersion with 5 PFU/cell of recombinant baculovirus and incubated objective. FITC was detected by using the 488-nm excita- at 27 jC for 72 h. The cells were then pelleted by tion line and analyzing emission between 500 and 535 nm. centrifugation for 5 min at 600 g, and resuspended in TRITC was detected by using the 543-nm excitation line cytoskeletal buffer (10 mM PIPES, pH 6.8, 100 mM KCl, 3 and emission between 575 and 650 nm. Differential inter- mM MgCl2, 300 mM sucrose, 1% Triton X-100, and ference contrast (DIC) images were obtained to determine protease inhibitor cocktail). The cells were then washed the location of cells and viral inclusion bodies. Images were and centrifuged again three times, and the pellet was processed with Adobe Photoshop (Adobe Systems). resuspended in Triton X-100-containing buffer (10 mM Tris–HCl, pH 7.5, 1.5 mM MgCl2, 150 mM NaCl, 0.5% Metabolic labeling and immunoprecipitation sodium deoxycholate, 1% Triton X-100, and protease in- hibitor cocktail) and centrifuged again for 5 min at 12000 Mock-infected and avian reovirus-infected CEF were g. The resulting supernantant was fractionated by 10% SDS- metabolically radiolabeled with [35S]amino acids for 1 h at PAGE, protein bands were visualized by Coomassie blue the indicated times, and then lysed in a Triton X-100- staining, and the recombinant ANS protein was excised from containing buffer (10 mM Tris–HCl, pH 7.5, 1.5 mM the gel and used as immunogen to raise a rabbit polyclonal MgCl2, 150 mM NaCl, 0.5% sodium deoxycholate, 1% antiserum, as described (Bodelon et al., 2001). Triton X–100). The cell extracts were centrifuged for 5 min at 12000 g, and the resulting supernatants were incubated Transient expression of avian reovirus proteins for 4 h with antibodies that had been previously immobi- lized to protein A-Sepharose (Amersham Biosciences). The The M3 gene was PCR-amplified from the recombinant Sepharose beads were washed six times with 500 Al of the plasmid pCR2.1-M3, using the forward primer 5V< corresponding lysis buffer, and finally boiled in Laemmli GGAATTCATCATGGCGTCAACCAAGTG > 3V (EcoRI sample buffer. site underlined) and the reverse primer 5V
Immunofluorescence microscopy Annadata, M., Vakharia, V.N., 1994. Comparative analysis of virus-in- duced polypeptides of an avirulent and a virulent strain of avian reovi- Cell monolayers grown on coverslips were infected or rus. Avian Dis. 38, 244–250. Attoui, H., Billoir, F., Biagini, P., de Micco, P., de Lamballerie, X., 2000. transfected as indicated in the figure legends. At the Complete sequence determination and genetic analysis of Banna virus indicated times, the monolayers were washed twice with and Kadipiro virus. Proposal for assignment to a new genus (Seador- PBS and fixed in methanol at 20 jC for 1 h. Fixed cells rnavirus) within the family Reoviridae. J. Gen. Virol. 81, 1507–1515. were washed twice with PBS, incubated for 1 h in permea- Banerjee, A.K., Shatkin, A.J., 1970. Transcription in vitro by reovirus- bilizing buffer (3% BSA and 0.1% Triton X-100 in PBS), associated ribonucleic acid-dependent polymerase. J. Virol. 6, 1–11. Becker, M.M., Peters, T.R., Dermody, T.S., 2003. Reovirus jNS and ANS and subsequently incubated for 1 h with primary antibodies protein form cytoplasmic inclusion structures in the absence of viral diluted in blocking buffer. Cells were then washed three infection. J. Virol. 77, 5948–5963. more times with PBS and incubated with secondary anti- Bodelon, G., Labrada, L., Martinez-Costas, J., Benavente, J., 2001. The F. Touris-Otero et al. / Virology 319 (2004) 94–106 105
avian reovirus genome segment S1 is a functionally tricistronic gene rus M3 gene sequences and conservation of coiled-coil motifs near the that expresses one structural and two nonstructural proteins in infected carboxyl terminus of the ANS protein. Virology 264, 16–24. cells. Virology 290, 181–191. Miller, C.L., Broering, T.J., Parker, J.S.L., Arnold, M.M., Nibert, M.L., Broering, T.J., McCutcheon, A.M., Centonze, V.E., Nibert, M.L., 2000. 2003. Reovirus jNS protein localizes to inclusions through an associ- Reovirus nonstructural protein ANS binds to core particles but does ation requiring the ANS amino terminus. J. Virol. 77, 4566–4576. not inhibit their transcription and capping activities. J. Virol. 