Physidae: Physella) in Southeastern Oregon: Convergent Evolution, Historical Context, and Conservation Considerations
Total Page：16
File Type：pdf, Size：1020Kb
Conserv Genet DOI 10.1007/s10592-014-0645-5 RESEARCH ARTICLE Recognition of a highly restricted freshwater snail lineage (Physidae: Physella) in southeastern Oregon: convergent evolution, historical context, and conservation considerations Alexandria C. Moore • John B. Burch • Thomas F. Duda Jr. Received: 9 December 2013 / Accepted: 25 July 2014 Ó Springer Science+Business Media Dordrecht 2014 Abstract Non-marine mollusks have the highest number and central California suggests a historical connection of documented extinctions of any major taxonomic group. between the Owyhee River and river drainages to the south. Given their conservation status and the numerous cases of Finally, we recommend that the Owyhee wet-rock physa be taxonomic uncertainty concerning freshwater mollusks in considered critically endangered based on its extremely particular, the recognition of potentially endangered spe- limited distribution. cies is critically important. Here, we evaluate the genetic distinctiveness and phylogenetic position of a freshwater Keywords Freshwater gastropods Physidae Á Á snail restricted to a series of geothermal springs within the Convergent evolution COI ITS1 ITS2 Owyhee River drainage in Oregon (the ‘Owyhee wet-rock Á Á Á physa’). Because these snails closely resemble Physella (Petrophysa) zionis, a wet-rock physa that occurs in a small Introduction area in Zion National Park (Utah), the Owyhee wet-rock physa is presumably either closely related to or represents a The decline in population sizes and extinctions of disjunct population of P. zionis. However, phylogenetic numerous North American freshwater gastropod species analyses of sequences of mitochondrial cytochrome oxi- during the past century are well established (Lydeard dase I and nuclear first and second internal transcribed et al. 2004; Regnier et al. 2009; Johnson et al. 2013). spacer gene regions indicate that the Owyhee wet-rock For example, 55 % of Physidae species, 79 % of Pleu- physa is genetically distinct from other physid species. roceridae species, and 91 % of Hydrobiidae species of Despite exhibiting similar morphologies, the Owyhee wet- North America are imperiled (Johnson et al. 2013). rock physa and P. zionis are distantly related physids; Indeed, freshwater snails of North America exhibit the instead, the Owyhee wet-rock physa is most closely related greatest imperilment rate of all freshwater taxa that have to a population of physids from central California. These been evaluated to date (Johnson et al. 2013). Such results suggest that convergent evolution may be respon- potential and realized losses are not without their con- sible for the similar shell morphologies of the Owyhee wet- sequences as freshwater gastropods provide several rock physa and P. zionis. Furthermore, the close relation- important ecosystem functions, including regulating rates ship between physid populations in southeastern Oregon of primary production, decomposition, and nutrient cycling (Strayer 2006; Lysne et al. 2008; Johnson et al. 2013). Freshwater snails therefore play an important role A. C. Moore (&) J. B. Burch T. F. Duda Jr. in ecosystem stability and often substantially affect Department of EcologyÁ and EvolutionaryÁ Biology and Museum of Zoology, University of Michigan, 1109 Geddes Avenue, human welfare (Strayer 2006; Johnson et al. 2013). Ann Arbor, MI 48109, USA Thus, the recognition and proper identification of e-mail: [email protected] potentially imperiled species is especially important for freshwater gastropods. This is of the utmost concern here T. F. Duda Jr. Smithsonian Tropical Research Institute, Balboa, Anco´n, for a highly restricted population of a freshwater physid Republic of Panama snail that occurs in southeastern Oregon. 123 Conserv Genet Fig. 1 Shell images of a the Owyhee wet-rock physa, b Physella zionis and c Physella cf. gyrina. Scale bars denote 1 mm Physidae is a family of freshwater gastropods that has of the Owyhee wet-rock physa, an assessment of this been estimated to contain approximately 80 species that putative species advances our understanding of biodiversity occur in a variety of habitat types throughout the world patterns within the Physidae and evaluates the conservation (Taylor 2003). In total, 47 physid species occur in the U.S. needs of this highly restricted snail. Here we examined and Canada (Johnson et al. 2013) and several are highly mitochondrial and nuclear gene sequences of the Owyhee endemic (Burch and Tottenham 1980; Taylor 2003). The wet-rock physa to determine its phylogenetic position ‘Owyhee wet-rock physa’ (sensu Frest and Johannes 1995) within the Physidae and assessed whether or not it repre- is a relatively small (\5 mm shell length) physid that is sents an evolutionarily significant unit that should be for- restricted to a small hot spring complex of the Owyhee mally described and considered for conservation. River (Oregon) where it is often the dominant molluscan species (Frest and Johannes 1995). Unlike nearly all other physid species, which are known for their high-spired, Materials and methods elongate shell morphology, the Owyhee wet-rock physa has a wide-aperture and rotund shell, much like Physella Specimens (Petrophysa) zionis (Pilsbury 1925) of Zion National Park (Utah) (Fig. 1a–b). In addition to these morphological David Hopper of the U.S. Fish and Wildlife Service collected similarities, both physid species are found in similar and provided specimens of the Owyhee wet-rock physa from landscapes that are characterized by vast canyons and river a geothermal spring complex in the Three Forks area of the tributaries coursing through them. Within this landscape, Owyhee River (Oregon), a tributary of the Snake River, in the range of the Owyhee wet-rock physa is highly restric- 2011. We received samples of the suspected sister species, ted; it has only been observed in a single stream complex of Physella zionis, from the Orma J. Smith Museum of Natural the river and has therefore been previously recommended History (Caldwell, Idaho). These specimens were originally for protection (Frest and Johannes 1995). Because of the collected from the Virgin River within Zion National Park unique shell morphology that it shares with P. zionis and (Utah) by Amy Wethington, Elliot Rogers and Christopher their similar habitats, the Owyhee wet-rock physa is pre- Rogers. Benoit Dayrat (Pennsylvania State University) col- sumably either a closely related species or a geographically lected and provided specimens of a population of physids disjunct population of P. zionis. from Agua Fria Creek (Mariposa County, California) of the As a freshwater mollusk, the Owyhee wet-rock physa San Joaquin River watershed that were tentatively identified may play an important role in the habitat in which it is as Physella gyrina; additional samples of this population found, potentially influencing both ecosystem functions were also obtained from the Invertebrate Zoology collections and stability. However, because so little is known about of the California Academy of Sciences (San Francisco). We this putative species, including its genetic distinctiveness, a sought these latter specimens after preliminary results formal evaluation is essential. Due to the current state of showed that mitochondrial gene sequences of the Owyhee ambiguity concerning numerous groups of freshwater wet-rock physa were most similar to a sequence of P. gyrina gastropods, including physids (see Rogers and Wethington that was previously published by Dayrat et al. (2011) 2007; Wethington and Lydeard 2007; Gates et al. 2012; [GenBank accession number HQ660033]. Specimens were Johnson et al. 2013), and the extremely limited distribution preserved and maintained in 70–95 % ethanol. 123 Conserv Genet Extraction and DNA amplification nucleotide substitution for each dataset. Phylogenetic trees were constructed using MrBayesÒ version 3.2.0 with We extracted genomic DNA from multiple individuals of the appropriate models. We examined each dataset separately Owyhee wet-rock physa, Physella zionis, and Physella gy- as well as a combined dataset that included both ITS rina with the E.Z.N.A.Ò Mollusk DNA Kit (Omega Bio- regions (sequences were partitioned and separate models Tek). We targeted three gene regions for sequencing: mito- were used for each data partition). For each gene region, chondrial cytochrome oxidase I (COI), nuclear first internal runs were executed for 10,000,000 generations; current transcribed spacer (ITS-1), and nuclear second internal trees and parameter values were recorded every 100 gen- transcribed spacer (ITS-2). For the COI gene region, we erations; the first 25 % of the trees were discarded; con- amplified this fragment from DNA of 35 individuals: 13 vergence diagnostics were calculated every 1,000 Owyhee wet-rock physa, 11 Physella zionis, and 11 Physella generations. Phylogenetic trees were prepared with FigTree gyrina. We also amplified both nuclear gene regions from version 1.3.1 (Rambaut 2009) and rooted to non-physid DNA of 35 individuals: 12 Owyhee wet-rock physa, 12 P. outgroup sequences of B. kuhniana or B. pfeifferi zionis, and 11 P. gyrina. We performed amplifications using (Table 1). GoTaq polymerase MasterMix (Promega) with the follow- ing primer pairs: GGTCAACAAATCATAAAGATATTGG (LCO1490) and TAAACTTCAGGGTGACCAAAAAA Results TCA (HCO2198) for COI (Folmer et al. 1994), TAA CAAGGTTTCCGTAGGTG and AGCTRGCTGCGT Phylogenetic trees TCTTCATCGA for ITS-1 (White et al. 1996), and GGGTCGATGAAGAACGCAG and GCTCTTCCCGCT The model test function