74, Miranda-Saksena, M., Armati, P., Boadle, R.A., Holland, D.J., Cunning- 5516–5524. ham, A.L., 2000. Anterograde transport of herpes simplex virus type Broering, T.J., Parker, J.S.L., Joyce, P.L., Kim, J., Nibert, M.L., 2002. 1 in cultured, dissociated human and rat dorsal root ganglion neurons. Mammalian reovirus nonstructural protein ANS forms large inclusions J. Virol. 74, 1827–1839. and colocalizes with reovirus microtubule-associated protein A2in Mitsui, H., Nakatani, K., Yamaguchi-Shinozaki, K., Shinozaki, K., Nishi- transfected cells. J. Virol. 76, 8285–8297. kawa, K., Takahashi, H., 1994. Sequencing and characterization of the Brookes, S.M., Hyatt, A.D., Eaton, B.T., 1993. Characterization of virus kinesin-related genes katB and katC of Arabidopsis thaliana. Plant Mol. inclusion bodies in bluetongue virus-infected cells. J. Gen. Virol. 74, Biol. 25, 865–876. 525–530. Mora, M., Partin, K., Bhatia, M., Partin, J., Carter, C., 1987. Association of Dales, S., 1963. Association between the spindle apparatus and reovirus. reovirus proteins with the structural matrix of infected cells. Virology Proc. Natl. Acad. Sci. U.S.A. 50, 268–275. 159, 265–277. Dibb, N.J., Maruyama, I.N., Krause, M., Karn, J., 1989. Sequence analysis Muhlschlegel, F., Sygulla, L., Frosch, P., Masseti, P., Frosch, M., 1993. of the complete Caenorhabditis elegans myosin heavy chain gene fam- Paramyosin of Echinococcus granulosus: cDNA sequence and charac- ily. J. Mol. Biol. 205, 603–613. terization of a tegumental antigen. Parasitol. Res. 79, 660–666. Fabbretti, E., Afrikanova, I., Vascotto, F., Burrone, O.R., 1999. Two non- Nilson, M., von Bonsdorff, C.H., Weclewicz, K., Cohen, J., Svensson, L., structural rotavirus proteins, NSP2 and NSP5, form viroplasm-like 1998. Assembly of viroplasm and virus-like particles of rotavirus by a structures in vivo. J. Gen. Virol. 80, 333–339. Semliki Forest virus replicon. Virology 242, 255–265. Futterer, J., Kiss-Laszlo, Z., Hohn, T., 1993. Nonlinear ribosome migration Pelletier, J., Sonenberg, N., 1988. Internal initiation of translation of eu- on cauliflower mosaic virus 35S RNA. Cell 73, 789–802. karyotic mRNA directed by a sequence derived from poliovirus RNA. Gonza´lez-Lo´pez, C., Martı´nez-Costas, J., Esteban, M., Benavente, J., 2003. Nature 334, 320–325. Evidence that avian reovirus jA protein is an inhibitor of the double- Petrie, B.L., Greenberg, H.B., Graham, D.Y., Estes, M.K., 1984. Ultra- stranded RNA-dependent protein kinase. J. Gen. Virol. 84, 1629–1639. structural localisation of rotavirus antigens using colloidal gold. Virus Gouvea, V., Schnitzer, T.J., 1982. Polymorphism of the genomic RNAs Res. 1, 133–152. among the avian reoviruses. J. Gen. Virol. 61, 87–91. Rhim, J.S., Jordan, L.E., Mayor, H.D., 1962. Cytochemical, fluorescent- Grande, A., Benavente, J., 2000. Optimal conditions for the growth, puri- antibody and electron microscopic studies on the growth of reovirus fication and storage of the avian reovirus S1133. J. Virol. Methods 85, (ECHO 10) in tissue culture. Virology 17, 342–355. 43–54. Robertson, M.D., Wilcox, G.E., 1986. Avian reovirus. Vet. Bull. 56, Gu¨bler, U., Hoffman, B.J., 1993. A simple and very efficient method for 759–766. generating cDNA libraries. Gene 25, 263–269. Rosenberger, J.K., Sterner, F.J., Botts, S., Lee, K.P., Margolin, A., 1989. In Hsiao, J., Martı´nez-Costas, J., Benavente, J., Vakharia, V.N., 2002. Clon- vitro and in vivo characterization of avian reoviruses. Pathogenicity and ing, expression, and characterization of avian reovirus guanylyltransfer- antigenic relatedness of several avian reovirus isolates. Avian Dis. 33, ase. Virology 296, 288–299. 535–544. Jackson, R.J., Kaminski, A., 1995. Internal initiation of translation in eu- Ro¨ttger, S., Frischknecht, F., Reckmann, I., Smith, G.L., Way, M., 1999. karyotes: the picornavirus paradigm and beyond. RNA 1, 985–1000. Interactions between vaccinia virus IEV membrane proteins and their Ketchum, A.S., Stewart, C.T., Stewart, M., Kiehart, D.P., 1990. Complete roles in IEV assembly and actin tail formation. J. Virol. 73, 2863–2875. sequence of the Drosophila nonmuscle myosin heavy-chain transcript: Ryabova, L.A., Hohn, T., 2000. Ribosome shunting in the cauliflower conserved sequences in the myosin tail and differential splicing in the mosaic virus 35S RNA leader is a special case of reinitiation of 5Vuntranslated sequence. Proc. Natl. Acad. Sci. U.S.A. 87, 6316–6320. translation functioning in plant and animal systems. Genes Dev. Kozak, M., 1991. Structural features in eukaryotic mRNAs that modulate 14, 817–829. the initiation of translation. J. Biol. Chem. 266, 19867–19870. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Kozak, M., 2002. Pushing the limits of the scanning mechanism for ini- Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold tiation of translation. Gene 299, 1–34. Spring Harbor, NY. Landa, A., Laclette, J.P., Nicholson-Weller, A., Shoemaker, C.B., 1993. Schnitzer, T.J., 1985. Protein coding assignment of the S genes of the avian Mol. Biochem. Parasitol. 60, 343–347. reovirus S1133. Virology 141, 167–170. Li, J.J.-K., Scheible, P.P., Keene, J.D., Joklik, W.K., 1980. The plus strand Shapouri, M.R., Arella, M., Silim, A., 1996. Evidence for the multimeric of reovirus gene S2 is identical with its in vitro transcript. Virology 105, nature and cell binding ability of avian reovirus sigma 3 protein. J. Gen. 282–286. Virol. 77, 1203–1210. Lupas, A., 1996. Coiled coils: new structures and new functions. Trends Shmulevitz, M., Duncan, R., 2000. A new class of fusion-associated small Biochem. Sci. 21, 375–382. transmembrane (FAST) proteins encoded by the non-enveloped fuso- Lupas, A., 1997. Predicting coiled-coil regions in proteins. Curr. Opin. genic reoviruses. EMBO J. 19, 902–912. Struct. Biol. 7, 388–393. Shmulevitz, M., Yameen, Z., Dawe, S., Shou, J., O’Hara, D., Holmes, I., Martinez-Costas, J., Varela, R., Benavente, J., 1995. Endogenous enzy- Duncan, R., 2002. Sequential partially overlapping gene arrangement in matic activities of the avian reovirus S1133: identification of the viral the tricistronic S1 genome segments of avian reovirus and Nelson Bay capping enzyme. Virology 206, 1017–1026. reovirus: implications for translation initiation. J. Virol. 76, 609–618. Martı´nez-Costas, J., Grande, A., Varela, R., Garcı´a-Martı´nez, C., Bena- Silverstein, S.C., Schur, P.H., 1970. Immunofluorescent localization of vente, J., 1997. Protein architecture of avian reovirus S1133 and iden- double-stranded RNA in reovirus-infected cells. Virology 41, 564–566. tification of the cell attachment protein. J. Virol. 71, 59–64. Spandidos, D.A., Graham, A.F., 1976. Physical and chemical character- Martı´nez-Costas, J., Go´nzalez-Lo´pez, C., Vakharia, V.N., Benavente, J., ization of an avian reovirus. J. Virol. 19, 968–976. 2000. Possible involvement of the double-stranded RNA-binding core Thomas, C.P., Booth, T.F., Roy, P., 1990. Synthesis of bluetongue virus- protein sigmaA in the resistance of avian reovirus to interferon. J. Virol. encoded phosphoprotein and formation of inclusion bodies by recombi- 74, 1124–1131. nant baculovirus in insect cells: it binds the single-stranded RNA spe- McCutcheon, A.M., Broering, T.J., Nibert, M.L., 1999. Mammalian reovi- cies. J. Gen. Virol. 71, 2073–2083. 106 F. Touris-Otero et al. / Virology 319 (2004) 94–106
Varela, R., Benavente, J., 1994. Protein coding assignment of avian reovi- Masaki, T., 1987. Complete primary structure of vertebrate smooth rus strain S1133. J. Virol. 68, 6775–6777. muscle myosin heavy chain deduced from its complementary DNA Varela, R., Martinez-Costas, J., Mallo, M., Benavente, J., 1996. Intracel- sequence. J. Mol. Biol. 198, 143–157. lular posttranslational modifications of S1133 avian reovirus proteins. Yin, H.S., Lee, L.H., 1998. Identification and characterization of RNA- J. Virol. 70, 2974–2981. binding activities of avian reovirus non-structural protein jNS. J. Gen. Wiener, J.R., Barlett, J.A., Joklik, W.K., 1989. The sequences of reovirus Virol. 79, 1411–1413. serotype 3 genome segments M1 and M3 encoding the minor protein A2 Yin, H.S., Shien, J.H., Lee, L.H., 2000. Synthesis in Escherichia coli of and the major nonstructural protein ANS, respectively. Virology 169, avian reovirus core protein sigmaA and its dsRNA-binding activity. 293–304. Virology 266, 33–41. Wolf, E., Kim, P.S., Berger, B., 1997. Multicoil: a program for predicting Yin, H.S., Su, Y.P., Lee, L.H., 2002. Evidence of nucleotidyl phosphatase two- and three-stranded coiled-coils. Protein Sci. 6, 1179–1189. activity associated with core protein sigma A of avian reovirus S1133. Yanagisawa, M., Hamad, H., Katsuragawa, Y., Imamura, M., Mikawa, T., Virology 293, 379–385.